#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PANK4	55229	broad.mit.edu	37	1	2449637	2449637	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:2449637T>A	ENST00000378466.3	-	9	1196	c.1184A>T	c.(1183-1185)gAg>gTg	p.E395V	PANK4_ENST00000435556.3_Missense_Mutation_p.E356V	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	395					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.E395V(1)		breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CGGGCCGAGCTCGGGTGATGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	39.0	38.0					1																	2449637		2198	4297	6495	2439497	SO:0001583	missense	55229			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1184A>T	1.37:g.2449637T>A	ENSP00000367727:p.Glu395Val	Unknown		x	x	x	2439497	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	37	CCDS42.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	10.50	1.366616	0.24771	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	D;D	0.96940	-4.18;-3.9	4.81	3.69	0.42338	.	0.220336	0.46758	D	0.000277	D	0.92136	0.7507	L	0.40543	1.245	0.48975	D	0.99973	P;B	0.37398	0.593;0.116	B;B	0.33392	0.163;0.022	D	0.89280	0.3611	10	0.54805	T	0.06	-33.814	9.2316	0.37441	0.0:0.0855:0.0:0.9145	.	356;395	E9PHT6;Q9NVE7	.;PANK4_HUMAN	V	395;356	ENSP00000367727:E395V;ENSP00000421433:E356V	ENSP00000367727:E395V	E	-	2	0	PANK4	2439497	1.000000	0.71417	0.849000	0.33467	0.010000	0.07245	3.671000	0.54576	0.715000	0.32103	0.459000	0.35465	GAG		0.647	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1			Missense_Mutation
MMEL1	79258	broad.mit.edu	37	1	2525350	2525350	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:2525350C>A	ENST00000378412.3	-	19	1931	c.1770G>T	c.(1768-1770)caG>caT	p.Q590H	MMEL1_ENST00000288709.6_Missense_Mutation_p.Q581H|MMEL1_ENST00000502556.1_Missense_Mutation_p.Q433H			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	590						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q581H(1)		cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		AGAAGGGGGGCTGGAGGATCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											55.0	49.0	51.0					1																	2525350		2203	4300	6503	2515210	SO:0001583	missense	79258			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1770G>T	1.37:g.2525350C>A	ENSP00000367668:p.Gln590His	Unknown		x	x	x	2515210	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	ENST00000378412.3	37	CCDS30569.2	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098069	0.76870	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.86030	-2.06;-2.06;-2.06	5.19	4.27	0.50696	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93051	0.7788	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93135	0.6536	10	0.87932	D	0	-36.2714	9.2891	0.37775	0.0:0.8313:0.0:0.1687	.	590	Q495T6	MMEL1_HUMAN	H	433;581;590;433	ENSP00000288709:Q581H;ENSP00000367668:Q590H;ENSP00000422492:Q433H	ENSP00000288709:Q581H	Q	-	3	2	MMEL1	2515210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.637000	0.37155	1.172000	0.42781	0.655000	0.94253	CAG		0.592	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467		Missense_Mutation
ZBTB17	7709	broad.mit.edu	37	1	16273503	16273503	+	Silent	SNP	G	G	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:16273503G>C	ENST00000375743.4	-	4	553	c.321C>G	c.(319-321)gcC>gcG	p.A107A	ZBTB17_ENST00000448462.2_Intron|ZBTB17_ENST00000479282.1_5'UTR|ZBTB17_ENST00000537142.1_Missense_Mutation_p.P18R|ZBTB17_ENST00000375733.2_Silent_p.A107A	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	107					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A107A(1)		breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCATGGCAGGCCGTGATGA	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											76.0	71.0	73.0					1																	16273503		2203	4300	6503	16146090	SO:0001819	synonymous_variant	7709			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.321C>G	1.37:g.16273503G>C		Unknown		x	x	x	16146090	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Silent	SNP	ENST00000375743.4	37	CCDS165.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190902	0.38707	.	.	ENSG00000116809	ENST00000537142	T	0.08896	3.04	5.48	3.5	0.40072	.	.	.	.	.	T	0.07007	0.0178	.	.	.	0.80722	D	1	B	0.24823	0.112	B	0.24394	0.053	T	0.18398	-1.0338	8	0.59425	D	0.04	.	6.0081	0.19557	0.0841:0.1353:0.642:0.1386	.	18	F5H411	.	R	18	ENSP00000438529:P18R	ENSP00000438529:P18R	P	-	2	0	ZBTB17	16146090	0.968000	0.33430	1.000000	0.80357	0.990000	0.78478	0.088000	0.14979	2.572000	0.86782	0.561000	0.74099	CCT		0.587	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443		Silent
CSMD2	114784	broad.mit.edu	37	1	33998804	33998804	+	Silent	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:33998804C>T	ENST00000373381.4	-	64	10193	c.10017G>A	c.(10015-10017)acG>acA	p.T3339T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T3195T(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATGCGTTGGCGTCTCTGGCT	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											32.0	31.0	31.0					1																	33998804		2203	4300	6503	33771391	SO:0001819	synonymous_variant	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.10017G>A	1.37:g.33998804C>T		Unknown		x	x	x	33771391	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37		SNP	27	Broad																																																																																				0.617	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896		Silent
MTF1	4520	broad.mit.edu	37	1	38305705	38305705	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:38305705G>A	ENST00000373036.4	-	3	674	c.534C>T	c.(532-534)ggC>ggT	p.G178G		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	178					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.G178G(1)		endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GGAAGGCTTTGCCACAGCCCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											187.0	153.0	164.0					1																	38305705		2203	4300	6503	38078292	SO:0001819	synonymous_variant	4520			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.534C>T	1.37:g.38305705G>A		Unknown		x	x	x	38078292	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	37	CCDS30676.1	SNP	46	Broad																																																																																				0.562	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955		Silent
LEPRE1	64175	broad.mit.edu	37	1	43213441	43213441	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:43213441C>T	ENST00000296388.5	-	13	1918	c.1867G>A	c.(1867-1869)Gat>Aat	p.D623N	LEPRE1_ENST00000462474.1_5'UTR|LEPRE1_ENST00000236040.4_Missense_Mutation_p.D623N|LEPRE1_ENST00000397054.3_Missense_Mutation_p.D623N			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	623	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)	p.D623N(1)		large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTTCCGCCATCGAAGTCCCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											159.0	157.0	158.0					1																	43213441		2203	4300	6503	42986028	SO:0001583	missense	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1867G>A	1.37:g.43213441C>T	ENSP00000296388:p.Asp623Asn	Unknown		x	x	x	42986028	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.118393	0.94385	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.42131	0.98;0.98;0.98	5.1	5.1	0.69264	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.153987	0.56097	D	0.000023	T	0.53834	0.1821	L	0.61036	1.89	0.45930	D	0.998769	D;P;D	0.63880	0.993;0.94;0.967	P;P;P	0.52710	0.535;0.545;0.707	T	0.59139	-0.7510	10	0.72032	D	0.01	-26.3936	16.0157	0.80439	0.0:1.0:0.0:0.0	.	623;488;623	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	N	623;623;623;488	ENSP00000380245:D623N;ENSP00000236040:D623N;ENSP00000296388:D623N	ENSP00000236040:D623N	D	-	1	0	LEPRE1	42986028	1.000000	0.71417	0.992000	0.48379	0.902000	0.53008	4.613000	0.61176	2.372000	0.80975	0.655000	0.94253	GAT		0.522	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356		Missense_Mutation
GLIS1	148979	broad.mit.edu	37	1	53972319	53972320	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:53972319_53972320GT>TG	ENST00000312233.2	-	10	2401_2402	c.1835_1836AC>CA	c.(1834-1836)cAC>cCA	p.H612P		NM_147193.2	NP_671726.2			GLIS family zinc finger 1									p.H612P(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						TGGAGGGGATGTGGCCCAGGCA	0.639																																																1	Substitution - Missense(1)	ovary(1)	1																																								53744908	SO:0001583	missense	148979			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1835_1836delinsTG	1.37:g.53972319_53972320delinsTG	ENSP00000309653:p.His612Pro	Unknown		x	x	x	53744907		Missense_Mutation	DNP	ENST00000312233.2	37	CCDS582.1	DNP	48	Broad																																																																																				0.639	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193		Missense_Mutation
C1orf85	112770	broad.mit.edu	37	1	156264687	156264687	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:156264687C>T	ENST00000362007.1	-	2	267	c.241G>A	c.(241-243)Gta>Ata	p.V81I	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	81					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V81I(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					GCCACCATTACCACTGCCAGA	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	81.0	79.0					1																	156264687		2203	4300	6503	154531311	SO:0001583	missense	112770			BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.241G>A	1.37:g.156264687C>T	ENSP00000354553:p.Val81Ile	Unknown		x	x	x	154531311	A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Missense_Mutation	SNP	ENST00000362007.1	37	CCDS1139.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577408	0.28180	.	.	ENSG00000198715	ENST00000362007	T	0.21932	1.98	5.03	2.08	0.27032	.	0.085473	0.48286	D	0.000188	T	0.05686	0.0149	N	0.22421	0.69	0.80722	D	1	B	0.22683	0.073	B	0.21151	0.033	T	0.17745	-1.0359	10	0.59425	D	0.04	0.1357	9.6568	0.39930	0.1042:0.2198:0.676:0.0	.	81	Q8WWB7	NCUG1_HUMAN	I	81	ENSP00000354553:V81I	ENSP00000354553:V81I	V	-	1	0	C1orf85	154531311	1.000000	0.71417	0.848000	0.33437	0.067000	0.16453	2.353000	0.44089	0.152000	0.19188	0.561000	0.74099	GTA		0.617	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052108.1	NM_144580		Missense_Mutation
FCRL5	83416	broad.mit.edu	37	1	157490961	157490961	+	Silent	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:157490961A>G	ENST00000361835.3	-	11	2518	c.2361T>C	c.(2359-2361)ttT>ttC	p.F787F	FCRL5_ENST00000461387.1_5'UTR|FCRL5_ENST00000356953.4_Silent_p.F787F	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	787	Ig-like C2-type 8.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.F787F(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CATCCTCATGAAAAAACCGGT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											65.0	70.0	68.0					1																	157490961		2203	4300	6503	155757585	SO:0001819	synonymous_variant	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2361T>C	1.37:g.157490961A>G		Unknown		x	x	x	155757585	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	CCDS1165.1	SNP	9	Broad																																																																																				0.587	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		Silent
HSD17B7	51478	broad.mit.edu	37	1	162773313	162773313	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:162773313G>A	ENST00000254521.3	+	6	790	c.735G>A	c.(733-735)ccG>ccA	p.P245P	HSD17B7_ENST00000367917.3_Intron|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	245					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)	p.P245P(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TGTTGATGCCGGCAATATTGC	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1											122.0	107.0	112.0					1																	162773313		2203	4300	6503	161039937	SO:0001819	synonymous_variant	51478			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.735G>A	1.37:g.162773313G>A		Unknown		x	x	x	161039937	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Silent	SNP	ENST00000254521.3	37	CCDS1242.1	SNP	39	Broad																																																																																				0.388	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083207.1	NM_016371		Silent
PM20D1	148811	broad.mit.edu	37	1	205814514	205814514	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr1:205814514C>G	ENST00000367136.4	-	3	472	c.428G>C	c.(427-429)gGg>gCg	p.G143A	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	143					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)	p.G143A(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			ACGCTCCAACCCAGAGAATGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	96.0	98.0					1																	205814514		2203	4300	6503	204081137	SO:0001583	missense	148811				CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.428G>C	1.37:g.205814514C>G	ENSP00000356104:p.Gly143Ala	Unknown		x	x	x	204081137	Q6P4E3|Q96DM4	Missense_Mutation	SNP	ENST00000367136.4	37	CCDS1460.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.70	1.716201	0.30413	.	.	ENSG00000162877	ENST00000367136	T	0.50277	0.75	6.04	6.04	0.98038	.	0.204131	0.50627	D	0.000104	T	0.59851	0.2224	L	0.42686	1.345	0.45046	D	0.998066	D	0.58970	0.984	D	0.65987	0.94	T	0.52895	-0.8514	10	0.36615	T	0.2	.	16.0008	0.80292	0.0:0.8283:0.1717:0.0	.	143	Q6GTS8	P20D1_HUMAN	A	143	ENSP00000356104:G143A	ENSP00000356104:G143A	G	-	2	0	PM20D1	204081137	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	5.095000	0.64529	2.873000	0.98535	0.561000	0.74099	GGG		0.577	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087736.1	NM_152491		Missense_Mutation
MUC6	4588	broad.mit.edu	37	11	1018575	1018575	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:1018575G>T	ENST00000421673.2	-	31	4276	c.4226C>A	c.(4225-4227)cCg>cAg	p.P1409Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1409	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.P1409Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGCCGTAGGCGGGGAGTGTGT	0.582																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	126.0	119.0					11																	1018575		1949	4138	6087	1008575	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4226C>A	11.37:g.1018575G>T	ENSP00000406861:p.Pro1409Gln	Unknown		x	x	x	1008575	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	3.386	-0.125401	0.06795	.	.	ENSG00000184956	ENST00000421673	T	0.17691	2.26	1.7	-0.626	0.11544	.	.	.	.	.	T	0.10423	0.0255	L	0.38175	1.15	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.34502	-0.9826	9	0.30078	T	0.28	.	2.4601	0.04539	0.1904:0.0:0.526:0.2836	.	1409	Q6W4X9	MUC6_HUMAN	Q	1409	ENSP00000406861:P1409Q	ENSP00000406861:P1409Q	P	-	2	0	MUC6	1008575	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.780000	0.00773	-0.125000	0.11703	0.298000	0.19748	CCG		0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		Missense_Mutation
