#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
RAP1GAP2	23108	genome.wustl.edu	37	17	2929391	2929391	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr17:2929391C>T	ENST00000254695.8	+	20	1931	c.1841C>T	c.(1840-1842)cCg>cTg	p.P614L	RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.P599L|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.P614L|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.P595L	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	614	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)	p.P614L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CCCAGCTCTCCGGAAATCTGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											46.0	50.0	49.0					17																	2929391		2028	4182	6210	2876141	SO:0001583	missense	23108			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1841C>T	17.37:g.2929391C>T	ENSP00000254695:p.Pro614Leu	Somatic		Capture	Illumina GAIIx	4	2876141	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	37	CCDS45573.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.132956	0.94517	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.97976	-4.64;-4.58;-4.62;-4.64	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.98770	0.9586	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99831	1.1054	10	0.87932	D	0	-29.2337	18.3392	0.90299	0.0:1.0:0.0:0.0	.	599;614	Q684P5-2;Q684P5	.;RPGP2_HUMAN	L	614;599;595;614	ENSP00000254695:P614L;ENSP00000389824:P599L;ENSP00000439688:P595L;ENSP00000444890:P614L	ENSP00000254695:P614L	P	+	2	0	RAP1GAP2	2876141	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.012000	0.76366	2.599000	0.87857	0.561000	0.74099	CCG		0.582	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2			Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-04-1349-01	TCGA-04-1349-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.S241F|TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F|TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	17	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	7518284	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	17.37:g.7577559G>A	ENSP00000269305:p.Ser241Phe	Somatic		Capture	Illumina GAIIx	4	7518284	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
FARSA	2193	genome.wustl.edu	37	19	13041497	13041497	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr19:13041497G>A	ENST00000314606.4	-	2	232	c.214C>T	c.(214-216)Cgg>Tgg	p.R72W	CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Missense_Mutation_p.R72W|FARSA_ENST00000588025.1_Missense_Mutation_p.R112W	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	72					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.R72W(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CTGCCCTCCCGGGCAATCTCC	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	47.0	48.0					19																	13041497		2203	4300	6503	12902497	SO:0001583	missense	2193			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.214C>T	19.37:g.13041497G>A	ENSP00000320309:p.Arg72Trp	Somatic		Capture	Illumina GAIIx	4	12902497	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	37	CCDS12287.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993712	0.74703	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.64803	-0.12;0.48	5.51	3.26	0.37387	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.393378	0.29178	N	0.012901	T	0.56920	0.2018	L	0.53249	1.67	0.40851	D	0.983757	P;P	0.46220	0.846;0.874	B;B	0.42959	0.339;0.403	T	0.62784	-0.6781	10	0.66056	D	0.02	-11.8343	9.9016	0.41351	0.0779:0.1397:0.7823:0.0	.	72;72	B4E363;Q9Y285	.;SYFA_HUMAN	W	72	ENSP00000320309:R72W;ENSP00000396548:R72W	ENSP00000320309:R72W	R	-	1	2	FARSA	12902497	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	5.449000	0.66619	1.342000	0.45619	0.561000	0.74099	CGG		0.627	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	NM_004461		Missense_Mutation
FAR1	84188	genome.wustl.edu	37	11	13749116	13749116	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1349-01	TCGA-04-1349-11	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr11:13749116A>T	ENST00000354817.3	+	11	1415	c.1271A>T	c.(1270-1272)gAt>gTt	p.D424V	FAR1_ENST00000532502.1_Missense_Mutation_p.D48V	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	424					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.D424V(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						TTCAATATTGATGTACGGCAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	107.0	107.0					11																	13749116		2200	4294	6494	13705692	SO:0001583	missense	84188			AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.1271A>T	11.37:g.13749116A>T	ENSP00000346874:p.Asp424Val	Somatic		Capture	Illumina GAIIx	4	13705692	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	37	CCDS7813.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645134	0.87859	.	.	ENSG00000197601	ENST00000354817;ENST00000532502	T	0.38240	1.15	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79055	-0.1960	10	0.87932	D	0	-20.8448	15.7281	0.77780	1.0:0.0:0.0:0.0	.	424	Q8WVX9	FACR1_HUMAN	V	424;48	ENSP00000346874:D424V	ENSP00000346874:D424V	D	+	2	0	FAR1	13705692	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.246000	0.74042	0.533000	0.62120	GAT		0.368	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	NM_032228		Missense_Mutation
NCAM2	4685	genome.wustl.edu	37	21	22652946	22652946	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr21:22652946G>C	ENST00000400546.1	+	2	353	c.104G>C	c.(103-105)gGa>gCa	p.G35A	NCAM2_ENST00000535285.1_Missense_Mutation_p.G60A|NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000486367.1_3'UTR	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	35	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G35A(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CTTAGTGTTGGAGAATCTAAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	21											68.0	65.0	66.0					21																	22652946		1806	4075	5881	21574817	SO:0001583	missense	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.104G>C	21.37:g.22652946G>C	ENSP00000383392:p.Gly35Ala	Somatic		Capture	Illumina GAIIx	4	21574817	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715640	0.89112	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.81247	-1.47;-1.47	5.73	5.73	0.89815	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.100536	0.64402	D	0.000002	D	0.91603	0.7347	M	0.89030	3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92609	0.6098	10	0.87932	D	0	-21.0832	18.4708	0.90774	0.0:0.0:1.0:0.0	.	60;35	B7Z841;O15394	.;NCAM2_HUMAN	A	35;60	ENSP00000383392:G35A;ENSP00000441887:G60A	ENSP00000383392:G35A	G	+	2	0	NCAM2	21574817	1.000000	0.71417	0.981000	0.43875	0.961000	0.63080	8.066000	0.89486	2.718000	0.92993	0.585000	0.79938	GGA		0.303	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540		Missense_Mutation
GPR158	57512	genome.wustl.edu	37	10	25886863	25886863	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1349-01	TCGA-04-1349-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr10:25886863T>C	ENST00000376351.3	+	11	2667	c.2308T>C	c.(2308-2310)Tct>Cct	p.S770P	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	770					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S770P(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCGGCAGTGCTCTAAAGAGGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	10											84.0	94.0	91.0					10																	25886863		2203	4300	6503	25926869	SO:0001583	missense	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2308T>C	10.37:g.25886863T>C	ENSP00000365529:p.Ser770Pro	Somatic		Capture	Illumina GAIIx	4	25926869	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124639	0.77436	.	.	ENSG00000151025	ENST00000376351	T	0.65178	-0.14	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000003	T	0.78039	0.4221	M	0.68317	2.08	0.44012	D	0.996727	D	0.89917	1.0	D	0.83275	0.996	T	0.80155	-0.1500	10	0.72032	D	0.01	.	16.1031	0.81201	0.0:0.0:0.0:1.0	.	770	Q5T848	GP158_HUMAN	P	770	ENSP00000365529:S770P	ENSP00000365529:S770P	S	+	1	0	GPR158	25926869	1.000000	0.71417	0.990000	0.47175	0.938000	0.57974	5.911000	0.69939	2.197000	0.70478	0.528000	0.53228	TCT		0.572	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		Missense_Mutation
