#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
BAI2	576	broad.mit.edu	37	1	32202221	32202221	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:32202221C>G	ENST00000373658.3	-	21	3424	c.3083G>C	c.(3082-3084)cGg>cCg	p.R1028P	BAI2_ENST00000398547.1_Missense_Mutation_p.R961P|BAI2_ENST00000373655.2_Missense_Mutation_p.R1028P|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398538.1_Missense_Mutation_p.R1016P|BAI2_ENST00000398556.3_Missense_Mutation_p.R976P|BAI2_ENST00000398542.1_Missense_Mutation_p.R961P|BAI2_ENST00000257070.4_Missense_Mutation_p.R1028P|BAI2_ENST00000440175.2_Missense_Mutation_p.R670P|BAI2_ENST00000527361.1_Missense_Mutation_p.R1028P	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1028					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1028P(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGTGCGCATCCGCCCAATGAC	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	59.0	63.0					1																	32202221		2202	4300	6502	31974808	SO:0001583	missense	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3083G>C	1.37:g.32202221C>G	ENSP00000362762:p.Arg1028Pro	Unknown		x	x	x	31974808	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509176	0.64410	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89	4.66	4.66	0.58398	GPCR, family 2-like (1);	0.000000	0.37393	N	0.002119	T	0.51483	0.1677	L	0.41573	1.285	0.40594	D	0.981517	D;P;B;D;P	0.62365	0.991;0.511;0.392;0.991;0.566	P;P;B;D;P	0.67548	0.854;0.462;0.161;0.952;0.597	T	0.52779	-0.8530	10	0.54805	T	0.06	.	11.1501	0.48453	0.0:0.9136:0.0:0.0864	.	1028;1016;670;1028;1028	O60241-4;O60241-3;B4DKC3;O60241-2;O60241	.;.;.;.;BAI2_HUMAN	P	976;961;1028;1028;961;1028;1028;670;1016	ENSP00000381564:R976P;ENSP00000381555:R961P;ENSP00000362762:R1028P;ENSP00000362759:R1028P;ENSP00000381550:R961P;ENSP00000257070:R1028P;ENSP00000435397:R1028P;ENSP00000391071:R670P;ENSP00000381548:R1016P	ENSP00000257070:R1028P	R	-	2	0	BAI2	31974808	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.857000	0.55972	2.312000	0.78011	0.462000	0.41574	CGG		0.642	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703		Missense_Mutation
LRRC41	10489	broad.mit.edu	37	1	46751997	46751997	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:46751997C>T	ENST00000343304.6	-	4	817	c.532G>A	c.(532-534)Gag>Aag	p.E178K	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	178					protein ubiquitination (GO:0016567)	membrane (GO:0016020)		p.E178K(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCCACCAGCTCGGTTGCACCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	60.0	59.0					1																	46751997		2203	4300	6503	46524584	SO:0001583	missense	10489			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.532G>A	1.37:g.46751997C>T	ENSP00000343298:p.Glu178Lys	Somatic		x	x	x	46524584	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	c	28.5	4.926338	0.92319	.	.	ENSG00000132128	ENST00000343304;ENST00000371972;ENST00000254454	D	0.86432	-2.12	5.08	5.08	0.68730	.	0.151564	0.45126	D	0.000386	D	0.89849	0.6834	L	0.27053	0.805	0.42862	D	0.994113	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.987;0.996;0.987	D	0.91695	0.5369	10	0.87932	D	0	-20.5144	18.583	0.91178	0.0:1.0:0.0:0.0	.	178;156;178	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	K	178;156;7	ENSP00000343298:E178K	ENSP00000254454:E7K	E	-	1	0	LRRC41	46524584	0.998000	0.40836	0.999000	0.59377	0.987000	0.75469	4.986000	0.63851	2.389000	0.81357	0.430000	0.28490	GAG		0.592	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369		Missense_Mutation
ERICH3	127254	broad.mit.edu	37	1	75055494	75055494	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:75055494T>G	ENST00000326665.5	-	12	2215	c.1997A>C	c.(1996-1998)gAg>gCg	p.E666A	C1orf173_ENST00000420661.2_Missense_Mutation_p.E469A|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		666	Glu-rich.							p.E666A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AAGAACATTCTCAAAGCTTTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											147.0	147.0	147.0					1																	75055494		2203	4300	6503	74828082	SO:0001583	missense	127254																														ENST00000326665.5:c.1997A>C	1.37:g.75055494T>G	ENSP00000322609:p.Glu666Ala	Unknown		x		x	74828082	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	12.41	1.929978	0.34096	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.18338	2.68;2.22	5.35	-3.08	0.05347	.	.	.	.	.	T	0.04497	0.0123	L	0.48642	1.525	0.09310	N	1	B;P	0.46859	0.4;0.885	B;P	0.45753	0.121;0.492	T	0.20638	-1.0269	9	0.19590	T	0.45	-0.3347	1.22	0.01922	0.1272:0.246:0.2608:0.366	.	469;666	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	A	666;469	ENSP00000322609:E666A;ENSP00000398581:E469A	ENSP00000322609:E666A	E	-	2	0	C1orf173	74828082	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.797000	0.04570	-0.200000	0.10300	0.472000	0.43445	GAG		0.408	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			Missense_Mutation
SSX2IP	117178	broad.mit.edu	37	1	85128152	85128152	+	Silent	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:85128152A>G	ENST00000342203.3	-	7	998	c.735T>C	c.(733-735)ggT>ggC	p.G245G	SSX2IP_ENST00000437941.2_Silent_p.G218G|SSX2IP_ENST00000370612.4_Silent_p.G245G|SSX2IP_ENST00000605755.1_Silent_p.G218G|SSX2IP_ENST00000603677.1_Intron	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	245					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.G245G(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CTTCAGTTTTACCAGTCCTCC	0.363																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	105.0	103.0					1																	85128152		2203	4300	6503	84900740	SO:0001819	synonymous_variant	117178				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.735T>C	1.37:g.85128152A>G		Somatic		x	x	x	84900740	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Silent	SNP	ENST00000342203.3	37	CCDS699.1	SNP	14	Broad																																																																																				0.363	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021		Silent
NTNG1	22854	broad.mit.edu	37	1	107866918	107866918	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:107866918G>A	ENST00000370068.1	+	3	1107	c.261G>A	c.(259-261)atG>atA	p.M87I	NTNG1_ENST00000370067.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370073.2_Missense_Mutation_p.M87I|NTNG1_ENST00000370061.3_Missense_Mutation_p.M87I|NTNG1_ENST00000370074.4_Missense_Mutation_p.M87I|NTNG1_ENST00000370070.2_Missense_Mutation_p.M87I|NTNG1_ENST00000542803.1_Missense_Mutation_p.M87I|NTNG1_ENST00000370066.1_Missense_Mutation_p.M87I|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370071.2_Missense_Mutation_p.M87I|NTNG1_ENST00000370072.3_Missense_Mutation_p.M87I|NTNG1_ENST00000370065.1_Missense_Mutation_p.M87I			Q9Y2I2	NTNG1_HUMAN	netrin G1	87	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.|NGL discriminant loop I.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.M87I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		ATCCCTACATGTGCAATAATG	0.478																																																1	Substitution - Missense(1)	ovary(1)	1											256.0	260.0	259.0					1																	107866918		2203	4300	6503	107668441	SO:0001583	missense	22854			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.261G>A	1.37:g.107866918G>A	ENSP00000359085:p.Met87Ile	Somatic		x	x	x	107668441	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821003	0.71028	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.68	5.68	0.88126	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.78786	0.4338	L	0.40543	1.245	0.58432	D	0.999999	D;D;B;P;P	0.71674	0.982;0.998;0.294;0.929;0.455	D;D;P;D;B	0.83275	0.989;0.996;0.522;0.946;0.342	T	0.76130	-0.3072	10	0.38643	T	0.18	.	19.7998	0.96502	0.0:0.0:1.0:0.0	.	87;87;87;87;87	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	I	87	ENSP00000359090:M87I;ENSP00000359088:M87I;ENSP00000440561:M87I;ENSP00000359078:M87I;ENSP00000359089:M87I;ENSP00000359087:M87I;ENSP00000359091:M87I;ENSP00000359085:M87I;ENSP00000359084:M87I;ENSP00000359083:M87I;ENSP00000359082:M87I	ENSP00000294649:M87I	M	+	3	0	NTNG1	107668441	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.876000	0.87215	2.683000	0.91414	0.655000	0.94253	ATG		0.478	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917		Missense_Mutation
PGLYRP3	114771	broad.mit.edu	37	1	153274927	153274927	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:153274927G>T	ENST00000290722.1	-	5	738	c.686C>A	c.(685-687)tCc>tAc	p.S229Y		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	229					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.S229Y(1)|p.S229F(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATGTGAAAGGACTGTATGTT	0.458																																																2	Substitution - Missense(2)	ovary(1)|pancreas(1)	1											281.0	257.0	265.0					1																	153274927		2203	4300	6503	151541551	SO:0001583	missense	114771			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.686C>A	1.37:g.153274927G>T	ENSP00000290722:p.Ser229Tyr	Unknown		x	x	x	151541551	A1A4U8|Q5SY65	Missense_Mutation	SNP	ENST00000290722.1	37	CCDS1035.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586553	0.46110	.	.	ENSG00000159527	ENST00000290722	T	0.18502	2.21	4.3	4.3	0.51218	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.230345	0.31071	N	0.008319	T	0.26557	0.0649	M	0.74647	2.275	0.35602	D	0.807928	D	0.63046	0.992	P	0.60949	0.881	T	0.05533	-1.0879	10	0.59425	D	0.04	-22.8123	12.1343	0.53961	0.0:0.0:1.0:0.0	.	229	Q96LB9	PGRP3_HUMAN	Y	229	ENSP00000290722:S229Y	ENSP00000290722:S229Y	S	-	2	0	PGLYRP3	151541551	0.989000	0.36119	0.858000	0.33744	0.824000	0.46624	2.670000	0.46833	2.230000	0.72887	0.655000	0.94253	TCC		0.458	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891		Missense_Mutation
FCRL5	83416	broad.mit.edu	37	1	157516843	157516843	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1331-01	TCGA-04-1331-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:157516843A>C	ENST00000361835.3	-	3	354	c.197T>G	c.(196-198)aTa>aGa	p.I66R	FCRL5_ENST00000368190.3_Missense_Mutation_p.I66R|FCRL5_ENST00000356953.4_Missense_Mutation_p.I66R|FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000368189.3_Missense_Mutation_p.I66R|FCRL5_ENST00000368188.2_Missense_Mutation_p.I66R	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	66	Ig-like C2-type 1.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.I66R(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TTCTCTTAGTATTTCTTTCCC	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	119.0	119.0					1																	157516843		2203	4300	6503	155783467	SO:0001583	missense	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.197T>G	1.37:g.157516843A>C	ENSP00000354691:p.Ile66Arg	Somatic		x	x	x	155783467	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	10.94	1.491958	0.26774	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368189;ENST00000368188	T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67	5.01	-7.81	0.01210	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02494	0.0076	L	0.37630	1.12	0.09310	N	1	B;B;B;B	0.26577	0.024;0.153;0.1;0.012	B;B;B;B	0.34346	0.021;0.18;0.038;0.066	T	0.42032	-0.9475	9	0.15066	T	0.55	.	6.1996	0.20569	0.2559:0.0:0.5355:0.2086	.	66;66;66;66	Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;FCRL5_HUMAN	R	66	ENSP00000354691:I66R;ENSP00000349434:I66R;ENSP00000357173:I66R;ENSP00000357172:I66R;ENSP00000357171:I66R	ENSP00000349434:I66R	I	-	2	0	FCRL5	155783467	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.034000	0.00636	-1.676000	0.01457	0.528000	0.53228	ATA		0.493	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		Missense_Mutation
FBXO28	23219	broad.mit.edu	37	1	224321795	224321795	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:224321795A>T	ENST00000366862.5	+	3	440	c.397A>T	c.(397-399)Aac>Tac	p.N133Y	FBXO28_ENST00000424254.2_Missense_Mutation_p.N133Y	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	133								p.N133Y(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		AGAAAGGAGAAACCATTCATT	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	57.0	60.0					1																	224321795		2203	4299	6502	222388418	SO:0001583	missense	23219			AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.397A>T	1.37:g.224321795A>T	ENSP00000355827:p.Asn133Tyr	Unknown		x	x	x	222388418	E9PEM8|O75070	Missense_Mutation	SNP	ENST00000366862.5	37	CCDS1539.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491949	0.84962	.	.	ENSG00000143756	ENST00000366862;ENST00000424254	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.99	T	0.78723	-0.2093	9	0.54805	T	0.06	-15.8636	14.9872	0.71356	1.0:0.0:0.0:0.0	.	133;133	E9PEM8;Q9NVF7	.;FBX28_HUMAN	Y	133	.	ENSP00000355827:N133Y	N	+	1	0	FBXO28	222388418	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.953000	0.93041	2.120000	0.65058	0.455000	0.32223	AAC		0.343	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091283.2	NM_015176		Missense_Mutation
OR2M2	391194	broad.mit.edu	37	1	248343719	248343719	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr1:248343719G>A	ENST00000359682.2	+	1	432	c.432G>A	c.(430-432)atG>atA	p.M144I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M144I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTGGACTTATGGCTACCTTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											202.0	210.0	207.0					1																	248343719		2203	4300	6503	246410342	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.432G>A	1.37:g.248343719G>A	ENSP00000352710:p.Met144Ile	Unknown		x	x	x	246410342	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	g	2.782	-0.253388	0.05829	.	.	ENSG00000198601	ENST00000359682	T	0.35605	1.3	1.7	-1.97	0.07503	GPCR, rhodopsin-like superfamily (1);	0.466003	0.15537	U	0.257149	T	0.25717	0.0626	L	0.41961	1.31	0.09310	N	1	B	0.24092	0.097	B	0.27887	0.084	T	0.21143	-1.0254	10	0.31617	T	0.26	.	7.5709	0.27907	0.3628:0.0:0.6372:0.0	.	144	Q96R28	OR2M2_HUMAN	I	144	ENSP00000352710:M144I	ENSP00000352710:M144I	M	+	3	0	OR2M2	246410342	0.019000	0.18553	0.000000	0.03702	0.001000	0.01503	0.076000	0.14712	-0.392000	0.07751	-0.396000	0.06452	ATG		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		Missense_Mutation
MKX	283078	broad.mit.edu	37	10	28023684	28023684	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr10:28023684C>A	ENST00000375790.5	-	5	971	c.539G>T	c.(538-540)gGg>gTg	p.G180V	MKX_ENST00000419761.1_Missense_Mutation_p.G180V			Q8IYA7	MKX_HUMAN	mohawk homeobox	180					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G180V(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						ATTATAGCCCCCTTCGTTCAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	10											121.0	121.0	121.0					10																	28023684		2203	4300	6503	28063690	SO:0001583	missense	283078			BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.539G>T	10.37:g.28023684C>A	ENSP00000364946:p.Gly180Val	Unknown		x	x	x	28063690	B3KWM5	Missense_Mutation	SNP	ENST00000375790.5	37	CCDS7156.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	8.413	0.844714	0.16963	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.64438	-0.1;-0.1	5.71	1.38	0.22167	.	0.589336	0.19010	N	0.125099	T	0.43411	0.1246	N	0.22421	0.69	0.39722	D	0.971483	B	0.09022	0.002	B	0.08055	0.003	T	0.28427	-1.0044	10	0.52906	T	0.07	-11.4336	7.4191	0.27061	0.0:0.5947:0.1224:0.2829	.	180	Q8IYA7	MKX_HUMAN	V	180	ENSP00000364946:G180V;ENSP00000400896:G180V	ENSP00000364946:G180V	G	-	2	0	MKX	28063690	0.016000	0.18221	0.219000	0.23793	0.723000	0.41478	0.067000	0.14510	0.337000	0.23665	0.558000	0.71614	GGG		0.493	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047332.3	NM_173576		Missense_Mutation
LZTS2	84445	broad.mit.edu	37	10	102763427	102763427	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr10:102763427C>G	ENST00000370220.1	+	2	3635	c.572C>G	c.(571-573)tCc>tGc	p.S191C	LZTS2_ENST00000370223.3_Missense_Mutation_p.S191C					leucine zipper, putative tumor suppressor 2									p.S191C(1)|p.S54C(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		tcctcctcctcctcttcctcc	0.647																																					Esophageal Squamous(8;38 437 13604 19902 37640)											2	Substitution - Missense(2)	ovary(2)	10											97.0	115.0	109.0					10																	102763427		2203	4299	6502	102753417	SO:0001583	missense	84445			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.572C>G	10.37:g.102763427C>G	ENSP00000359240:p.Ser191Cys	Unknown		x	x	x	102753417		Missense_Mutation	SNP	ENST00000370220.1	37	CCDS7507.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635554	0.67130	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000429732;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.33865	1.39;1.39	5.12	5.12	0.69794	.	0.536231	0.21286	N	0.077066	T	0.31389	0.0795	N	0.08118	0	0.33103	D	0.539512	D	0.69078	0.997	P	0.52881	0.712	T	0.46569	-0.9182	10	0.62326	D	0.03	-15.161	14.4181	0.67165	0.0:1.0:0.0:0.0	.	191	Q9BRK4	LZTS2_HUMAN	C	191	ENSP00000359243:S191C;ENSP00000359240:S191C	ENSP00000314437:S191C	S	+	2	0	LZTS2	102753417	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	4.225000	0.58600	2.539000	0.85634	0.561000	0.74099	TCC		0.647	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743		Missense_Mutation