KCNQ1	3784	broad.mit.edu	37	11	2869021	2869021	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:2869021G>C	ENST00000155840.5	+	16	1927	c.1819G>C	c.(1819-1821)Gca>Cca	p.A607P	KCNQ1_ENST00000526095.1_3'UTR|KCNQ1_ENST00000335475.5_Missense_Mutation_p.A480P|KCNQ1-AS1_ENST00000440887.2_RNA	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	607	Subunits assembly domain.			AL -> VI (in Ref. 4; AAM94040). {ECO:0000305}.	atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.A607P(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CCAGAGGCTGGCACTCATCAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	11											19.0	16.0	17.0					11																	2869021		2191	4294	6485	2825597	SO:0001583	missense	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1819G>C	11.37:g.2869021G>C	ENSP00000155840:p.Ala607Pro	Unknown		x	x	x	2825597	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	ENST00000155840.5	37	CCDS7736.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472781	0.26423	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99667	-6.34;-6.34	2.94	1.97	0.26223	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	1.100600	0.07067	N	0.834827	D	0.97256	0.9103	N	0.08118	0	0.22858	N	0.998648	B;P	0.36412	0.008;0.552	B;B	0.39805	0.02;0.31	D	0.99013	1.0815	10	0.66056	D	0.02	-4.28	2.4794	0.04583	0.2886:0.2964:0.415:0.0	.	480;607	Q14D14;P51787	.;KCNQ1_HUMAN	P	607;480	ENSP00000155840:A607P;ENSP00000334497:A480P	ENSP00000155840:A607P	A	+	1	0	KCNQ1	2825597	1.000000	0.71417	0.998000	0.56505	0.680000	0.39746	2.100000	0.41777	0.751000	0.32900	0.491000	0.48974	GCA		0.672	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218		Missense_Mutation
OR51S1	119692	broad.mit.edu	37	11	4870049	4870049	+	Silent	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:4870049C>G	ENST00000322101.2	-	1	465	c.390G>C	c.(388-390)cgG>cgC	p.R130R	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R130R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGCCAGTGCCCGATCAATGG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	11											105.0	101.0	103.0					11																	4870049		2201	4298	6499	4826625	SO:0001819	synonymous_variant	119692			AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.390G>C	11.37:g.4870049C>G		Unknown		x	x	x	4826625	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	37	CCDS31362.1	SNP	22	Broad																																																																																				0.527	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758		Silent
OR2AG2	338755	broad.mit.edu	37	11	6789379	6789379	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:6789379T>G	ENST00000338569.2	-	1	907	c.810A>C	c.(808-810)caA>caC	p.Q270H		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q270H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGATGTTGTCTTGTTTGGGGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	11											152.0	138.0	143.0					11																	6789379		2201	4296	6497	6745955	SO:0001583	missense	338755			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.810A>C	11.37:g.6789379T>G	ENSP00000342697:p.Gln270His	Unknown		x	x	x	6745955		Missense_Mutation	SNP	ENST00000338569.2	37	CCDS31413.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862119	0.51482	.	.	ENSG00000188124	ENST00000338569	T	0.00169	8.63	4.47	-3.12	0.05282	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000198	T	0.00328	0.0010	M	0.66560	2.04	0.29402	N	0.861852	D	0.89917	1.0	D	0.85130	0.997	T	0.49542	-0.8929	10	0.35671	T	0.21	.	5.158	0.15046	0.1526:0.2605:0.0:0.5869	.	270	A6NM03	O2AG2_HUMAN	H	270	ENSP00000342697:Q270H	ENSP00000342697:Q270H	Q	-	3	2	OR2AG2	6745955	0.000000	0.05858	0.571000	0.28486	0.990000	0.78478	-3.646000	0.00404	-0.558000	0.06118	0.533000	0.62120	CAA		0.512	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490		Missense_Mutation
NUP160	23279	broad.mit.edu	37	11	47869814	47869814	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:47869814G>A	ENST00000378460.2	-	1	205	c.159C>T	c.(157-159)cgC>cgT	p.R53R	NUP160_ENST00000532747.1_Silent_p.R19R|NUP160_ENST00000530326.1_5'UTR|NUP160_ENST00000526870.1_Silent_p.R53R	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	53					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.R53R(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TCGGCCTTTCGCGCTCAGCTC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	11											65.0	68.0	67.0					11																	47869814		2201	4298	6499	47826390	SO:0001819	synonymous_variant	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.159C>T	11.37:g.47869814G>A		Unknown		x	x	x	47826390	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	ENST00000378460.2	37	CCDS31484.1	SNP	38	Broad																																																																																				0.652	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231		Silent
OR5D14	219436	broad.mit.edu	37	11	55563433	55563433	+	Silent	SNP	T	T	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:55563433T>C	ENST00000335605.1	+	1	402	c.402T>C	c.(400-402)taT>taC	p.Y134Y		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y134Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTCTGCTTTATACAGTGGCCA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	90.0	94.0					11																	55563433		2200	4296	6496	55320009	SO:0001819	synonymous_variant	219436			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.402T>C	11.37:g.55563433T>C		Unknown		x	x	x	55320009	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	ENST00000335605.1	37	CCDS31508.1	SNP	49	Broad																																																																																				0.542	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		Silent
INTS5	80789	broad.mit.edu	37	11	62416167	62416167	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:62416167A>G	ENST00000330574.2	-	2	1437	c.1385T>C	c.(1384-1386)cTa>cCa	p.L462P	GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000346178.4_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	462					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.L462P(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						GGGCGGGCCTAGCACCCCTTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											53.0	57.0	56.0					11																	62416167		2202	4299	6501	62172743	SO:0001583	missense	80789			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.1385T>C	11.37:g.62416167A>G	ENSP00000327889:p.Leu462Pro	Unknown		x	x	x	62172743	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	ENST00000330574.2	37	CCDS8027.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	7.798	0.713079	0.15306	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.87	4.87	0.63330	.	0.284524	0.31301	N	0.007882	T	0.48003	0.1476	N	0.08118	0	0.58432	D	0.99999	D	0.64830	0.994	P	0.59889	0.865	T	0.56691	-0.7937	9	0.59425	D	0.04	.	12.476	0.55814	1.0:0.0:0.0:0.0	.	462	Q6P9B9	INT5_HUMAN	P	462	.	ENSP00000327889:L462P	L	-	2	0	INTS5	62172743	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	3.972000	0.56838	2.052000	0.61016	0.533000	0.62120	CTA		0.597	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628		Missense_Mutation
ATG2A	23130	broad.mit.edu	37	11	64675292	64675294	+	Missense_Mutation	TNP	CTG	CTG	TCA	rs367628201		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:64675292_64675294CTG>TCA	ENST00000377264.3	-	17	2545_2547	c.2433_2435CAG>TGA	c.(2431-2436)tgCAGc>tgTGAc	p.S812D	ATG2A_ENST00000421419.2_Missense_Mutation_p.S812D	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	812					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CACTTCCAGGCTGCAGCGGGACA	0.616																																																1	Substitution - coding silent(1)	ovary(1)	11																																								64431870	SO:0001583	missense	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2433_2435CAG>TGA	11.37:g.64675292CTG>TCA	ENSP00000366475:p.Ser812Asp	Unknown		x	x	x	64431868	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	TNP	ENST00000377264.3	37	CCDS31602.1	TNP	28	Broad																																																																																				0.616	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104		Missense_Mutation
PITPNM1	9600	broad.mit.edu	37	11	67265653	67265654	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:67265653_67265654GC>TG	ENST00000534749.1	-	10	1812_1813	c.1624_1625GC>CA	c.(1624-1626)GCc>CAc	p.A542H	PITPNM1_ENST00000356404.3_Missense_Mutation_p.A542H|PITPNM1_ENST00000436757.2_Missense_Mutation_p.A542H			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	542					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)	p.A542H(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GGCTGAGTAGGCCTGGTTGGTG	0.663																																					GBM(28;144 709 4607 5525)											1	Substitution - Missense(1)	ovary(1)	11																																								67022230	SO:0001583	missense	9600			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1624_1625delinsTG	11.37:g.67265653_67265654delinsTG	ENSP00000437286:p.Ala542His	Unknown		x	x	x	67022229	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	DNP	ENST00000534749.1	37	CCDS31620.1	DNP	42	Broad																																																																																				0.663	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910		Missense_Mutation
SIDT2	51092	broad.mit.edu	37	11	117052204	117052204	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:117052204C>A	ENST00000324225.4	+	2	787	c.256C>A	c.(256-258)Cag>Aag	p.Q86K	SIDT2_ENST00000431081.2_Missense_Mutation_p.Q86K|SIDT2_ENST00000530948.1_3'UTR	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	86					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)	p.Q86K(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TGTGGTCCGCCAGAAGGAGGC	0.597											OREG0021368	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											117.0	108.0	111.0					11																	117052204		2201	4296	6497	116557414	SO:0001583	missense	51092			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.256C>A	11.37:g.117052204C>A	ENSP00000314023:p.Gln86Lys	Unknown	1478	x	x	x	116557414	Q8NBY7|Q9Y357	Missense_Mutation	SNP	ENST00000324225.4	37	CCDS31682.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	34	5.389797	0.95988	.	.	ENSG00000149577	ENST00000324225;ENST00000532960;ENST00000525347;ENST00000278951;ENST00000431081	T;T;T;T	0.61274	1.75;0.12;1.67;1.75	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.71674	0.998;0.996;0.997;0.997	D;D;D;D	0.87578	0.998;0.979;0.998;0.996	T	0.78398	-0.2219	10	0.72032	D	0.01	-19.9203	18.2341	0.89944	0.0:1.0:0.0:0.0	.	86;86;86;86	Q8NBJ9-2;F5H8L4;Q8NBJ9;C9JBG5	.;.;SIDT2_HUMAN;.	K	86	ENSP00000314023:Q86K;ENSP00000431176:Q86K;ENSP00000278951:Q86K;ENSP00000399635:Q86K	ENSP00000278951:Q86K	Q	+	1	0	SIDT2	116557414	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.189000	0.77747	2.619000	0.88677	0.655000	0.94253	CAG		0.597	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996		Missense_Mutation
BACE1	23621	broad.mit.edu	37	11	117186334	117186334	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr11:117186334A>G	ENST00000313005.6	-	1	638	c.178T>C	c.(178-180)Ttt>Ctt	p.F60L	BACE1_ENST00000428381.2_Missense_Mutation_p.F60L|BACE1_ENST00000528053.1_Missense_Mutation_p.F60L|AP000892.4_ENST00000504906.1_RNA|BACE1_ENST00000513780.1_Missense_Mutation_p.F60L|BACE1_ENST00000445823.2_Missense_Mutation_p.F60L|BACE1_ENST00000514464.1_5'UTR	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	60					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)	p.F60L(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		ATCTCCACAAAGCTGCCCCTC	0.731																																																1	Substitution - Missense(1)	ovary(1)	11											39.0	39.0	39.0					11																	117186334		2201	4296	6497	116691544	SO:0001583	missense	23621			AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.178T>C	11.37:g.117186334A>G	ENSP00000318585:p.Phe60Leu	Unknown		x	x	x	116691544	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Missense_Mutation	SNP	ENST00000313005.6	37	CCDS8383.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175261	0.78564	.	.	ENSG00000186318	ENST00000313005;ENST00000528053;ENST00000428381;ENST00000513780;ENST00000445823	T;T;T;T;T	0.61040	0.37;0.2;0.4;0.15;0.14	4.99	4.99	0.66335	Peptidase aspartic (1);	0.165319	0.53938	N	0.000053	T	0.68439	0.3001	L	0.61218	1.895	0.80722	D	1	D;B;B;D;P	0.60160	0.982;0.071;0.148;0.987;0.627	D;B;B;D;B	0.68765	0.952;0.008;0.084;0.96;0.295	T	0.64964	-0.6283	10	0.13853	T	0.58	.	12.6208	0.56601	1.0:0.0:0.0:0.0	.	60;60;60;60;60	Q76KP0;P56817;P56817-3;P56817-4;P56817-2	.;BACE1_HUMAN;.;.;.	L	60	ENSP00000318585:F60L;ENSP00000431848:F60L;ENSP00000402228:F60L;ENSP00000424536:F60L;ENSP00000403685:F60L	ENSP00000318585:F60L	F	-	1	0	BACE1	116691544	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.425000	0.73370	1.866000	0.54105	0.533000	0.62120	TTT		0.731	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1			Missense_Mutation
ABCB9	23457	broad.mit.edu	37	12	123414661	123414661	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr12:123414661G>A	ENST00000542678.1	-	12	4936	c.2098C>T	c.(2098-2100)Cgg>Tgg	p.R700W	ABCB9_ENST00000344275.7_Intron|ABCB9_ENST00000442833.2_Intron|ABCB9_ENST00000442028.2_Missense_Mutation_p.R703W|ABCB9_ENST00000280560.8_Missense_Mutation_p.R700W|ABCB9_ENST00000392439.3_Missense_Mutation_p.R700W|ABCB9_ENST00000540285.1_Missense_Mutation_p.R637W|ABCB9_ENST00000346530.5_Missense_Mutation_p.R657W			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	700	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)	p.R700W(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GTGCTCAGCCGGTGCGCGATG	0.677																																					Ovarian(49;786 1333 9175 38236)											1	Substitution - Missense(1)	ovary(1)	12											41.0	25.0	30.0					12																	123414661		2181	4261	6442	121980614	SO:0001583	missense	23457			U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.2098C>T	12.37:g.123414661G>A	ENSP00000440288:p.Arg700Trp	Unknown		x	x	x	121980614	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	CCDS9241.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960731	0.74016	.	.	ENSG00000150967	ENST00000280560;ENST00000540285;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028;ENST00000546289	D;D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	4.81	4.81	0.61882	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.95379	0.8500	H	0.99074	4.42	0.50632	D	0.999887	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	D	0.96235	0.9171	10	0.87932	D	0	-35.2916	11.3489	0.49577	0.0:0.0:0.6837:0.3163	.	637;307;657;700	B4E2J0;B4DFR8;Q9NP78-2;Q9NP78	.;.;.;ABCB9_HUMAN	W	700;637;657;700;700;703;244	ENSP00000280560:R700W;ENSP00000441734:R637W;ENSP00000280559:R657W;ENSP00000376234:R700W;ENSP00000440288:R700W;ENSP00000394898:R703W;ENSP00000442281:R244W	ENSP00000280560:R700W	R	-	1	2	ABCB9	121980614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.651000	0.46674	2.213000	0.71641	0.561000	0.74099	CGG		0.677	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624		Missense_Mutation
CENPJ	55835	broad.mit.edu	37	13	25480632	25480632	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr13:25480632G>T	ENST00000381884.4	-	7	1729	c.1544C>A	c.(1543-1545)aCa>aAa	p.T515K	CENPJ_ENST00000545981.1_Missense_Mutation_p.T515K	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	515					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)	p.T515K(1)		endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		ATTCCACCCTGTGCAGCCAGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	13											75.0	79.0	77.0					13																	25480632		2203	4300	6503	24378632	SO:0001583	missense	55835			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1544C>A	13.37:g.25480632G>T	ENSP00000371308:p.Thr515Lys	Unknown		x	x	x	24378632	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	0	-2.632536	0.00115	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.24723	1.84;1.84	5.93	-2.8	0.05823	.	0.640502	0.16964	N	0.192372	T	0.06826	0.0174	N	0.03253	-0.375	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37197	-0.9716	10	0.02654	T	1	.	6.1009	0.20047	0.0:0.2269:0.3952:0.3779	.	515	Q9HC77	CENPJ_HUMAN	K	515	ENSP00000371308:T515K;ENSP00000441090:T515K	ENSP00000371308:T515K	T	-	2	0	CENPJ	24378632	0.540000	0.26410	0.030000	0.17652	0.003000	0.03518	0.561000	0.23515	-0.314000	0.08716	-0.262000	0.10625	ACA		0.458	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451		Missense_Mutation