ANKS1A	23294	genome.wustl.edu	37	6	34985642	34985642	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr6:34985642C>T	ENST00000360359.3	+	11	1954	c.1816C>T	c.(1816-1818)Cga>Tga	p.R606*	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	606					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.R606*(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GGCCAGGAGCCGAGCGCCTCC	0.607																																																1	Substitution - Nonsense(1)	ovary(1)	6											92.0	110.0	104.0					6																	34985642		2203	4300	6503	35093620	SO:0001587	stop_gained	23294			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1816C>T	6.37:g.34985642C>T	ENSP00000353518:p.Arg606*	Somatic		Capture	Illumina GAIIx	4	35093620	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Nonsense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	38	6.808851	0.97853	.	.	ENSG00000064999	ENST00000360359	.	.	.	5.14	3.26	0.37387	.	0.166897	0.27262	N	0.020164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4371	7.0516	0.25075	0.3849:0.5278:0.0:0.0872	.	.	.	.	X	606	.	ENSP00000353518:R606X	R	+	1	2	ANKS1A	35093620	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.738000	0.26158	1.220000	0.43490	0.655000	0.94253	CGA		0.607	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478		Nonsense_Mutation
TTC3	7267	genome.wustl.edu	37	21	38497001	38497001	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr21:38497001A>G	ENST00000399017.2	+	14	3939	c.1192A>G	c.(1192-1194)Att>Gtt	p.I398V	TTC3_ENST00000540756.1_Missense_Mutation_p.I88V|TTC3_ENST00000355666.1_Missense_Mutation_p.I398V|TTC3_ENST00000354749.2_Missense_Mutation_p.I398V|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	398					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I398V(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTTCAGAAAAATTAATCACGA	0.363																																					Ovarian(38;194 1649 35661)											1	Substitution - Missense(1)	ovary(1)	21											68.0	70.0	69.0					21																	38497001		2203	4299	6502	37418871	SO:0001583	missense	7267			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1192A>G	21.37:g.38497001A>G	ENSP00000381981:p.Ile398Val	Somatic		Capture	Illumina GAIIx	4	37418871	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	0.086	-1.174778	0.01646	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	T;T;T;T;T;T;T	0.41758	1.38;1.38;1.38;3.15;0.99;3.15;3.15	4.6	-1.85	0.07784	.	0.729483	0.12672	N	0.448703	T	0.12902	0.0313	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.0;0.001	T	0.28744	-1.0034	10	0.12430	T	0.62	-1.8982	4.3683	0.11235	0.3865:0.3356:0.2779:0.0	.	88;398	B4DSZ9;P53804	.;TTC3_HUMAN	V	398;398;380;398;88;398;398	ENSP00000403943:I398V;ENSP00000408456:I398V;ENSP00000391891:I380V;ENSP00000347889:I398V;ENSP00000442875:I88V;ENSP00000381981:I398V;ENSP00000346791:I398V	ENSP00000346791:I398V	I	+	1	0	TTC3	37418871	0.004000	0.15560	0.018000	0.16275	0.380000	0.30137	-0.025000	0.12413	-0.306000	0.08818	-0.250000	0.11733	ATT		0.363	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1			Missense_Mutation
CBX7	23492	genome.wustl.edu	37	22	39530037	39530037	+	Silent	SNP	G	G	T	rs201404123		TCGA-04-1349-01	TCGA-04-1349-11	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr22:39530037G>T	ENST00000216133.5	-	6	820	c.615C>A	c.(613-615)gcC>gcA	p.A205A	CBX7_ENST00000401405.3_Silent_p.A112A|CBX7_ENST00000475962.1_Intron	NM_175709.3	NP_783640.1	O95931	CBX7_HUMAN	chromobox homolog 7	205					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)	p.A205A(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					GGGGCCCCTCGGCCAGGTCGG	0.657																																					GBM(46;845 904 3560 9866 23971)											1	Substitution - coding silent(1)	ovary(1)	22											62.0	66.0	64.0					22																	39530037		2203	4300	6503	37859983	SO:0001819	synonymous_variant	23492				CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000216133.5:c.615C>A	22.37:g.39530037G>T		Somatic		Capture	Illumina GAIIx	4	37859983	Q86T17	Silent	SNP	ENST00000216133.5	37	CCDS13986.1	SNP	39	WashU																																																																																				0.657	CBX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318020.1	NM_175709		Silent
PRICKLE1	144165	genome.wustl.edu	37	12	42858557	42858557	+	Missense_Mutation	SNP	G	G	C	rs553919252		TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr12:42858557G>C	ENST00000455697.1	-	7	1564	c.1279C>G	c.(1279-1281)Ctc>Gtc	p.L427V	PRICKLE1_ENST00000445766.2_Missense_Mutation_p.L427V|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.L427V|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.L427V|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.L427V	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	427					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.L427V(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GGCTGAAAGAGGCTTTTATCA	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											70.0	73.0	72.0					12																	42858557		2203	4300	6503	41144824	SO:0001583	missense	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1279C>G	12.37:g.42858557G>C	ENSP00000401060:p.Leu427Val	Somatic		Capture	Illumina GAIIx	4	41144824	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458406	0.43634	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.76	4.86	0.63082	.	0.178326	0.52532	N	0.000078	T	0.39253	0.1071	N	0.08118	0	0.41473	D	0.988117	B	0.09022	0.002	B	0.12156	0.007	T	0.15665	-1.0429	10	0.23891	T	0.37	-4.2574	17.2937	0.87164	0.0:0.1252:0.8748:0.0	.	427	Q96MT3	PRIC1_HUMAN	V	427	ENSP00000401060:L427V;ENSP00000398947:L427V;ENSP00000448359:L427V;ENSP00000345064:L427V;ENSP00000449819:L427V	ENSP00000345064:L427V	L	-	1	0	PRICKLE1	41144824	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.961000	0.40432	1.566000	0.49654	0.650000	0.86243	CTC		0.438	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1			Missense_Mutation
KIAA1644	85352	genome.wustl.edu	37	22	44692680	44692680	+	Silent	SNP	C	C	T	rs565301340		TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr22:44692680C>T	ENST00000381176.4	-	3	285	c.153G>A	c.(151-153)tcG>tcA	p.S51S		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	51						integral component of membrane (GO:0016021)		p.S51S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				TCTTGTTGTCCGAGAGCCGGG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		20792	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	22											164.0	184.0	177.0					22																	44692680		2125	4234	6359	43024013	SO:0001819	synonymous_variant	85352			AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.153G>A	22.37:g.44692680C>T		Somatic		Capture	Illumina GAIIx	4	43024013	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Silent	SNP	ENST00000381176.4	37	CCDS43025.1	SNP	23	WashU																																																																																				0.537	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294		Silent