TMEM132A	54972	broad.mit.edu	37	11	60703454	60703454	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr11:60703454C>G	ENST00000453848.2	+	11	2305	c.2147C>G	c.(2146-2148)cCa>cGa	p.P716R	TMEM132A_ENST00000005286.4_Missense_Mutation_p.P717R			Q24JP5	T132A_HUMAN	transmembrane protein 132A	716	Binds to HSPA5/GRP78. {ECO:0000250}.|Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.P717R(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						GCCATCCTGCCAGCTGAGGAG	0.697																																																1	Substitution - Missense(1)	ovary(1)	11											39.0	38.0	38.0					11																	60703454		2203	4298	6501	60460030	SO:0001583	missense	54972			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2147C>G	11.37:g.60703454C>G	ENSP00000405823:p.Pro716Arg	Unknown		x	x	x	60460030	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649930	0.67472	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286;ENST00000535480	T;T;T	0.22539	2.59;2.59;1.95	5.35	4.42	0.53409	.	0.426996	0.21729	N	0.069991	T	0.33962	0.0881	L	0.44542	1.39	0.38094	D	0.937059	D;D	0.67145	0.994;0.996	D;P	0.65010	0.931;0.895	T	0.10613	-1.0622	10	0.87932	D	0	.	10.9484	0.47315	0.0:0.9118:0.0:0.0882	.	716;717	Q24JP5;Q24JP5-2	T132A_HUMAN;.	R	467;716;717;82	ENSP00000405823:P716R;ENSP00000005286:P717R;ENSP00000439716:P82R	ENSP00000005286:P717R	P	+	2	0	TMEM132A	60460030	0.882000	0.30256	0.998000	0.56505	0.780000	0.44128	1.925000	0.40074	2.677000	0.91161	0.561000	0.74099	CCA		0.697	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870		Missense_Mutation
MRPL11	65003	broad.mit.edu	37	11	66204862	66204862	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr11:66204862A>G	ENST00000310999.7	-	3	365	c.272T>C	c.(271-273)cTg>cCg	p.L91P	MRPL11_ENST00000430466.2_Missense_Mutation_p.L65P|MRPL11_ENST00000524576.1_5'UTR|MRPL11_ENST00000329819.4_Missense_Mutation_p.L91P	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	91					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.L91P(1)		endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						TGCTGCCTTCAGGAAGTAGGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											64.0	65.0	64.0					11																	66204862		2200	4295	6495	65961438	SO:0001583	missense	65003			AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.272T>C	11.37:g.66204862A>G	ENSP00000308897:p.Leu91Pro	Unknown		x	x	x	65961438	A6NLT0|A8K219|Q32P46|Q96Q73	Missense_Mutation	SNP	ENST00000310999.7	37	CCDS8139.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.257678	0.80246	.	.	ENSG00000174547	ENST00000310999;ENST00000430466;ENST00000329819	.	.	.	5.61	5.61	0.85477	Ribosomal protein L11, N-terminal (1);Ribosomal protein L11, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.85822	0.5786	M	0.94063	3.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89353	0.3662	9	0.87932	D	0	-11.2863	13.7656	0.62992	1.0:0.0:0.0:0.0	.	65;91;91	Q9Y3B7-2;Q9Y3B7;A6NLT0	.;RM11_HUMAN;.	P	91;65;91	.	ENSP00000308897:L91P	L	-	2	0	MRPL11	65961438	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.600000	0.82769	2.118000	0.64928	0.533000	0.62120	CTG		0.493	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393098.2	NM_016050		Missense_Mutation
C11orf30	56946	broad.mit.edu	37	11	76207393	76207393	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr11:76207393G>C	ENST00000529032.1	+	8	1243	c.1243G>C	c.(1243-1245)Gtg>Ctg	p.V415L	C11orf30_ENST00000334736.3_Missense_Mutation_p.V415L|C11orf30_ENST00000524490.1_Intron|C11orf30_ENST00000525038.1_Missense_Mutation_p.V430L|C11orf30_ENST00000525919.1_Missense_Mutation_p.V416L|C11orf30_ENST00000524767.1_Missense_Mutation_p.V430L|C11orf30_ENST00000343878.3_Missense_Mutation_p.V415L|C11orf30_ENST00000533248.1_Missense_Mutation_p.V429L			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	415	Gln-rich.|Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V415L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						GTTATATCAAGTGCAACAGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											152.0	133.0	139.0					11																	76207393		2200	4292	6492	75885041	SO:0001583	missense	56946			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1243G>C	11.37:g.76207393G>C	ENSP00000432327:p.Val415Leu	Somatic		x	x	x	75885041	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851537	0.51270	.	.	ENSG00000158636	ENST00000334736;ENST00000343878;ENST00000393457;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032	.	.	.	5.82	4.89	0.63831	.	0.323261	0.30134	N	0.010324	T	0.17195	0.0413	N	0.08118	0	0.25616	N	0.986448	B;B;B;B;B;B;B	0.20261	0.005;0.003;0.005;0.012;0.043;0.007;0.007	B;B;B;B;B;B;B	0.20955	0.002;0.002;0.002;0.008;0.032;0.003;0.003	T	0.13872	-1.0493	9	0.26408	T	0.33	-4.7892	6.2074	0.20610	0.1772:0.0:0.6736:0.1492	.	429;430;430;415;365;416;415	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;F5H2F0;Q17RM7;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	L	415;415;365;430;429;416;430;415	.	ENSP00000334130:V415L	V	+	1	0	C11orf30	75885041	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	1.840000	0.39230	1.424000	0.47217	0.563000	0.77884	GTG		0.483	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193		Missense_Mutation
GRAMD1B	57476	broad.mit.edu	37	11	123480517	123480517	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr11:123480517C>T	ENST00000529750.1	+	12	1570	c.1243C>T	c.(1243-1245)Cca>Tca	p.P415S	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.P415S|GRAMD1B_ENST00000450171.2_Missense_Mutation_p.P106S|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.P422S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	415						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P415S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CATCTTCCATCCATGGAAAAA	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											47.0	50.0	49.0					11																	123480517		1905	4126	6031	122985727	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1243C>T	11.37:g.123480517C>T	ENSP00000436500:p.Pro415Ser	Unknown		x	x	x	122985727	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899462	0.91962	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764;ENST00000450171	T;T;T;T;T;T	0.50813	1.62;1.63;1.63;1.64;1.31;0.73	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	M	0.72353	2.195	0.80722	D	1	P;D;D;D;D	0.89917	0.768;0.985;1.0;0.999;0.974	B;P;D;P;P	0.87578	0.325;0.828;0.998;0.895;0.677	T	0.63373	-0.6652	10	0.28530	T	0.3	.	19.8471	0.96713	0.0:1.0:0.0:0.0	.	375;422;106;415;422	B7Z4N9;F5H572;Q3KR37-3;Q3KR37;E7EPH8	.;.;.;GRM1B_HUMAN;.	S	422;422;415;415;375;411;106	ENSP00000402457:P422S;ENSP00000325628:P415S;ENSP00000436500:P415S;ENSP00000432987:P375S;ENSP00000434214:P411S;ENSP00000388458:P106S	ENSP00000325628:P415S	P	+	1	0	GRAMD1B	122985727	1.000000	0.71417	0.412000	0.26496	0.945000	0.59286	7.765000	0.85310	2.688000	0.91661	0.655000	0.94253	CCA		0.527	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660		Missense_Mutation
FEZ1	9638	broad.mit.edu	37	11	125359623	125359623	+	Silent	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr11:125359623G>C	ENST00000278919.3	-	2	285	c.51C>G	c.(49-51)ccC>ccG	p.P17P	FEZ1_ENST00000366139.3_Silent_p.P17P|FEZ1_ENST00000524435.1_Silent_p.P17P	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	17					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)		p.P17P(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CCGAGCAGGAGGGTCGAAGGT	0.527																																					Melanoma(180;509 2033 10762 15939 24711)											1	Substitution - coding silent(1)	ovary(1)	11											68.0	72.0	71.0					11																	125359623		2201	4299	6500	124864833	SO:0001819	synonymous_variant	9638			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.51C>G	11.37:g.125359623G>C		Unknown		x	x	x	124864833	O00679|O00728|Q6IBI7	Silent	SNP	ENST00000278919.3	37	CCDS31716.1	SNP	35	Broad																																																																																				0.527	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103		Silent
CAPRIN2	65981	broad.mit.edu	37	12	30906458	30906458	+	Silent	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:30906458C>T	ENST00000395805.2	-	1	787	c.240G>A	c.(238-240)ggG>ggA	p.G80G	CAPRIN2_ENST00000251071.5_Silent_p.G80G|CAPRIN2_ENST00000308433.5_5'UTR|CAPRIN2_ENST00000298892.5_Silent_p.G80G|CAPRIN2_ENST00000417045.1_Silent_p.G80G|RP11-77I22.2_ENST00000500076.2_lincRNA	NM_001206856.1	NP_001193785.1			caprin family member 2									p.G80G(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ACTTCATATTCCCCTCTCTTT	0.537											OREG0021723	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	12											162.0	155.0	157.0					12																	30906458		2203	4300	6503	30797725	SO:0001819	synonymous_variant	65981			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.240G>A	12.37:g.30906458C>T		Unknown	820	x	x	x	30797725		Silent	SNP	ENST00000395805.2	37	CCDS55816.1	SNP	30	Broad																																																																																				0.537	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925		Silent
KRT6A	3853	broad.mit.edu	37	12	52884933	52884933	+	Missense_Mutation	SNP	C	C	T	rs376821206		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:52884933C>T	ENST00000330722.6	-	3	847	c.779G>A	c.(778-780)cGc>cAc	p.R260H		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	260	Coil 1B.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.R260H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCTGCTGTGCGCTTGTTGAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	12						C	HIS/ARG	0,4404		0,0,2202	72.0	67.0	69.0		779	5.1	1.0	12		69	1,8561	1.2+/-3.3	0,1,4280	no	missense	KRT6A	NM_005554.3	29	0,1,6482	TT,TC,CC		0.0117,0.0,0.0077	possibly-damaging	260/565	52884933	1,12965	2202	4281	6483	51171200	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.779G>A	12.37:g.52884933C>T	ENSP00000369317:p.Arg260His	Unknown		x	x	x	51171200	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	27.0	4.794489	0.90453	0.0	1.17E-4	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.89939	-2.59	5.14	5.14	0.70334	Filament (1);	0.000000	0.56097	D	0.000022	D	0.92466	0.7608	M	0.87547	2.89	0.50632	D	0.999882	P	0.51653	0.947	P	0.48982	0.597	D	0.93679	0.6997	10	0.66056	D	0.02	.	16.0286	0.80560	0.0:0.8657:0.1343:0.0	.	260	P02538	K2C6A_HUMAN	H	260;216	ENSP00000369317:R260H	ENSP00000369317:R260H	R	-	2	0	KRT6A	51171200	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.937000	0.70162	2.550000	0.86006	0.555000	0.69702	CGC		0.458	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554		Missense_Mutation
CSAD	51380	broad.mit.edu	37	12	53553935	53553935	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:53553935G>A	ENST00000444623.1	-	14	1402	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	CSAD_ENST00000379843.3_Missense_Mutation_p.R232W|CSAD_ENST00000453446.2_Missense_Mutation_p.R379W|CSAD_ENST00000267085.4_Missense_Mutation_p.R406W|CSAD_ENST00000379846.1_Missense_Mutation_p.R232W|RP11-1136G11.8_ENST00000550908.1_lincRNA	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	379					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)	p.R379W(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	TCGATGCGCCGCTCCAGCCCT	0.657											OREG0021859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(109;252 1546 16882 28524 44645)											1	Substitution - Missense(1)	ovary(1)	12											96.0	85.0	89.0					12																	53553935		2203	4300	6503	51840202	SO:0001583	missense	51380			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1135C>T	12.37:g.53553935G>A	ENSP00000415485:p.Arg379Trp	Somatic	993	x	x	x	51840202	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	SNP	38	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.833|9.833	1.189033|1.189033	0.21954|0.21954	.|.	.|.	ENSG00000139631|ENSG00000139631	ENST00000379850|ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	.|T;T;T;T;T	.|0.39997	.|1.05;1.05;1.05;1.05;1.05	4.67|4.67	3.77|3.77	0.43336|0.43336	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|1.166190	.|0.06061	.|N	.|0.658452	T|T	0.41766|0.41766	0.1173|0.1173	L|L	0.58583|0.58583	1.82|1.82	0.48087|0.48087	D|D	0.999582|0.999582	.|B;B;B	.|0.23540	.|0.005;0.002;0.087	.|B;B;B	.|0.17979	.|0.002;0.002;0.02	T|T	0.37337|0.37337	-0.9710|-0.9710	5|10	.|0.66056	.|D	.|0.02	-1.8474|-1.8474	7.6902|7.6902	0.28563|0.28563	0.0862:0.0:0.7527:0.1611|0.0862:0.0:0.7527:0.1611	.|.	.|406;379;232	.|Q9Y600-3;Q9Y600;Q9Y600-2	.|.;CSAD_HUMAN;.	V|W	404|468;232;406;232;379;340;379	.|ENSP00000369172:R232W;ENSP00000267085:R406W;ENSP00000369175:R232W;ENSP00000415485:R379W;ENSP00000410648:R379W	.|ENSP00000267085:R406W	A|R	-|-	2|1	0|2	CSAD|CSAD	51840202|51840202	0.203000|0.203000	0.23435|0.23435	0.832000|0.832000	0.32986|0.32986	0.097000|0.097000	0.18754|0.18754	1.102000|1.102000	0.31050|0.31050	1.305000|1.305000	0.44909|0.44909	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.657	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989		Missense_Mutation
DDIT3	1649	broad.mit.edu	37	12	57911116	57911116	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1331-01	TCGA-04-1331-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:57911116A>C	ENST00000346473.3	-	3	253	c.74T>G	c.(73-75)cTg>cGg	p.L25R	MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000551116.1_Missense_Mutation_p.L48R|DDIT3_ENST00000552740.1_Missense_Mutation_p.L48R|DDIT3_ENST00000547303.1_Missense_Mutation_p.L25R	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	25	N-terminal.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.L25R(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						GACCTCTTGCAGGTCCTCATA	0.498			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	1	Substitution - Missense(1)	ovary(1)	12											65.0	59.0	61.0					12																	57911116		2203	4300	6503	56197383	SO:0001583	missense	1649			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.74T>G	12.37:g.57911116A>C	ENSP00000340671:p.Leu25Arg	Somatic		x	x	x	56197383	F8VS99	Missense_Mutation	SNP	ENST00000346473.3	37	CCDS8943.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	22.4	4.288084	0.80803	.	.	ENSG00000175197	ENST00000547303;ENST00000551116;ENST00000346473;ENST00000552740;ENST00000547526	T;T;T;T	0.70045	-0.36;-0.45;-0.36;-0.45	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000002	T	0.74215	0.3687	L	0.36672	1.1	0.52099	D	0.999945	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.77159	-0.2690	10	0.87932	D	0	-2.6048	14.1539	0.65405	1.0:0.0:0.0:0.0	.	48;25	F8VS99;P35638	.;DDIT3_HUMAN	R	25;48;25;48;48	ENSP00000447188:L25R;ENSP00000448665:L48R;ENSP00000340671:L25R;ENSP00000447803:L48R	ENSP00000340671:L25R	L	-	2	0	DDIT3	56197383	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.141000	0.89618	2.240000	0.73641	0.533000	0.62120	CTG		0.498	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083		Missense_Mutation
HECTD4	283450	broad.mit.edu	37	12	112608168	112608168	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:112608168C>A	ENST00000430131.2	-	68	11900	c.10755G>T	c.(10753-10755)gaG>gaT	p.E3585D	HECTD4_ENST00000550722.1_Missense_Mutation_p.E3861D|HECTD4_ENST00000377560.5_Missense_Mutation_p.E3835D			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3585					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.E3585D(1)|p.E3835D(1)									CCAAGGTGATCTCAGGGGCCG	0.537																																																2	Substitution - Missense(2)	ovary(2)	12											62.0	65.0	64.0					12																	112608168		2020	4195	6215	111092551	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10755G>T	12.37:g.112608168C>A	ENSP00000404379:p.Glu3585Asp	Unknown		x	x	x	111092551	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457489	0.84317	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.49432	0.78;0.78;0.78	5.98	1.67	0.24075	.	.	.	.	.	T	0.48447	0.1500	N	0.19112	0.55	0.39635	D	0.970234	P	0.52842	0.956	D	0.65010	0.931	T	0.51084	-0.8750	9	0.87932	D	0	.	10.0854	0.42415	0.0:0.6266:0.0:0.3734	.	3585	Q9Y4D8	K0614_HUMAN	D	3835;3585;3861	ENSP00000366783:E3835D;ENSP00000404379:E3585D;ENSP00000449784:E3861D	ENSP00000366783:E3835D	E	-	3	2	C12orf51	111092551	0.999000	0.42202	0.997000	0.53966	0.847000	0.48162	0.627000	0.24506	0.436000	0.26393	0.591000	0.81541	GAG		0.537	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		Missense_Mutation
C12orf49	79794	broad.mit.edu	37	12	117158152	117158152	+	Silent	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr12:117158152G>A	ENST00000261318.3	-	3	529	c.369C>T	c.(367-369)ggC>ggT	p.G123G	C12orf49_ENST00000536380.1_Silent_p.G93G|C12orf49_ENST00000548356.1_5'Flank	NM_024738.1	NP_079014.1	Q9H741	CL049_HUMAN	chromosome 12 open reading frame 49	123	Cys-rich.					extracellular region (GO:0005576)		p.G123G(1)		endometrium(1)|lung(1)|ovary(1)|skin(1)	4	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		CGCTGCAGCAGCCGTTGGGCC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	12											102.0	89.0	94.0					12																	117158152		2203	4300	6503	115642535	SO:0001819	synonymous_variant	79794			AK025068	CCDS9179.1	12q24.22	2012-05-30			ENSG00000111412	ENSG00000111412			26128	protein-coding gene	gene with protein product						12477932	Standard	NM_024738		Approved	FLJ21415	uc001tvz.1	Q9H741	OTTHUMG00000169392	ENST00000261318.3:c.369C>T	12.37:g.117158152G>A		Unknown		x	x	x	115642535	Q53GE8	Silent	SNP	ENST00000261318.3	37	CCDS9179.1	SNP	34	Broad																																																																																				0.552	C12orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403847.1	NM_024738		Silent
BRCA2	675	broad.mit.edu	37	13	32910625	32910625	+	Nonsense_Mutation	SNP	C	C	A	rs535547513	byFrequency	TCGA-04-1331-01	TCGA-04-1331-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr13:32910625C>A	ENST00000380152.3	+	11	2366	c.2133C>A	c.(2131-2133)tgC>tgA	p.C711*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.C711*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	711	Interaction with NPM1.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.C711*(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CTCTGTCATGCCTGCAGGAAG	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Substitution - Nonsense(1)	ovary(1)	13											54.0	57.0	56.0					13																	32910625		2203	4300	6503	31808625	SO:0001587	stop_gained	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.2133C>A	13.37:g.32910625C>A	ENSP00000369497:p.Cys711*	Somatic		x	x	x	31808625	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025060	0.93518	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.58	0.395	0.16304	.	1.186530	0.05852	N	0.621294	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	7.935	0.29925	0.0:0.6087:0.1847:0.2066	.	.	.	.	X	711	.	ENSP00000369497:C711X	C	+	3	2	BRCA2	31808625	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.310000	0.19356	0.064000	0.16427	-1.094000	0.02160	TGC		0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		Nonsense_Mutation