PCDH17	27253	broad.mit.edu	37	13	58209190	58209190	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr13:58209190C>A	ENST00000377918.3	+	1	2536	c.2510C>A	c.(2509-2511)aCc>aAc	p.T837N		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	837					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T837N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ACCAGCTTCACCGGACAAGGG	0.567																																					Melanoma(72;952 1291 1619 12849 33676)											1	Substitution - Missense(1)	ovary(1)	13											33.0	36.0	35.0					13																	58209190		2203	4299	6502	57107191	SO:0001583	missense	27253			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2510C>A	13.37:g.58209190C>A	ENSP00000367151:p.Thr837Asn	Unknown		x	x	x	57107191	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061498	0.36373	.	.	ENSG00000118946	ENST00000377918	T	0.53857	0.6	5.98	5.98	0.97165	.	0.047437	0.85682	D	0.000000	T	0.46600	0.1401	L	0.34521	1.04	0.58432	D	0.999998	B;B	0.19583	0.037;0.002	B;B	0.23852	0.049;0.005	T	0.27905	-1.0060	9	.	.	.	.	20.4366	0.99092	0.0:1.0:0.0:0.0	.	837;837	O14917-2;O14917	.;PCD17_HUMAN	N	837	ENSP00000367151:T837N	.	T	+	2	0	PCDH17	57107191	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.487000	0.81328	2.837000	0.97791	0.591000	0.81541	ACC		0.567	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		Missense_Mutation
KLHL1	57626	broad.mit.edu	37	13	70681661	70681661	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr13:70681661G>A	ENST00000377844.4	-	1	930	c.171C>T	c.(169-171)ctC>ctT	p.L57L	ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'UTR|ATXN8OS_ENST00000414504.2_RNA	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	57	Ser-rich.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.L57L(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTTGGCTTTTGAGCAGGCGAC	0.617																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	13											65.0	75.0	72.0					13																	70681661		2203	4300	6503	69579662	SO:0001819	synonymous_variant	57626			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.171C>T	13.37:g.70681661G>A		Unknown		x	x	x	69579662	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	37	CCDS9445.1	SNP	45	Broad																																																																																				0.617	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866		Silent
TNFSF13B	10673	broad.mit.edu	37	13	108922505	108922505	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr13:108922505G>C	ENST00000375887.4	+	1	440	c.262G>C	c.(262-264)Gcg>Ccg	p.A88P	TNFSF13B_ENST00000430559.1_Missense_Mutation_p.A88P|TNFSF13B_ENST00000542136.1_Missense_Mutation_p.A88P	NM_006573.4	NP_006564.1	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily, member 13b	88					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|cell proliferation (GO:0008283)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.A88P(1)		large_intestine(1)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)		Belimumab(DB08879)	GGGCCACCACGCGGAGAAGCT	0.662																																																1	Substitution - Missense(1)	ovary(1)	13											24.0	29.0	27.0					13																	108922505		2202	4298	6500	107720506	SO:0001583	missense	10673			AF136293	CCDS9509.1, CCDS45067.1	13q32-q34	2008-05-14			ENSG00000102524	ENSG00000102524		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11929	protein-coding gene	gene with protein product		603969		TNFSF20		10331498, 10359578	Standard	NM_006573		Approved	BAFF, THANK, BLYS, TALL-1, TALL1, CD257	uc001vqr.3	Q9Y275	OTTHUMG00000017329	ENST00000375887.4:c.262G>C	13.37:g.108922505G>C	ENSP00000365048:p.Ala88Pro	Unknown		x	x	x	107720506	E0ADT7|Q6FHD6|Q7Z5J2	Missense_Mutation	SNP	ENST00000375887.4	37	CCDS9509.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	5.268	0.234795	0.09969	.	.	ENSG00000102524	ENST00000430559;ENST00000375887;ENST00000542136	T;T;T	0.55052	0.54;0.54;0.54	4.03	-0.858	0.10689	.	0.515553	0.17334	N	0.177988	T	0.24509	0.0594	N	0.08118	0	0.09310	N	1	P;P	0.39216	0.57;0.664	B;B	0.39617	0.305;0.221	T	0.11941	-1.0567	10	0.31617	T	0.26	0.1712	2.1774	0.03865	0.1139:0.1576:0.4092:0.3193	.	88;88	Q9Y275-2;Q9Y275	.;TN13B_HUMAN	P	88	ENSP00000389540:A88P;ENSP00000365048:A88P;ENSP00000445334:A88P	ENSP00000365048:A88P	A	+	1	0	TNFSF13B	107720506	0.000000	0.05858	0.001000	0.08648	0.285000	0.27093	-0.236000	0.09003	-0.115000	0.11915	-0.158000	0.13435	GCG		0.662	TNFSF13B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045739.3			Missense_Mutation
ALKBH1	8846	broad.mit.edu	37	14	78161112	78161112	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr14:78161112C>T	ENST00000216489.3	-	3	439	c.424G>A	c.(424-426)Gat>Aat	p.D142N	ALKBH1_ENST00000554097.1_5'UTR	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	142					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)	p.D142N(1)		endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TCCCACAGATCTTGGGTCTCT	0.423																																																1	Substitution - Missense(1)	ovary(1)	14											207.0	202.0	204.0					14																	78161112		2203	4300	6503	77230865	SO:0001583	missense	8846			X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.424G>A	14.37:g.78161112C>T	ENSP00000216489:p.Asp142Asn	Somatic		x	x	x	77230865	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	CCDS32127.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543728	0.27563	.	.	ENSG00000100601	ENST00000216489	T	0.32753	1.44	6.04	4.22	0.49857	.	0.341305	0.37136	N	0.002238	T	0.17789	0.0427	N	0.16478	0.41	0.34238	D	0.677347	B	0.18013	0.025	B	0.20184	0.028	T	0.18116	-1.0347	10	0.11182	T	0.66	-20.016	12.2332	0.54500	0.0:0.8638:0.0:0.1362	.	142	Q13686	ALKB1_HUMAN	N	142	ENSP00000216489:D142N	ENSP00000216489:D142N	D	-	1	0	ALKBH1	77230865	0.183000	0.23186	0.020000	0.16555	0.996000	0.88848	0.725000	0.25970	1.557000	0.49525	0.563000	0.77884	GAT		0.423	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020		Missense_Mutation
PLCB2	5330	broad.mit.edu	37	15	40580971	40580971	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr15:40580971A>C	ENST00000260402.3	-	32	3752	c.3503T>G	c.(3502-3504)cTg>cGg	p.L1168R	PLCB2_ENST00000557821.1_Missense_Mutation_p.L1164R|PLCB2_ENST00000456256.2_Missense_Mutation_p.L1153R	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	1168					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.L1164R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CTGCTCACACAGCTCTGGGGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	15											43.0	49.0	47.0					15																	40580971		1958	4140	6098	38368263	SO:0001583	missense	5330				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.3503T>G	15.37:g.40580971A>C	ENSP00000260402:p.Leu1168Arg	Unknown		x	x	x	38368263	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	11.50	1.657622	0.29425	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.22134	1.99;1.97	5.62	-1.47	0.08772	.	4.156080	0.00424	N	0.000073	T	0.11965	0.0291	N	0.14661	0.345	0.09310	N	1	B;B;B	0.30973	0.201;0.302;0.201	B;B;B	0.29942	0.069;0.101;0.109	T	0.14008	-1.0488	10	0.21014	T	0.42	.	5.5029	0.16838	0.2917:0.0:0.5806:0.1277	.	1153;1164;1168	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	R	1168;1153	ENSP00000260402:L1168R;ENSP00000411991:L1153R	ENSP00000260402:L1168R	L	-	2	0	PLCB2	38368263	0.002000	0.14202	0.004000	0.12327	0.025000	0.11179	-0.515000	0.06290	-0.258000	0.09446	-0.441000	0.05720	CTG		0.627	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			Missense_Mutation
WDR90	197335	broad.mit.edu	37	16	703655	703656	+	Missense_Mutation	DNP	TT	TT	CC			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr16:703655_703656TT>CC	ENST00000293879.4	+	12	1364_1365	c.1364_1365TT>CC	c.(1363-1365)gTT>gCC	p.V455A	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.V455A			Q96KV7	WDR90_HUMAN	WD repeat domain 90	455								p.V455A(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCAATGCACGTTGTCTGCTCTC	0.629																																																1	Substitution - Missense(1)	ovary(1)	16																																								643657	SO:0001583	missense	197335			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	Exception_encountered	16.37:g.703655_703656delinsCC	ENSP00000293879:p.Val455Ala	Unknown		x	x	x	643656	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	DNP	ENST00000293879.4	37	CCDS42092.1	DNP	60	Broad																																																																																				0.629	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294		Missense_Mutation
RNPS1	10921	broad.mit.edu	37	16	2305708	2305708	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr16:2305708C>A	ENST00000565678.1	-	7	1241	c.696G>T	c.(694-696)gaG>gaT	p.E232D	RNPS1_ENST00000561718.1_Missense_Mutation_p.E55D|RNPS1_ENST00000566458.1_Missense_Mutation_p.E209D|RNPS1_ENST00000569598.2_Missense_Mutation_p.E138D|AC009065.1_ENST00000454671.1_Silent_p.I150I|RNPS1_ENST00000397086.2_Missense_Mutation_p.E232D|RNPS1_ENST00000566397.1_Missense_Mutation_p.E55D|RNPS1_ENST00000567147.1_Intron|RNPS1_ENST00000568631.1_Missense_Mutation_p.E232D|RNPS1_ENST00000301730.8_Missense_Mutation_p.E232D|RNPS1_ENST00000320225.5_Missense_Mutation_p.E232D			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	232	Interaction with SAP18 and ACIN1.|Necessary for interaction with PNN and exon-skipping.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E232D(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						TGGCAGTGATCTCCTGGCCAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	16											25.0	27.0	26.0					16																	2305708		2198	4300	6498	2245709	SO:0001583	missense	10921			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.696G>T	16.37:g.2305708C>A	ENSP00000457723:p.Glu232Asp	Unknown		x	x	x	2245709	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	ENST00000565678.1	37	CCDS10465.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	7.696	0.692114	0.15039	.	.	ENSG00000205937	ENST00000320225;ENST00000397086;ENST00000301730	T;T;T	0.18338	2.22;2.22;2.22	5.25	4.24	0.50183	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049952	0.85682	D	0.000000	T	0.28797	0.0714	L	0.48174	1.505	0.80722	D	1	B;P	0.47604	0.39;0.898	P;P	0.60415	0.537;0.874	T	0.01133	-1.1441	10	0.37606	T	0.19	.	10.4996	0.44798	0.0:0.8967:0.0:0.1033	.	209;232	Q15287-2;Q15287	.;RNPS1_HUMAN	D	232	ENSP00000315859:E232D;ENSP00000380275:E232D;ENSP00000301730:E232D	ENSP00000301730:E232D	E	-	3	2	RNPS1	2245709	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.491000	0.35583	1.316000	0.45131	0.446000	0.29264	GAG		0.547	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435415.1	NM_080594		Missense_Mutation
PAQR4	124222	broad.mit.edu	37	16	3021896	3021897	+	Missense_Mutation	DNP	GG	GG	CT	rs142699591|rs144862584		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr16:3021896_3021897GG>CT	ENST00000318782.8	+	3	1199_1200	c.769_770GG>CT	c.(769-771)GGc>CTc	p.G257L	PAQR4_ENST00000293978.8_Missense_Mutation_p.G218L|PAQR4_ENST00000574988.1_Missense_Mutation_p.G190L|PAQR4_ENST00000572687.1_Missense_Mutation_p.G183L|PKMYT1_ENST00000431515.2_Intron|PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000576565.1_Missense_Mutation_p.G190L	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	257						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G257L(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						GCTGCACGCCGGCGTCGTGCCC	0.673																																																1	Substitution - Missense(1)	ovary(1)	16																																								2961898	SO:0001583	missense	124222				CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	Exception_encountered	16.37:g.3021896_3021897delinsCT	ENSP00000321804:p.Gly257Leu	Unknown		x	x	x	2961897	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	DNP	ENST00000318782.8	37	CCDS10485.1	DNP	39	Broad																																																																																				0.673	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341		Missense_Mutation
KATNB1	10300	broad.mit.edu	37	16	57787110	57787110	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr16:57787110T>G	ENST00000379661.3	+	11	1369	c.977T>G	c.(976-978)cTg>cGg	p.L326R		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1									p.L326R(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				GCACAGCCACTGCCCAACCCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	16											18.0	21.0	20.0					16																	57787110		2159	4217	6376	56344611	SO:0001583	missense	10300			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.977T>G	16.37:g.57787110T>G	ENSP00000368982:p.Leu326Arg	Unknown		x	x	x	56344611		Missense_Mutation	SNP	ENST00000379661.3	37	CCDS10788.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	t	0.518	-0.863437	0.02590	.	.	ENSG00000140854	ENST00000379661	T	0.52057	0.68	5.19	0.92	0.19397	.	1.380280	0.04441	N	0.370912	T	0.22859	0.0552	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17961	-1.0352	10	0.11794	T	0.64	-12.3583	6.262	0.20905	0.1277:0.6562:0.0:0.2161	.	326	Q9BVA0	KTNB1_HUMAN	R	326	ENSP00000368982:L326R	ENSP00000368982:L326R	L	+	2	0	KATNB1	56344611	0.000000	0.05858	0.003000	0.11579	0.049000	0.14656	-0.126000	0.10563	0.192000	0.20272	-0.212000	0.12691	CTG		0.701	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3			Missense_Mutation
METTL16	79066	broad.mit.edu	37	17	2323627	2323627	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr17:2323627G>A	ENST00000263092.6	-	10	1453	c.1326C>T	c.(1324-1326)gcC>gcT	p.A442A	METTL16_ENST00000538844.1_Silent_p.A224A|METTL16_ENST00000571669.2_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	442							methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.A442A(1)		kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						CCTCCACAGCGGCAGCCTCGC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	17											61.0	68.0	66.0					17																	2323627		1847	4079	5926	2270377	SO:0001819	synonymous_variant	79066			AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.1326C>T	17.37:g.2323627G>A		Unknown		x	x	x	2270377	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Silent	SNP	ENST00000263092.6	37	CCDS42232.1	SNP	39	Broad																																																																																				0.657	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437653.2	NM_024086		Silent