NNT	23530	genome.wustl.edu	37	5	43656085	43656085	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr5:43656085G>A	ENST00000264663.5	+	15	2424	c.2203G>A	c.(2203-2205)Gca>Aca	p.A735T	NNT_ENST00000344920.4_Missense_Mutation_p.A735T|NNT_ENST00000512996.2_Missense_Mutation_p.A604T	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	735					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.A735T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					GGATGCAGCAGCAAATCTCAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											122.0	107.0	112.0					5																	43656085		2203	4300	6503	43691842	SO:0001583	missense	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2203G>A	5.37:g.43656085G>A	ENSP00000264663:p.Ala735Thr	Somatic		Capture	Illumina GAIIx	4	43691842	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172558	0.57584	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.91464	-2.85;-2.85;-2.85	5.91	3.11	0.35812	.	0.137570	0.64402	N	0.000003	D	0.84401	0.5464	L	0.37800	1.135	0.58432	D	0.999999	B	0.15473	0.013	B	0.22880	0.042	T	0.75625	-0.3253	10	0.40728	T	0.16	-4.274	8.3736	0.32430	0.1336:0.0:0.7356:0.1308	.	735	Q13423	NNTM_HUMAN	T	250;735;735;604	ENSP00000264663:A735T;ENSP00000343873:A735T;ENSP00000426343:A604T	ENSP00000264663:A735T	A	+	1	0	NNT	43691842	1.000000	0.71417	0.899000	0.35326	0.995000	0.86356	6.361000	0.73070	0.368000	0.24481	-0.150000	0.13652	GCA		0.438	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977		Missense_Mutation
KRT79	338785	genome.wustl.edu	37	12	53218087	53218087	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr12:53218087G>T	ENST00000330553.5	-	5	949	c.915C>A	c.(913-915)aaC>aaA	p.N305K		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	305	Linker 12.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.N305K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGTTGCGGTTGTTGTCCATGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											107.0	83.0	91.0					12																	53218087		2203	4300	6503	51504354	SO:0001583	missense	338785			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.915C>A	12.37:g.53218087G>T	ENSP00000328358:p.Asn305Lys	Somatic		Capture	Illumina GAIIx	4	51504354	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121685	0.77436	.	.	ENSG00000185640	ENST00000330553	T	0.75821	-0.97	4.08	3.19	0.36642	Filament (1);	0.000000	0.53938	D	0.000049	D	0.88548	0.6466	H	0.95884	3.735	0.47476	D	0.999439	D	0.69078	0.997	D	0.65323	0.934	D	0.90911	0.4776	10	0.87932	D	0	.	11.4539	0.50169	0.0902:0.0:0.9098:0.0	.	305	Q5XKE5	K2C79_HUMAN	K	305	ENSP00000328358:N305K	ENSP00000328358:N305K	N	-	3	2	KRT79	51504354	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.358000	0.52284	1.295000	0.44724	0.561000	0.74099	AAC		0.597	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834		Missense_Mutation
RB1CC1	9821	genome.wustl.edu	37	8	53586460	53586460	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1349-01	TCGA-04-1349-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr8:53586460T>C	ENST00000025008.5	-	7	1470	c.947A>G	c.(946-948)gAt>gGt	p.D316G	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Missense_Mutation_p.D316G|RB1CC1_ENST00000539297.1_Missense_Mutation_p.D316G	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	316					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.D316G(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ATTAGGTCTATCTTGAACATT	0.348																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Missense(1)	ovary(1)	8											85.0	78.0	80.0					8																	53586460		2203	4300	6503	53749013	SO:0001583	missense	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.947A>G	8.37:g.53586460T>C	ENSP00000025008:p.Asp316Gly	Somatic		Capture	Illumina GAIIx	4	53749013	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	26.5	4.743573	0.89663	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.21734	1.99;1.99;1.99	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	L	0.41573	1.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.15723	-1.0427	10	0.72032	D	0.01	-24.9624	16.0859	0.81049	0.0:0.0:0.0:1.0	.	316;316	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	G	316	ENSP00000025008:D316G;ENSP00000396067:D316G;ENSP00000445960:D316G	ENSP00000025008:D316G	D	-	2	0	RB1CC1	53749013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.248000	0.74166	0.460000	0.39030	GAT		0.348	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		Missense_Mutation
PCDH15	65217	genome.wustl.edu	37	10	55616968	55616968	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr10:55616968G>T	ENST00000320301.6	-	28	4167	c.3773C>A	c.(3772-3774)aCt>aAt	p.T1258N	PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.T1258N|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000361849.3_Missense_Mutation_p.T1258N|PCDH15_ENST00000395433.1_Missense_Mutation_p.T1236N|PCDH15_ENST00000414778.1_Missense_Mutation_p.T1263N|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.T1187N|PCDH15_ENST00000395438.1_Missense_Mutation_p.T1258N|PCDH15_ENST00000395445.1_Missense_Mutation_p.T1265N|PCDH15_ENST00000409834.1_Missense_Mutation_p.T869N|PCDH15_ENST00000395432.2_Missense_Mutation_p.T1221N|PCDH15_ENST00000373965.2_Missense_Mutation_p.T1265N	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1258	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.T1258N(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCCACTAGAGTAGGAGGCAC	0.299										HNSCC(58;0.16)																																						1	Substitution - Missense(1)	ovary(1)	10											73.0	73.0	73.0					10																	55616968		2203	4299	6502	55286974	SO:0001583	missense	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3773C>A	10.37:g.55616968G>T	ENSP00000322604:p.Thr1258Asn	Somatic		Capture	Illumina GAIIx	4	55286974	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710069	0.89018	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.58060	0.48;0.53;0.47;0.48;0.44;0.38;0.36;0.41;0.37;0.36;0.36	5.17	5.17	0.71159	Cadherin (1);	.	.	.	.	T	0.70133	0.3189	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;1.0;0.999;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.997;0.987;0.99;0.987;0.996;0.999;0.997;0.997;0.999;0.999;0.974;0.98;0.99	T	0.70898	-0.4747	9	0.51188	T	0.08	.	18.2926	0.90135	0.0:0.0:1.0:0.0	.	1236;1258;1258;1263;1187;1221;1258;1258;1265;1265;1258;1263;1258	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	N	1265;1263;1258;1258;869;1265;1221;1258;1236;1258;1258;1263;1187	ENSP00000363076:T1265N;ENSP00000410304:T1263N;ENSP00000378826:T1258N;ENSP00000386693:T869N;ENSP00000378832:T1265N;ENSP00000378820:T1221N;ENSP00000354950:T1258N;ENSP00000378821:T1236N;ENSP00000322604:T1258N;ENSP00000378818:T1258N;ENSP00000412628:T1187N	ENSP00000322604:T1258N	T	-	2	0	PCDH15	55286974	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.624000	0.98398	2.418000	0.82041	0.655000	0.94253	ACT		0.299	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		Missense_Mutation
LRIG3	121227	genome.wustl.edu	37	12	59274510	59274510	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr12:59274510G>C	ENST00000320743.3	-	13	1940	c.1654C>G	c.(1654-1656)Ctc>Gtc	p.L552V	LRIG3_ENST00000379141.4_Missense_Mutation_p.L492V	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	552	Ig-like C2-type 1.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L552V(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TGGGCCCGGAGGTGTGCATAA	0.498			T	ROS1	NSCLC																																		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	1	Substitution - Missense(1)	ovary(1)	12											144.0	123.0	130.0					12																	59274510		2203	4300	6503	57560777	SO:0001583	missense	121227			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1654C>G	12.37:g.59274510G>C	ENSP00000326759:p.Leu552Val	Somatic		Capture	Illumina GAIIx	4	57560777	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	CCDS8960.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	8.558	0.877055	0.17395	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.63417	-0.04;-0.04	6.04	6.04	0.98038	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.33199	N	0.005163	T	0.36138	0.0956	N	0.02169	-0.655	0.52099	D	0.999944	B;B	0.27068	0.001;0.167	B;B	0.31101	0.002;0.124	T	0.39820	-0.9595	9	.	.	.	.	13.7331	0.62802	0.0698:0.0:0.9302:0.0	.	492;552	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	V	492;552	ENSP00000368436:L492V;ENSP00000326759:L552V	.	L	-	1	0	LRIG3	57560777	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.456000	0.66665	2.873000	0.98535	0.561000	0.74099	CTC		0.498	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377		Missense_Mutation