ABHD13	84945	broad.mit.edu	37	13	108882235	108882235	+	Silent	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr13:108882235A>G	ENST00000375898.3	+	2	970	c.669A>G	c.(667-669)ccA>ccG	p.P223P		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	223						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.P223P(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TAAGCATACCACATATGGCCA	0.388																																					Pancreas(22;506 789 38166 45896 51596)											1	Substitution - coding silent(1)	ovary(1)	13											121.0	119.0	119.0					13																	108882235		2203	4300	6503	107680236	SO:0001819	synonymous_variant	84945			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.669A>G	13.37:g.108882235A>G		Somatic		x	x	x	107680236	B3KWE7|Q8NBW1|Q96JX9	Silent	SNP	ENST00000375898.3	37	CCDS32007.1	SNP	6	Broad																																																																																				0.388	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859		Silent
CPSF2	53981	broad.mit.edu	37	14	92621554	92621554	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr14:92621554G>T	ENST00000298875.4	+	11	1614	c.1329G>T	c.(1327-1329)atG>atT	p.M443I		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	443					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)	p.M443I(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		ACTTGATGATGAAAGGTGAAG	0.398																																					Ovarian(78;28 1788 18702 44111)											1	Substitution - Missense(1)	ovary(1)	14											115.0	104.0	108.0					14																	92621554		2203	4300	6503	91691307	SO:0001583	missense	53981			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.1329G>T	14.37:g.92621554G>T	ENSP00000298875:p.Met443Ile	Unknown		x	x	x	91691307	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	ENST00000298875.4	37	CCDS9902.1	SNP	45	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.51|14.51	2.555486|2.555486	0.45487|0.45487	.|.	.|.	ENSG00000165934|ENSG00000165934	ENST00000298875|ENST00000555244	T|.	0.41400|.	1.0|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55545|.	0.1927|.	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B|.	0.11235|.	0.004|.	B|.	0.08055|.	0.003|.	T|.	0.48163|.	-0.9059|.	10|.	0.37606|.	T|.	0.19|.	.|.	20.0745|20.0745	0.97737|0.97737	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	443|.	Q9P2I0|.	CPSF2_HUMAN|.	I|L	443|11	ENSP00000298875:M443I|.	ENSP00000298875:M443I|.	M|X	+|+	3|2	0|2	CPSF2|CPSF2	91691307|91691307	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.613000|9.613000	0.98350|0.98350	2.748000|2.748000	0.94277|0.94277	0.462000|0.462000	0.41574|0.41574	ATG|TGA		0.398	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1			Missense_Mutation
ADSSL1	122622	broad.mit.edu	37	14	105212597	105212597	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr14:105212597T>C	ENST00000555674.1	+	1	205	c.14T>C	c.(13-15)gTc>gCc	p.V5A	ADSSL1_ENST00000332972.5_Missense_Mutation_p.V442A|ADSSL1_ENST00000330877.2_Missense_Mutation_p.V399A|ADSSL1_ENST00000556623.1_Missense_Mutation_p.V5A|ADSSL1_ENST00000554657.1_3'UTR					adenylosuccinate synthase like 1											central_nervous_system(1)|cervix(1)|kidney(1)|lung(5)|ovary(2)|prostate(1)	11		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)		CTTCAGAAGGTCGAAGTTGAG	0.582																																																0			14											73.0	66.0	68.0					14																	105212597		2203	4300	6503	104283642	SO:0001583	missense	122622			AK095921	CCDS9990.1, CCDS9991.1	14q32.33	2010-08-05			ENSG00000185100	ENSG00000185100			20093	protein-coding gene	gene with protein product		612498					Standard	NM_199165		Approved	FLJ38602	uc001ype.3	Q8N142		ENST00000555674.1:c.14T>C	14.37:g.105212597T>C	ENSP00000450433:p.Val5Ala	Unknown		x	x	x	104283642		Missense_Mutation	SNP	ENST00000555674.1	37		SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079298	0.76528	.	.	ENSG00000185100	ENST00000330877;ENST00000332972;ENST00000556623;ENST00000555674	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	L	0.37697	1.125	0.80722	D	1	D;D	0.63880	0.993;0.981	D;D	0.72982	0.979;0.959	T	0.52593	-0.8555	10	0.41790	T	0.15	-16.7754	15.212	0.73230	0.0:0.0:0.0:1.0	.	442;399	Q8N142-2;Q8N142	.;PURA1_HUMAN	A	399;442;5;5	ENSP00000331260:V399A;ENSP00000333019:V442A;ENSP00000452303:V5A;ENSP00000450433:V5A	ENSP00000331260:V399A	V	+	2	0	ADSSL1	104283642	1.000000	0.71417	0.960000	0.40013	0.616000	0.37450	7.938000	0.87678	1.981000	0.57761	0.533000	0.62120	GTC		0.582	ADSSL1-010	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000410540.1			Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105420500	105420500	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr14:105420500C>G	ENST00000333244.5	-	7	1407	c.1288G>C	c.(1288-1290)Gag>Cag	p.E430Q	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	430						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.E430Q(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACTGCTGTCTCCTGTGCCTGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	14											50.0	55.0	53.0					14																	105420500		2028	4174	6202	104491545	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.1288G>C	14.37:g.105420500C>G	ENSP00000353114:p.Glu430Gln	Unknown		x	x	x	104491545	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	16.09	3.024810	0.54683	.	.	ENSG00000185567	ENST00000333244	T	0.05717	3.4	4.5	0.937	0.19494	.	.	.	.	.	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	B	0.24823	0.112	B	0.20184	0.028	T	0.43686	-0.9376	9	0.36615	T	0.2	.	4.9838	0.14180	0.0:0.3356:0.4191:0.2453	.	430	Q8IVF2	AHNK2_HUMAN	Q	430	ENSP00000353114:E430Q	ENSP00000353114:E430Q	E	-	1	0	AHNAK2	104491545	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.294000	0.19047	0.415000	0.25817	0.555000	0.69702	GAG		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Missense_Mutation
NEDD4	4734	broad.mit.edu	37	15	56208548	56208548	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr15:56208548G>T	ENST00000508342.1	-	1	781	c.482C>A	c.(481-483)tCt>tAt	p.S161Y	NEDD4_ENST00000506154.1_Missense_Mutation_p.S161Y|NEDD4_ENST00000338963.2_Missense_Mutation_p.S161Y|NEDD4_ENST00000435532.3_Intron	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	161	Ser-rich.				adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)	p.S161Y(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		GCTGCTGTAAGACCCATTATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	15											155.0	139.0	145.0					15																	56208548		2193	4292	6485	53995840	SO:0001583	missense	4734			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.482C>A	15.37:g.56208548G>T	ENSP00000424827:p.Ser161Tyr	Somatic		x	x	x	53995840	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723016	0.68959	.	.	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.51574	0.7;0.7;0.7	5.17	5.17	0.71159	.	286.185000	0.00166	N	0.000000	T	0.66858	0.2832	L	0.34521	1.04	0.30523	N	0.768271	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.85130	0.997;0.994;0.997	T	0.63229	-0.6684	10	0.51188	T	0.08	.	18.0099	0.89220	0.0:0.0:1.0:0.0	.	161;161;161	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	Y	161	ENSP00000424827:S161Y;ENSP00000345530:S161Y;ENSP00000422705:S161Y	ENSP00000345530:S161Y	S	-	2	0	NEDD4	53995840	1.000000	0.71417	0.991000	0.47740	0.918000	0.54935	5.366000	0.66122	2.585000	0.87301	0.591000	0.81541	TCT		0.403	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400		Missense_Mutation
CA12	771	broad.mit.edu	37	15	63634277	63634277	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr15:63634277T>G	ENST00000178638.3	-	5	889	c.449A>C	c.(448-450)aAc>aCc	p.N150T	CA12_ENST00000344366.3_Missense_Mutation_p.N150T|CA12_ENST00000422263.2_Missense_Mutation_p.N90T	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	150					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.N150T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AAGGTCTGAGTTATAATGGAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	60.0	65.0					15																	63634277		2203	4300	6503	61421330	SO:0001583	missense	771			AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.449A>C	15.37:g.63634277T>G	ENSP00000178638:p.Asn150Thr	Unknown		x	x	x	61421330	B2RE24|Q53YE5|Q9BWG2	Missense_Mutation	SNP	ENST00000178638.3	37	CCDS10185.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436368	0.83885	.	.	ENSG00000074410	ENST00000178638;ENST00000344366;ENST00000422263	T;T;T	0.72051	-0.62;-0.62;-0.62	5.3	5.3	0.74995	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	M	0.91038	3.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.89810	0.3981	10	0.87932	D	0	.	14.0751	0.64885	0.0:0.0:0.0:1.0	.	90;150;150	B3KUB4;O43570-2;O43570	.;.;CAH12_HUMAN	T	150;150;90	ENSP00000178638:N150T;ENSP00000343088:N150T;ENSP00000403028:N90T	ENSP00000178638:N150T	N	-	2	0	CA12	61421330	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.538000	0.82048	1.999000	0.58509	0.533000	0.62120	AAC		0.498	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218		Missense_Mutation
PSMA4	5685	broad.mit.edu	37	15	78834948	78834948	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr15:78834948A>C	ENST00000044462.7	+	4	320	c.170A>C	c.(169-171)gAt>gCt	p.D57A	PSMA4_ENST00000558094.1_5'Flank|PSMA4_ENST00000413382.2_Intron|PSMA4_ENST00000559082.1_Missense_Mutation_p.D57A|PSMA4_ENST00000557929.1_3'UTR|PSMA4_ENST00000558281.1_Missense_Mutation_p.D57A|PSMA4_ENST00000560217.1_Missense_Mutation_p.D26A|PSMA4_ENST00000558341.1_Missense_Mutation_p.D57A	NM_002789.4	NP_002780.1	P25789	PSA4_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 4	57					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)	p.D57A(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						AAGCTTCTTGATGAAGTCTTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	15											120.0	126.0	124.0					15																	78834948		2196	4293	6489	76622003	SO:0001583	missense	5685			BC005361	CCDS10303.1, CCDS45319.1	15q24.1	2004-01-19			ENSG00000041357	ENSG00000041357		"""Proteasome (prosome, macropain) subunits"""	9533	protein-coding gene	gene with protein product		176846				2025653	Standard	NM_002789		Approved	HC9, HsT17706	uc010blf.3	P25789	OTTHUMG00000143859	ENST00000044462.7:c.170A>C	15.37:g.78834948A>C	ENSP00000044462:p.Asp57Ala	Unknown		x	x	x	76622003	D3DW86|Q53XP2|Q567Q5|Q8TBD1	Missense_Mutation	SNP	ENST00000044462.7	37	CCDS10303.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260108	0.80246	.	.	ENSG00000041357	ENST00000044462	T	0.22134	1.97	5.65	5.65	0.86999	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.37293	0.0998	M	0.87038	2.855	0.80722	D	1	P	0.45212	0.853	P	0.44696	0.458	T	0.42783	-0.9431	10	0.56958	D	0.05	-32.546	14.4332	0.67264	1.0:0.0:0.0:0.0	.	57	P25789	PSA4_HUMAN	A	57	ENSP00000044462:D57A	ENSP00000044462:D57A	D	+	2	0	PSMA4	76622003	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.966000	0.93397	2.158000	0.67659	0.533000	0.62120	GAT		0.368	PSMA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290107.5	NM_002789		Missense_Mutation
TICRR	90381	broad.mit.edu	37	15	90145047	90145047	+	Missense_Mutation	SNP	G	G	A	rs115860712	byFrequency	TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr15:90145047G>A	ENST00000268138.7	+	12	2512	c.2407G>A	c.(2407-2409)Gtc>Atc	p.V803I	TICRR_ENST00000560985.1_Missense_Mutation_p.V802I			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	803					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.V803I(1)									GCTGGCTGGTGTCCTTCCTAC	0.423													G|||	12	0.00239617	0.0076	0.0014	5008	,	,		20047	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						G	ILE/VAL	54,3752		0,54,1849	170.0	159.0	163.0		2407	4.8	1.0	15	dbSNP_132	163	1,8249		0,1,4124	yes	missense	C15orf42	NM_152259.3	29	0,55,5973	AA,AG,GG		0.0121,1.4188,0.4562	possibly-damaging	803/1911	90145047	55,12001	1903	4125	6028	87946051	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2407G>A	15.37:g.90145047G>A	ENSP00000268138:p.Val803Ile	Unknown		x	x	x	87946051	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	SNP	48	Broad	5	0.0022893772893772895	2	0.0040650406504065045	2	0.0055248618784530384	0	0.0	1	0.0013192612137203166	G	16.88	3.245726	0.59103	0.014188	1.21E-4	ENSG00000140534	ENST00000268138	T	0.17691	2.26	5.76	4.83	0.62350	.	0.270122	0.34959	N	0.003551	T	0.13030	0.0316	L	0.47190	1.495	0.38114	D	0.93765	P	0.41450	0.75	B	0.39152	0.292	T	0.02437	-1.1159	10	0.49607	T	0.09	-11.6649	15.7201	0.77700	0.0686:0.0:0.9314:0.0	.	803	Q7Z2Z1	TICRR_HUMAN	I	803	ENSP00000268138:V803I	ENSP00000268138:V803I	V	+	1	0	C15orf42	87946051	1.000000	0.71417	0.963000	0.40424	0.999000	0.98932	4.013000	0.57138	2.882000	0.98803	0.655000	0.94253	GTC		0.423	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		Missense_Mutation
VIMP	55829	broad.mit.edu	37	15	101812979	101812979	+	Silent	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr15:101812979G>C	ENST00000398226.3	-	6	599	c.567C>G	c.(565-567)ggC>ggG	p.G189G	VIMP_ENST00000531964.1_Silent_p.G166G|VIMP_ENST00000537379.1_3'UTR|VIMP_ENST00000526049.1_Silent_p.G189G			Q9BQE4	SELS_HUMAN	VCP-interacting membrane protein	189					cell redox homeostasis (GO:0045454)|cellular response to insulin stimulus (GO:0032869)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oxidative stress (GO:0034599)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of tumor necrosis factor production (GO:0032720)|regulation of gluconeogenesis (GO:0006111)|regulation of nitric oxide metabolic process (GO:0080164)|response to glucose (GO:0009749)|response to redox state (GO:0051775)|retrograde protein transport, ER to cytosol (GO:0030970)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|selenium binding (GO:0008430)	p.G189G(1)									AAGATTCTTAGCCTCATCCGC	0.517																																																1	Substitution - coding silent(1)	ovary(1)	15											38.0	41.0	40.0					15																	101812979		1957	4159	6116	99630502	SO:0001819	synonymous_variant	55829			AF328864	CCDS53979.1	15q26.3	2012-10-02			ENSG00000131871	ENSG00000131871			30396	protein-coding gene	gene with protein product	"""selenoprotein S"""	607918				16227999, 16186510	Standard	NM_018445		Approved	SELS, MGC2553, SBBI8, AD-015, SEPS1	uc021sxu.1	Q9BQE4	OTTHUMG00000166441	ENST00000398226.3:c.567C>G	15.37:g.101812979G>C		Unknown		x	x	x	99630502	Q3B771|Q9P0I6	Silent	SNP	ENST00000398226.3	37	CCDS53979.1	SNP	34	Broad																																																																																				0.517	VIMP-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389784.2	NM_018445		Silent
FLYWCH2	114984	broad.mit.edu	37	16	2949111	2949111	+	Silent	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr16:2949111C>T	ENST00000396958.3	+	4	764	c.384C>T	c.(382-384)aaC>aaT	p.N128N	FLYWCH2_ENST00000572786.1_3'UTR|FLYWCH2_ENST00000293981.6_Silent_p.N128N	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	128							poly(A) RNA binding (GO:0044822)	p.N128N(2)		central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						CTGGGGAGAACTTTGCCCCCT	0.607																																																2	Substitution - coding silent(2)	ovary(2)	16											52.0	51.0	51.0					16																	2949111		2198	4300	6498	2889112	SO:0001819	synonymous_variant	114984			BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.384C>T	16.37:g.2949111C>T		Unknown		x	x	x	2889112		Silent	SNP	ENST00000396958.3	37	CCDS10482.1	SNP	20	Broad																																																																																				0.607	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439		Silent
CLDN9	9080	broad.mit.edu	37	16	3063589	3063589	+	Missense_Mutation	SNP	G	G	C	rs544084273		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr16:3063589G>C	ENST00000445369.2	+	1	1133	c.226G>C	c.(226-228)Gac>Cac	p.D76H		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	76					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						TCTGCCGCAGGACCTGCAGGC	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18767	0.0		0.0	False		,,,				2504	0.0															0			16											107.0	84.0	91.0					16																	3063589		2198	4300	6498	3003590	SO:0001583	missense	9080			AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.226G>C	16.37:g.3063589G>C	ENSP00000398017:p.Asp76His	Unknown		x	x	x	3003590		Missense_Mutation	SNP	ENST00000445369.2	37	CCDS10487.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581074	0.46006	.	.	ENSG00000213937	ENST00000445369	D	0.88509	-2.39	4.72	4.72	0.59763	.	0.206143	0.39615	N	0.001303	D	0.94265	0.8158	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.94071	0.7335	10	0.45353	T	0.12	.	15.2132	0.73241	0.0:0.0:1.0:0.0	.	76	O95484	CLD9_HUMAN	H	76	ENSP00000398017:D76H	ENSP00000398017:D76H	D	+	1	0	CLDN9	3003590	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	7.856000	0.86956	2.423000	0.82170	0.467000	0.42956	GAC		0.657	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250989.1	NM_020982		Missense_Mutation