OR3A1	4994	broad.mit.edu	37	17	3195235	3195235	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr17:3195235C>T	ENST00000323404.1	-	1	641	c.642G>A	c.(640-642)atG>atA	p.M214I	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	214					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M214I(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						CAATGAGAGCCATGGGGGTAC	0.542																																					GBM(20;287 516 18743 28660 36594)											1	Substitution - Missense(1)	ovary(1)	17											64.0	61.0	62.0					17																	3195235		2203	4300	6503	3141985	SO:0001583	missense	4994			X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.642G>A	17.37:g.3195235C>T	ENSP00000313803:p.Met214Ile	Unknown		x	x	x	3141985	Q4VB06|Q6IFM4	Missense_Mutation	SNP	ENST00000323404.1	37	CCDS11023.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	7.554	0.663268	0.14710	.	.	ENSG00000180090	ENST00000323404	T	0.36340	1.26	5.01	3.97	0.46021	GPCR, rhodopsin-like superfamily (1);	0.820942	0.10921	N	0.619493	T	0.13713	0.0332	N	0.02192	-0.645	0.09310	N	1	B	0.15930	0.015	B	0.22386	0.039	T	0.19063	-1.0317	10	0.21540	T	0.41	-2.9939	3.6395	0.08162	0.1712:0.5743:0.1648:0.0897	.	214	P47881	OR3A1_HUMAN	I	214	ENSP00000313803:M214I	ENSP00000313803:M214I	M	-	3	0	OR3A1	3141985	0.000000	0.05858	0.719000	0.30619	0.378000	0.30076	-0.340000	0.07821	2.753000	0.94483	0.650000	0.86243	ATG		0.542	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2			Missense_Mutation
CHRNB1	1140	broad.mit.edu	37	17	7348475	7348475	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr17:7348475T>C	ENST00000306071.2	+	1	96	c.29T>C	c.(28-30)cTg>cCg	p.L10P	RP11-104H15.8_ENST00000576615.1_RNA|CHRNB1_ENST00000536404.2_5'Flank|RP11-104H15.7_ENST00000575310.1_RNA|CHRNB1_ENST00000576360.1_5'Flank|RP11-104H15.10_ENST00000575331.1_RNA	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	10					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)	p.L10P(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	CTGATGCTGCTGGGGGCGCTG	0.692																																																1	Substitution - Missense(1)	ovary(1)	17											9.0	12.0	11.0					17																	7348475		2065	4174	6239	7289199	SO:0001583	missense	1140			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.29T>C	17.37:g.7348475T>C	ENSP00000304290:p.Leu10Pro	Unknown		x	x	x	7289199	B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	ENST00000306071.2	37	CCDS11106.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345668	0.41498	.	.	ENSG00000170175	ENST00000306071	T	0.81163	-1.46	4.78	4.78	0.61160	.	0.713569	0.11856	N	0.522838	D	0.84151	0.5409	L	0.39898	1.24	0.80722	D	1	D	0.69078	0.997	D	0.65573	0.936	T	0.82176	-0.0587	10	0.66056	D	0.02	.	10.6285	0.45521	0.0:0.0:0.0:1.0	.	10	P11230	ACHB_HUMAN	P	10	ENSP00000304290:L10P	ENSP00000304290:L10P	L	+	2	0	CHRNB1	7289199	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	1.389000	0.34453	2.015000	0.59207	0.533000	0.62120	CTG		0.692	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3			Missense_Mutation
KCNH6	81033	broad.mit.edu	37	17	61601672	61601672	+	Silent	SNP	G	G	T	rs141876437		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr17:61601672G>T	ENST00000583023.1	+	2	260	c.249G>T	c.(247-249)gcG>gcT	p.A83A	KCNH6_ENST00000581784.1_Silent_p.A83A|KCNH6_ENST00000580652.1_Silent_p.A83A|KCNH6_ENST00000456941.2_Silent_p.A83A|KCNH6_ENST00000314672.5_Silent_p.A83A	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	83					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.A83A(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCCGCCTAGCGCAGGCCCTGC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											71.0	63.0	66.0					17																	61601672		2203	4300	6503	58955404	SO:0001819	synonymous_variant	81033			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.249G>T	17.37:g.61601672G>T		Unknown		x	x	x	58955404	Q9BRD7	Silent	SNP	ENST00000583023.1	37	CCDS11638.1	SNP	38	Broad																																																																																				0.627	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779		Silent
ANKRD12	23253	broad.mit.edu	37	18	9208762	9208762	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr18:9208762G>A	ENST00000262126.4	+	5	652	c.412G>A	c.(412-414)Gca>Aca	p.A138T	ANKRD12_ENST00000540578.2_3'UTR|ANKRD12_ENST00000400020.3_Missense_Mutation_p.A115T|ANKRD12_ENST00000383440.2_Missense_Mutation_p.A115T	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	138						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A138T(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAAACAGATGGCACTTCTTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	18											216.0	189.0	198.0					18																	9208762		2203	4300	6503	9198762	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.412G>A	18.37:g.9208762G>A	ENSP00000262126:p.Ala138Thr	Unknown		x	x	x	9198762	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755322	0.69648	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.56275	3.41;0.47;3.34	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.992;0.998;0.996	T	0.67608	-0.5627	10	0.72032	D	0.01	-22.3531	20.0951	0.97834	0.0:0.0:1.0:0.0	.	138;115;138	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	T	115;115;138;138	ENSP00000372932:A115T;ENSP00000441510:A115T;ENSP00000262126:A138T	ENSP00000262126:A138T	A	+	1	0	ANKRD12	9198762	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.869000	0.99810	2.753000	0.94483	0.467000	0.42956	GCA		0.413	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		Missense_Mutation
SMAD7	4092	broad.mit.edu	37	18	46476315	46476315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr18:46476315G>T	ENST00000262158.2	-	1	766	c.480C>A	c.(478-480)tgC>tgA	p.C160*	SMAD7_ENST00000591805.1_5'Flank|SMAD7_ENST00000589634.1_Nonsense_Mutation_p.C160*	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	160	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.C160*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					TGAACACTTTGCACAGCAGGA	0.672											OREG0024975	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	18											38.0	42.0	40.0					18																	46476315		2203	4300	6503	44730313	SO:0001587	stop_gained	4092			AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.480C>A	18.37:g.46476315G>T	ENSP00000262158:p.Cys160*	Unknown	939	x	x	x	44730313	B7Z773|K7EQ10|O14740|Q6DK23	Nonsense_Mutation	SNP	ENST00000262158.2	37	CCDS11936.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	41	8.559874	0.98863	.	.	ENSG00000101665	ENST00000262158	.	.	.	4.7	4.7	0.59300	.	0.112759	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2154	0.82211	0.0:0.0:1.0:0.0	.	.	.	.	X	160	.	ENSP00000262158:C160X	C	-	3	2	SMAD7	44730313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.557000	0.60782	2.158000	0.67659	0.561000	0.74099	TGC		0.672	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255906.1	NM_005904		Nonsense_Mutation
SMARCA4	6597	broad.mit.edu	37	19	11144525	11144526	+	Missense_Mutation	DNP	AG	AG	CA			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:11144525_11144526AG>CA	ENST00000429416.3	+	28	4138_4139	c.3857_3858AG>CA	c.(3856-3858)gAG>gCA	p.E1286A	SMARCA4_ENST00000450717.3_Intron|SMARCA4_ENST00000444061.3_Intron|SMARCA4_ENST00000413806.3_Intron|SMARCA4_ENST00000589677.1_Intron|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E1286A|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E1286A|SMARCA4_ENST00000541122.2_Intron|SMARCA4_ENST00000590574.1_Intron|SMARCA4_ENST00000538456.3_Intron	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1286					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.E1286A(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				cccgacttggaggagccacctc	0.629			"""F, N, Mis"""		NSCLC																																		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|lung(1)	19																																								11005526	SO:0001583	missense	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	Exception_encountered	19.37:g.11144525_11144526delinsCA	ENSP00000395654:p.Glu1286Ala	Unknown		x	x	x	11005525	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	DNP	ENST00000429416.3	37	CCDS12253.1	DNP	11	Broad																																																																																				0.629	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072		Missense_Mutation
AKAP8	10270	broad.mit.edu	37	19	15483906	15483906	+	Missense_Mutation	SNP	C	C	A	rs111389458	byFrequency	TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:15483906C>A	ENST00000269701.2	-	5	677	c.617G>T	c.(616-618)cGc>cTc	p.R206L		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	206					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R206L(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						GGGGTCGCTGCGCATGAAGGT	0.721																																					GBM(190;1671 2163 3274 27186 30476)											1	Substitution - Missense(1)	ovary(1)	19											11.0	14.0	13.0					19																	15483906		2189	4288	6477	15344906	SO:0001583	missense	10270			Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.617G>T	19.37:g.15483906C>A	ENSP00000269701:p.Arg206Leu	Unknown		x	x	x	15344906		Missense_Mutation	SNP	ENST00000269701.2	37	CCDS12329.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	21.6	4.173747	0.78452	.	.	ENSG00000105127	ENST00000269701	T	0.58652	0.32	5.06	5.06	0.68205	.	0.000000	0.52532	D	0.000065	T	0.74898	0.3777	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.77632	-0.2515	10	0.72032	D	0.01	-26.9897	15.702	0.77549	0.0:1.0:0.0:0.0	.	206;206	Q8NE02;O43823	.;AKAP8_HUMAN	L	206	ENSP00000269701:R206L	ENSP00000269701:R206L	R	-	2	0	AKAP8	15344906	1.000000	0.71417	0.988000	0.46212	0.660000	0.38997	4.661000	0.61518	2.508000	0.84585	0.651000	0.88453	CGC		0.721	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858		Missense_Mutation
ANO8	57719	broad.mit.edu	37	19	17440630	17440630	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:17440630A>T	ENST00000159087.4	-	12	1498	c.1340T>A	c.(1339-1341)gTc>gAc	p.V447D		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	447	Leu-rich.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.V447D(1)		autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GTACGAGTTGACAAACTGGAA	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											54.0	44.0	47.0					19																	17440630		2203	4299	6502	17301630	SO:0001583	missense	57719			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.1340T>A	19.37:g.17440630A>T	ENSP00000159087:p.Val447Asp	Unknown		x	x	x	17301630	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	23.0	4.366216	0.82463	.	.	ENSG00000074855	ENST00000159087	T	0.70516	-0.49	4.33	4.33	0.51752	.	0.222936	0.36628	N	0.002487	D	0.85940	0.5814	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88440	0.3041	10	0.87932	D	0	.	11.5173	0.50529	1.0:0.0:0.0:0.0	.	447	Q9HCE9	ANO8_HUMAN	D	447	ENSP00000159087:V447D	ENSP00000159087:V447D	V	-	2	0	ANO8	17301630	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	6.746000	0.74866	1.615000	0.50252	0.397000	0.26171	GTC		0.612	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644		Missense_Mutation
KCNN1	3780	broad.mit.edu	37	19	18084992	18084992	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:18084992C>G	ENST00000222249.9	+	3	614	c.295C>G	c.(295-297)Ctc>Gtc	p.L99V	RNA5SP468_ENST00000516782.1_RNA	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	99					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.L116V(1)		endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCGGCGGGCGCTCTTCGAGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											26.0	35.0	32.0					19																	18084992		2000	4166	6166	17945992	SO:0001583	missense	3780			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.295C>G	19.37:g.18084992C>G	ENSP00000476519:p.Leu99Val	Unknown		x	x	x	17945992	Q5KR10|Q6DJU4	Missense_Mutation	SNP	ENST00000222249.9	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509672	0.85282	.	.	ENSG00000105642	ENST00000222249;ENST00000536713	.	.	.	4.52	4.52	0.55395	Potassium channel, calcium-activated, SK, conserved region (1);	0.000000	0.64402	D	0.000001	D	0.84306	0.5443	M	0.90369	3.11	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.87845	0.2654	9	0.87932	D	0	-28.15	14.7558	0.69564	0.0:1.0:0.0:0.0	.	99	Q92952	KCNN1_HUMAN	V	116;99	.	ENSP00000222249:L116V	L	+	1	0	KCNN1	17945992	1.000000	0.71417	0.425000	0.26659	0.953000	0.61014	7.466000	0.80914	2.334000	0.79466	0.561000	0.74099	CTC		0.627	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248		Missense_Mutation
NUDT19	390916	broad.mit.edu	37	19	33183390	33183391	+	Missense_Mutation	DNP	CG	CG	AC	rs569908996		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:33183390_33183391CG>AC	ENST00000397061.3	+	1	524_525	c.524_525CG>AC	c.(523-525)cCG>cAC	p.P175H	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	175	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)	p.P175H(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					CGCCAGGACCCGCGCCACTTCC	0.743																																																1	Substitution - Missense(1)	ovary(1)	19																																								37875231	SO:0001583	missense	390916				CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		Exception_encountered	19.37:g.33183390_33183391delinsAC	ENSP00000380251:p.Pro175His	Unknown		x	x	x	37875230		Missense_Mutation	DNP	ENST00000397061.3	37	CCDS42543.1	DNP	23	Broad																																																																																				0.743	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723		Missense_Mutation
IRGQ	126298	broad.mit.edu	37	19	44097194	44097194	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:44097194T>G	ENST00000602269.1	-	2	1041	c.856A>C	c.(856-858)Acc>Ccc	p.T286P	IRGQ_ENST00000422989.1_Missense_Mutation_p.T286P|L34079.2_ENST00000594374.1_5'Flank|IRGQ_ENST00000601520.1_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	286	IRG-type G.							p.T286P(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				GCCGCGGTGGTGGCAGTGCCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	19											27.0	28.0	27.0					19																	44097194		2202	4298	6500	48789034	SO:0001583	missense	126298			AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.856A>C	19.37:g.44097194T>G	ENSP00000472250:p.Thr286Pro	Unknown		x	x	x	48789034	B2RNP3	Missense_Mutation	SNP	ENST00000602269.1	37	CCDS33040.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	2.592	-0.294939	0.05568	.	.	ENSG00000167378	ENST00000422989	T	0.42900	0.96	2.15	-1.84	0.07809	.	0.453294	0.20486	N	0.091392	T	0.14614	0.0353	N	0.08118	0	0.09310	N	1	B	0.29716	0.255	B	0.26969	0.075	T	0.14090	-1.0485	10	0.21540	T	0.41	.	2.3528	0.04288	0.2516:0.3931:0.0:0.3553	.	286	Q8WZA9	IRGQ_HUMAN	P	286	ENSP00000387535:T286P	ENSP00000387535:T286P	T	-	1	0	IRGQ	48789034	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-0.719000	0.04974	-0.538000	0.06281	0.533000	0.62120	ACC		0.701	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561		Missense_Mutation