TTC9C	283237	genome.wustl.edu	37	11	62496464	62496464	+	Silent	SNP	G	G	T			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr11:62496464G>T	ENST00000316461.4	+	1	454	c.144G>T	c.(142-144)ccG>ccT	p.P48P	TTC9C_ENST00000513247.2_Silent_p.P181P|TTC9C_ENST00000532583.1_Silent_p.P48P|HNRNPUL2_ENST00000301785.5_5'Flank|HNRNPUL2-BSCL2_ENST00000403734.2_5'Flank	NM_173810.3	NP_776171.1	Q8N5M4	TTC9C_HUMAN	tetratricopeptide repeat domain 9C	48								p.P48P(1)		breast(1)|endometrium(1)|lung(2)|ovary(1)|pancreas(1)	6						TGCCCTCTCCGTTACCTAATC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	11											118.0	105.0	109.0					11																	62496464		2202	4299	6501	62253040	SO:0001819	synonymous_variant	283237			BC032123	CCDS8033.1	11q12.3	2013-01-10			ENSG00000162222	ENSG00000162222		"""Tetratricopeptide (TTC) repeat domain containing"""	28432	protein-coding gene	gene with protein product							Standard	NM_173810		Approved	MGC29649	uc001nuy.3	Q8N5M4	OTTHUMG00000167607	ENST00000316461.4:c.144G>T	11.37:g.62496464G>T		Somatic		Capture	Illumina GAIIx	4	62253040	Q8WYY7	Silent	SNP	ENST00000316461.4	37	CCDS8033.1	SNP	40	WashU																																																																																				0.552	TTC9C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395338.1	NM_173810		Silent
PLEK2	26499	genome.wustl.edu	37	14	67862145	67862145	+	Silent	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr14:67862145G>A	ENST00000216446.4	-	3	503	c.363C>T	c.(361-363)ttC>ttT	p.F121F	PLEK2_ENST00000557388.1_5'Flank	NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	121					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.F121F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		GGGGCAGCTTGAAGGAGTTTC	0.652																																																1	Substitution - coding silent(1)	ovary(1)	14											57.0	55.0	56.0					14																	67862145		2203	4300	6503	66931898	SO:0001819	synonymous_variant	26499			AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.363C>T	14.37:g.67862145G>A		Somatic		Capture	Illumina GAIIx	4	66931898	Q96JT0	Silent	SNP	ENST00000216446.4	37	CCDS9782.1	SNP	45	WashU																																																																																				0.652	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412547.2			Silent
NUMB	8650	genome.wustl.edu	37	14	73743380	73743380	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr14:73743380G>A	ENST00000355058.3	-	13	2140	c.1862C>T	c.(1861-1863)gCt>gTt	p.A621V	NUMB_ENST00000560335.1_Missense_Mutation_p.A475V|NUMB_ENST00000554521.2_Missense_Mutation_p.A415V|NUMB_ENST00000359560.3_Missense_Mutation_p.A610V|NUMB_ENST00000454166.4_Missense_Mutation_p.A475V|NUMB_ENST00000544991.3_Missense_Mutation_p.A426V|NUMB_ENST00000557597.1_Missense_Mutation_p.A610V|RP4-647C14.3_ENST00000556578.1_RNA|NUMB_ENST00000556772.1_Missense_Mutation_p.A477V|NUMB_ENST00000356296.4_Missense_Mutation_p.A573V|NUMB_ENST00000555238.1_Missense_Mutation_p.A621V|NUMB_ENST00000559312.1_Missense_Mutation_p.A426V|NUMB_ENST00000535282.1_Missense_Mutation_p.A610V|NUMB_ENST00000555738.2_Missense_Mutation_p.A464V|NUMB_ENST00000555394.1_Missense_Mutation_p.A573V|NUMB_ENST00000554546.1_Missense_Mutation_p.A562V			P49757	NUMB_HUMAN	numb homolog (Drosophila)	621					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A621V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		TTCTAATGCAGCCCACTGGGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	14											75.0	71.0	73.0					14																	73743380		2203	4300	6503	72813133	SO:0001583	missense	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1862C>T	14.37:g.73743380G>A	ENSP00000347169:p.Ala621Val	Somatic		Capture	Illumina GAIIx	4	72813133	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	ENST00000355058.3	37	CCDS32116.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862993	0.51482	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282	T;T;T;T;T;T;T;T;T;T;T;T;T	0.72615	-0.36;-0.5;-0.16;-0.19;0.59;-0.19;-0.16;-0.5;-0.67;-0.59;-0.56;-0.65;-0.16	5.3	5.3	0.74995	.	0.047630	0.85682	D	0.000000	T	0.64227	0.2579	L	0.27053	0.805	0.80722	D	1	P;B;B;B;B;P;P;P;P	0.47302	0.846;0.227;0.227;0.227;0.227;0.893;0.893;0.72;0.736	B;B;B;B;B;B;B;B;B	0.42692	0.395;0.034;0.034;0.034;0.034;0.303;0.303;0.365;0.272	T	0.70299	-0.4910	10	0.87932	D	0	-14.3677	19.1566	0.93514	0.0:0.0:1.0:0.0	.	319;464;475;415;426;562;573;610;621	B1P2N9;B1P2N6;B1P2N5;B1P2N8;B1P2N7;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;NUMB_HUMAN	V	562;573;610;621;477;621;610;573;426;475;464;415;610	ENSP00000452416:A562V;ENSP00000348644:A573V;ENSP00000451117:A610V;ENSP00000451300:A621V;ENSP00000451513:A477V;ENSP00000347169:A621V;ENSP00000352563:A610V;ENSP00000451625:A573V;ENSP00000446001:A426V;ENSP00000394025:A475V;ENSP00000452069:A464V;ENSP00000450817:A415V;ENSP00000441258:A610V	ENSP00000347169:A621V	A	-	2	0	NUMB	72813133	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.523000	0.81856	2.763000	0.94921	0.561000	0.74099	GCT		0.483	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1			Missense_Mutation
CDH13	1012	genome.wustl.edu	37	16	83250966	83250966	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr16:83250966G>T	ENST00000566620.1	+	5	790	c.500G>T	c.(499-501)aGg>aTg	p.R167M	CDH13_ENST00000569454.1_3'UTR|CDH13_ENST00000268613.10_Missense_Mutation_p.R214M|CDH13_ENST00000428848.3_Missense_Mutation_p.R128M	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	167	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.R167M(1)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		GATAGTGACAGGCCAGAAAGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	16											91.0	88.0	89.0					16																	83250966		1877	4102	5979	81808467	SO:0001583	missense	1012			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.500G>T	16.37:g.83250966G>T	ENSP00000454435:p.Arg167Met	Somatic		Capture	Illumina GAIIx	4	81808467	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	CCDS58486.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.50	2.552642	0.45487	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143	T	0.53423	0.62	5.77	5.77	0.91146	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45418	0.1341	L	0.34521	1.04	0.80722	D	1	B;B;B	0.22909	0.077;0.037;0.03	B;B;B	0.33392	0.163;0.163;0.029	T	0.38436	-0.9661	9	0.59425	D	0.04	.	17.4882	0.87694	0.0:0.0:1.0:0.0	.	128;214;167	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	M	214;167;128	ENSP00000268613:R214M	ENSP00000268613:R214M	R	+	2	0	CDH13	81808467	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.954000	0.56708	2.720000	0.93068	0.557000	0.71058	AGG		0.453	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		Missense_Mutation
CDH13	1012	genome.wustl.edu	37	16	83250975	83250975	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr16:83250975G>T	ENST00000566620.1	+	5	799	c.509G>T	c.(508-510)aGg>aTg	p.R170M	CDH13_ENST00000569454.1_3'UTR|CDH13_ENST00000268613.10_Missense_Mutation_p.R217M|CDH13_ENST00000428848.3_Missense_Mutation_p.R131M	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	170	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)	p.R170M(1)		large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AGGCCAGAAAGGTCCAAGTTC	0.463																																																1	Substitution - Missense(1)	ovary(1)	16											92.0	89.0	90.0					16																	83250975		1871	4102	5973	81808476	SO:0001583	missense	1012			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.509G>T	16.37:g.83250975G>T	ENSP00000454435:p.Arg170Met	Somatic		Capture	Illumina GAIIx	4	81808476	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	37	CCDS58486.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406774	0.42715	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143	T	0.52754	0.65	5.77	5.77	0.91146	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.46092	0.1375	L	0.34521	1.04	0.80722	D	1	B;B;P	0.35612	0.002;0.0;0.512	B;B;B	0.41619	0.0;0.002;0.361	T	0.39014	-0.9634	9	0.46703	T	0.11	.	17.4882	0.87694	0.0:0.0:1.0:0.0	.	131;217;170	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	M	217;170;131	ENSP00000268613:R217M	ENSP00000268613:R217M	R	+	2	0	CDH13	81808476	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.954000	0.56708	2.720000	0.93068	0.557000	0.71058	AGG		0.463	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		Missense_Mutation