CCDC102A	92922	broad.mit.edu	37	16	57559891	57559891	+	Missense_Mutation	SNP	G	G	T	rs563952674		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr16:57559891G>T	ENST00000258214.2	-	3	980	c.734C>A	c.(733-735)aCg>aAg	p.T245K		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	245								p.T245K(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						CTCCTCCTCCGTGGCAGCTGT	0.716																																																1	Substitution - Missense(1)	ovary(1)	16											33.0	28.0	30.0					16																	57559891		2198	4300	6498	56117392	SO:0001583	missense	92922			BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.734C>A	16.37:g.57559891G>T	ENSP00000258214:p.Thr245Lys	Unknown		x	x	x	56117392	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	1.394	-0.580037	0.03854	.	.	ENSG00000135736	ENST00000258214	T	0.42513	0.97	5.15	1.44	0.22558	.	1.007110	0.07968	N	0.983485	T	0.21550	0.0519	N	0.19112	0.55	0.09310	N	1	B	0.15719	0.014	B	0.15484	0.013	T	0.29058	-1.0024	10	0.06365	T	0.9	-9.0099	3.6057	0.08042	0.4979:0.2047:0.2974:0.0	.	245	Q96A19	C102A_HUMAN	K	245	ENSP00000258214:T245K	ENSP00000258214:T245K	T	-	2	0	CCDC102A	56117392	0.000000	0.05858	0.018000	0.16275	0.867000	0.49689	1.097000	0.30988	0.591000	0.29711	-0.362000	0.07510	ACG		0.716	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-04-1331-01	TCGA-04-1331-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	17	GRCh37	CM971506	TP53	M	rs121913344						120.0	106.0	110.0					17																	7577022		2203	4300	6503	7517747	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*	Somatic		x	x	x	7517747	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
ALOXE3	59344	broad.mit.edu	37	17	8018366	8018366	+	Silent	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr17:8018366G>A	ENST00000448843.2	-	5	784	c.444C>T	c.(442-444)atC>atT	p.I148I	ALOXE3_ENST00000318227.3_Silent_p.I280I|ALOXE3_ENST00000380149.1_Silent_p.I304I	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	148	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.I148I(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CAGGGGCATAGATCTTCCAGC	0.478																																																1	Substitution - coding silent(1)	ovary(1)	17											119.0	115.0	116.0					17																	8018366		2203	4300	6503	7959091	SO:0001819	synonymous_variant	59344			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.444C>T	17.37:g.8018366G>A		Unknown		x	x	x	7959091	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Silent	SNP	ENST00000448843.2	37	CCDS11130.1	SNP	33	Broad																																																																																				0.478	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1			Silent
NEK8	284086	broad.mit.edu	37	17	27065157	27065157	+	Silent	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr17:27065157A>G	ENST00000268766.6	+	8	1150	c.1116A>G	c.(1114-1116)gcA>gcG	p.A372A	AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	372					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.A383A(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					TTCCTGGGGCAGTGGAGCAGC	0.672																																					NSCLC(6;19 293 14866 25253 49845)											1	Substitution - coding silent(1)	ovary(1)	17											65.0	53.0	57.0					17																	27065157		2203	4300	6503	24089284	SO:0001819	synonymous_variant	284086			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.1116A>G	17.37:g.27065157A>G		Unknown		x	x	x	24089284	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Silent	SNP	ENST00000268766.6	37	CCDS32597.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	11.66	1.706042	0.30232	.	.	ENSG00000160602	ENST00000543014	T	0.71698	-0.59	5.54	-11.1	0.00147	.	.	.	.	.	T	0.51227	0.1662	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53265	-0.8463	6	0.19147	T	0.46	.	4.8073	0.13326	0.0862:0.373:0.3114:0.2293	.	.	.	.	G	426	ENSP00000465859:S426G	ENSP00000446066:S426G	S	+	1	0	NEK8	24089284	0.000000	0.05858	0.125000	0.21846	0.563000	0.35712	-1.938000	0.01546	-4.023000	0.00081	-0.408000	0.06270	AGT		0.672	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446467.2			Silent
NF1	4763	broad.mit.edu	37	17	29585518	29585518	+	Missense_Mutation	SNP	A	A	G	rs137854550		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr17:29585518A>G	ENST00000358273.4	+	32	4713	c.4330A>G	c.(4330-4332)Aag>Gag	p.K1444E	NF1_ENST00000356175.3_Missense_Mutation_p.K1423E	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1444	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.		K -> E (in NF1 and NFNS; significant reduction of intrinsic GAP activity; dbSNP:rs137854550). {ECO:0000269|PubMed:11857752, ECO:0000269|PubMed:1568247, ECO:0000269|PubMed:16380919, ECO:0000269|PubMed:9003501}.|K -> N (in NF1; dbSNP:rs199474750). {ECO:0000269|PubMed:12552569, ECO:0000269|PubMed:15146469}.|K -> R (in NF1; dbSNP:rs199474781). {ECO:0000269|PubMed:11735023}.		actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)|p.K1444E(3)|p.K1444Q(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTAATGTCAAAGGTGAATTA	0.348			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	17	Whole gene deletion(8)|Unknown(5)|Substitution - Missense(4)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	17	GRCh37	CM920506	NF1	M	rs137854550						52.0	49.0	50.0					17																	29585518		2203	4299	6502	26609644	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4330A>G	17.37:g.29585518A>G	ENSP00000351015:p.Lys1444Glu	Unknown		x	x	x	26609644	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	32	5.123099	0.94429	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.90844	-2.74;-2.74;-2.74	6.02	6.02	0.97574	Rho GTPase activation protein (1);Armadillo-type fold (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.97238	0.9097	H	0.97852	4.09	0.80722	A	1	D;D;D	0.89917	1.0;0.974;0.998	D;D;D	0.91635	0.999;0.969;0.997	D	0.98561	1.0641	9	0.87932	D	0	.	15.1131	0.72375	1.0:0.0:0.0:0.0	.	473;1423;1444	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	E	1444;1423;1089	ENSP00000351015:K1444E;ENSP00000348498:K1423E;ENSP00000389907:K1089E	ENSP00000348498:K1423E	K	+	1	0	NF1	26609644	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.923000	0.92808	2.304000	0.77564	0.528000	0.53228	AAG		0.348	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Missense_Mutation
EMILIN2	84034	broad.mit.edu	37	18	2890859	2890859	+	Missense_Mutation	SNP	C	C	A	rs200574377		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr18:2890859C>A	ENST00000254528.3	+	4	893	c.734C>A	c.(733-735)aCg>aAg	p.T245K		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	245					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.T245K(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GACACAGAAACGGGCCAGAGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	18											54.0	60.0	58.0					18																	2890859		2203	4300	6503	2880859	SO:0001583	missense	84034			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.734C>A	18.37:g.2890859C>A	ENSP00000254528:p.Thr245Lys	Unknown		x	x	x	2880859	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249647	0.22880	.	.	ENSG00000132205	ENST00000254528	T	0.36157	1.27	5.41	1.68	0.24146	.	0.627640	0.15689	N	0.249510	T	0.33673	0.0871	M	0.68952	2.095	0.09310	N	1	P	0.46621	0.881	P	0.49140	0.601	T	0.25847	-1.0120	10	0.05959	T	0.93	-4.1037	2.9721	0.05926	0.1115:0.5175:0.1087:0.2624	.	245	Q9BXX0	EMIL2_HUMAN	K	245	ENSP00000254528:T245K	ENSP00000254528:T245K	T	+	2	0	EMILIN2	2880859	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.188000	0.03064	0.024000	0.15214	-0.226000	0.12346	ACG		0.502	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048		Missense_Mutation
DSEL	92126	broad.mit.edu	37	18	65178448	65178448	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr18:65178448A>T	ENST00000310045.7	-	2	4901	c.3428T>A	c.(3427-3429)tTt>tAt	p.F1143Y	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1133					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.F1143Y(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TTTCTGAGGAAAATGCACAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	18											54.0	53.0	53.0					18																	65178448		2203	4300	6503	63329428	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3428T>A	18.37:g.65178448A>T	ENSP00000310565:p.Phe1143Tyr	Unknown		x	x	x	63329428	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	12.94	2.088729	0.36855	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.21932	1.98	4.79	2.2	0.27929	Sulfotransferase domain (1);	0.377447	0.24298	U	0.039750	T	0.11452	0.0279	L	0.40543	1.245	0.27984	N	0.935931	B	0.06786	0.001	B	0.13407	0.009	T	0.35724	-0.9777	10	0.02654	T	1	-6.7002	4.1187	0.10095	0.6872:0.0:0.1622:0.1506	.	1133	Q8IZU8	DSEL_HUMAN	Y	1143;1133	ENSP00000310565:F1143Y	ENSP00000310565:F1143Y	F	-	2	0	DSEL	63329428	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	1.728000	0.38105	0.785000	0.33685	0.460000	0.39030	TTT		0.388	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160		Missense_Mutation
DSEL	92126	broad.mit.edu	37	18	65181739	65181739	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr18:65181739G>A	ENST00000310045.7	-	2	1610	c.137C>T	c.(136-138)aCa>aTa	p.T46I	RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	36					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.T46I(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TATATCATCTGTGAAAACTGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	18											101.0	96.0	97.0					18																	65181739		2203	4300	6503	63332719	SO:0001583	missense	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.137C>T	18.37:g.65181739G>A	ENSP00000310565:p.Thr46Ile	Unknown		x	x	x	63332719	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.70	2.615076	0.46631	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.23950	1.88	4.87	3.99	0.46301	.	0.217217	0.36234	U	0.002717	T	0.17534	0.0421	L	0.27053	0.805	0.30691	N	0.751343	B	0.02656	0.0	B	0.04013	0.001	T	0.08046	-1.0741	10	0.42905	T	0.14	-2.5467	9.9923	0.41879	0.1782:0.0:0.8218:0.0	.	36	Q8IZU8	DSEL_HUMAN	I	46;36	ENSP00000310565:T46I	ENSP00000310565:T46I	T	-	2	0	DSEL	63332719	1.000000	0.71417	0.609000	0.28983	0.891000	0.51852	5.403000	0.66338	1.059000	0.40554	0.561000	0.74099	ACA		0.333	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160		Missense_Mutation
PIP5K1C	23396	broad.mit.edu	37	19	3645970	3645970	+	Splice_Site	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr19:3645970A>G	ENST00000335312.3	-	11	1434		c.e11+1		PIP5K1C_ENST00000537021.1_Splice_Site|PIP5K1C_ENST00000589578.1_Splice_Site|PIP5K1C_ENST00000539785.1_Splice_Site	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma						actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.?(1)		large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CAGGTGGCTTACAGGAGTTCT	0.647																																					Esophageal Squamous(135;99 1744 12852 27186 39851)											1	Unknown(1)	ovary(1)	19											65.0	69.0	68.0					19																	3645970		2202	4300	6502	3596970	SO:0001630	splice_region_variant	23396			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1345+1T>C	19.37:g.3645970A>G		Unknown		x	x	x	3596970	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Splice_Site_SNP	SNP	ENST00000335312.3	37	CCDS32872.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	a	17.13	3.310318	0.60414	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7144	0.57107	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIP5K1C	3596970	1.000000	0.71417	0.995000	0.50966	0.602000	0.36980	9.053000	0.93860	1.670000	0.50864	0.255000	0.18592	.		0.647	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	Intron	Splice_Site_SNP
PLEKHF1	79156	broad.mit.edu	37	19	30165158	30165158	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr19:30165158G>A	ENST00000436066.3	+	2	878	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	PLEKHF1_ENST00000592810.1_Missense_Mutation_p.G138S	NM_024310.4	NP_077286.3	Q96S99	PKHF1_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 1	138					apoptotic process (GO:0006915)|endosome organization (GO:0007032)|positive regulation of autophagy (GO:0010508)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein localization to plasma membrane (GO:0072659)|vesicle organization (GO:0016050)	endosome membrane (GO:0010008)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.G138S(1)		breast(1)|lung(3)|ovary(1)|prostate(1)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			GAGGGCCACGGGCCGCCCGCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											23.0	26.0	25.0					19																	30165158		2199	4295	6494	34856998	SO:0001583	missense	79156			AF434818	CCDS12417.1	19q11	2013-01-10				ENSG00000166289		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20764	protein-coding gene	gene with protein product		615200					Standard	NM_024310		Approved	APPD, MGC4090, PHAFIN1, ZFYVE15	uc002nsh.4	Q96S99		ENST00000436066.3:c.412G>A	19.37:g.30165158G>A	ENSP00000389787:p.Gly138Ser	Unknown		x	x	x	34856998	Q96K11|Q9BUB9	Missense_Mutation	SNP	ENST00000436066.3	37	CCDS12417.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	16.78	3.219041	0.58560	.	.	ENSG00000166289	ENST00000436066	T	0.70749	-0.51	4.96	4.96	0.65561	.	0.052090	0.85682	D	0.000000	T	0.73830	0.3637	M	0.68317	2.08	0.58432	D	0.999998	P;P	0.46784	0.589;0.884	B;P	0.45232	0.223;0.474	T	0.78700	-0.2102	10	0.66056	D	0.02	5.4111	17.1795	0.86851	0.0:0.0:1.0:0.0	.	223;138	B4DWN9;Q96S99	.;PKHF1_HUMAN	S	138	ENSP00000389787:G138S	ENSP00000389787:G138S	G	+	1	0	PLEKHF1	34856998	1.000000	0.71417	0.998000	0.56505	0.548000	0.35241	5.266000	0.65525	2.287000	0.76781	0.462000	0.41574	GGC		0.682	PLEKHF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459323.1	NM_024310		Missense_Mutation
ACTN4	81	broad.mit.edu	37	19	39205150	39205150	+	Silent	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr19:39205150C>A	ENST00000252699.2	+	9	937	c.861C>A	c.(859-861)gtC>gtA	p.V287V	ACTN4_ENST00000390009.3_Silent_p.V68V|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	287					actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V287V(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGCTGGCTGTCAACCAAGAGA	0.617																																					Colon(168;199 1940 10254 46213 46384)											1	Substitution - coding silent(1)	ovary(1)	19											93.0	76.0	82.0					19																	39205150		2203	4300	6503	43896990	SO:0001819	synonymous_variant	81			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.861C>A	19.37:g.39205150C>A		Unknown		x	x	x	43896990	A4K467|D6PXK4|O76048	Silent	SNP	ENST00000252699.2	37	CCDS12518.1	SNP	29	Broad																																																																																				0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1			Silent
MAP4K3	8491	broad.mit.edu	37	2	39553363	39553363	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:39553363C>T	ENST00000263881.3	-	9	910	c.586G>A	c.(586-588)Gat>Aat	p.D196N	RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000341681.5_Missense_Mutation_p.D196N|MAP4K3_ENST00000536018.1_5'Flank|MAP4K3_ENST00000437545.1_Missense_Mutation_p.D133N	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.D196N(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GCCCAGAGATCACAGAGTTGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	123.0	122.0					2																	39553363		2203	4300	6503	39406867	SO:0001583	missense	8491			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.586G>A	2.37:g.39553363C>T	ENSP00000263881:p.Asp196Asn	Unknown		x	x	x	39406867	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	CCDS1803.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.793501	0.96952	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.75154	-0.91;0.73;-0.91	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93552	0.7942	H	0.99863	4.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96382	0.9282	9	.	.	.	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	196;196	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	N	196;133;196	ENSP00000263881:D196N;ENSP00000416958:D133N;ENSP00000345434:D196N	.	D	-	1	0	MAP4K3	39406867	1.000000	0.71417	0.994000	0.49952	0.945000	0.59286	7.631000	0.83237	2.668000	0.90789	0.585000	0.79938	GAT		0.418	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		Missense_Mutation
C2orf78	388960	broad.mit.edu	37	2	74042850	74042850	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:74042850G>C	ENST00000409561.1	+	3	1621	c.1500G>C	c.(1498-1500)agG>agC	p.R500S		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	500								p.R470S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						ATCAAGTCAGGAAGAACAAGC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	79.0	80.0					2																	74042850		1943	4142	6085	73896358	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1500G>C	2.37:g.74042850G>C	ENSP00000387124:p.Arg500Ser	Unknown		x	x	x	73896358		Missense_Mutation	SNP	ENST00000409561.1	37	CCDS46338.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	15.37	2.814495	0.50527	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.11	3.27	0.37495	.	0.279729	0.25214	N	0.032287	T	0.43389	0.1245	M	0.75777	2.31	0.09310	N	1	P	0.47106	0.89	B	0.42738	0.396	T	0.41680	-0.9495	9	0.72032	D	0.01	-8.6865	8.4655	0.32953	0.0:0.1683:0.6571:0.1746	.	500	A6NCI8	CB078_HUMAN	S	500;470	.	ENSP00000340692:R470S	R	+	3	2	C2orf78	73896358	1.000000	0.71417	0.056000	0.19401	0.198000	0.23893	1.702000	0.37836	0.631000	0.30412	0.655000	0.94253	AGG		0.468	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474		Missense_Mutation