FCAR	2204	broad.mit.edu	37	19	55401079	55401079	+	Silent	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:55401079C>T	ENST00000355524.3	+	5	724	c.714C>T	c.(712-714)ctC>ctT	p.L238L	FCAR_ENST00000353758.4_Silent_p.L129L|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391726.3_Silent_p.L130L|FCAR_ENST00000391724.3_Silent_p.L204L|FCAR_ENST00000359272.4_Silent_p.L226L|FCAR_ENST00000391723.3_Missense_Mutation_p.R202C|FCAR_ENST00000391725.3_Silent_p.L216L|FCAR_ENST00000345937.4_Silent_p.L142L	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	238					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L238L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GACTGGTCCTCGTGGCTCTCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	19											280.0	272.0	274.0					19																	55401079		2203	4300	6503	60092891	SO:0001819	synonymous_variant	2204			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.714C>T	19.37:g.55401079C>T		Unknown		x	x	x	60092891	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	11.19	1.567171	0.28003	.	.	ENSG00000186431	ENST00000391723	T	0.00594	6.33	3.8	-7.6	0.01303	.	.	.	.	.	T	0.00468	0.0015	.	.	.	0.20074	N	0.999939	B	0.02656	0.0	B	0.01281	0.0	T	0.44620	-0.9316	8	0.87932	D	0	.	4.4982	0.11851	0.0915:0.1127:0.4212:0.3746	.	202	Q92588	.	C	202	ENSP00000375603:R202C	ENSP00000375603:R202C	R	+	1	0	FCAR	60092891	0.000000	0.05858	0.000000	0.03702	0.580000	0.36256	-2.945000	0.00681	-4.119000	0.00072	-0.262000	0.10625	CGT		0.542	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000		Missense_Mutation
BRSK1	84446	broad.mit.edu	37	19	55814187	55814187	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:55814187G>A	ENST00000309383.1	+	10	1257	c.980G>A	c.(979-981)gGc>gAc	p.G327D	BRSK1_ENST00000326848.7_Missense_Mutation_p.G22D|BRSK1_ENST00000590333.1_Missense_Mutation_p.G343D|BRSK1_ENST00000585418.1_Missense_Mutation_p.G327D	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	327	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.G327D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		GCATCACTGGGCTGCTTCAGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											62.0	52.0	55.0					19																	55814187		2203	4300	6503	60505999	SO:0001583	missense	84446			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.980G>A	19.37:g.55814187G>A	ENSP00000310649:p.Gly327Asp	Somatic		x	x	x	60505999	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	CCDS12921.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	.	29.3	4.991245	0.93106	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.74002	-0.8;0.51	4.69	4.69	0.59074	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.000000	0.85682	D	0.000000	D	0.86678	0.5990	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88843	0.3314	10	0.87932	D	0	.	16.7703	0.85535	0.0:0.0:1.0:0.0	.	327;343	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	D	327;22;22	ENSP00000310649:G327D;ENSP00000320853:G22D	ENSP00000310649:G327D	G	+	2	0	BRSK1	60505999	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.347000	0.97059	2.345000	0.79718	0.655000	0.94253	GGC		0.682	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430		Missense_Mutation
NLRP5	126206	broad.mit.edu	37	19	56538441	56538441	+	Missense_Mutation	SNP	C	C	T	rs45627733	byFrequency	TCGA-04-1342-01	TCGA-04-1342-11			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr19:56538441C>T	ENST00000390649.3	+	7	842	c.842C>T	c.(841-843)aCg>aTg	p.T281M		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	281	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.T281M(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CGGCCTCGCACGGTGGTTCTG	0.552													C|||	5	0.000998403	0.0008	0.0	5008	,	,		19235	0.0		0.004	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						C	MET/THR	2,4076		0,2,2037	48.0	51.0	50.0		842	3.3	0.1	19	dbSNP_127	50	15,8337		0,15,4161	yes	missense	NLRP5	NM_153447.4	81	0,17,6198	TT,TC,CC		0.1796,0.049,0.1368	probably-damaging	281/1201	56538441	17,12413	2039	4176	6215	61230253	SO:0001583	missense	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.842C>T	19.37:g.56538441C>T	ENSP00000375063:p.Thr281Met	Somatic		x	x	x	61230253	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	SNP	19	Broad	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	13.96	2.392367	0.42410	4.9E-4	0.001796	ENSG00000171487	ENST00000390649	T	0.80393	-1.37	3.35	3.35	0.38373	NACHT nucleoside triphosphatase (1);	0.000000	0.38111	N	0.001820	D	0.87478	0.6187	M	0.76002	2.32	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77879	-0.2423	10	0.87932	D	0	.	10.4875	0.44731	0.0:1.0:0.0:0.0	rs45627733	281	P59047	NALP5_HUMAN	M	281	ENSP00000375063:T281M	ENSP00000375063:T281M	T	+	2	0	NLRP5	61230253	0.039000	0.19947	0.051000	0.19133	0.003000	0.03518	0.688000	0.25422	2.167000	0.68274	0.655000	0.94253	ACG		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447		Missense_Mutation
GTF2A1L	11036	broad.mit.edu	37	2	48873885	48873885	+	Missense_Mutation	SNP	G	G	A	rs61754876	byFrequency	TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr2:48873885G>A	ENST00000403751.3	+	6	719	c.682G>A	c.(682-684)Gtg>Atg	p.V228M	STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.V932M|LHCGR_ENST00000420913.3_Intron|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.V885M|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.V932M|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.V932M|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.V932M|GTF2A1L_ENST00000430487.2_Missense_Mutation_p.V194M	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	228					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.V932M(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCATAAAATCGTGCCTGAAGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	110.0	115.0					2																	48873885		2203	4300	6503	48727389	SO:0001583	missense	286749			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.682G>A	2.37:g.48873885G>A	ENSP00000384597:p.Val228Met	Unknown		x	x	x	48727389	B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	ENST00000403751.3	37	CCDS46281.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	3.154	-0.173515	0.06421	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000437125;ENST00000430487;ENST00000403751	T;T;T;T;T;T	0.47528	2.84;2.82;2.84;2.84;3.1;0.84	4.52	-5.33	0.02713	.	1.770990	0.03153	N	0.168183	T	0.16642	0.0400	N	0.00823	-1.155	0.09310	N	1	B;B;B;B;B	0.12013	0.005;0.003;0.002;0.004;0.001	B;B;B;B;B	0.11329	0.004;0.001;0.004;0.006;0.001	T	0.17653	-1.0362	10	0.41790	T	0.15	.	5.411	0.16349	0.336:0.299:0.3649:0.0	.	194;885;932;228;932	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	M	932;932;932;932;885;227;237;194;228	ENSP00000385499:V932M;ENSP00000385701:V932M;ENSP00000378236:V932M;ENSP00000311493:V932M;ENSP00000378234:V885M;ENSP00000396702:V237M	ENSP00000384597:V228M	V	+	1	0	STON1-GTF2A1L;GTF2A1L	48727389	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-0.850000	0.04317	-0.772000	0.04602	-0.948000	0.02665	GTG		0.413	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872		Missense_Mutation
SNRNP200	23020	broad.mit.edu	37	2	96957584	96957584	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr2:96957584G>A	ENST00000323853.5	-	17	2292	c.2215C>T	c.(2215-2217)Cgg>Tgg	p.R739W	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	739	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R739W(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CACATGTCCCGGATGGCCCTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	61.0	63.0					2																	96957584		2203	4300	6503	96321311	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.2215C>T	2.37:g.96957584G>A	ENSP00000317123:p.Arg739Trp	Somatic		x	x	x	96321311	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482628	0.84747	.	.	ENSG00000144028	ENST00000323853;ENST00000540328	T	0.76316	-1.01	6.17	6.17	0.99709	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	D	0.93031	0.6448	10	0.87932	D	0	-17.1617	12.9695	0.58505	0.0:0.0:0.7432:0.2568	.	739	O75643	U520_HUMAN	W	739;414	ENSP00000317123:R739W	ENSP00000317123:R739W	R	-	1	2	SNRNP200	96321311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.263000	0.51546	2.941000	0.99782	0.655000	0.94253	CGG		0.557	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Missense_Mutation
CNNM3	26505	broad.mit.edu	37	2	97482930	97482931	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr2:97482930_97482931AA>CT	ENST00000305510.3	+	1	944_945	c.916_917AA>CT	c.(916-918)AAg>CTg	p.K306L	CNNM3_ENST00000377060.3_Missense_Mutation_p.K306L	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3	306					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.K306L(1)		NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						CGATCTCAGCAAGGGCGTGCTG	0.743																																																1	Substitution - Missense(1)	ovary(1)	2																																								96846658	SO:0001583	missense	26505			AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	Exception_encountered	2.37:g.97482930_97482931delinsCT	ENSP00000305449:p.Lys306Leu	Unknown		x	x	x	96846657	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	Missense_Mutation	DNP	ENST00000305510.3	37	CCDS2025.1	DNP	5	Broad																																																																																				0.743	CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252952.2	NM_017623		Missense_Mutation
MARS2	92935	broad.mit.edu	37	2	198571596	198571596	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr2:198571596G>T	ENST00000282276.6	+	1	1510	c.1467G>T	c.(1465-1467)agG>agT	p.R489S	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	489					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.R489S(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	TTGTCCAAAGGCATGCACCAT	0.517																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	120.0	120.0					2																	198571596		2203	4300	6503	198279841	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1467G>T	2.37:g.198571596G>T	ENSP00000282276:p.Arg489Ser	Unknown		x	x	x	198279841	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	ENST00000282276.6	37	CCDS33358.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	2.890	-0.229868	0.06022	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.41065	1.01	5.07	4.15	0.48705	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.148930	0.56097	D	0.000024	T	0.29850	0.0746	L	0.37561	1.115	0.49798	D	0.99982	B	0.12013	0.005	B	0.15870	0.014	T	0.15809	-1.0424	10	0.59425	D	0.04	-16.1538	5.2826	0.15684	0.1091:0.0:0.6925:0.1984	.	489	Q96GW9	SYMM_HUMAN	S	489;416	ENSP00000282276:R489S	ENSP00000282276:R489S	R	+	3	2	MARS2	198279841	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.396000	0.20867	1.281000	0.44480	0.655000	0.94253	AGG		0.517	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395		Missense_Mutation
SLCO4A1	28231	broad.mit.edu	37	20	61297799	61297799	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr20:61297799G>C	ENST00000370507.1	+	6	1440	c.1344G>C	c.(1342-1344)agG>agC	p.R448S	RP11-93B14.5_ENST00000451648.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.R448S|RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000411824.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	448					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R448S(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ACAAGCTCAGGCTCCGGGGCT	0.637																																					Pancreas(168;741 2006 10379 40139 45334)											1	Substitution - Missense(1)	ovary(1)	20											123.0	119.0	120.0					20																	61297799		2203	4300	6503	60768244	SO:0001583	missense	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1344G>C	20.37:g.61297799G>C	ENSP00000359538:p.Arg448Ser	Unknown		x	x	x	60768244	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	CCDS13501.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375521	0.24857	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.39229	1.09;1.09	4.71	2.72	0.32119	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.316936	0.33712	N	0.004632	T	0.34221	0.0890	L	0.45137	1.4	0.33788	D	0.625129	B	0.33777	0.425	B	0.36766	0.232	T	0.44832	-0.9302	10	0.52906	T	0.07	.	7.8457	0.29424	0.2891:0.0:0.7109:0.0	.	448	Q96BD0	SO4A1_HUMAN	S	448;448;448;300	ENSP00000217159:R448S;ENSP00000359538:R448S	ENSP00000217159:R448S	R	+	3	2	SLCO4A1	60768244	1.000000	0.71417	0.988000	0.46212	0.189000	0.23516	0.759000	0.26461	0.400000	0.25396	0.561000	0.74099	AGG		0.637	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354		Missense_Mutation
DGCR2	9993	broad.mit.edu	37	22	19026556	19026556	+	Missense_Mutation	SNP	C	C	A	rs141421532	byFrequency	TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr22:19026556C>A	ENST00000263196.7	-	10	1722	c.1475G>T	c.(1474-1476)cGc>cTc	p.R492L	DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.R451L	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	492					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R492L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					CTGCTCCAGGCGCCGGAGTAA	0.657																																																1	Substitution - Missense(1)	ovary(1)	22											26.0	29.0	28.0					22																	19026556		2203	4298	6501	17406556	SO:0001583	missense	9993			D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1475G>T	22.37:g.19026556C>A	ENSP00000263196:p.Arg492Leu	Unknown		x	x	x	17406556	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	37	CCDS33598.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	5.870	0.344604	0.11126	.	.	ENSG00000070413	ENST00000537045;ENST00000263196	T;T	0.46451	0.87;0.87	5.43	-7.4	0.01397	.	1.097000	0.06712	N	0.773433	T	0.12092	0.0294	N	0.04043	-0.29	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24297	-1.0164	10	0.07482	T	0.82	.	0.7147	0.00930	0.2775:0.1422:0.1691:0.4113	.	448;492	B7Z3T5;P98153	.;IDD_HUMAN	L	451;492	ENSP00000440062:R451L;ENSP00000263196:R492L	ENSP00000263196:R492L	R	-	2	0	DGCR2	17406556	0.000000	0.05858	0.010000	0.14722	0.625000	0.37756	-0.608000	0.05641	-0.986000	0.03498	0.655000	0.94253	CGC		0.657	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137		Missense_Mutation
LZTR1	8216	broad.mit.edu	37	22	21336711	21336712	+	Missense_Mutation	DNP	AG	AG	CA			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr22:21336711_21336712AG>CA	ENST00000215739.8	+	1	410_411	c.51_52AG>CA	c.(49-54)gcAGgc>gcCAgc	p.G18S	LZTR1_ENST00000479606.1_Intron|XXbac-B135H6.18_ENST00000610278.1_lincRNA|LZTR1_ENST00000389355.3_Missense_Mutation_p.G18S	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	18					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G18S(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CGGCCCTGGCAGGCGGCGCGCG	0.693																																																1	Substitution - Missense(1)	ovary(1)	22																																								19666712	SO:0001583	missense	8216			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	Exception_encountered	22.37:g.21336711_21336712delinsCA	ENSP00000215739:p.Gly18Ser	Unknown		x	x	x	19666711	Q14776|Q20WK0	Missense_Mutation	DNP	ENST00000215739.8	37	CCDS33606.1	DNP	7	Broad																																																																																				0.693	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767		Missense_Mutation
MICALL1	85377	broad.mit.edu	37	22	38320678	38320678	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr22:38320678G>T	ENST00000215957.6	+	7	1162	c.1036G>T	c.(1036-1038)Gaa>Taa	p.E346*		NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	346	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)	p.E346K(1)|p.E346*(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					GAGACTGCACGAACTGCCTGT	0.642																																																2	Substitution - Nonsense(1)|Substitution - Missense(1)	ovary(1)|prostate(1)	22											74.0	73.0	73.0					22																	38320678		2203	4300	6503	36650624	SO:0001587	stop_gained	85377			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.1036G>T	22.37:g.38320678G>T	ENSP00000215957:p.Glu346*	Unknown		x	x	x	36650624	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Nonsense_Mutation	SNP	ENST00000215957.6	37	CCDS13961.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397612	0.83120	.	.	ENSG00000100139	ENST00000215957	.	.	.	5.08	5.08	0.68730	.	0.092366	0.46442	D	0.000296	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	15.1982	0.73112	0.0:0.0:1.0:0.0	.	.	.	.	X	346	.	ENSP00000215957:E346X	E	+	1	0	MICALL1	36650624	0.998000	0.40836	0.124000	0.21820	0.169000	0.22640	5.699000	0.68310	2.346000	0.79739	0.561000	0.74099	GAA		0.642	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386		Nonsense_Mutation