CADM2	253559	genome.wustl.edu	37	3	85775654	85775654	+	Intron	SNP	A	A	G			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr3:85775654A>G	ENST00000407528.2	+	2	123				CADM2_ENST00000405615.2_Missense_Mutation_p.N8S|CADM2_ENST00000383699.3_Intron	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2						adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.N8S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TTCTTGTGCAACCTTTCCTTG	0.348																																																1	Substitution - Missense(1)	ovary(1)	3											160.0	160.0	160.0					3																	85775654		2203	4300	6503	85858344	SO:0001627	intron_variant	253559			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.62-75543A>G	3.37:g.85775654A>G		Somatic		Capture	Illumina GAIIx	4	85858344	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	5.470	0.271823	0.10349	.	.	ENSG00000175161	ENST00000405615	T	0.62105	0.05	5.41	-0.746	0.11095	.	0.761709	0.12124	N	0.497440	T	0.31734	0.0806	.	.	.	0.22581	N	0.998965	B	0.15473	0.013	B	0.16289	0.015	T	0.26985	-1.0087	9	0.06494	T	0.89	.	6.6124	0.22759	0.4886:0.1314:0.0:0.38	.	8	Q8N3J6-3	.	S	8	ENSP00000384193:N8S	ENSP00000384193:N8S	N	+	2	0	CADM2	85858344	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	1.163000	0.31798	0.306000	0.22856	0.482000	0.46254	AAC		0.348	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184		Missense_Mutation
VWA3B	200403	genome.wustl.edu	37	2	98866853	98866853	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr2:98866853A>G	ENST00000477737.1	+	20	2950	c.2746A>G	c.(2746-2748)Aat>Gat	p.N916D	VWA3B_ENST00000490947.2_3'UTR	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	916								p.N916D(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGCCAAACTCAATATCTACAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											135.0	129.0	131.0					2																	98866853		1869	4100	5969	98233285	SO:0001583	missense	200403			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2746A>G	2.37:g.98866853A>G	ENSP00000417955:p.Asn916Asp	Somatic		Capture	Illumina GAIIx	4	98233285	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	SNP	5	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.274|7.274	0.607660|0.607660	0.14002|0.14002	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737;ENST00000358269|ENST00000473149	T|.	0.05786|.	3.39|.	4.63|4.63	3.48|3.48	0.39840|0.39840	.|.	0.350144|.	0.26761|.	N|.	0.022638|.	T|T	0.54078|0.54078	0.1836|0.1836	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	B;B;B|.	0.21606|.	0.058;0.002;0.002|.	B;B;B|.	0.18561|.	0.022;0.006;0.004|.	T|T	0.47355|0.47355	-0.9124|-0.9124	10|5	0.13853|.	T|.	0.58|.	.|.	7.0743|7.0743	0.25195|0.25195	0.8972:0.0:0.1028:0.0|0.8972:0.0:0.1028:0.0	.|.	308;916;916|.	Q502W6-5;Q502W6;Q502W6-8|.	.;VWA3B_HUMAN;.|.	D|R	916;38|326	ENSP00000417955:N916D|.	ENSP00000351009:N38D|.	N|Q	+|+	1|2	0|0	VWA3B|VWA3B	98233285|98233285	0.928000|0.928000	0.31464|0.31464	0.964000|0.964000	0.40570|0.40570	0.900000|0.900000	0.52787|0.52787	0.946000|0.946000	0.29069|0.29069	0.903000|0.903000	0.36546|0.36546	0.528000|0.528000	0.53228|0.53228	AAT|CAA		0.398	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992		Missense_Mutation
MFSD9	84804	genome.wustl.edu	37	2	103335355	103335355	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr2:103335355G>A	ENST00000258436.5	-	6	992	c.949C>T	c.(949-951)Cgg>Tgg	p.R317W	MFSD9_ENST00000496253.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	317					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R317W(2)		breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						ACCTTGGGCCGCACCCCAAAG	0.587																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	2											45.0	44.0	45.0					2																	103335355		2203	4300	6503	102701787	SO:0001583	missense	84804				CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.949C>T	2.37:g.103335355G>A	ENSP00000258436:p.Arg317Trp	Somatic		Capture	Illumina GAIIx	4	102701787	Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Missense_Mutation	SNP	ENST00000258436.5	37	CCDS2063.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782346	0.49891	.	.	ENSG00000135953	ENST00000258436	T	0.80909	-1.43	5.0	-5.83	0.02325	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.252691	0.37483	N	0.002070	T	0.69967	0.3170	L	0.51422	1.61	0.28379	N	0.919641	B	0.27791	0.189	B	0.23852	0.049	T	0.60234	-0.7303	10	0.66056	D	0.02	-26.6188	13.5421	0.61681	0.0:0.0809:0.1549:0.7642	.	317	Q8NBP5	MFSD9_HUMAN	W	317	ENSP00000258436:R317W	ENSP00000258436:R317W	R	-	1	2	MFSD9	102701787	1.000000	0.71417	0.008000	0.14137	0.855000	0.48748	1.362000	0.34148	-0.728000	0.04882	-0.195000	0.12781	CGG		0.587	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	NM_032718		Missense_Mutation
DAO	1610	genome.wustl.edu	37	12	109281280	109281280	+	Silent	SNP	C	C	T	rs149638037		TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr12:109281280C>T	ENST00000228476.3	+	3	453	c.249C>T	c.(247-249)aaC>aaT	p.N83N	DAO_ENST00000551281.1_Silent_p.N83N	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	83					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)	p.N83N(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	ATTCTCCCAACGCTGAAAACC	0.542																																																1	Substitution - coding silent(1)	ovary(1)	12											334.0	310.0	318.0					12																	109281280		2203	4300	6503	107805409	SO:0001819	synonymous_variant	1610			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.249C>T	12.37:g.109281280C>T		Somatic		Capture	Illumina GAIIx	4	107805409	B2R7I5|Q16758|Q8N6R2	Silent	SNP	ENST00000228476.3	37	CCDS9122.1	SNP	19	WashU																																																																																				0.542	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1			Silent
SOBP	55084	genome.wustl.edu	37	6	107955065	107955065	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr6:107955065C>A	ENST00000317357.5	+	6	1676	c.1017C>A	c.(1015-1017)aaC>aaA	p.N339K		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)									p.N339K(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		ACACTGCCAACTGCTCTGTCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	103.0	100.0					6																	107955065		2046	4190	6236	108061758	SO:0001583	missense	55084			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.1017C>A	6.37:g.107955065C>A	ENSP00000318900:p.Asn339Lys	Somatic		Capture	Illumina GAIIx	4	108061758		Missense_Mutation	SNP	ENST00000317357.5	37	CCDS43488.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338743	0.41398	.	.	ENSG00000112320	ENST00000317357	T	0.30448	1.53	5.7	4.82	0.62117	.	0.124916	0.53938	D	0.000055	T	0.07818	0.0196	N	0.22421	0.69	0.38771	D	0.954559	P	0.42248	0.774	B	0.36922	0.236	T	0.10428	-1.0630	10	0.13108	T	0.6	-15.2399	11.0749	0.48025	0.0:0.8566:0.0:0.1434	.	339	A7XYQ1	SOBP_HUMAN	K	339	ENSP00000318900:N339K	ENSP00000318900:N339K	N	+	3	2	SOBP	108061758	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	1.512000	0.35812	1.377000	0.46286	0.655000	0.94253	AAC		0.627	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013		Missense_Mutation