MALL	7851	broad.mit.edu	37	2	110845256	110845256	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:110845256T>A	ENST00000272462.2	-	3	1065	c.292A>T	c.(292-294)Acc>Tcc	p.T98S	MALL_ENST00000427178.1_Intron|MIR4436B1_ENST00000583272.1_RNA	NM_005434.4	NP_005425.1	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	98	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cholesterol homeostasis (GO:0042632)	clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)		p.T98S(1)		kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	9				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		ATGCCAGTGGTCCCGTGGTAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	2																																								110202545	SO:0001583	missense	7851			U17077	CCDS2085.1	2q13	2008-02-05			ENSG00000144063	ENSG00000144063			6818	protein-coding gene	gene with protein product		602022				9326933	Standard	NM_005434		Approved	BENE	uc002tfk.3	Q13021	OTTHUMG00000131196	ENST00000272462.2:c.292A>T	2.37:g.110845256T>A	ENSP00000272462:p.Thr98Ser	Unknown		x	x	x	110202545	B3KWR6|Q9BTU0	Missense_Mutation	SNP	ENST00000272462.2	37	CCDS2085.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	11.57	1.676833	0.29783	.	.	ENSG00000144063	ENST00000272462	T	0.25250	1.81	3.6	3.6	0.41247	Marvel (1);MARVEL-like domain (1);	0.109439	0.40554	N	0.001071	T	0.23532	0.0569	L	0.56396	1.775	0.80722	D	1	B	0.26445	0.149	B	0.27380	0.079	T	0.04229	-1.0967	10	0.26408	T	0.33	-28.5535	8.8789	0.35363	0.0:0.0:0.0:1.0	.	98	Q13021	MALL_HUMAN	S	98	ENSP00000272462:T98S	ENSP00000272462:T98S	T	-	1	0	MALL	110202545	0.594000	0.26849	0.997000	0.53966	0.329000	0.28539	0.606000	0.24194	1.417000	0.47077	0.254000	0.18369	ACC		0.493	MALL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253921.1	NM_005434		Missense_Mutation
LRP2	4036	broad.mit.edu	37	2	170063340	170063340	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1331-01	TCGA-04-1331-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:170063340A>G	ENST00000263816.3	-	39	7175	c.6890T>C	c.(6889-6891)tTg>tCg	p.L2297S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2297					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.L2297S(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GATCTTTTTCAAATTCCTATC	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											135.0	139.0	138.0					2																	170063340		2203	4300	6503	169771586	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6890T>C	2.37:g.170063340A>G	ENSP00000263816:p.Leu2297Ser	Somatic		x	x	x	169771586	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	23.3	4.402447	0.83230	.	.	ENSG00000081479	ENST00000263816	D	0.90069	-2.61	6.07	6.07	0.98685	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.93255	0.7851	M	0.64567	1.98	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.91936	0.5559	10	0.31617	T	0.26	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	2297	P98164	LRP2_HUMAN	S	2297	ENSP00000263816:L2297S	ENSP00000263816:L2297S	L	-	2	0	LRP2	169771586	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.339000	0.96797	2.326000	0.78906	0.533000	0.62120	TTG		0.413	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
LRP2	4036	broad.mit.edu	37	2	170147490	170147490	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:170147490C>T	ENST00000263816.3	-	8	1072	c.787G>A	c.(787-789)Gtt>Att	p.V263I	LRP2_ENST00000443831.1_Missense_Mutation_p.V263I	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	263					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.V263I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CATTTATGAACATCATGAGGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											110.0	108.0	109.0					2																	170147490		2203	4300	6503	169855736	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.787G>A	2.37:g.170147490C>T	ENSP00000263816:p.Val263Ile	Somatic		x	x	x	169855736	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	5.630	0.300873	0.10678	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.94376	-2.47;-3.41	3.69	-7.38	0.01407	.	1.878100	0.03031	N	0.152011	T	0.81250	0.4783	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.0;0.002	T	0.72754	-0.4198	9	.	.	.	.	1.2371	0.01955	0.3325:0.2381:0.2965:0.1328	.	263;263	E9PC35;P98164	.;LRP2_HUMAN	I	263	ENSP00000263816:V263I;ENSP00000409813:V263I	.	V	-	1	0	LRP2	169855736	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.968000	0.03817	-1.688000	0.01435	-0.274000	0.10170	GTT		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179457223	179457223	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:179457223G>A	ENST00000591111.1	-	251	54810	c.54586C>T	c.(54586-54588)Cca>Tca	p.P18196S	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P17269S|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P10897S|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P10964S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P19837S|TTN_ENST00000460472.2_Missense_Mutation_p.P10772S|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18196	Ig-like 105.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P17267S(1)|p.P10772S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACCAACTGGAGTCACATCA	0.403																																																2	Substitution - Missense(2)	ovary(2)	2											289.0	267.0	274.0					2																	179457223		1898	4116	6014	179165469	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54586C>T	2.37:g.179457223G>A	ENSP00000465570:p.Pro18196Ser	Somatic		x	x	x	179165469	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	10.23	1.291667	0.23564	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47078	0.1426	N	0.25485	0.75	0.34085	D	0.660075	P;P;P;P	0.43231	0.801;0.801;0.801;0.801	B;B;B;B	0.34931	0.192;0.192;0.192;0.192	T	0.64626	-0.6363	9	0.87932	D	0	.	12.3433	0.55105	0.0:0.1344:0.7411:0.1245	.	10772;10897;10964;18196	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	17269;10772;10964;10897;10770	ENSP00000343764:P17269S;ENSP00000434586:P10772S;ENSP00000340554:P10964S;ENSP00000352154:P10897S	ENSP00000340554:P10964S	P	-	1	0	TTN	179165469	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.223000	0.58587	2.868000	0.98415	0.557000	0.71058	CCA		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
MAP2	4133	broad.mit.edu	37	2	210517994	210517994	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:210517994C>A	ENST00000360351.4	+	4	606	c.100C>A	c.(100-102)Caa>Aaa	p.Q34K	MAP2_ENST00000199940.6_Missense_Mutation_p.Q34K|MAP2_ENST00000447185.1_Missense_Mutation_p.Q34K|MAP2_ENST00000361559.4_Missense_Mutation_p.Q34K|MAP2_ENST00000392194.1_Missense_Mutation_p.Q34K	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	34					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.Q34K(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GATTAAGGATCAAGGCGGAGC	0.542																																					Pancreas(27;423 979 28787 29963)											1	Substitution - Missense(1)	ovary(1)	2											110.0	81.0	91.0					2																	210517994		2203	4300	6503	210226239	SO:0001583	missense	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.100C>A	2.37:g.210517994C>A	ENSP00000353508:p.Gln34Lys	Somatic		x	x	x	210226239	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643054	0.87859	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185	T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.45	5.45	0.79879	.	0.000000	0.53938	D	0.000043	T	0.35307	0.0927	L	0.27053	0.805	0.43868	D	0.996475	D;B;P;B;D;P	0.61080	0.988;0.135;0.891;0.034;0.989;0.801	D;B;P;B;D;B	0.75020	0.985;0.12;0.877;0.015;0.966;0.258	T	0.07233	-1.0783	10	0.51188	T	0.08	-13.6884	18.2826	0.90103	0.0:1.0:0.0:0.0	.	34;34;35;34;34;34	P11137-3;P11137-2;Q59FX9;E7EV03;P11137;Q8IUX2	.;.;.;.;MAP2_HUMAN;.	K	34	ENSP00000199940:Q34K;ENSP00000376031:Q34K;ENSP00000353508:Q34K;ENSP00000355290:Q34K;ENSP00000409969:Q34K;ENSP00000376032:Q34K;ENSP00000392164:Q34K	ENSP00000199940:Q34K	Q	+	1	0	MAP2	210226239	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.333000	0.65917	2.561000	0.86390	0.655000	0.94253	CAA		0.542	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Missense_Mutation
STK36	27148	broad.mit.edu	37	2	219559278	219559278	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:219559278G>T	ENST00000295709.3	+	21	2710	c.2431G>T	c.(2431-2433)Ggt>Tgt	p.G811C	STK36_ENST00000392105.3_Missense_Mutation_p.G811C|STK36_ENST00000392106.2_Missense_Mutation_p.G811C|STK36_ENST00000440309.1_Missense_Mutation_p.G811C	NM_015690.4	NP_056505.2			serine/threonine kinase 36									p.G811C(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GGGACAGCTTGGTCAGCAAGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	110.0	111.0					2																	219559278		2203	4300	6503	219267522	SO:0001583	missense	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2431G>T	2.37:g.219559278G>T	ENSP00000295709:p.Gly811Cys	Somatic		x	x	x	219267522		Missense_Mutation	SNP	ENST00000295709.3	37	CCDS2421.1	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.49|11.49	1.654865|1.654865	0.29425|0.29425	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309|ENST00000431040	T;T;T;T|.	0.71222|.	-0.55;-0.54;-0.55;-0.55|.	5.01|5.01	1.92|1.92	0.25849|0.25849	.|.	0.297179|.	0.24366|.	N|.	0.039148|.	T|T	0.28863|0.28863	0.0716|0.0716	N|N	0.19112|0.19112	0.55|0.55	0.31044|0.31044	N|N	0.716014|0.716014	B;B|.	0.06786|.	0.001;0.001|.	B;B|.	0.09377|.	0.004;0.001|.	T|T	0.35968|0.35968	-0.9767|-0.9767	10|6	0.46703|0.87932	T|D	0.11|0	-0.5893|-0.5893	4.071|4.071	0.09882|0.09882	0.2839:0.0:0.5159:0.2002|0.2839:0.0:0.5159:0.2002	.|.	811;811|.	Q9NRP7-2;Q9NRP7|.	.;STK36_HUMAN|.	C|F	811|4	ENSP00000295709:G811C;ENSP00000375955:G811C;ENSP00000375954:G811C;ENSP00000394095:G811C|.	ENSP00000295709:G811C|ENSP00000416372:L4F	G|L	+|+	1|3	0|2	STK36|STK36	219267522|219267522	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.442000|0.442000	0.21628|0.21628	0.661000|0.661000	0.30985|0.30985	-0.136000|-0.136000	0.14681|0.14681	GGT|TTG		0.557	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2			Missense_Mutation
NOP56	10528	broad.mit.edu	37	20	2636044	2636044	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr20:2636044C>T	ENST00000329276.5	+	6	1159	c.643C>T	c.(643-645)Cag>Tag	p.Q215*	SNORD56_ENST00000413522.1_RNA|SNORA51_ENST00000606420.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD110_ENST00000408189.1_RNA|SNORD86_ENST00000391196.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD57_ENST00000448188.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	215					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)	p.Q215*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						CCGTCTTGCCCAGTTTATTGG	0.532																																																1	Substitution - Nonsense(1)	ovary(1)	20											142.0	135.0	137.0					20																	2636044		2203	4300	6503	2584044	SO:0001587	stop_gained	10528			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.643C>T	20.37:g.2636044C>T	ENSP00000370589:p.Gln215*	Unknown		x	x	x	2584044	Q2M3T6|Q9NQ05	Nonsense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557240	0.86231	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	.	.	.	5.69	5.69	0.88448	.	0.228475	0.45361	D	0.000365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.6489	12.2785	0.54751	0.1695:0.8305:0.0:0.0	.	.	.	.	X	215;244	.	ENSP00000370589:Q215X	Q	+	1	0	NOP56	2584044	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.913000	0.56394	2.672000	0.90937	0.561000	0.74099	CAG		0.532	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392		Nonsense_Mutation
FAM83D	81610	broad.mit.edu	37	20	37580824	37580824	+	Silent	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr20:37580824C>T	ENST00000217429.4	+	4	1550	c.1509C>T	c.(1507-1509)tcC>tcT	p.S503S		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	473					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S503S(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CGAGATCTTCCAGTTTGAAGT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	20											94.0	93.0	93.0					20																	37580824		1965	4137	6102	37014238	SO:0001819	synonymous_variant	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.1509C>T	20.37:g.37580824C>T		Unknown		x	x	x	37014238	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Silent	SNP	ENST00000217429.4	37	CCDS42872.1	SNP	21	Broad																																																																																				0.488	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1			Silent
LDOC1L	84247	broad.mit.edu	37	22	44892979	44892979	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr22:44892979A>T	ENST00000341255.3	-	2	967	c.458T>A	c.(457-459)aTc>aAc	p.I153N		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	153								p.I153N(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CATGTGGGGGATAGCCCACTT	0.622																																																1	Substitution - Missense(1)	ovary(1)	22											44.0	45.0	45.0					22																	44892979		2203	4300	6503	43271643	SO:0001583	missense	84247			CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.458T>A	22.37:g.44892979A>T	ENSP00000340434:p.Ile153Asn	Unknown		x	x	x	43271643	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	18.82	3.704870	0.68615	.	.	ENSG00000188636	ENST00000341255	T	0.18657	2.2	3.27	3.27	0.37495	.	0.143577	0.30383	N	0.009745	T	0.25195	0.0612	L	0.27053	0.805	0.32314	N	0.563288	D	0.69078	0.997	D	0.71414	0.973	T	0.09930	-1.0652	10	0.16896	T	0.51	-20.4448	8.2789	0.31889	1.0:0.0:0.0:0.0	.	153	Q6ICC9	LDOCL_HUMAN	N	153	ENSP00000340434:I153N	ENSP00000340434:I153N	I	-	2	0	LDOC1L	43271643	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	2.078000	0.41567	1.737000	0.51674	0.482000	0.46254	ATC		0.622	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287		Missense_Mutation
BRPF1	7862	broad.mit.edu	37	3	9782526	9782526	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:9782526C>G	ENST00000457855.1	+	3	1634	c.1623C>G	c.(1621-1623)caC>caG	p.H541Q	BRPF1_ENST00000424362.1_Missense_Mutation_p.H541Q|BRPF1_ENST00000302054.3_Missense_Mutation_p.H541Q|BRPF1_ENST00000383829.2_Missense_Mutation_p.H541Q|BRPF1_ENST00000433861.2_Missense_Mutation_p.H541Q			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	541	Interaction with MEAF6 and ING5.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H541Q(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AGAGGCTGCACAGCTACTGGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											85.0	74.0	78.0					3																	9782526		2203	4300	6503	9757526	SO:0001583	missense	7862			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1623C>G	3.37:g.9782526C>G	ENSP00000410210:p.His541Gln	Unknown		x	x	x	9757526	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855714	0.51376	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.16743	2.33;2.32;3.72;2.33;2.33	5.74	4.86	0.63082	.	0.093789	0.85682	D	0.000000	T	0.20414	0.0491	L	0.52823	1.66	0.80722	D	1	B;B;B;B	0.32324	0.364;0.198;0.198;0.249	B;B;B;B	0.36922	0.236;0.171;0.176;0.186	T	0.02533	-1.1145	10	0.29301	T	0.29	.	13.03	0.58837	0.0:0.865:0.0:0.135	.	541;541;541;541	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	Q	541	ENSP00000402485:H541Q;ENSP00000398863:H541Q;ENSP00000373340:H541Q;ENSP00000306297:H541Q;ENSP00000410210:H541Q	ENSP00000306297:H541Q	H	+	3	2	BRPF1	9757526	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.999000	0.29757	1.403000	0.46800	0.650000	0.86243	CAC		0.537	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694		Missense_Mutation
WNT7A	7476	broad.mit.edu	37	3	13896086	13896086	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:13896086C>A	ENST00000285018.4	-	3	817	c.513G>T	c.(511-513)gaG>gaT	p.E171D		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	171					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.E171D(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TCTGCTTGATCTCCCGGGCAT	0.632																																																1	Substitution - Missense(1)	ovary(1)	3											115.0	127.0	123.0					3																	13896086		2203	4300	6503	13871087	SO:0001583	missense	7476			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.513G>T	3.37:g.13896086C>A	ENSP00000285018:p.Glu171Asp	Unknown		x	x	x	13871087	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	CCDS2616.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273519	0.80580	.	.	ENSG00000154764	ENST00000285018	T	0.78481	-1.18	5.11	3.28	0.37604	.	0.000000	0.85682	D	0.000000	D	0.86112	0.5855	M	0.80332	2.49	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86688	0.1921	10	0.87932	D	0	.	9.2472	0.37534	0.0:0.7918:0.0:0.2082	.	171	O00755	WNT7A_HUMAN	D	171	ENSP00000285018:E171D	ENSP00000285018:E171D	E	-	3	2	WNT7A	13871087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.339000	0.33885	2.386000	0.81285	0.561000	0.74099	GAG		0.632	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625		Missense_Mutation
CSRNP1	64651	broad.mit.edu	37	3	39185371	39185371	+	Silent	SNP	A	A	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:39185371A>T	ENST00000273153.5	-	5	1122	c.945T>A	c.(943-945)ccT>ccA	p.P315P	CSRNP1_ENST00000514182.1_Silent_p.P315P	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	315					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P315P(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						TGCCCTGGGCAGGGGCCTCCA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	3											34.0	35.0	35.0					3																	39185371		2203	4300	6503	39160375	SO:0001819	synonymous_variant	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.945T>A	3.37:g.39185371A>T		Unknown		x	x	x	39160375	Q69YY5	Silent	SNP	ENST00000273153.5	37	CCDS2682.1	SNP	7	Broad																																																																																				0.592	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027		Silent
RRP9	9136	broad.mit.edu	37	3	51975463	51975463	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:51975463C>A	ENST00000232888.6	-	2	205	c.132G>T	c.(130-132)aaG>aaT	p.K44N	PARP3_ENST00000398755.3_5'Flank|PARP3_ENST00000417220.2_5'Flank|PARP3_ENST00000431474.1_5'Flank	NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	44					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.K44N(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CCTCATTCATCTTGCCGCCAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											135.0	129.0	131.0					3																	51975463		2203	4300	6503	51950503	SO:0001583	missense	9136			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.132G>T	3.37:g.51975463C>A	ENSP00000232888:p.Lys44Asn	Unknown		x	x	x	51950503	B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	CCDS2837.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452403	0.43531	.	.	ENSG00000114767	ENST00000232888	T	0.52983	0.64	5.83	3.03	0.35002	.	0.199371	0.42172	D	0.000759	T	0.33818	0.0876	N	0.24115	0.695	0.41825	D	0.990046	B	0.29301	0.241	B	0.33454	0.164	T	0.05517	-1.0880	10	0.30078	T	0.28	-19.3197	11.1163	0.48262	0.0:0.7713:0.0:0.2287	.	44	O43818	U3IP2_HUMAN	N	44	ENSP00000232888:K44N	ENSP00000232888:K44N	K	-	3	2	RRP9	51950503	0.997000	0.39634	0.989000	0.46669	0.509000	0.34042	0.914000	0.28624	0.092000	0.17331	-1.134000	0.01955	AAG		0.552	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704		Missense_Mutation