CHKB	1120	broad.mit.edu	37	22	51017932	51017933	+	Nonsense_Mutation	DNP	CA	CA	AC			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr22:51017932_51017933CA>AC	ENST00000406938.2	-	10	1252_1253	c.1035_1036TG>GT	c.(1033-1038)taTGct>taGTct	p.345_346YA>*S	CHKB-CPT1B_ENST00000453634.1_Nonsense_Mutation_p.10_11YA>*S|CHKB-CPT1B_ENST00000452668.1_Intron|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000312108.7_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CPT1B_ENST00000360719.2_5'Flank|CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000405237.3_5'Flank|CPT1B_ENST00000395650.2_5'Flank|CPT1B_ENST00000440709.1_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	345					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)	p.Y345*(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	GATGCCAGAGCATACCTGGGGG	0.53																																																1	Substitution - Nonsense(1)	ovary(1)	22																																								49364799	SO:0001587	stop_gained	1120			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.1035_1036delinsAC	22.37:g.51017932_51017933delinsAC	ENSP00000384400:p.Y345_A346delins*S	Unknown		x	x	x	49364798	A0PJM6|Q13388	Nonsense_Mutation	DNP	ENST00000406938.2	37	CCDS14099.1	DNP	25	Broad																																																																																				0.530	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198		Nonsense_Mutation
GRIP2	80852	broad.mit.edu	37	3	14536473	14536473	+	RNA	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr3:14536473G>A	ENST00000273083.3	-	0	2912							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.R951W(1)		endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						AAGTCATGCCGCATGGGGTCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	107.0	105.0					3																	14536473		2091	4205	6296	14511477			80852			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14536473G>A		Unknown		x	x	x	14511477	Q8TEH9|Q9H7H3	Missense_Mutation	SNP	ENST00000273083.3	37		SNP	38	Broad																																																																																				0.592	GRIP2-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000340582.2	NM_001080423		Missense_Mutation
SCN10A	6336	broad.mit.edu	37	3	38802218	38802218	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr3:38802218G>A	ENST00000449082.2	-	7	903	c.904C>T	c.(904-906)Cga>Tga	p.R302*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	302					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R302*(2)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GAAGTGCCTCGCTTATTTATG	0.458																																																2	Substitution - Nonsense(2)	ovary(1)|endometrium(1)	3											113.0	102.0	106.0					3																	38802218		2203	4300	6503	38777222	SO:0001587	stop_gained	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.904C>T	3.37:g.38802218G>A	ENSP00000390600:p.Arg302*	Unknown		x	x	x	38777222	A6NDQ1	Nonsense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433282	0.83776	.	.	ENSG00000185313	ENST00000449082	.	.	.	4.36	-2.59	0.06209	.	3.700920	0.04016	U	0.299077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	1.4459	0.02365	0.1636:0.243:0.3468:0.2467	.	.	.	.	X	302	.	ENSP00000390600:R302X	R	-	1	2	SCN10A	38777222	0.000000	0.05858	0.000000	0.03702	0.423000	0.31445	-1.493000	0.02298	-0.311000	0.08754	0.650000	0.86243	CGA		0.458	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		Nonsense_Mutation
LAMB2	3913	broad.mit.edu	37	3	49161168	49161168	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr3:49161168C>T	ENST00000418109.1	-	25	3954	c.3790G>A	c.(3790-3792)Gag>Aag	p.E1264K	LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.E1264K|USP19_ENST00000434032.2_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1264	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.E1264K(1)		NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACCGCAGCTCCTCTGTGGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											38.0	41.0	40.0					3																	49161168		2203	4300	6503	49136172	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3790G>A	3.37:g.49161168C>T	ENSP00000388325:p.Glu1264Lys	Unknown		x	x	x	49136172	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995967	0.54147	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	T;T	0.34072	1.38;1.38	5.69	5.69	0.88448	.	0.459093	0.24426	N	0.038635	T	0.31888	0.0811	L	0.40543	1.245	0.41436	D	0.987898	B	0.27559	0.181	B	0.18561	0.022	T	0.07966	-1.0745	10	0.18710	T	0.47	.	19.815	0.96564	0.0:1.0:0.0:0.0	.	1264	P55268	LAMB2_HUMAN	K	1264;1264;31	ENSP00000388325:E1264K;ENSP00000307156:E1264K	ENSP00000307156:E1264K	E	-	1	0	LAMB2	49136172	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.723000	0.84788	2.681000	0.91329	0.561000	0.74099	GAG		0.612	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		Missense_Mutation
BSN	8927	broad.mit.edu	37	3	49688124	49688124	+	Missense_Mutation	SNP	C	C	T	rs572736678		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr3:49688124C>T	ENST00000296452.4	+	4	1712	c.1598C>T	c.(1597-1599)cCg>cTg	p.P533L		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	533					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.P533L(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCCCTGCCGCCGCCCACCTCA	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13015	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											54.0	68.0	63.0					3																	49688124		2199	4291	6490	49663128	SO:0001583	missense	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.1598C>T	3.37:g.49688124C>T	ENSP00000296452:p.Pro533Leu	Unknown		x	x	x	49663128	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	0.765	-0.767755	0.02974	.	.	ENSG00000164061	ENST00000296452	T	0.17528	2.27	4.87	1.14	0.20703	.	0.671249	0.13897	N	0.355184	T	0.03520	0.0101	N	0.00583	-1.355	0.21064	N	0.999797	B	0.02656	0.0	B	0.01281	0.0	T	0.42137	-0.9469	10	0.15952	T	0.53	.	3.796	0.08740	0.1491:0.251:0.0:0.6	.	533	Q9UPA5	BSN_HUMAN	L	533	ENSP00000296452:P533L	ENSP00000296452:P533L	P	+	2	0	BSN	49663128	0.958000	0.32768	0.050000	0.19076	0.009000	0.06853	1.294000	0.33365	-0.035000	0.13691	-1.087000	0.02190	CCG		0.642	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		Missense_Mutation
ZNF721	170960	broad.mit.edu	37	4	436638	436638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr4:436638G>A	ENST00000338977.5	-	2	1630	c.1582C>T	c.(1582-1584)Cag>Tag	p.Q528*	ZNF721_ENST00000511833.2_Nonsense_Mutation_p.Q540*|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q310*(1)		endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ATTGCGGACTGTCTAAAGGCT	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	4											84.0	91.0	89.0					4																	436638		2109	4257	6366	426638	SO:0001587	stop_gained	170960			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1582C>T	4.37:g.436638G>A	ENSP00000340524:p.Gln528*	Unknown		x	x	x	426638	Q69YG7	Nonsense_Mutation	SNP	ENST00000338977.5	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617074	0.66672	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	.	.	.	0.701	-0.906	0.10524	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	1.6189	0.02709	0.2706:0.0:0.3957:0.3336	.	.	.	.	X	528;540	.	ENSP00000340524:Q528X	Q	-	1	0	ZNF721	426638	0.000000	0.05858	0.000000	0.03702	0.653000	0.38743	-1.439000	0.02414	-0.298000	0.08921	0.184000	0.17185	CAG		0.408	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474		Nonsense_Mutation
NELFA	7469	broad.mit.edu	37	4	1985221	1985221	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr4:1985221C>A	ENST00000411638.2	-	11	1427	c.1412G>T	c.(1411-1413)tGc>tTc	p.C471F	NELFA_ENST00000542778.1_Missense_Mutation_p.C336F|MIR943_ENST00000401286.1_RNA|NELFA_ENST00000382882.3_Missense_Mutation_p.C482F	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	471					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.C471F(1)									CTGCTCCTGGCACGGGTTCTC	0.662																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	94.0	94.0					4																	1985221		2203	4300	6503	1955019	SO:0001583	missense	7469			AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.1412G>T	4.37:g.1985221C>A	ENSP00000399165:p.Cys471Phe	Unknown		x	x	x	1955019	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600881	0.66332	.	.	ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000542778;ENST00000411638	T;T;T;T	0.60672	0.17;0.17;0.17;0.17	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.60521	0.2275	M	0.62016	1.91	0.80722	D	1	B	0.22851	0.076	B	0.30251	0.113	T	0.58194	-0.7679	10	0.40728	T	0.16	-23.4084	18.8421	0.92188	0.0:1.0:0.0:0.0	.	471	Q9H3P2	NELFA_HUMAN	F	482;475;336;471	ENSP00000372335:C482F;ENSP00000387647:C475F;ENSP00000445757:C336F;ENSP00000399165:C471F	ENSP00000372335:C482F	C	-	2	0	WHSC2	1955019	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.614000	0.82996	2.457000	0.83068	0.462000	0.41574	TGC		0.662	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473007.1	NM_005663		Missense_Mutation
RAB28	9364	broad.mit.edu	37	4	13383174	13383174	+	Missense_Mutation	SNP	G	G	A	rs139395840	byFrequency	TCGA-04-1342-01	TCGA-04-1342-11			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr4:13383174G>A	ENST00000330852.5	-	5	650	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	RAB28_ENST00000338176.4_Missense_Mutation_p.R146W|RAB28_ENST00000288723.4_Missense_Mutation_p.R146W	NM_001017979.2	NP_001017979.1	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family	146					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R146W(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	8						TGGCAAAACCGTAAGTGTTTT	0.328													G|||	4	0.000798722	0.003	0.0	5008	,	,		14322	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	4						G	TRP/ARG,TRP/ARG,TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	67.0	69.0	69.0		436,436,436	2.1	0.7	4	dbSNP_134	69	0,8600		0,0,4300	yes	missense,missense,missense	RAB28	NM_001017979.2,NM_001159601.1,NM_004249.3	101,101,101	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging,probably-damaging	146/222,146/205,146/221	13383174	4,13002	2203	4300	6503	12992272	SO:0001583	missense	9364			X94703	CCDS3409.1, CCDS33961.1, CCDS54741.1	4p16.1	2014-04-24			ENSG00000157869	ENSG00000157869		"""RAB, member RAS oncogene"""	9768	protein-coding gene	gene with protein product		612994				8647132	Standard	NM_004249		Approved		uc003gmu.2	P51157	OTTHUMG00000090543	ENST00000330852.5:c.436C>T	4.37:g.13383174G>A	ENSP00000328551:p.Arg146Trp	Somatic		x	x	x	12992272	G8JLC5|Q8IYR8|Q8NI05	Missense_Mutation	SNP	ENST00000330852.5	37	CCDS33961.1	SNP	40	Broad	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	19.70|19.70	3.877388|3.877388	0.72294|0.72294	9.08E-4|9.08E-4	0.0|0.0	ENSG00000157869|ENSG00000157869	ENST00000330852;ENST00000288723;ENST00000338176|ENST00000511649	T;T;T|.	0.77489|.	-1.1;-1.1;-1.1|.	5.87|5.87	2.09|2.09	0.27110|0.27110	Small GTP-binding protein domain (1);|.	0.119762|.	0.56097|.	N|.	0.000037|.	T|T	0.63908|0.63908	0.2551|0.2551	M|M	0.71871|0.71871	2.18|2.18	0.58432|0.58432	D|D	0.999997|0.999997	D;D|.	0.76494|.	0.999;0.999|.	P;P|.	0.61940|.	0.896;0.892|.	T|T	0.58498|0.58498	-0.7626|-0.7626	10|5	0.72032|.	D|.	0.01|.	.|.	9.5919|9.5919	0.39550|0.39550	0.0646:0.0:0.4075:0.5279|0.0646:0.0:0.4075:0.5279	.|.	146;146|.	P51157;P51157-2|.	RAB28_HUMAN;.|.	W|M	146|68	ENSP00000328551:R146W;ENSP00000288723:R146W;ENSP00000340079:R146W|.	ENSP00000288723:R146W|.	R|T	-|-	1|2	2|0	RAB28|RAB28	12992272|12992272	1.000000|1.000000	0.71417|0.71417	0.707000|0.707000	0.30419|0.30419	0.997000|0.997000	0.91878|0.91878	1.971000|1.971000	0.40530|0.40530	0.064000|0.064000	0.16427|0.16427	0.585000|0.585000	0.79938|0.79938	CGG|ACG		0.328	RAB28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207068.2	NM_001017979		Missense_Mutation
KIT	3815	broad.mit.edu	37	4	55604662	55604662	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1342-01	TCGA-04-1342-11			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr4:55604662T>C	ENST00000288135.5	+	21	2967	c.2870T>C	c.(2869-2871)aTc>aCc	p.I957T		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	957					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I957T(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTGTGCGGATCAATTCTGTC	0.527		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	ovary(1)	4											135.0	129.0	131.0					4																	55604662		2203	4300	6503	55299419	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2870T>C	4.37:g.55604662T>C	ENSP00000288135:p.Ile957Thr	Somatic		x	x	x	55299419	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303566	0.60195	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.77358	-1.09;-1.09	5.72	5.72	0.89469	.	0.137643	0.38381	N	0.001715	T	0.76428	0.3986	L	0.55481	1.735	0.46011	D	0.99881	B;P	0.36768	0.127;0.569	B;B	0.39771	0.139;0.309	T	0.78816	-0.2055	10	0.72032	D	0.01	.	14.2508	0.66019	0.0:0.0:0.0:1.0	.	953;957	P10721-2;P10721	.;KIT_HUMAN	T	957;953	ENSP00000288135:I957T;ENSP00000390987:I953T	ENSP00000288135:I957T	I	+	2	0	KIT	55299419	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	6.703000	0.74633	2.185000	0.69588	0.459000	0.35465	ATC		0.527	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Missense_Mutation
UGT2B17	7367	broad.mit.edu	37	4	69434111	69434111	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr4:69434111G>A	ENST00000317746.2	-	1	134	c.92C>T	c.(91-93)aCa>aTa	p.T31I		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	31					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.T31I(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	GCTGTATTCTGTGGGCCACAC	0.458																																					Melanoma(18;649 833 28984 37818 38500)											1	Substitution - Missense(1)	ovary(1)	4											190.0	190.0	190.0					4																	69434111		2102	3988	6090	69116706	SO:0001583	missense	7367			U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.92C>T	4.37:g.69434111G>A	ENSP00000320401:p.Thr31Ile	Somatic		x	x	x	69116706		Missense_Mutation	SNP	ENST00000317746.2	37	CCDS3523.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	g	8.593	0.885133	0.17540	.	.	ENSG00000197888	ENST00000317746	T	0.61274	0.12	2.54	-1.44	0.08856	.	0.168004	0.36778	U	0.002411	T	0.46580	0.1400	L	0.39566	1.225	0.09310	N	1	.	.	.	.	.	.	T	0.41875	-0.9484	8	0.42905	T	0.14	.	6.9481	0.24530	0.5619:0.0:0.4381:0.0	.	.	.	.	I	31	ENSP00000320401:T31I	ENSP00000320401:T31I	T	-	2	0	UGT2B17	69116706	0.000000	0.05858	0.004000	0.12327	0.971000	0.66376	0.248000	0.18198	-0.247000	0.09597	0.393000	0.25936	ACA		0.458	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251436.1	NM_001077		Missense_Mutation