CAMK2D	817	genome.wustl.edu	37	4	114381345	114381345	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr4:114381345A>C	ENST00000342666.5	-	16	1161	c.1162T>G	c.(1162-1164)Tta>Gta	p.L388V	CAMK2D_ENST00000379773.2_Missense_Mutation_p.L388V|CAMK2D_ENST00000508738.1_Missense_Mutation_p.L399V|CAMK2D_ENST00000394526.2_Missense_Mutation_p.L399V|CAMK2D_ENST00000429180.1_Missense_Mutation_p.L408V|CAMK2D_ENST00000394524.3_Missense_Mutation_p.L388V|CAMK2D_ENST00000514328.1_Missense_Mutation_p.L387V|CAMK2D_ENST00000296402.5_Missense_Mutation_p.L388V|CAMK2D_ENST00000394522.3_Missense_Mutation_p.L402V|CAMK2D_ENST00000505990.1_Missense_Mutation_p.L422V|CAMK2D_ENST00000454265.2_Missense_Mutation_p.L413V|CAMK2D_ENST00000511664.1_Missense_Mutation_p.L422V|CAMK2D_ENST00000418639.2_Missense_Mutation_p.L402V|CAMK2D_ENST00000515496.1_Missense_Mutation_p.L399V			Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II delta	388					calcium ion transport (GO:0006816)|cardiac muscle cell contraction (GO:0086003)|cellular response to calcium ion (GO:0071277)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle cell action potential (GO:0098901)|regulation of cardiac muscle cell action potential involved in regulation of contraction (GO:0098909)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cell growth (GO:0001558)|regulation of cellular localization (GO:0060341)|regulation of generation of L-type calcium current (GO:1902514)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of histone deacetylase activity (GO:1901725)|regulation of membrane depolarization (GO:0003254)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of the force of heart contraction (GO:0002026)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|relaxation of cardiac muscle (GO:0055119)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|calcium channel complex (GO:0034704)|calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intercalated disc (GO:0014704)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|ion channel binding (GO:0044325)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|sodium channel inhibitor activity (GO:0019871)|titin binding (GO:0031432)	p.L388V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	13		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		CCTTCCACTAAATTACCCAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											88.0	99.0	96.0					4																	114381345		2203	4300	6503	114600794	SO:0001583	missense	817			U50361	CCDS3703.1, CCDS3704.1, CCDS43263.1, CCDS47127.1, CCDS54797.1	4q26	2008-10-30	2008-10-30		ENSG00000145349	ENSG00000145349			1462	protein-coding gene	gene with protein product		607708	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II delta"""	CAMKD			Standard	NM_001221		Approved		uc003ibi.3	Q13557	OTTHUMG00000132910	ENST00000342666.5:c.1162T>G	4.37:g.114381345A>C	ENSP00000339740:p.Leu388Val	Somatic		Capture	Illumina GAIIx	4	114600794	A8MVS8|Q52PK4|Q59G21|Q8N553|Q9UGH6|Q9UQE9	Missense_Mutation	SNP	ENST00000342666.5	37	CCDS3703.1	SNP	1	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.67|18.67	3.673236|3.673236	0.67928|0.67928	.|.	.|.	ENSG00000145349|ENSG00000145349	ENST00000513132|ENST00000394524;ENST00000454265;ENST00000429180;ENST00000418639;ENST00000394526;ENST00000296402;ENST00000511664;ENST00000342666;ENST00000515496;ENST00000514328;ENST00000394522;ENST00000505990;ENST00000379773;ENST00000508738;ENST00000509594	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.48836	.|0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.47|5.47	4.3|4.3	0.51218|0.51218	.|Protein kinase-like domain (1);Calcium/calmodulin-dependent protein kinase II, association-domain (1);	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.66127|0.66127	0.2758|0.2758	M|M	0.84156|0.84156	2.68|2.68	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D	.|0.76494	.|0.999;0.999;0.975;0.991;0.999	.|D;D;P;D;D	.|0.91635	.|0.999;0.997;0.863;0.91;0.998	T|T	0.66646|0.66646	-0.5871|-0.5871	5|10	.|0.62326	.|D	.|0.03	.|.	6.0141|6.0141	0.19592|0.19592	0.6903:0.0:0.3097:0.0|0.6903:0.0:0.3097:0.0	.|.	.|422;399;402;388;388	.|E9PF82;Q13557-3;Q13557-6;Q13557-12;Q13557	.|.;.;.;.;KCC2D_HUMAN	C|V	91|388;413;408;402;399;388;422;388;399;387;402;422;388;399;181	.|ENSP00000378032:L388V;ENSP00000415248:L413V;ENSP00000415707:L408V;ENSP00000406131:L402V;ENSP00000378034:L399V;ENSP00000296402:L388V;ENSP00000425824:L422V;ENSP00000339740:L388V;ENSP00000423482:L399V;ENSP00000423677:L387V;ENSP00000378030:L402V;ENSP00000424245:L422V;ENSP00000369098:L388V;ENSP00000422566:L399V;ENSP00000423753:L181V	.|ENSP00000296402:L388V	F|L	-|-	2|1	0|2	CAMK2D|CAMK2D	114600794|114600794	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.148000|4.148000	0.58085|0.58085	0.923000|0.923000	0.37045|0.37045	0.533000|0.533000	0.62120|0.62120	TTT|TTA		0.333	CAMK2D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256420.2			Missense_Mutation
MCM9	254394	genome.wustl.edu	37	6	119238803	119238803	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr6:119238803G>A	ENST00000316316.6	-	5	1113	c.827C>T	c.(826-828)tCa>tTa	p.S276L	MCM9_ENST00000316068.3_Missense_Mutation_p.S276L	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	276					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.S276L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GATGATCCCTGAGGACTGCTC	0.423																																																1	Substitution - Missense(1)	ovary(1)	6											124.0	115.0	118.0					6																	119238803		2203	4300	6503	119280502	SO:0001583	missense	254394			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.827C>T	6.37:g.119238803G>A	ENSP00000314505:p.Ser276Leu	Somatic		Capture	Illumina GAIIx	4	119280502	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	37	CCDS56447.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	8.244	0.807444	0.16467	.	.	ENSG00000111877	ENST00000316316;ENST00000316068	T;T	0.06371	3.74;3.31	5.81	2.97	0.34412	.	.	.	.	.	T	0.01287	0.0042	N	0.16833	0.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47289	-0.9129	9	0.45353	T	0.12	.	5.8785	0.18842	0.0683:0.2581:0.54:0.1336	.	276	Q9NXL9-2	.	L	276	ENSP00000314505:S276L;ENSP00000312870:S276L	ENSP00000312870:S276L	S	-	2	0	MCM9	119280502	0.765000	0.28485	0.026000	0.17262	0.318000	0.28184	3.692000	0.54727	0.752000	0.32923	0.650000	0.86243	TCA		0.423	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255		Missense_Mutation
NUP188	23511	genome.wustl.edu	37	9	131730797	131730797	+	Missense_Mutation	SNP	G	G	A	rs375622238		TCGA-04-1349-01	TCGA-04-1349-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr9:131730797G>A	ENST00000372577.2	+	9	619	c.598G>A	c.(598-600)Gtg>Atg	p.V200M		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	200					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.V200M(1)		breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGAGCGCCAAGTGTCTCGCTG	0.383																																																1	Substitution - Missense(1)	ovary(1)	9						G	MET/VAL	0,4406		0,0,2203	87.0	88.0	88.0		598	5.5	1.0	9		88	1,8599	1.2+/-3.3	0,1,4299	no	missense	NUP188	NM_015354.1	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	200/1750	131730797	1,13005	2203	4300	6503	130770618	SO:0001583	missense	23511			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.598G>A	9.37:g.131730797G>A	ENSP00000361658:p.Val200Met	Somatic		Capture	Illumina GAIIx	4	130770618	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013579	0.75161	0.0	1.16E-4	ENSG00000095319	ENST00000372577	T	0.31769	1.48	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.20371	-1.0277	10	0.37606	T	0.19	-2.6676	18.8285	0.92128	0.0:0.0:1.0:0.0	.	200	Q5SRE5	NU188_HUMAN	M	200	ENSP00000361658:V200M	ENSP00000361658:V200M	V	+	1	0	NUP188	130770618	1.000000	0.71417	0.997000	0.53966	0.852000	0.48524	6.122000	0.71608	2.763000	0.94921	0.563000	0.77884	GTG		0.383	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			Missense_Mutation