CPOX	1371	broad.mit.edu	37	3	98309879	98309879	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:98309879C>A	ENST00000264193.2	-	2	895	c.677G>T	c.(676-678)gGa>gTa	p.G226V		NM_000097.5	NP_000088.3	P36551	HEM6_HUMAN	coproporphyrinogen oxidase	226					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to arsenic-containing substance (GO:0046685)|response to insecticide (GO:0017085)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to methylmercury (GO:0051597)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	coproporphyrinogen oxidase activity (GO:0004109)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)	p.G226V(1)		endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CAGAACTTTTCCTCTGCTTCT	0.373																																					Esophageal Squamous(75;7 1223 22300 43648 48951)											1	Substitution - Missense(1)	ovary(1)	3											119.0	117.0	118.0					3																	98309879		2203	4300	6503	99792569	SO:0001583	missense	1371			BC017210	CCDS2932.1	3q12	2012-10-02		2004-01-30		ENSG00000080819	1.3.3.3		2321	protein-coding gene	gene with protein product	"""coproporphyria"""	612732	"""coproporphyrinogen oxidase (coproporphyria, harderoporphyria)"""	CPO		7757079, 8407975	Standard	NM_000097		Approved	CPX, HCP	uc003dsx.3	P36551		ENST00000264193.2:c.677G>T	3.37:g.98309879C>A	ENSP00000264193:p.Gly226Val	Somatic		x	x	x	99792569	A8K275|B4DSD5|Q14060|Q53F08|Q8IZ45|Q96AF3	Missense_Mutation	SNP	ENST00000264193.2	37	CCDS2932.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.9	4.465898	0.84425	.	.	ENSG00000080819	ENST00000264193	D	0.93366	-3.21	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.97291	0.9114	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	D	0.97887	1.0295	10	0.87932	D	0	-14.7043	17.0268	0.86450	0.0:1.0:0.0:0.0	.	226;226	B4DSD5;P36551	.;HEM6_HUMAN	V	226	ENSP00000264193:G226V	ENSP00000264193:G226V	G	-	2	0	CPOX	99792569	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.550000	0.67268	2.692000	0.91855	0.655000	0.94253	GGA		0.373	CPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358900.1	NM_000097		Missense_Mutation
MYLK	4638	broad.mit.edu	37	3	123427616	123427616	+	Missense_Mutation	SNP	G	G	A	rs368417112		TCGA-04-1331-01	TCGA-04-1331-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:123427616G>A	ENST00000475616.1	-	12	2068	c.2069C>T	c.(2068-2070)aCg>aTg	p.T690M	MYLK_ENST00000346322.5_Missense_Mutation_p.T621M|MYLK_ENST00000360772.3_Missense_Mutation_p.T690M|MYLK_ENST00000360304.3_Missense_Mutation_p.T690M|MYLK_ENST00000359169.1_Missense_Mutation_p.T690M			Q15746	MYLK_HUMAN	myosin light chain kinase	690	Ig-like C2-type 5.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.T690M(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GTACGTGCCCGTGTCCTCCGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	3						G	MET/THR,MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	96.0	90.0	92.0		2069,1862,2069,1862	3.4	1.0	3		92	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	MYLK	NM_053025.3,NM_053026.3,NM_053027.3,NM_053028.3	81,81,81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	690/1915,621/1846,690/1864,621/1795	123427616	1,13005	2203	4300	6503	124910306	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2069C>T	3.37:g.123427616G>A	ENSP00000418335:p.Thr690Met	Somatic		x	x	x	124910306	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849001	0.71603	0.0	1.16E-4	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	4.29	3.41	0.39046	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69797	0.3151	L	0.41710	1.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.996;0.975;0.996;0.991;0.998	T	0.70714	-0.4796	9	0.54805	T	0.06	.	12.3709	0.55254	0.0826:0.0:0.9174:0.0	.	690;621;690;621;690	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	M	690;690;690;621;690	ENSP00000354004:T690M;ENSP00000353452:T690M;ENSP00000352088:T690M;ENSP00000320622:T621M;ENSP00000418335:T690M	ENSP00000320622:T621M	T	-	2	0	MYLK	124910306	1.000000	0.71417	0.979000	0.43373	0.775000	0.43874	5.389000	0.66255	1.128000	0.42052	0.655000	0.94253	ACG		0.587	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025		Missense_Mutation
AMOTL2	51421	broad.mit.edu	37	3	134086487	134086487	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:134086487C>G	ENST00000422605.2	-	3	1059	c.893G>C	c.(892-894)aGt>aCt	p.S298T	AMOTL2_ENST00000511759.1_5'Flank|AMOTL2_ENST00000513145.1_Missense_Mutation_p.S298T|AMOTL2_ENST00000249883.5_Missense_Mutation_p.S298T|AMOTL2_ENST00000514516.1_Missense_Mutation_p.S356T			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	298					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)		p.S298T(1)		endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						GGCCTGGGCACTCACTGGCCC	0.672																																																1	Substitution - Missense(1)	ovary(1)	3											31.0	34.0	33.0					3																	134086487		2203	4300	6503	135569177	SO:0001583	missense	51421			AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.893G>C	3.37:g.134086487C>G	ENSP00000409999:p.Ser298Thr	Unknown		x	x	x	135569177	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	ENST00000422605.2	37		SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	9.393	1.075983	0.20227	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.37	3.41	0.39046	.	1.563470	0.03426	N	0.207036	T	0.20414	0.0491	L	0.42245	1.32	0.09310	N	1	B;B;B	0.24132	0.075;0.075;0.098	B;B;B	0.19391	0.017;0.017;0.025	T	0.30736	-0.9968	10	0.13108	T	0.6	-2.9386	9.8339	0.40958	0.0:0.6994:0.2162:0.0843	.	298;298;356	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	T	298;298;356;298	ENSP00000249883:S298T;ENSP00000409999:S298T;ENSP00000424765:S356T;ENSP00000425475:S298T	ENSP00000249883:S298T	S	-	2	0	AMOTL2	135569177	0.000000	0.05858	0.012000	0.15200	0.742000	0.42306	0.225000	0.17757	1.384000	0.46424	0.462000	0.41574	AGT		0.672	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358149.1	NM_016201		Missense_Mutation
TBL1XR1	79718	broad.mit.edu	37	3	176769438	176769438	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr3:176769438G>C	ENST00000430069.1	-	5	540	c.281C>G	c.(280-282)aCa>aGa	p.T94R	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.T94R			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	94					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.T94R(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TTGTTGTCTTGTTTGTACTAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	62.0	65.0					3																	176769438		1879	4105	5984	178252132	SO:0001583	missense	79718			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.281C>G	3.37:g.176769438G>C	ENSP00000405574:p.Thr94Arg	Unknown		x	x	x	178252132	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	ENST00000430069.1	37	CCDS46961.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489162	0.44249	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758;ENST00000428970;ENST00000424913;ENST00000352800;ENST00000437738;ENST00000431421;ENST00000450267;ENST00000431674	T;T	0.51817	0.69;0.69	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.44540	0.1298	L	0.50333	1.59	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.30268	-0.9984	10	0.18710	T	0.47	-26.9563	18.4353	0.90643	0.0:0.0:1.0:0.0	.	94	Q9BZK7	TBL1R_HUMAN	R	94;94;7;7;7;94;94;7;94;94	ENSP00000405574:T94R;ENSP00000413251:T94R	ENSP00000263964:T94R	T	-	2	0	TBL1XR1	178252132	1.000000	0.71417	0.373000	0.26003	0.930000	0.56654	9.476000	0.97823	2.609000	0.88269	0.557000	0.71058	ACA		0.473	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665		Missense_Mutation
SORCS2	57537	broad.mit.edu	37	4	7716082	7716082	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr4:7716082G>A	ENST00000507866.2	+	16	2214	c.2105G>A	c.(2104-2106)cGg>cAg	p.R702Q	SORCS2_ENST00000329016.9_Missense_Mutation_p.R530Q	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	702					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.R552Q(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TGCGAGTGCCGGGACTCGGAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	4											28.0	34.0	32.0					4																	7716082		2086	4191	6277	7766982	SO:0001583	missense	57537			AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2105G>A	4.37:g.7716082G>A	ENSP00000422185:p.Arg702Gln	Unknown		x	x	x	7766982	Q9P2L7	Missense_Mutation	SNP	ENST00000507866.2	37	CCDS47008.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524414	0.27299	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.13657	2.57;2.58	4.01	3.12	0.35913	VPS10 (1);	0.461490	0.20530	N	0.090528	T	0.08758	0.0217	L	0.43152	1.355	0.09310	N	1	P;P	0.48089	0.716;0.905	B;B	0.26693	0.05;0.072	T	0.34527	-0.9825	10	0.66056	D	0.02	.	10.7191	0.46030	0.0:0.2022:0.6755:0.1223	.	530;702	B5MED8;Q96PQ0	.;SORC2_HUMAN	Q	702;530	ENSP00000422185:R702Q;ENSP00000329124:R530Q	ENSP00000329124:R530Q	R	+	2	0	SORCS2	7766982	0.895000	0.30542	0.840000	0.33206	0.427000	0.31564	1.349000	0.33998	2.053000	0.61076	0.655000	0.94253	CGG		0.632	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777		Missense_Mutation
KIAA1109	84162	broad.mit.edu	37	4	123280783	123280783	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr4:123280783T>C	ENST00000264501.4	+	85	15080	c.14707T>C	c.(14707-14709)Tcc>Ccc	p.S4903P	KIAA1109_ENST00000388738.3_Missense_Mutation_p.S4903P			Q2LD37	K1109_HUMAN	KIAA1109	4903					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S4903P(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGACGACAATTCCTCTGATAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	4											127.0	114.0	118.0					4																	123280783		1850	4087	5937	123500233	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14707T>C	4.37:g.123280783T>C	ENSP00000264501:p.Ser4903Pro	Unknown		x	x	x	123500233	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	22.8	4.339840	0.81911	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.47177	0.85;0.85;0.85	5.57	4.4	0.53042	Fragile site-associated protein, C-terminal (1);	0.058425	0.64402	D	0.000001	T	0.54175	0.1842	L	0.48642	1.525	0.80722	D	1	P;D	0.53462	0.95;0.96	P;P	0.56514	0.698;0.8	T	0.50466	-0.8825	10	0.38643	T	0.18	.	12.4954	0.55925	0.0:0.0:0.1516:0.8484	.	4902;4903	Q2LD37-4;Q2LD37	.;K1109_HUMAN	P	4903;4903;1572;504	ENSP00000264501:S4903P;ENSP00000373390:S4903P;ENSP00000410874:S1572P	ENSP00000264501:S4903P	S	+	1	0	KIAA1109	123500233	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.363000	0.59473	0.948000	0.37687	0.528000	0.53228	TCC		0.353	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		Missense_Mutation
PAPD7	11044	broad.mit.edu	37	5	6748679	6748679	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:6748679C>G	ENST00000230859.6	+	8	941	c.812C>G	c.(811-813)tCc>tGc	p.S271C		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	501					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)	p.S271C(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CTGGCCAGGTCCTATCCAAAC	0.547																																					NSCLC(7;212 333 5667 23379 46547)											1	Substitution - Missense(1)	ovary(1)	5											277.0	241.0	253.0					5																	6748679		2203	4300	6503	6801679	SO:0001583	missense	11044			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.812C>G	5.37:g.6748679C>G	ENSP00000230859:p.Ser271Cys	Somatic		x	x	x	6801679	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697168	0.48202	.	.	ENSG00000112941	ENST00000230859	T	0.35236	1.32	5.62	4.74	0.60224	.	0.241327	0.43416	D	0.000567	T	0.30510	0.0767	L	0.47716	1.5	0.46564	D	0.999105	B;B	0.18968	0.032;0.014	B;B	0.17098	0.017;0.017	T	0.08310	-1.0728	10	0.39692	T	0.17	-6.4797	9.2368	0.37470	0.1465:0.7816:0.0:0.0719	.	271;271	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	C	271	ENSP00000230859:S271C	ENSP00000230859:S271C	S	+	2	0	PAPD7	6801679	0.983000	0.35010	0.994000	0.49952	0.970000	0.65996	2.181000	0.42547	1.337000	0.45525	0.561000	0.74099	TCC		0.547	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999		Missense_Mutation
TRIO	7204	broad.mit.edu	37	5	14297204	14297204	+	Silent	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:14297204C>G	ENST00000344204.4	+	7	1224	c.1200C>G	c.(1198-1200)cgC>cgG	p.R400R	TRIO_ENST00000537187.1_Silent_p.R400R|TRIO_ENST00000509967.2_Silent_p.R351R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	400					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R400R(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ATATAAACCGCATCATGTCGG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	5											91.0	82.0	85.0					5																	14297204		2203	4300	6503	14350204	SO:0001819	synonymous_variant	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1200C>G	5.37:g.14297204C>G		Somatic		x	x	x	14350204	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1	SNP	25	Broad																																																																																				0.542	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		Silent
MROH2B	133558	broad.mit.edu	37	5	41049516	41049516	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:41049516G>T	ENST00000399564.4	-	14	1817	c.1367C>A	c.(1366-1368)aCt>aAt	p.T456N	MROH2B_ENST00000506092.2_Missense_Mutation_p.T11N	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	456								p.T456N(2)									TACCACAAAAGTCAGGATCCT	0.458																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											63.0	59.0	60.0					5																	41049516		1898	4125	6023	41085273	SO:0001583	missense	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1367C>A	5.37:g.41049516G>T	ENSP00000382476:p.Thr456Asn	Unknown		x	x	x	41085273	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174440	0.38413	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.66995	3.19;-0.24	5.7	4.83	0.62350	Armadillo-type fold (1);	0.000000	0.46758	D	0.000276	T	0.72542	0.3473	L	0.54323	1.7	0.33885	D	0.636657	D	0.76494	0.999	D	0.69479	0.964	T	0.73033	-0.4110	10	0.18710	T	0.47	.	9.6167	0.39696	0.0921:0.0:0.9079:0.0	.	456	Q7Z745	HTRB2_HUMAN	N	11;160;456	ENSP00000441504:T11N;ENSP00000382476:T456N	ENSP00000296803:T160N	T	-	2	0	HEATR7B2	41085273	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.269000	0.33074	2.705000	0.92388	0.650000	0.86243	ACT		0.458	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		Missense_Mutation
NDUFAF2	91942	broad.mit.edu	37	5	60241130	60241130	+	Silent	SNP	A	A	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:60241130A>T	ENST00000296597.5	+	1	175	c.48A>T	c.(46-48)tcA>tcT	p.S16S	ERCC8_ENST00000265038.5_5'Flank|ERCC8_ENST00000426742.2_5'Flank|NDUFAF2_ENST00000511107.1_Silent_p.S16S|ERCC8_ENST00000543101.1_5'Flank	NM_174889.4	NP_777549.1	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 2	16					negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)	mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.S16S(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|ovary(1)	6		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				GATCGCTGTCAAGGGAAGTGA	0.592																																																1	Substitution - coding silent(1)	ovary(1)	5											73.0	63.0	66.0					5																	60241130		2203	4296	6499	60276887	SO:0001819	synonymous_variant	91942			AB183433	CCDS3979.1	5q12.1	2012-10-12	2012-05-08	2008-02-15	ENSG00000164182	ENSG00000164182		"""Mitochondrial respiratory chain complex assembly factors"""	28086	protein-coding gene	gene with protein product	"""Myc-induced mitochondrial protein"""	609653	"""NDUFA12-like"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2"""	NDUFA12L		15774466, 16200211, 17383918	Standard	NM_174889		Approved	B17.2L, MMTN, mimitin	uc003jsp.4	Q8N183	OTTHUMG00000131221	ENST00000296597.5:c.48A>T	5.37:g.60241130A>T		Unknown		x	x	x	60276887	A8K5I1	Silent	SNP	ENST00000296597.5	37	CCDS3979.1	SNP	5	Broad																																																																																				0.592	NDUFAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253965.1	NM_174889		Silent
RAD50	10111	broad.mit.edu	37	5	131925370	131925370	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:131925370G>C	ENST00000265335.6	+	9	1680	c.1293G>C	c.(1291-1293)gaG>gaC	p.E431D	RAD50_ENST00000378823.3_Missense_Mutation_p.E292D			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	431					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.E292D(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGATAGATGAGATAAGAGATA	0.289								Homologous recombination																																								1	Substitution - Missense(1)	ovary(1)	5											55.0	58.0	57.0					5																	131925370		2203	4299	6502	131953269	SO:0001583	missense	10111			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1293G>C	5.37:g.131925370G>C	ENSP00000265335:p.Glu431Asp	Unknown		x	x	x	131953269	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068711	0.36470	.	.	ENSG00000113522	ENST00000378823;ENST00000265335;ENST00000453394	T;T;T	0.07567	3.42;3.65;3.18	5.51	-1.46	0.08800	.	0.232310	0.50627	N	0.000112	T	0.03695	0.0105	N	0.20401	0.57	0.37987	D	0.933796	B	0.13594	0.008	B	0.15052	0.012	T	0.44590	-0.9318	10	0.18710	T	0.47	-11.8195	3.5574	0.07869	0.4818:0.0:0.2072:0.311	.	431	Q92878	RAD50_HUMAN	D	292;431;431	ENSP00000368100:E292D;ENSP00000265335:E431D;ENSP00000400049:E431D	ENSP00000265335:E431D	E	+	3	2	RAD50	131953269	0.662000	0.27439	0.983000	0.44433	0.985000	0.73830	-0.064000	0.11636	-0.133000	0.11537	-0.188000	0.12872	GAG		0.289	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732		Missense_Mutation