SLC12A7	10723	broad.mit.edu	37	5	1076888	1076889	+	Nonsense_Mutation	DNP	CC	CC	GT			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:1076888_1076889CC>GT	ENST00000264930.5	-	13	1711_1712	c.1668_1669GG>AC	c.(1666-1671)tgGGcg>tgACcg	p.556_557WA>*P		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	556					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.W556*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGCAGCAGCGCCCACGTGGGCT	0.634																																																1	Substitution - Nonsense(1)	ovary(1)	5																																								1129889	SO:0001587	stop_gained	10723			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1668_1669delinsGT	5.37:g.1076888_1076889delinsGT	ENSP00000264930:p.W556_A557delins*P	Unknown		x	x	x	1129888	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Nonsense_Mutation	DNP	ENST00000264930.5	37	CCDS34129.1	DNP	26	Broad																																																																																				0.634	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598		Nonsense_Mutation
MTRR	4552	broad.mit.edu	37	5	7897055	7897055	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:7897055G>T	ENST00000264668.2	+	13	1866	c.1836G>T	c.(1834-1836)agG>agT	p.R612S	MTRR_ENST00000440940.2_Missense_Mutation_p.R585S	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	612					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)	p.R612S(1)		NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	ATAAGGATAGGGATTATCTAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	5											57.0	60.0	59.0					5																	7897055		2203	4300	6503	7950055	SO:0001583	missense	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1836G>T	5.37:g.7897055G>T	ENSP00000264668:p.Arg612Ser	Unknown		x	x	x	7950055	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548085	0.65311	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	T;T	0.77620	-1.11;-1.11	5.49	-0.487	0.12060	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.368957	0.35291	N	0.003302	T	0.69637	0.3133	N	0.25332	0.735	0.80722	D	1	D	0.59357	0.985	P	0.58820	0.846	T	0.63941	-0.6523	10	0.15066	T	0.55	-27.1968	5.7448	0.18114	0.6517:0.0:0.1904:0.1579	.	612	Q9UBK8	MTRR_HUMAN	S	612;585	ENSP00000264668:R612S;ENSP00000402510:R585S	ENSP00000264668:R612S	R	+	3	2	MTRR	7950055	0.996000	0.38824	0.095000	0.20976	0.958000	0.62258	0.727000	0.25999	-0.015000	0.14150	-0.345000	0.07892	AGG		0.363	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1			Missense_Mutation
ANKRD32	84250	broad.mit.edu	37	5	94031004	94031004	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:94031004T>C	ENST00000265140.5	+	21	3583	c.3164T>C	c.(3163-3165)aTg>aCg	p.M1055T	ANKRD32_ENST00000493934.1_Intron	NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	1055						centrosome (GO:0005813)|nucleus (GO:0005634)		p.M419T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		CGGTCAGTCATGGAGTTTTCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											149.0	151.0	151.0					5																	94031004		2146	4264	6410	94056760	SO:0001583	missense	84250			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.3164T>C	5.37:g.94031004T>C	ENSP00000265140:p.Met1055Thr	Unknown		x	x	x	94056760	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	CCDS4071.2	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	0.091	-1.167230	0.01660	.	.	ENSG00000133302	ENST00000265140	T	0.37752	1.18	5.55	2.7	0.31948	.	1.450950	0.04061	N	0.306306	T	0.12860	0.0312	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33777	-0.9855	10	0.02654	T	1	.	5.4602	0.16612	0.0:0.6128:0.1445:0.2427	.	1055	Q9BQI6	ANR32_HUMAN	T	1055	ENSP00000265140:M1055T	ENSP00000265140:M1055T	M	+	2	0	ANKRD32	94056760	0.329000	0.24696	0.974000	0.42286	0.967000	0.64934	0.012000	0.13287	0.717000	0.32145	-0.132000	0.14878	ATG		0.408	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290		Missense_Mutation
WDR36	134430	broad.mit.edu	37	5	110446633	110446633	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:110446633A>G	ENST00000513710.2	+	14	1760	c.1756A>G	c.(1756-1758)Atg>Gtg	p.M586V	WDR36_ENST00000505303.1_Missense_Mutation_p.M530V|WDR36_ENST00000506538.2_Missense_Mutation_p.M586V			Q8NI36	WDR36_HUMAN	WD repeat domain 36	586					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.M586V(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TCCAAATATCATGTTGCTACA	0.323																																																1	Substitution - Missense(1)	ovary(1)	5											77.0	81.0	80.0					5																	110446633		2202	4298	6500	110474532	SO:0001583	missense	134430			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1756A>G	5.37:g.110446633A>G	ENSP00000424628:p.Met586Val	Unknown		x	x	x	110474532	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	5.003	0.186324	0.09495	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.77877	-1.13;-1.13;-0.23	5.72	4.52	0.55395	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.426061	0.32328	N	0.006251	T	0.66761	0.2822	L	0.38531	1.155	0.30955	N	0.724308	B	0.12630	0.006	B	0.10450	0.005	T	0.65915	-0.6052	10	0.87932	D	0	-12.3979	7.3552	0.26714	0.7823:0.1459:0.0719:0.0	.	586	Q8NI36	WDR36_HUMAN	V	586;586;530	ENSP00000423067:M586V;ENSP00000424628:M586V;ENSP00000422158:M530V	ENSP00000422158:M530V	M	+	1	0	WDR36	110474532	0.994000	0.37717	0.971000	0.41717	0.519000	0.34347	2.538000	0.45710	0.943000	0.37553	0.528000	0.53228	ATG		0.323	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281		Missense_Mutation
CAMK4	814	broad.mit.edu	37	5	110819728	110819728	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1342-01	TCGA-04-1342-11			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:110819728C>A	ENST00000282356.4	+	11	1384	c.986C>A	c.(985-987)gCg>gAg	p.A329E	CAMK4_ENST00000512453.1_Missense_Mutation_p.A329E|CAMK4_ENST00000512890.1_3'UTR	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	329	Calmodulin-binding. {ECO:0000255}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.A329E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AATCAGGCAGCGGTGAAGGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											32.0	34.0	33.0					5																	110819728		2201	4295	6496	110847627	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.986C>A	5.37:g.110819728C>A	ENSP00000282356:p.Ala329Glu	Somatic		x	x	x	110847627	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022756	0.93462	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	T;T	0.69926	-0.44;-0.44	5.81	5.81	0.92471	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80944	0.4721	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81300	-0.0995	10	0.87932	D	0	.	20.0749	0.97738	0.0:1.0:0.0:0.0	.	329	Q16566	KCC4_HUMAN	E	329	ENSP00000422634:A329E;ENSP00000282356:A329E	ENSP00000282356:A329E	A	+	2	0	CAMK4	110847627	1.000000	0.71417	0.744000	0.31058	0.989000	0.77384	5.526000	0.67116	2.759000	0.94783	0.591000	0.81541	GCG		0.542	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744		Missense_Mutation
REEP2	51308	broad.mit.edu	37	5	137774925	137774925	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:137774925G>A	ENST00000254901.5	+	1	150	c.28G>A	c.(28-30)Gtg>Atg	p.V10M	REEP2_ENST00000506158.1_5'UTR|REEP2_ENST00000464751.2_3'UTR|REEP2_ENST00000378339.2_Missense_Mutation_p.V10M	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	10					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)		p.V10M(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CTCTCGCCTGGTGGTGTGAGT	0.731																																																1	Substitution - Missense(1)	ovary(1)	5											18.0	26.0	23.0					5																	137774925		1982	4122	6104	137802824	SO:0001583	missense	51308			AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.28G>A	5.37:g.137774925G>A	ENSP00000254901:p.Val10Met	Unknown		x	x	x	137802824	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	37	CCDS4205.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274342	0.80580	.	.	ENSG00000132563	ENST00000378339;ENST00000254901	D;D	0.93076	-3.16;-3.16	4.32	4.32	0.51571	.	0.151002	0.43416	D	0.000580	D	0.92893	0.7739	M	0.65320	2	0.80722	D	1	B;P	0.35307	0.318;0.494	B;B	0.39339	0.297;0.297	D	0.93549	0.6885	10	0.59425	D	0.04	-15.3107	17.2102	0.86929	0.0:0.0:1.0:0.0	.	10;10	A8K3D2;Q9BRK0	.;REEP2_HUMAN	M	10	ENSP00000367590:V10M;ENSP00000254901:V10M	ENSP00000254901:V10M	V	+	1	0	REEP2	137802824	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.560000	0.73950	2.118000	0.64928	0.485000	0.47835	GTG		0.731	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606		Missense_Mutation
PCDHA11	56138	broad.mit.edu	37	5	140249647	140249647	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:140249647A>G	ENST00000398640.2	+	1	959	c.959A>G	c.(958-960)cAg>cGg	p.Q320R	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	320	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTGAAGTACAGGCTACAGAT	0.413																																																0			5											52.0	59.0	56.0					5																	140249647		2064	4228	6292	140229831	SO:0001583	missense	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.959A>G	5.37:g.140249647A>G	ENSP00000381636:p.Gln320Arg	Unknown		x	x	x	140229831	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	12.12	1.841880	0.32513	.	.	ENSG00000249158	ENST00000398640	T	0.60548	0.18	5.73	3.22	0.36961	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.55545	0.1927	L	0.35341	1.055	0.18873	N	0.999981	P;B	0.35348	0.496;0.118	P;P	0.45946	0.467;0.498	T	0.51903	-0.8646	9	0.72032	D	0.01	.	10.1787	0.42955	0.606:0.0:0.0:0.394	.	320;320	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	R	320	ENSP00000381636:Q320R	ENSP00000381636:Q320R	Q	+	2	0	PCDHA11	140229831	0.000000	0.05858	0.998000	0.56505	0.970000	0.65996	1.512000	0.35812	0.382000	0.24878	0.460000	0.39030	CAG		0.413	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902		Missense_Mutation
PCDHB14	56122	broad.mit.edu	37	5	140604613	140604613	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:140604613C>G	ENST00000239449.4	+	1	1536	c.1536C>G	c.(1534-1536)caC>caG	p.H512Q	PCDHB14_ENST00000515856.2_Missense_Mutation_p.H359Q	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H512Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAATGGCCACCTGTTTGCCC	0.672																																					Ovarian(141;50 1831 27899 33809 37648)											1	Substitution - Missense(1)	ovary(1)	5											100.0	104.0	103.0					5																	140604613		2203	4300	6503	140584797	SO:0001583	missense	56122			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1536C>G	5.37:g.140604613C>G	ENSP00000239449:p.His512Gln	Unknown		x	x	x	140584797	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	-	0.001	-2.889453	0.00060	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.01705	4.68;4.68	4.15	-2.23	0.06930	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01254	0.0041	N	0.10645	0.015	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.46247	-0.9205	9	0.36615	T	0.2	.	12.0001	0.53226	0.0:0.2068:0.6562:0.1371	.	512	Q9Y5E9	PCDBE_HUMAN	Q	359;512	ENSP00000444518:H359Q;ENSP00000239449:H512Q	ENSP00000239449:H512Q	H	+	3	2	PCDHB14	140584797	0.000000	0.05858	0.892000	0.35008	0.115000	0.19883	-1.633000	0.02022	-0.283000	0.09115	-0.314000	0.08810	CAC		0.672	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		Missense_Mutation
SH3PXD2B	285590	broad.mit.edu	37	5	171765936	171765936	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr5:171765936A>C	ENST00000311601.5	-	13	2343	c.2173T>G	c.(2173-2175)Tcc>Gcc	p.S725A	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	725					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.S725A(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCTCTGCAGGAAATCTCTTTT	0.627																																																1	Substitution - Missense(1)	ovary(1)	5											37.0	41.0	40.0					5																	171765936		2203	4300	6503	171698541	SO:0001583	missense	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2173T>G	5.37:g.171765936A>C	ENSP00000309714:p.Ser725Ala	Unknown		x	x	x	171698541	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	1.619	-0.522042	0.04171	.	.	ENSG00000174705	ENST00000311601	T	0.60424	0.19	5.42	-5.97	0.02227	.	1.382880	0.04422	N	0.367776	T	0.38772	0.1053	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23619	-1.0183	9	.	.	.	-1.4909	11.2014	0.48743	0.1713:0.2735:0.5551:0.0	.	725	A1X283	SPD2B_HUMAN	A	725	ENSP00000309714:S725A	.	S	-	1	0	SH3PXD2B	171698541	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.609000	0.05635	-1.240000	0.02529	0.459000	0.35465	TCC		0.627	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963		Missense_Mutation
KCND2	3751	broad.mit.edu	37	7	119915568	119915568	+	Silent	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr7:119915568C>G	ENST00000331113.4	+	1	1847	c.882C>G	c.(880-882)gtC>gtG	p.V294V		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	294					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.V294V(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CACTCCGAGTCTTCCGGGTCT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	7											104.0	89.0	94.0					7																	119915568		2203	4300	6503	119702804	SO:0001819	synonymous_variant	3751			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.882C>G	7.37:g.119915568C>G		Unknown		x	x	x	119702804	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	CCDS5776.1	SNP	32	Broad																																																																																				0.527	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		Silent
FEZF1	389549	broad.mit.edu	37	7	121943234	121943234	+	Silent	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr7:121943234C>T	ENST00000442488.2	-	2	1000	c.933G>A	c.(931-933)acG>acA	p.T311T	FEZF1-AS1_ENST00000437317.1_RNA|FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000331178.4_Silent_p.T307T|FEZF1_ENST00000427185.2_Silent_p.T261T	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	311					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.T307T(1)		breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						AACACACCTGCGTGTGAATGA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	7											140.0	134.0	136.0					7																	121943234		2203	4300	6503	121730470	SO:0001819	synonymous_variant	389549			AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.933G>A	7.37:g.121943234C>T		Unknown		x	x	x	121730470	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Silent	SNP	ENST00000442488.2	37	CCDS34741.2	SNP	27	Broad																																																																																				0.458	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613		Silent
GDF6	392255	broad.mit.edu	37	8	97172702	97172702	+	Silent	SNP	G	G	A			TCGA-04-1342-01	TCGA-04-1342-11			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr8:97172702G>A	ENST00000287020.5	-	1	318	c.219C>T	c.(217-219)gaC>gaT	p.D73D		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	73					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.D73D(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					CCCGGGGTTCGTCCTGAGGCC	0.701																																																1	Substitution - coding silent(1)	ovary(1)	8											37.0	45.0	42.0					8																	97172702		2195	4289	6484	97241878	SO:0001819	synonymous_variant	392255				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.219C>T	8.37:g.97172702G>A		Somatic		x	x	x	97241878	Q6PI58	Silent	SNP	ENST00000287020.5	37	CCDS34926.1	SNP	40	Broad																																																																																				0.701	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557		Silent