PPP2CA	5515	genome.wustl.edu	37	5	133537663	133537663	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr5:133537663C>G	ENST00000481195.1	-	3	642	c.362G>C	c.(361-363)aGa>aCa	p.R121T	CTD-2410N18.5_ENST00000519718.1_Intron|PPP2CA_ENST00000231504.5_5'Flank	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	121					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.R121T(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	TGTGATCTGTCTGCTCTCATG	0.328																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	117.0	117.0					5																	133537663		2203	4300	6503	133565562	SO:0001583	missense	5515				CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.362G>C	5.37:g.133537663C>G	ENSP00000418447:p.Arg121Thr	Somatic		Capture	Illumina GAIIx	4	133565562	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	37	CCDS4173.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	34	5.404939	0.96051	.	.	ENSG00000113575	ENST00000481195;ENST00000522385;ENST00000523082	T;T;T	0.06449	3.3;3.3;3.3	5.98	5.98	0.97165	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66268	-0.5966	10	0.87932	D	0	-11.3039	20.452	0.99131	0.0:1.0:0.0:0.0	.	121	P67775	PP2AA_HUMAN	T	121;56;108	ENSP00000418447:R121T;ENSP00000430869:R56T;ENSP00000428816:R108T	ENSP00000418447:R121T	R	-	2	0	PPP2CA	133565562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.838000	0.97847	0.591000	0.81541	AGA		0.328	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715		Missense_Mutation
PPP1R26	9858	genome.wustl.edu	37	9	138379949	138379949	+	Missense_Mutation	SNP	C	C	T	rs201592205		TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr9:138379949C>T	ENST00000356818.2	+	4	4142	c.3593C>T	c.(3592-3594)aCg>aTg	p.T1198M	PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605660.1_Missense_Mutation_p.T1198M|PPP1R26_ENST00000605286.1_Missense_Mutation_p.T1198M|PPP1R26_ENST00000401470.3_Missense_Mutation_p.T1198M|PPP1R26_ENST00000604351.1_Missense_Mutation_p.T1198M	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	1198					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.T1198M(1)									GACACCTCCACGGAGGACAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	9						C	MET/THR	0,4406		0,0,2203	53.0	55.0	54.0		3593	3.0	0.5	9		54	2,8598	2.2+/-6.3	0,2,4298	yes	missense	KIAA0649	NM_014811.3	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1198/1210	138379949	2,13004	2203	4300	6503	137519770	SO:0001583	missense	9858			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.3593C>T	9.37:g.138379949C>T	ENSP00000349274:p.Thr1198Met	Somatic		Capture	Illumina GAIIx	4	137519770	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	ENST00000356818.2	37	CCDS6988.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	5.408	0.260374	0.10239	0.0	2.33E-4	ENSG00000196422	ENST00000356818	T	0.09445	2.98	5.34	3.0	0.34707	.	1.609420	0.03204	N	0.175259	T	0.05640	0.0148	N	0.03608	-0.345	0.09310	N	0.999997	B	0.06786	0.001	B	0.01281	0.0	T	0.32666	-0.9898	10	0.31617	T	0.26	-4.3096	4.5691	0.12202	0.0:0.1726:0.1669:0.6605	.	1198	Q5T8A7	PPR26_HUMAN	M	1198	ENSP00000349274:T1198M	ENSP00000349274:T1198M	T	+	2	0	KIAA0649	137519770	0.803000	0.28956	0.487000	0.27428	0.243000	0.25628	0.988000	0.29616	0.425000	0.26087	-1.267000	0.01435	ACG		0.597	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811		Missense_Mutation
Unknown	0	genome.wustl.edu	37	5	140568838	140568838	+	IGR	SNP	G	G	A			TCGA-04-1349-01	TCGA-04-1349-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr5:140568838G>A								PCDHB16 (3045 upstream) : PCDHB10 (3103 downstream)																							ACAATGGCGAGCCTCCTCGCT	0.711																																																0			5											26.0	28.0	27.0					5																	140568838		2111	4160	6271	140549022	SO:0001628	intergenic_variant	56127																															5.37:g.140568838G>A		Somatic		Capture	Illumina GAIIx	4	140549022		Missense_Mutation	SNP		37		SNP	34	WashU																																																																																			0	0.711									Missense_Mutation
CYP11B1	1584	genome.wustl.edu	37	8	143959174	143959174	+	Intron	SNP	T	T	C	rs75717953	byFrequency	TCGA-04-1349-01	TCGA-04-1349-11	T	T	T	C	T	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr8:143959174T>C	ENST00000292427.4	-	3	428				CYP11B1_ENST00000377675.3_Splice_Site_p.R203G|CYP11B1_ENST00000517471.1_Intron	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1						aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CATCCTCACCTACAGCCAGAG	0.557									Familial Hyperaldosteronism type I																																							0			8											61.0	58.0	59.0					8																	143959174		876	1991	2867	143956176	SO:0001627	intron_variant	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.396-536A>G	8.37:g.143959174T>C		Germline		Capture	Illumina GAIIx	4	143956176	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	.	5.217	0.225576	0.09916	.	.	ENSG00000160882	ENST00000377675	T	0.68181	-0.31	1.6	-3.2	0.05156	.	.	.	.	.	T	0.46151	0.1378	.	.	.	0.19300	N	0.99998	B	0.02656	0.0	B	0.01281	0.0	T	0.12708	-1.0537	8	0.42905	T	0.14	.	1.1804	0.01844	0.156:0.3861:0.2612:0.1967	.	203	Q4VAR0	.	G	203	ENSP00000366903:R203G	ENSP00000366903:R203G	R	-	1	2	CYP11B1	143956176	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.158000	0.10070	-2.403000	0.00577	-1.307000	0.01316	AGG		0.557	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2			Missense_Mutation
LRBA	987	genome.wustl.edu	37	4	151392833	151392833	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr4:151392833A>T	ENST00000357115.3	-	44	6886	c.6643T>A	c.(6643-6645)Tgg>Agg	p.W2215R	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.W2204R|LRBA_ENST00000507224.1_Missense_Mutation_p.W2204R|LRBA_ENST00000510413.1_Missense_Mutation_p.W2204R	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2215	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.W2215R(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CTGTGTTGCCATCGCTGGGTC	0.323																																																1	Substitution - Missense(1)	ovary(1)	4											120.0	121.0	120.0					4																	151392833		2203	4300	6503	151612283	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6643T>A	4.37:g.151392833A>T	ENSP00000349629:p.Trp2215Arg	Somatic		Capture	Illumina GAIIx	4	151612283	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	SNP	8	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.8|24.8	4.571318|4.571318	0.86542|0.86542	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|D;D;D;D	.|0.89681	.|-2.55;-2.55;-2.55;-2.55	5.28|5.28	5.28|5.28	0.74379|0.74379	.|BEACH domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97090|0.97090	0.9049|0.9049	H|H	0.99444|0.99444	4.57|4.57	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.98619|0.98619	1.0666|1.0666	5|10	.|0.87932	.|D	.|0	.|.	14.4774|14.4774	0.67557|0.67557	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|2215;2204;105	.|P50851;P50851-2;Q68D03	.|LRBA_HUMAN;.;.	E|R	856|2204;2204;2215;2204	.|ENSP00000446299:W2204R;ENSP00000421552:W2204R;ENSP00000349629:W2215R;ENSP00000422180:W2204R	.|ENSP00000349629:W2215R	D|W	-|-	3|1	2|0	LRBA|LRBA	151612283|151612283	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.056000|9.056000	0.93881|0.93881	2.107000|2.107000	0.64212|0.64212	0.528000|0.528000	0.53228|0.53228	GAT|TGG		0.323	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			Missense_Mutation