TRPC7	57113	broad.mit.edu	37	5	135692447	135692447	+	Missense_Mutation	SNP	T	T	A	rs565522086		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:135692447T>A	ENST00000513104.1	-	2	911	c.629A>T	c.(628-630)gAc>gTc	p.D210V	TRPC7_ENST00000426057.2_Missense_Mutation_p.D210V|TRPC7_ENST00000355180.3_Missense_Mutation_p.D210V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	210					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTGAAGGAGTCTTTCCGCTG	0.602													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19986	0.0		0.0	False		,,,				2504	0.0															0			5											57.0	63.0	61.0					5																	135692447		2157	4269	6426	135720346	SO:0001583	missense	57113			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.629A>T	5.37:g.135692447T>A	ENSP00000426070:p.Asp210Val	Unknown		x	x	x	135720346	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	SNP	58	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.346766|4.346766	0.82022|0.82022	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	D;D;D|.	0.85171|.	-1.95;-1.95;-1.95|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Transient receptor potential II (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83529|0.83529	0.5274|0.5274	M|M	0.90595|0.90595	3.13|3.13	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;0.998;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.998;0.957;1.0;0.999|.	D|D	0.87004|0.87004	0.2118|0.2118	10|5	0.87932|.	D|.	0|.	-31.9821|-31.9821	15.3565|15.3565	0.74431|0.74431	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	210;210;210;210|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	V|S	210|209	ENSP00000347312:D210V;ENSP00000441628:D210V;ENSP00000426070:D210V|.	ENSP00000265193:D210V|.	D|R	-|-	2|3	0|2	TRPC7|TRPC7	135720346|135720346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.868000|7.868000	0.87116|0.87116	2.205000|2.205000	0.71048|0.71048	0.528000|0.528000	0.53228|0.53228	GAC|AGA		0.602	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389		Missense_Mutation
TCOF1	6949	broad.mit.edu	37	5	149753735	149753735	+	Splice_Site	SNP	A	A	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr5:149753735A>C	ENST00000504761.2	+	8	870		c.e8-1		TCOF1_ENST00000451292.1_Splice_Site|TCOF1_ENST00000513346.1_Splice_Site|TCOF1_ENST00000323668.7_Splice_Site|TCOF1_ENST00000377797.3_Splice_Site|TCOF1_ENST00000445265.2_Splice_Site|TCOF1_ENST00000439160.2_Splice_Site|TCOF1_ENST00000394269.3_Splice_Site			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1						skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.?(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTTTTCACCAGGTAAAGGCC	0.547																																																1	Unknown(1)	ovary(1)	5											13.0	13.0	13.0					5																	149753735		2185	4258	6443	149733928	SO:0001630	splice_region_variant	6949				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.871-1A>C	5.37:g.149753735A>C		Unknown		x	x	x	149733928	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Splice_Site_SNP	SNP	ENST00000504761.2	37	CCDS54936.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	8.784	0.928845	0.18131	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	.	.	.	4.66	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.34083	D	0.659766	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1861	0.20498	0.8893:0.0:0.1107:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TCOF1	149733928	0.989000	0.36119	0.147000	0.22382	0.027000	0.11550	3.864000	0.56024	2.030000	0.59900	0.379000	0.24179	.		0.547	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	Intron	Splice_Site_SNP
KCNK17	89822	broad.mit.edu	37	6	39272379	39272379	+	Silent	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr6:39272379G>A	ENST00000373231.4	-	3	637	c.405C>T	c.(403-405)ttC>ttT	p.F135F	KCNK17_ENST00000453413.2_Silent_p.F135F	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	135					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.F135F(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						CAAGGGCAAAGAAGATGCAGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	6											150.0	150.0	150.0					6																	39272379		2203	4300	6503	39380357	SO:0001819	synonymous_variant	89822			AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.405C>T	6.37:g.39272379G>A		Unknown		x	x	x	39380357	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Silent	SNP	ENST00000373231.4	37	CCDS4842.1	SNP	33	Broad																																																																																				0.622	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460		Silent
COL9A1	1297	broad.mit.edu	37	6	70983761	70983761	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr6:70983761G>A	ENST00000357250.6	-	12	1212	c.1054C>T	c.(1054-1056)Cgt>Tgt	p.R352C	COL9A1_ENST00000320755.7_Missense_Mutation_p.R109C|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.R109C	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	352	Collagen-like 2.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R352C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGAAATCCACGCGATCCAGGC	0.294																																																1	Substitution - Missense(1)	ovary(1)	6											53.0	56.0	55.0					6																	70983761		2203	4300	6503	71040482	SO:0001583	missense	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1054C>T	6.37:g.70983761G>A	ENSP00000349790:p.Arg352Cys	Unknown		x	x	x	71040482	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393632	0.62066	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.94537	-3.45;-3.41;-3.45	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.97820	1.0256	10	0.66056	D	0.02	.	18.1531	0.89682	0.0:0.0:1.0:0.0	.	352;109	P20849;P20849-2	CO9A1_HUMAN;.	C	352;109;109	ENSP00000349790:R352C;ENSP00000315252:R109C;ENSP00000359530:R109C	ENSP00000315252:R109C	R	-	1	0	COL9A1	71040482	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.822000	0.75277	2.885000	0.99019	0.655000	0.94253	CGT		0.294	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			Missense_Mutation
HACE1	57531	broad.mit.edu	37	6	105291160	105291160	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr6:105291160T>C	ENST00000262903.4	-	5	616	c.340A>G	c.(340-342)Atg>Gtg	p.M114V	RP11-809N15.2_ENST00000422930.2_RNA|HACE1_ENST00000369125.2_Missense_Mutation_p.M114V	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	114					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.M114V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		AATTTACTCATACATTTCTTC	0.284																																																1	Substitution - Missense(1)	ovary(1)	6											115.0	129.0	125.0					6																	105291160		2202	4297	6499	105397853	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.340A>G	6.37:g.105291160T>C	ENSP00000262903:p.Met114Val	Unknown		x	x	x	105397853	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	6.273	0.418421	0.11870	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000519645;ENST00000524020	T;T;T;T	0.57595	0.39;0.39;0.56;0.39	5.92	5.92	0.95590	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.22205	0.0535	N	0.00315	-1.66	0.80722	D	1	P;P	0.35542	0.508;0.508	P;P	0.51945	0.685;0.685	T	0.57676	-0.7770	10	0.28530	T	0.3	.	16.3604	0.83263	0.0:0.0:0.0:1.0	.	114;114	E9PGP0;Q8IYU2	.;HACE1_HUMAN	V	114;114;114;80	ENSP00000262903:M114V;ENSP00000358121:M114V;ENSP00000429765:M114V;ENSP00000427901:M80V	ENSP00000262903:M114V	M	-	1	0	HACE1	105397853	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.423000	0.80229	2.260000	0.74910	0.528000	0.53228	ATG		0.284	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		Missense_Mutation
NCOA7	135112	broad.mit.edu	37	6	126236497	126236497	+	Silent	SNP	A	A	C			TCGA-04-1331-01	TCGA-04-1331-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr6:126236497A>C	ENST00000368357.3	+	12	2467	c.2115A>C	c.(2113-2115)acA>acC	p.T705T	NCOA7_ENST00000229634.9_Silent_p.T590T|NCOA7_ENST00000392477.2_Silent_p.T705T	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	705					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.T705T(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ATTTGTACACATTCTTTGTTC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	6											218.0	184.0	196.0					6																	126236497		2203	4300	6503	126278190	SO:0001819	synonymous_variant	135112			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.2115A>C	6.37:g.126236497A>C		Somatic		x	x	x	126278190	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Silent	SNP	ENST00000368357.3	37	CCDS5132.1	SNP	8	Broad																																																																																				0.433	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748		Silent
LATS1	9113	broad.mit.edu	37	6	149983199	149983199	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr6:149983199C>G	ENST00000543571.1	-	8	3606	c.3059G>C	c.(3058-3060)aGa>aCa	p.R1020T	LATS1_ENST00000253339.5_Missense_Mutation_p.R1020T	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1									p.R1020T(1)		central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AGACTGCTGTCTCAGGTCACT	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	114.0	114.0					6																	149983199		2203	4300	6503	150024892	SO:0001583	missense	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.3059G>C	6.37:g.149983199C>G	ENSP00000437550:p.Arg1020Thr	Somatic		x	x	x	150024892		Missense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074715	0.76415	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.07567	3.18;3.18	5.6	5.6	0.85130	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.56097	D	0.000031	T	0.28896	0.0717	M	0.89163	3.01	0.80722	D	1	D	0.64830	0.994	D	0.66716	0.946	T	0.10683	-1.0619	9	.	.	.	.	19.6081	0.95588	0.0:1.0:0.0:0.0	.	1020	O95835	LATS1_HUMAN	T	1020	ENSP00000437550:R1020T;ENSP00000253339:R1020T	.	R	-	2	0	LATS1	150024892	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.442000	0.80503	2.643000	0.89663	0.591000	0.81541	AGA		0.393	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690		Missense_Mutation
KLHL7	55975	broad.mit.edu	37	7	23213826	23213826	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr7:23213826C>G	ENST00000339077.5	+	11	1913	c.1670C>G	c.(1669-1671)gCc>gGc	p.A557G	AC005082.1_ENST00000366347.4_Intron|KLHL7_ENST00000539124.1_Missense_Mutation_p.A481G|KLHL7_ENST00000545443.1_Missense_Mutation_p.A535G|KLHL7_ENST00000322231.7_Missense_Mutation_p.A535G|KLHL7_ENST00000409689.1_Missense_Mutation_p.A509G|KLHL7_ENST00000542558.1_Missense_Mutation_p.A332G	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	557					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.A535G(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAATGGGTTGCCAACTCCAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											206.0	195.0	198.0					7																	23213826		2203	4300	6503	23180351	SO:0001583	missense	55975				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.1670C>G	7.37:g.23213826C>G	ENSP00000343273:p.Ala557Gly	Unknown		x	x	x	23180351	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	37	CCDS34609.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993313	0.35131	.	.	ENSG00000122550	ENST00000538858;ENST00000322231;ENST00000339077;ENST00000539124;ENST00000542558;ENST00000409689;ENST00000545443	T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.62	5.62	0.85841	Kelch-type beta propeller (1);	0.099254	0.64402	D	0.000001	T	0.59555	0.2202	L	0.29908	0.895	0.50632	D	0.999886	B;B;B	0.11235	0.0;0.004;0.002	B;B;B	0.15052	0.001;0.005;0.012	T	0.54002	-0.8358	10	0.51188	T	0.08	.	19.6528	0.95823	0.0:1.0:0.0:0.0	.	332;557;535	B7Z3P9;Q8IXQ5;Q8IXQ5-2	.;KLHL7_HUMAN;.	G	398;535;557;481;332;509;535	ENSP00000322958:A535G;ENSP00000343273:A557G;ENSP00000441136:A481G;ENSP00000442367:A332G;ENSP00000386263:A509G;ENSP00000442366:A535G	ENSP00000322958:A535G	A	+	2	0	KLHL7	23180351	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.359000	0.66074	2.646000	0.89796	0.655000	0.94253	GCC		0.408	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846		Missense_Mutation
TNS3	64759	broad.mit.edu	37	7	47342861	47342861	+	Silent	SNP	T	T	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr7:47342861T>A	ENST00000398879.1	-	22	3510	c.3144A>T	c.(3142-3144)tcA>tcT	p.S1048S	TNS3_ENST00000311160.9_Silent_p.S1048S|TNS3_ENST00000355730.3_Silent_p.S808S			Q68CZ2	TENS3_HUMAN	tensin 3	1048					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S1048S(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TGGGGGTCGGTGACGCTCCAT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	7											17.0	21.0	20.0					7																	47342861		2033	4170	6203	47309386	SO:0001819	synonymous_variant	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3144A>T	7.37:g.47342861T>A		Unknown		x	x	x	47309386	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	ENST00000398879.1	37	CCDS5506.2	SNP	59	Broad																																																																																				0.667	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748		Silent
PCLO	27445	broad.mit.edu	37	7	82544341	82544341	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr7:82544341C>T	ENST00000333891.9	-	7	13298	c.12961G>A	c.(12961-12963)Gct>Act	p.A4321T	PCLO_ENST00000423517.2_Missense_Mutation_p.A4321T|PCLO_ENST00000437081.1_Missense_Mutation_p.A1041T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.A4321T(3)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGAGCTTCAGCCTCTTGAGCT	0.438																																																3	Substitution - Missense(3)	endometrium(2)|ovary(1)	7											62.0	60.0	60.0					7																	82544341		1883	4106	5989	82382277	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12961G>A	7.37:g.82544341C>T	ENSP00000334319:p.Ala4321Thr	Unknown		x	x	x	82382277		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	8.512	0.866643	0.17250	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16457	2.34;2.35	5.79	5.79	0.91817	.	.	.	.	.	T	0.15955	0.0384	L	0.43152	1.355	0.39537	D	0.968764	B;B;B	0.28783	0.024;0.222;0.222	B;B;B	0.27715	0.005;0.082;0.082	T	0.03423	-1.1038	9	0.87932	D	0	.	9.7593	0.40522	0.0:0.7861:0.1415:0.0724	.	4252;4321;4321	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	T	4321;4321;1041	ENSP00000334319:A4321T;ENSP00000388393:A4321T	ENSP00000334319:A4321T	A	-	1	0	PCLO	82382277	0.945000	0.32115	0.998000	0.56505	0.997000	0.91878	2.111000	0.41883	2.753000	0.94483	0.557000	0.71058	GCT		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		Missense_Mutation
ABCB8	11194	broad.mit.edu	37	7	150730931	150730931	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr7:150730931G>A	ENST00000297504.6	+	3	452	c.386G>A	c.(385-387)gGg>gAg	p.G129E	ABCB8_ENST00000542328.1_Intron|ABCB8_ENST00000477719.1_Missense_Mutation_p.G112E|ABCB8_ENST00000477092.1_Missense_Mutation_p.G112E|ABCB8_ENST00000493338.1_3'UTR|ABCB8_ENST00000498578.1_Missense_Mutation_p.G112E|ABCB8_ENST00000358849.4_Missense_Mutation_p.G112E|ABCB8_ENST00000356058.4_Missense_Mutation_p.G149E			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	129					transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.G112E(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CATGTCGTGGGGTCTCGCTTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											71.0	63.0	66.0					7																	150730931		2203	4300	6503	150361864	SO:0001583	missense	11194			AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.386G>A	7.37:g.150730931G>A	ENSP00000297504:p.Gly129Glu	Unknown		x	x	x	150361864	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.806034	0.00606	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	D;D;D;D;D;D	0.89485	-2.41;-2.41;-2.52;-1.73;-1.69;-1.7	4.07	2.93	0.34026	ABC transporter, transmembrane domain, type 1 (1);	0.623384	0.16656	N	0.205003	T	0.67107	0.2858	N	0.02916	-0.46	0.29913	N	0.823367	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.001;0.001;0.001	T	0.59279	-0.7484	10	0.02654	T	1	-0.3662	5.2534	0.15534	0.759:0.0:0.241:0.0	.	112;129;112;112;149	A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.;ABCB8_HUMAN;.;.;.	E	112;95;129;112;149;112;112	ENSP00000351717:G112E;ENSP00000297504:G129E;ENSP00000418271:G112E;ENSP00000348353:G149E;ENSP00000419891:G112E;ENSP00000419558:G112E	ENSP00000297504:G129E	G	+	2	0	ABCB8	150361864	1.000000	0.71417	0.178000	0.23040	0.251000	0.25915	1.744000	0.38268	0.738000	0.32606	-0.367000	0.07326	GGG		0.612	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188		Missense_Mutation
LONRF1	91694	broad.mit.edu	37	8	12594483	12594483	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr8:12594483T>G	ENST00000398246.3	-	5	1349	c.1280A>C	c.(1279-1281)aAa>aCa	p.K427T	LONRF1_ENST00000533751.1_Missense_Mutation_p.K70T|LONRF1_ENST00000530693.1_5'Flank	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	427							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		CAACTTTCTTTTCAGCAGAAC	0.353																																																0			8											95.0	84.0	87.0					8																	12594483		1829	4087	5916	12638854	SO:0001583	missense	91694			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1280A>C	8.37:g.12594483T>G	ENSP00000381298:p.Lys427Thr	Unknown		x	x	x	12638854	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	26.4	4.732137	0.89390	.	.	ENSG00000154359	ENST00000398246;ENST00000533751;ENST00000524526	D;T;D	0.86627	-2.15;-1.45;-1.54	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.89619	0.6767	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.90894	0.4763	10	0.66056	D	0.02	-24.9709	15.7668	0.78131	0.0:0.0:0.0:1.0	.	427;427	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	T	427;70;41	ENSP00000381298:K427T;ENSP00000432130:K70T;ENSP00000433327:K41T	ENSP00000381298:K427T	K	-	2	0	LONRF1	12638854	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.539000	0.60657	2.266000	0.75297	0.533000	0.62120	AAA		0.353	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271		Missense_Mutation