PLEC	5339	broad.mit.edu	37	8	145006392	145006392	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr8:145006392C>T	ENST00000322810.4	-	17	2568	c.2399G>A	c.(2398-2400)cGg>cAg	p.R800Q	PLEC_ENST00000354589.3_Missense_Mutation_p.R663Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R631Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R690Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R667Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R663Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R641Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R649Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R686Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	800	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.R800Q(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTCCAGCTCCCGCATCAGCGC	0.687																																																1	Substitution - Missense(1)	ovary(1)	8											19.0	23.0	22.0					8																	145006392		1954	4129	6083	145078380	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2399G>A	8.37:g.145006392C>T	ENSP00000323856:p.Arg800Gln	Unknown		x	x	x	145078380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	13.50	2.257074	0.39896	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	4.42	3.53	0.40419	.	0.000000	0.53938	U	0.000044	T	0.57888	0.2084	M	0.64997	1.995	0.46874	D	0.999231	P;P;P;P;P;P;P;P	0.50819	0.939;0.939;0.939;0.899;0.939;0.939;0.939;0.939	B;B;B;B;B;B;B;B	0.36289	0.221;0.221;0.221;0.11;0.221;0.221;0.221;0.221	T	0.61579	-0.7034	10	0.45353	T	0.12	.	11.7028	0.51581	0.0:0.9106:0.0:0.0894	.	690;649;641;800;631;663;667;663	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	663;667;663;631;800;641;649;690;686	ENSP00000344848:R663Q;ENSP00000350277:R667Q;ENSP00000346602:R663Q;ENSP00000381756:R631Q;ENSP00000323856:R800Q;ENSP00000347044:R641Q;ENSP00000348702:R649Q;ENSP00000388180:R690Q;ENSP00000434583:R686Q	ENSP00000323856:R800Q	R	-	2	0	PLEC	145078380	0.619000	0.27059	0.885000	0.34714	0.452000	0.32318	1.243000	0.32767	1.083000	0.41159	0.453000	0.30009	CGG		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		Missense_Mutation
S1PR3	1903	broad.mit.edu	37	9	91617112	91617112	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:91617112G>C	ENST00000375846.3	+	1	5692	c.997G>C	c.(997-999)Gac>Cac	p.D333H	S1PR3_ENST00000358157.2_Missense_Mutation_p.D333H			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	333					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.D333H(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						GCCTGCGCTCGACCCAAGCAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											53.0	58.0	56.0					9																	91617112		2203	4300	6503	90806932	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.997G>C	9.37:g.91617112G>C	ENSP00000365006:p.Asp333His	Unknown		x	x	x	90806932	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	ENST00000375846.3	37	CCDS6680.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	8.707	0.911116	0.17833	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.37584	1.19;1.19	5.15	3.23	0.37069	.	0.307428	0.35646	N	0.003074	T	0.26376	0.0644	L	0.29908	0.895	0.48830	D	0.999713	B	0.17667	0.023	B	0.18263	0.021	T	0.10222	-1.0639	10	0.54805	T	0.06	.	10.7649	0.46288	0.0717:0.131:0.7974:0.0	.	333	Q99500	S1PR3_HUMAN	H	333	ENSP00000350878:D333H;ENSP00000365006:D333H	ENSP00000350878:D333H	D	+	1	0	S1PR3	90806932	1.000000	0.71417	0.062000	0.19696	0.308000	0.27856	4.446000	0.60014	1.411000	0.46957	0.313000	0.20887	GAC		0.627	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052979.2	NM_005226		Missense_Mutation
C9orf129	445577	broad.mit.edu	37	9	96081452	96081452	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:96081452T>G	ENST00000375419.1	-	4	733	c.370A>C	c.(370-372)Aca>Cca	p.T124P	WNK2_ENST00000471076.1_Intron|WNK2_ENST00000395477.2_Intron|WNK2_ENST00000349097.3_Intron|WNK2_ENST00000395475.2_Intron|WNK2_ENST00000356055.3_Intron	NM_001098808.1	NP_001092278.1	Q5T035	CI129_HUMAN	chromosome 9 open reading frame 129	124								p.T124P(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(2)	6						CAATAGATTGTATATCTGAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	9											81.0	83.0	82.0					9																	96081452		1932	4136	6068	95121273	SO:0001583	missense	445577				CCDS43850.1	9q22.31	2012-04-02			ENSG00000204352	ENSG00000204352			31116	protein-coding gene	gene with protein product							Standard	NM_001098808		Approved	bA165J3.3	uc010mre.3	Q5T035	OTTHUMG00000020248	ENST00000375419.1:c.370A>C	9.37:g.96081452T>G	ENSP00000364568:p.Thr124Pro	Unknown		x	x	x	95121273		Missense_Mutation	SNP	ENST00000375419.1	37	CCDS43850.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563123	0.45694	.	.	ENSG00000204352	ENST00000375419	T	0.47528	0.84	5.41	5.41	0.78517	.	.	.	.	.	T	0.49457	0.1558	N	0.08118	0	0.28131	N	0.930189	D	0.76494	0.999	D	0.68192	0.956	T	0.53725	-0.8398	9	0.87932	D	0	.	14.9186	0.70818	0.0:0.0:0.0:1.0	.	124	Q5T035	CI129_HUMAN	P	124	ENSP00000364568:T124P	ENSP00000364568:T124P	T	-	1	0	C9orf129	95121273	1.000000	0.71417	0.134000	0.22075	0.471000	0.32888	5.058000	0.64300	2.171000	0.68590	0.482000	0.46254	ACA		0.453	C9orf129-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053147.1	NM_001098808		Missense_Mutation
PAPPA	5069	broad.mit.edu	37	9	119065126	119065126	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:119065126C>G	ENST00000328252.3	+	10	3413	c.3044C>G	c.(3043-3045)aCg>aGg	p.T1015R	PAPPA_ENST00000534838.1_Missense_Mutation_p.T53R|RP11-45A16.4_ENST00000451100.1_RNA	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1015					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T1015R(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGTGTCTACACGCCCCAGGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											124.0	108.0	113.0					9																	119065126		2203	4300	6503	118104947	SO:0001583	missense	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3044C>G	9.37:g.119065126C>G	ENSP00000330658:p.Thr1015Arg	Somatic		x	x	x	118104947	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	28.7	4.942695	0.92526	.	.	ENSG00000182752	ENST00000328252;ENST00000443904;ENST00000534838	T;T	0.54071	0.59;0.59	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.77287	0.4108	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.78494	-0.2182	10	0.87932	D	0	-10.923	20.6244	0.99512	0.0:1.0:0.0:0.0	.	53;459;1015	F5GZ19;E7EMD3;Q13219	.;.;PAPP1_HUMAN	R	1015;459;53	ENSP00000330658:T1015R;ENSP00000441461:T53R	ENSP00000330658:T1015R	T	+	2	0	PAPPA	118104947	1.000000	0.71417	0.977000	0.42913	0.971000	0.66376	7.696000	0.84270	2.879000	0.98667	0.650000	0.86243	ACG		0.512	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		Missense_Mutation
TLR4	7099	broad.mit.edu	37	9	120475251	120475251	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1342-01	TCGA-04-1342-11			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:120475251A>G	ENST00000355622.6	+	3	946	c.845A>G	c.(844-846)aAt>aGt	p.N282S	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.N242S	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	282					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.N282S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GGCCTGTGCAATTTGACCATT	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											93.0	99.0	97.0					9																	120475251		2203	4300	6503	119515072	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.845A>G	9.37:g.120475251A>G	ENSP00000363089:p.Asn282Ser	Somatic		x	x	x	119515072	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	1.363	-0.588154	0.03799	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37915	1.45;1.17	5.78	3.46	0.39613	.	0.414246	0.25200	N	0.032391	T	0.27731	0.0682	L	0.47716	1.5	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23583	-1.0184	10	0.16420	T	0.52	.	9.2	0.37251	0.8776:0.0:0.1224:0.0	.	282	O00206	TLR4_HUMAN	S	242;282	ENSP00000377997:N242S;ENSP00000363089:N282S	ENSP00000363089:N282S	N	+	2	0	TLR4	119515072	0.001000	0.12720	0.045000	0.18777	0.047000	0.14425	1.353000	0.34045	0.480000	0.27534	0.533000	0.62120	AAT		0.373	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		Missense_Mutation
C9orf16	79095	broad.mit.edu	37	9	130925891	130925891	+	Silent	SNP	C	C	G			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:130925891C>G	ENST00000372994.1	+	2	397	c.249C>G	c.(247-249)ccC>ccG	p.P83P	C9orf16_ENST00000492588.1_3'UTR	NM_024112.3	NP_077017.1	Q9BUW7	CI016_HUMAN	chromosome 9 open reading frame 16	83								p.P83P(1)		ovary(1)	1		Myeloproliferative disorder(762;0.0511)		GBM - Glioblastoma multiforme(294;0.0294)		ATGCCAGCCCCTAGGCTCCAA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	9											9.0	10.0	10.0					9																	130925891		2189	4279	6468	129965712	SO:0001819	synonymous_variant	79095			AK022885	CCDS6893.1	9q34.1	2012-03-06			ENSG00000171159	ENSG00000171159			17823	protein-coding gene	gene with protein product						10369878	Standard	NM_024112		Approved	EST00098, FLJ12823, MGC4639	uc004btp.1	Q9BUW7	OTTHUMG00000020731	ENST00000372994.1:c.249C>G	9.37:g.130925891C>G		Unknown		x	x	x	129965712	Q5SYV8|Q9Y3F7	Silent	SNP	ENST00000372994.1	37	CCDS6893.1	SNP	24	Broad																																																																																				0.682	C9orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054351.1	NM_024112		Silent
C9orf114	51490	broad.mit.edu	37	9	131589348	131589348	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr9:131589348C>T	ENST00000361256.5	-	4	371	c.331G>A	c.(331-333)Gag>Aag	p.E111K		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	111							poly(A) RNA binding (GO:0044822)	p.E111K(1)		kidney(2)|large_intestine(4)|ovary(1)	7						ACCACGATCTCATCCACACAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											144.0	124.0	131.0					9																	131589348		2203	4300	6503	130629169	SO:0001583	missense	51490				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.331G>A	9.37:g.131589348C>T	ENSP00000354812:p.Glu111Lys	Unknown		x	x	x	130629169	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	ENST00000361256.5	37	CCDS6913.1	SNP	29	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.776553|5.776553	0.96922|0.96922	.|.	.|.	ENSG00000198917|ENSG00000198917	ENST00000361256|ENST00000372618	T|.	0.38401|.	1.14|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.595021	.|0.19541	.|N	.|0.111790	T|T	0.81123|0.81123	0.4757|0.4757	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.68621|.	0.959|.	T|T	0.78558|0.78558	-0.2158|-0.2158	9|7	0.87932|0.29301	D|T	0|0.29	-5.1726|-5.1726	18.4485|18.4485	0.90695|0.90695	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	111|.	Q5T280|.	CI114_HUMAN|.	K|I	111|110	ENSP00000354812:E111K|.	ENSP00000354812:E111K|ENSP00000361701:M110I	E|M	-|-	1|3	0|0	C9orf114|C9orf114	130629169|130629169	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.655000|7.655000	0.83696|0.83696	2.602000|2.602000	0.87976|0.87976	0.650000|0.650000	0.86243|0.86243	GAG|ATG		0.632	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054500.1	NM_016390		Missense_Mutation
L1CAM	3897	broad.mit.edu	37	X	153129865	153129865	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1342-01	TCGA-04-1342-11			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chrX:153129865C>T	ENST00000370060.1	-	25	3423	c.3234G>A	c.(3232-3234)tgG>tgA	p.W1078*	L1CAM_ENST00000361699.4_Nonsense_Mutation_p.W1078*|L1CAM_ENST00000361981.3_Nonsense_Mutation_p.W1073*|L1CAM_ENST00000543994.1_Nonsense_Mutation_p.W1080*|L1CAM_ENST00000538883.1_Nonsense_Mutation_p.W1080*|L1CAM_ENST00000370055.1_Nonsense_Mutation_p.W1073*|L1CAM_ENST00000370057.3_Nonsense_Mutation_p.W1078*	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1078	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.W1078*(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTGCAGGTCCCACTGCGTGT	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	X											141.0	123.0	130.0					X																	153129865		2203	4300	6503	152783059	SO:0001587	stop_gained	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3234G>A	X.37:g.153129865C>T	ENSP00000359077:p.Trp1078*	Somatic		x	x	x	152783059	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Nonsense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847699	0.91277	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000370058;ENST00000361699	.	.	.	4.55	4.55	0.56014	.	0.430644	0.20032	N	0.100688	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.937	0.52878	0.0:1.0:0.0:0.0	.	.	.	.	X	1078;1080;1078;1080;1073;1073;23;1078	.	ENSP00000355380:W1078X	W	-	3	0	L1CAM	152783059	0.981000	0.34729	0.974000	0.42286	0.925000	0.55904	1.398000	0.34554	1.848000	0.53677	0.468000	0.43344	TGG		0.582	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Nonsense_Mutation
WDR81	124997	broad.mit.edu	37	17	1631515	1631521	+	Frame_Shift_Del	DEL	GGGCTCT	GGGCTCT	-	rs369472052		TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr17:1631515_1631521delGGGCTCT	ENST00000409644.1	+	1	3262_3268	c.3262_3268delGGGCTCT	c.(3262-3270)gggctctatfs	p.GLY1088fs	WDR81_ENST00000545662.1_5'Flank|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Frame_Shift_Del_p.GLY37fs|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000437219.2_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1088					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.G37fs*2(1)		cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTTCCAAGCCGGGCTCTATGTGACTGA	0.662																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								1578271	SO:0001589	frameshift_variant	124997			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3262_3268delGGGCTCT	17.37:g.1631515_1631521delGGGCTCT	ENSP00000386609:p.Gly1088fs	Unknown		Capture	Illumina GAIIx	Phase_I	1578265	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Frame_Shift_Del	DEL	ENST00000409644.1	37	CCDS54062.1	DEL	39	Broad																																																																																				0.662	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348		Frame_Shift_Del
MCM5	4174	broad.mit.edu	37	22	35817330	35817332	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-04-1342-01	TCGA-04-1342-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1342-01	TCGA-04-1342-11	g.chr22:35817330_35817332delCGC	ENST00000216122.4	+	15	2006_2008	c.1852_1854delCGC	c.(1852-1854)cgcdel	p.R618del	MCM5_ENST00000382011.5_In_Frame_Del_p.R575del	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	618					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R618delR(1)|p.R618C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						GGCCATTGTGCGCATCGCGGAAG	0.64																																																2	Substitution - Missense(1)|Deletion - In frame(1)	large_intestine(1)|ovary(1)	22																																								34147332	SO:0001651	inframe_deletion	4174				CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1852_1854delCGC	22.37:g.35817330_35817332delCGC	ENSP00000216122:p.Arg618del	Unknown		Capture	Illumina GAIIx	Phase_I	34147330	O60785|Q14578|Q9BTJ4|Q9BWL8	In_Frame_Del	DEL	ENST00000216122.4	37	CCDS13915.1	DEL	27	Broad																																																																																				0.640	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			In_Frame_Del