HMCN1	83872	genome.wustl.edu	37	1	185992177	185992177	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1349-01	TCGA-04-1349-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr1:185992177C>T	ENST00000271588.4	+	36	5870	c.5641C>T	c.(5641-5643)Cga>Tga	p.R1881*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.R1881*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1881	Ig-like C2-type 16.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTCTTCTGGTCGAGTTCTACA	0.398																																																0			1											120.0	119.0	120.0					1																	185992177		2203	4300	6503	184258800	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5641C>T	1.37:g.185992177C>T	ENSP00000271588:p.Arg1881*	Somatic		Capture	Illumina GAIIx	4	184258800	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	48	13.893863	0.99769	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.52	3.6	0.41247	.	0.071267	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2544	0.66040	0.2803:0.7197:0.0:0.0	.	.	.	.	X	1881	.	ENSP00000271588:R1881X	R	+	1	2	HMCN1	184258800	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.980000	0.49321	0.654000	0.30846	-0.127000	0.14921	CGA		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Nonsense_Mutation
PGAP1	80055	genome.wustl.edu	37	2	197781283	197781283	+	Silent	SNP	T	T	C			TCGA-04-1349-01	TCGA-04-1349-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr2:197781283T>C	ENST00000354764.4	-	3	450	c.336A>G	c.(334-336)gcA>gcG	p.A112A	PGAP1_ENST00000409475.1_Silent_p.A112A|PGAP1_ENST00000485830.1_5'UTR|PGAP1_ENST00000409188.1_Silent_p.A70A	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	112					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.A112A(1)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						CAATGTCCTCTGCTTTTCTAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	2											83.0	76.0	78.0					2																	197781283		2203	4300	6503	197489528	SO:0001819	synonymous_variant	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.336A>G	2.37:g.197781283T>C		Somatic		Capture	Illumina GAIIx	4	197489528	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Silent	SNP	ENST00000354764.4	37	CCDS2318.1	SNP	55	WashU																																																																																				0.398	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989		Silent
FAM117B	150864	genome.wustl.edu	37	2	203630305	203630305	+	Nonsense_Mutation	SNP	A	A	T			TCGA-04-1349-01	TCGA-04-1349-11	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr2:203630305A>T	ENST00000392238.2	+	8	1588	c.1588A>T	c.(1588-1590)Aag>Tag	p.K530*	FAM117B_ENST00000303116.6_Nonsense_Mutation_p.K286*			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	530								p.K286*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						TCTTACACTCAAGGGCTCTGG	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	2											133.0	125.0	128.0					2																	203630305		2203	4300	6503	203338550	SO:0001587	stop_gained	150864			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.1588A>T	2.37:g.203630305A>T	ENSP00000376071:p.Lys530*	Somatic		Capture	Illumina GAIIx	4	203338550	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Nonsense_Mutation	SNP	ENST00000392238.2	37	CCDS33362.2	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886859	0.91814	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.75	5.75	0.90469	.	0.053328	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0826	16.0549	0.80794	1.0:0.0:0.0:0.0	.	.	.	.	X	286;530	.	ENSP00000306299:K286X	K	+	1	0	FAM117B	203338550	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.370000	0.52372	2.192000	0.70111	0.459000	0.35465	AAG		0.522	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335888.3	NM_173511		Nonsense_Mutation
SLC18A1	6570	genome.wustl.edu	37	8	20038410	20038411	+	Frame_Shift_Ins	INS	-	-	T			TCGA-04-1349-01	TCGA-04-1349-11	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr8:20038410_20038411insT	ENST00000276373.5	-	2	331_332	c.65_66insA	c.(64-66)ctgfs	p.L22fs	SLC18A1_ENST00000265808.7_Frame_Shift_Ins_p.L22fs|SLC18A1_ENST00000440926.1_Frame_Shift_Ins_p.L22fs|SLC18A1_ENST00000437980.1_Frame_Shift_Ins_p.L22fs|SLC18A1_ENST00000519026.1_Frame_Shift_Ins_p.L22fs|SLC18A1_ENST00000381608.4_Frame_Shift_Ins_p.L22fs	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	22					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)	p.V23fs*29(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	CCACCAGCACCAGCTGCCGGGA	0.594																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								20082691	SO:0001589	frameshift_variant	6570				CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.65_66insA	8.37:g.20038410_20038411insT	ENSP00000276373:p.Leu22fs	Somatic		Capture	Illumina GAIIx	4	20082690	E9PDJ5|Q9BRE4	Frame_Shift_Ins	INS	ENST00000276373.5	37	CCDS6013.1	INS	21	WashU																																																																																				0.594	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1			Frame_Shift_Ins
PADI2	11240	genome.wustl.edu	37	1	17418969	17418969	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1349-01	TCGA-04-1349-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr1:17418969C>T	ENST00000375486.4	-	6	652	c.589G>A	c.(589-591)Gga>Aga	p.G197R	PADI2_ENST00000375481.1_Missense_Mutation_p.G197R|PADI2_ENST00000444885.2_Intron	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	197					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)	p.G197R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	ATCTCGTATCCGGCGGGGAGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											96.0	86.0	89.0					1																	17418969		2203	4300	6503	17291556	SO:0001583	missense	11240			AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.589G>A	1.37:g.17418969C>T	ENSP00000364635:p.Gly197Arg	Somatic		Capture	Illumina GAIIx	PhaseIII	17291556	Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	37	CCDS177.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044152	0.55110	.	.	ENSG00000117115	ENST00000375486;ENST00000375481	T;T	0.14893	2.47;2.47	5.76	4.85	0.62838	Protein-arginine deiminase (PAD), central domain (2);	0.045313	0.85682	D	0.000000	T	0.29524	0.0736	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	P	0.60345	0.873	T	0.02774	-1.1112	10	0.19590	T	0.45	-11.7819	13.8238	0.63338	0.0:0.9256:0.0:0.0744	.	197	Q9Y2J8	PADI2_HUMAN	R	197	ENSP00000364635:G197R;ENSP00000364630:G197R	ENSP00000364630:G197R	G	-	1	0	PADI2	17291556	0.997000	0.39634	0.058000	0.19502	0.453000	0.32348	5.244000	0.65400	1.440000	0.47531	0.561000	0.74099	GGA		0.537	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1			Missense_Mutation
CYP21A2	1589	genome.wustl.edu	37	6	32006215	32006217	+	In_Frame_Del	DEL	CTG	CTG	-	rs61338903|rs138498156	byFrequency	TCGA-04-1349-01	TCGA-04-1349-11	CTG	CTG	CTG	-	CTG	CTG	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1349-01	TCGA-04-1349-11	g.chr6:32006215_32006217delCTG	ENST00000418967.2	+	1	174_176	c.16_18delCTG	c.(16-18)ctgdel	p.L10del	C4B-AS1_ENST00000415626.1_RNA|CYP21A2_ENST00000435122.2_In_Frame_Del_p.L10del	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	0					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	gctcctgggcctgctgctgctgc	0.67														1086	0.216853	0.0356	0.3703	5008	,	,		14879	0.2123		0.336	False		,,,				2504	0.2352				Melanoma(174;1669 1998 3915 34700 46447)											0			6							,	328,3316		88,152,1582					,	1.1	0.8		dbSNP_134	4	2077,4999		596,885,2057	no	coding,coding	CYP21A2	NM_001128590.3,NM_000500.7	,	684,1037,3639	A1A1,A1R,RR		29.3527,9.0011,22.4347	,	,		2405,8315				32114196	SO:0001651	inframe_deletion	1589			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.16_18delCTG	6.37:g.32006224_32006226delCTG	ENSP00000408860:p.Leu10del	Somatic		Capture	Illumina GAIIx	PhaseIII	32114194	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	In_Frame_Del	DEL	ENST00000418967.2	37	CCDS4735.1	DEL	24	WashU																																																																																				0.670	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500		In_Frame_Del