DOCK5	80005	broad.mit.edu	37	8	25198465	25198465	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1331-01	TCGA-04-1331-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr8:25198465G>T	ENST00000276440.7	+	23	2444	c.2400G>T	c.(2398-2400)atG>atT	p.M800I		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	800					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.M800I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTTTCAATATGCTGATGGACA	0.438																																					Pancreas(145;34 1887 3271 10937 30165)											1	Substitution - Missense(1)	ovary(1)	8											71.0	67.0	69.0					8																	25198465		2203	4300	6503	25254382	SO:0001583	missense	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2400G>T	8.37:g.25198465G>T	ENSP00000276440:p.Met800Ile	Somatic		x	x	x	25254382	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	SNP	46	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.020|5.020	0.189326|0.189326	0.09547|0.09547	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000444569|ENST00000276440	.|T	.|0.18960	.|2.18	4.99|4.99	-3.09|-3.09	0.05331|0.05331	.|Armadillo-type fold (1);	.|0.895719	.|0.09915	.|N	.|0.739277	T|T	0.06371|0.06371	0.0164|0.0164	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.32851|0.32851	-0.9891|-0.9891	5|10	.|0.30854	.|T	.|0.27	.|.	0.9033|0.9033	0.01279|0.01279	0.4215:0.1667:0.206:0.2058|0.4215:0.1667:0.206:0.2058	.|.	.|790;575;800	.|D3DSS6;Q68DL4;Q9H7D0	.|.;.;DOCK5_HUMAN	S|I	572|800	.|ENSP00000276440:M800I	.|ENSP00000276440:M800I	A|M	+|+	1|3	0|0	DOCK5|DOCK5	25254382|25254382	0.001000|0.001000	0.12720|0.12720	0.070000|0.070000	0.20053|0.20053	0.224000|0.224000	0.24922|0.24922	-0.127000|-0.127000	0.10547|0.10547	-0.252000|-0.252000	0.09528|0.09528	-0.808000|-0.808000	0.03180|0.03180	GCT|ATG		0.438	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940		Missense_Mutation
COL15A1	1306	broad.mit.edu	37	9	101747856	101747856	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr9:101747856C>T	ENST00000375001.3	+	3	533	c.110C>T	c.(109-111)tCc>tTc	p.S37F		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	37					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.S37F(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GAGACTGCTTCCCAGGGTCAC	0.552																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	9											56.0	54.0	55.0					9																	101747856		2203	4300	6503	100787677	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.110C>T	9.37:g.101747856C>T	ENSP00000364140:p.Ser37Phe	Unknown		x	x	x	100787677	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392531	0.42410	.	.	ENSG00000204291	ENST00000375001	D	0.90900	-2.75	5.11	5.11	0.69529	.	1.458950	0.03909	N	0.281524	D	0.92635	0.7660	L	0.29908	0.895	0.33137	D	0.54385	D	0.69078	0.997	P	0.59012	0.85	D	0.85616	0.1261	10	0.45353	T	0.12	-18.7942	16.3839	0.83495	0.0:1.0:0.0:0.0	.	37	P39059	COFA1_HUMAN	F	37	ENSP00000364140:S37F	ENSP00000364140:S37F	S	+	2	0	COL15A1	100787677	0.744000	0.28250	0.994000	0.49952	0.774000	0.43823	4.610000	0.61155	2.521000	0.84997	0.650000	0.86243	TCC		0.552	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		Missense_Mutation
FAM166A	401565	broad.mit.edu	37	9	140139863	140139863	+	Missense_Mutation	SNP	G	G	C	rs375372931		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr9:140139863G>C	ENST00000344774.4	-	3	472	c.418C>G	c.(418-420)Cca>Gca	p.P140A	FAM166A_ENST00000388932.2_Missense_Mutation_p.P140A	NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	140						nucleus (GO:0005634)		p.P140A(1)		kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						CTGCCTGGTGGGCACGGAGGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	9											76.0	85.0	82.0					9																	140139863		2203	4300	6503	139259684	SO:0001583	missense	401565			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.418C>G	9.37:g.140139863G>C	ENSP00000344729:p.Pro140Ala	Unknown		x	x	x	139259684	A6NND9|Q8N830	Missense_Mutation	SNP	ENST00000344774.4	37	CCDS35186.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	6.975	0.549884	0.13374	.	.	ENSG00000188163	ENST00000344774;ENST00000388932;ENST00000484720	.	.	.	5.23	4.33	0.51752	.	0.225560	0.36482	N	0.002580	T	0.39279	0.1072	M	0.62723	1.935	0.33691	D	0.613271	P	0.42908	0.793	B	0.38842	0.283	T	0.49881	-0.8892	9	0.07175	T	0.84	-8.9357	10.878	0.46923	0.0889:0.0:0.9111:0.0	.	140	Q6J272	F166A_HUMAN	A	140;140;167	.	ENSP00000344729:P140A	P	-	1	0	FAM166A	139259684	0.954000	0.32549	0.973000	0.42090	0.096000	0.18686	2.055000	0.41345	1.203000	0.43233	0.561000	0.74099	CCA		0.647	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356125.1	NM_001001710		Missense_Mutation
FAM47C	442444	broad.mit.edu	37	X	37028941	37028941	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:37028941G>A	ENST00000358047.3	+	1	2510	c.2458G>A	c.(2458-2460)Gga>Aga	p.G820R		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	820								p.G820R(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TACCAAGACCGGAGCGTCCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											62.0	61.0	61.0					X																	37028941		2202	4300	6502	36938862	SO:0001583	missense	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2458G>A	X.37:g.37028941G>A	ENSP00000367913:p.Gly820Arg	Unknown		x	x	x	36938862	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	1.187	-0.636355	0.03557	.	.	ENSG00000198173	ENST00000358047	T	0.12879	2.64	0.14	0.14	0.14804	.	.	.	.	.	T	0.04452	0.0122	N	0.05383	-0.06	0.09310	N	1	P	0.44139	0.827	B	0.34452	0.183	T	0.34976	-0.9807	8	0.13853	T	0.58	.	.	.	.	.	820	Q5HY64	FA47C_HUMAN	R	820	ENSP00000367913:G820R	ENSP00000367913:G820R	G	+	1	0	FAM47C	36938862	0.019000	0.18553	0.005000	0.12908	0.005000	0.04900	-0.349000	0.07731	0.168000	0.19655	0.169000	0.16792	GGA		0.552	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		Missense_Mutation
KDM5C	8242	broad.mit.edu	37	X	53226114	53226114	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:53226114C>T	ENST00000375401.3	-	19	3267	c.2735G>A	c.(2734-2736)gGg>gAg	p.G912E	KDM5C_ENST00000404049.3_Missense_Mutation_p.G911E|KDM5C_ENST00000375379.3_Missense_Mutation_p.G912E|KDM5C_ENST00000452825.3_Missense_Mutation_p.G845E|KDM5C_ENST00000375383.3_Missense_Mutation_p.G871E	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	912					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.G912E(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CACCTCCACCCCCAGCTGCCG	0.692			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	1	Substitution - Missense(1)	ovary(1)	X											23.0	20.0	21.0					X																	53226114		2198	4288	6486	53242839	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2735G>A	X.37:g.53226114C>T	ENSP00000364550:p.Gly912Glu	Somatic		x	x	x	53242839	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.46	1.946057	0.34377	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.44	4.44	0.53790	Lysine-specific demethylase-like domain (1);	0.277555	0.33854	U	0.004481	T	0.41050	0.1142	M	0.65975	2.015	0.19575	N	0.999961	B;B;B	0.33345	0.409;0.254;0.146	B;B;B	0.36186	0.211;0.219;0.219	T	0.31223	-0.9951	10	0.30078	T	0.28	-5.6249	9.9425	0.41589	0.0:0.7972:0.2028:0.0	.	845;911;912	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	E	845;912;911;912;871	ENSP00000445176:G845E;ENSP00000364550:G912E;ENSP00000385394:G911E;ENSP00000364528:G912E;ENSP00000364532:G871E	ENSP00000364528:G912E	G	-	2	0	KDM5C	53242839	0.211000	0.23529	0.965000	0.40720	0.995000	0.86356	2.058000	0.41374	1.821000	0.53095	0.594000	0.82650	GGG		0.692	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187		Missense_Mutation
FGD1	2245	broad.mit.edu	37	X	54473872	54473872	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:54473872C>A	ENST00000375135.3	-	17	3185	c.2452G>T	c.(2452-2454)Gct>Tct	p.A818S		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	818					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.A818S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TTCTCTGCAGCCACTGAGGCC	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											68.0	41.0	50.0					X																	54473872		2203	4299	6502	54490597	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2452G>T	X.37:g.54473872C>A	ENSP00000364277:p.Ala818Ser	Unknown		x	x	x	54490597	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635482	0.29068	.	.	ENSG00000102302	ENST00000375135	T	0.11063	2.81	5.33	5.33	0.75918	.	0.000000	0.49305	D	0.000144	T	0.07999	0.0200	N	0.19112	0.55	0.36717	D	0.880992	B	0.19935	0.04	B	0.20384	0.029	T	0.17868	-1.0355	10	0.08599	T	0.76	-6.4557	16.8048	0.85623	0.0:1.0:0.0:0.0	.	818	P98174	FGD1_HUMAN	S	818	ENSP00000364277:A818S	ENSP00000364277:A818S	A	-	1	0	FGD1	54490597	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.136000	0.42121	2.229000	0.72834	0.529000	0.55759	GCT		0.542	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		Missense_Mutation
FAAH2	158584	broad.mit.edu	37	X	57358060	57358060	+	Missense_Mutation	SNP	C	C	T	rs141132166		TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:57358060C>T	ENST00000374900.4	+	4	562	c.442C>T	c.(442-444)Cgt>Tgt	p.R148C		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	148						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.R148C(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						ACTCATGAACCGTCGTGATGC	0.413										HNSCC(52;0.14)			.|||	6	0.0015894	0.0	0.0	3775	,	,		14541	0.0		0.0	False		,,,				2504	0.0061															1	Substitution - Missense(1)	ovary(1)	X						C	CYS/ARG	2,3833		0,2,1630,571	101.0	83.0	89.0		442	1.5	0.5	X	dbSNP_134	89	0,6728		0,0,2428,1872	no	missense	FAAH2	NM_174912.3	180	0,2,4058,2443	TT,TC,CC,C		0.0,0.0522,0.0189	probably-damaging	148/533	57358060	2,10561	2203	4300	6503	57374785	SO:0001583	missense	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.442C>T	X.37:g.57358060C>T	ENSP00000364035:p.Arg148Cys	Unknown		x	x	x	57374785	Q86VT2|Q96N98	Missense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467716	0.26335	5.22E-4	0.0	ENSG00000165591	ENST00000374900	T	0.64260	-0.09	2.38	1.49	0.22878	Amidase signature domain (2);	0.000000	0.64402	U	0.000001	T	0.80352	0.4607	M	0.93808	3.46	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.77670	-0.2501	10	0.72032	D	0.01	.	6.7878	0.23683	0.0:0.8359:0.0:0.1641	.	148	Q6GMR7	FAAH2_HUMAN	C	148	ENSP00000364035:R148C	ENSP00000364035:R148C	R	+	1	0	FAAH2	57374785	0.995000	0.38212	0.534000	0.28014	0.381000	0.30169	3.093000	0.50217	0.052000	0.16007	-0.322000	0.08575	CGT		0.413	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912		Missense_Mutation
ZDHHC15	158866	broad.mit.edu	37	X	74742742	74742742	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:74742742C>T	ENST00000373367.3	-	1	348	c.118G>A	c.(118-120)Gtc>Atc	p.V40I	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.V40I|ZDHHC15_ENST00000482827.1_5'UTR|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.V40I	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	40					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.V40I(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						AGTTCAAAGACGTAGGCATAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	X											102.0	79.0	87.0					X																	74742742		2203	4300	6503	74659467	SO:0001583	missense	158866			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.118G>A	X.37:g.74742742C>T	ENSP00000362465:p.Val40Ile	Unknown		x	x	x	74659467	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	CCDS14430.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682271	0.88542	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.77358	0.78;1.09;-1.09	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.87904	0.6295	M	0.79926	2.475	0.80722	D	1	D;D;B	0.71674	0.998;0.995;0.123	D;P;B	0.75484	0.986;0.838;0.019	D	0.87504	0.2435	10	0.38643	T	0.18	-15.1225	15.6856	0.77409	0.0:1.0:0.0:0.0	.	40;40;40	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	I	40	ENSP00000362465:V40I;ENSP00000445420:V40I;ENSP00000362459:V40I	ENSP00000362459:V40I	V	-	1	0	ZDHHC15	74659467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.395000	0.73228	2.300000	0.77407	0.529000	0.55759	GTC		0.562	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969		Missense_Mutation
SYTL4	94121	broad.mit.edu	37	X	99941009	99941009	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:99941009T>A	ENST00000372989.1	-	15	1758	c.1427A>T	c.(1426-1428)cAt>cTt	p.H476L	SYTL4_ENST00000372981.1_3'UTR|SYTL4_ENST00000276141.6_Missense_Mutation_p.H476L|SYTL4_ENST00000263033.5_Missense_Mutation_p.H476L|SYTL4_ENST00000454200.2_Missense_Mutation_p.H478L|SYTL4_ENST00000455616.1_Missense_Mutation_p.H476L	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	476					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.H476L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGGGAGGCAATGATCCAGTTT	0.458																																																1	Substitution - Missense(1)	ovary(1)	X											87.0	70.0	76.0					X																	99941009		2203	4298	6501	99827665	SO:0001583	missense	94121				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1427A>T	X.37:g.99941009T>A	ENSP00000362080:p.His476Leu	Unknown		x	x	x	99827665	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	19.91	3.914513	0.72983	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033	T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16	5.88	5.88	0.94601	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.345544	0.36101	N	0.002795	T	0.07773	0.0195	L	0.40543	1.245	0.52099	D	0.99994	P	0.43542	0.81	B	0.33620	0.167	T	0.33727	-0.9857	9	.	.	.	-19.5063	15.2041	0.73165	0.0:0.0:0.0:1.0	.	476	Q96C24	SYTL4_HUMAN	L	476;476;478;476;476	ENSP00000362080:H476L;ENSP00000390252:H476L;ENSP00000403556:H478L;ENSP00000276141:H476L;ENSP00000263033:H476L	.	H	-	2	0	SYTL4	99827665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.051000	0.76627	1.973000	0.57446	0.486000	0.48141	CAT		0.458	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		Missense_Mutation
ACTRT1	139741	broad.mit.edu	37	X	127185495	127185495	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chrX:127185495G>A	ENST00000371124.3	-	1	887	c.691C>T	c.(691-693)Cgc>Tgc	p.R231C		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	231						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R231C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						CGGCTCTTGCGTAGCTCTTTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											130.0	122.0	125.0					X																	127185495		2203	4300	6503	127013176	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.691C>T	X.37:g.127185495G>A	ENSP00000360165:p.Arg231Cys	Unknown		x	x	x	127013176	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	0.111	-1.138244	0.01742	.	.	ENSG00000123165	ENST00000371124	D	0.94650	-3.48	3.45	-6.89	0.01660	.	1.252160	0.05461	N	0.551277	D	0.86306	0.5901	L	0.28344	0.845	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.71272	-0.4642	10	0.87932	D	0	.	0.4575	0.00511	0.267:0.2136:0.2879:0.2314	.	231	Q8TDG2	ACTT1_HUMAN	C	231	ENSP00000360165:R231C	ENSP00000360165:R231C	R	-	1	0	ACTRT1	127013176	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.426000	0.02443	-2.944000	0.00296	-1.724000	0.00704	CGC		0.512	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289		Missense_Mutation
MIB1	57534	broad.mit.edu	37	18	19353583	19353589	+	Splice_Site	DEL	AGGTAAC	AGGTAAC	-			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr18:19353583_19353589delAGGTAAC	ENST00000261537.6	+	4	795_800	c.531_536delAGGTAAC	c.(529-537)aaaggtaac>aac	p.KG177fs	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	177	MIB/HERC2 2. {ECO:0000255|PROSITE- ProRule:PRU00749}.				blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			CTATTCTGTTAGGTAACAGAAATCCAG	0.377																																																1	Unknown(1)	ovary(1)	18																																								17607587	SO:0001630	splice_region_variant	57534			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.532-1AGGTAAC>-	18.37:g.19353583_19353589delAGGTAAC		Unknown		Capture	Illumina GAIIx	Phase_I	17607581	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Splice_Site_Del	DEL	ENST00000261537.6	37	CCDS11871.1	DEL	15	Broad																																																																																				0.377	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	Frame_Shift_Del	Splice_Site_Del
NEB	4703	broad.mit.edu	37	2	152566216	152566217	+	Frame_Shift_Ins	INS	-	-	T			TCGA-04-1331-01	TCGA-04-1331-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1331-01	TCGA-04-1331-10	g.chr2:152566216_152566217insT	ENST00000172853.10	-	12	1135_1136	c.988_989insA	c.(988-990)acafs	p.T330fs	NEB_ENST00000604864.1_Frame_Shift_Ins_p.T330fs|NEB_ENST00000397345.3_Frame_Shift_Ins_p.T330fs|NEB_ENST00000427231.2_Frame_Shift_Ins_p.T330fs|NEB_ENST00000409198.1_Frame_Shift_Ins_p.T330fs|NEB_ENST00000603639.1_Frame_Shift_Ins_p.T330fs			P20929	NEBU_HUMAN	nebulin	330					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.T330fs*5(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATACTCTGGTGTTTCGGTCTGC	0.386																																																1	Insertion - Frameshift(1)	ovary(1)	2																																								152274463	SO:0001589	frameshift_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.989dupA	2.37:g.152566219_152566219dupT	ENSP00000172853:p.Thr330fs	Unknown		Capture	Illumina GAIIx	Phase_I	152274462	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Frame_Shift_Ins	INS	ENST00000172853.10	37		INS	48	Broad																																																																																				0.386	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		Frame_Shift_Ins
