#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ECE1	1889	broad.mit.edu	37	1	21571547	21571547	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:21571547A>C	ENST00000374893.6	-	10	1287	c.1213T>G	c.(1213-1215)Ttc>Gtc	p.F405V	ECE1_ENST00000415912.2_Missense_Mutation_p.F389V|ECE1_ENST00000528294.1_5'UTR|ECE1_ENST00000436918.2_Missense_Mutation_p.F405V|ECE1_ENST00000357071.4_Missense_Mutation_p.F393V|ECE1_ENST00000264205.6_Missense_Mutation_p.F402V	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	405					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)	p.F405V(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		TGGTCAAGGAAGGAGCTTGTT	0.557											OREG0013200	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											133.0	110.0	118.0					1																	21571547		2203	4300	6503	21444134	SO:0001583	missense	1889			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.1213T>G	1.37:g.21571547A>C	ENSP00000364028:p.Phe405Val	Unknown	749	x	x	x	21444134	A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	ENST00000374893.6	37	CCDS215.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	9.023	0.985338	0.18889	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	5.55	5.55	0.83447	Peptidase M13 (1);	0.148771	0.64402	D	0.000011	T	0.67692	0.2920	N	0.11818	0.18	0.46927	D	0.99925	B;B;B;B;B	0.18741	0.002;0.021;0.005;0.03;0.017	B;B;B;B;B	0.25614	0.014;0.029;0.062;0.017;0.017	T	0.62459	-0.6850	10	0.17369	T	0.5	-32.4324	9.8024	0.40773	0.9189:0.0:0.0811:0.0	.	405;389;405;393;402	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	V	389;393;405;405;402	ENSP00000405088:F389V;ENSP00000349581:F393V;ENSP00000364028:F405V;ENSP00000388439:F405V;ENSP00000264205:F402V	ENSP00000264205:F402V	F	-	1	0	ECE1	21444134	1.000000	0.71417	0.995000	0.50966	0.723000	0.41478	1.769000	0.38522	2.122000	0.65172	0.459000	0.35465	TTC		0.557	ECE1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007470.2	NM_001397		Missense_Mutation
PTPRU	10076	broad.mit.edu	37	1	29631874	29631874	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:29631874C>A	ENST00000345512.3	+	19	2913	c.2784C>A	c.(2782-2784)caC>caA	p.H928Q	PTPRU_ENST00000373779.3_Missense_Mutation_p.H918Q|PTPRU_ENST00000323874.8_Missense_Mutation_p.H918Q|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000428026.2_Missense_Mutation_p.H918Q|PTPRU_ENST00000356870.3_Missense_Mutation_p.H918Q|PTPRU_ENST00000460170.2_Missense_Mutation_p.H918Q	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	928	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H928Q(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ATGATCGGCACCGAGTGAAAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	108.0	113.0					1																	29631874		2203	4300	6503	29504461	SO:0001583	missense	10076			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2784C>A	1.37:g.29631874C>A	ENSP00000334941:p.His928Gln	Somatic		x	x	x	29504461	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670396	0.47677	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59	4.06	4.06	0.47325	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	L	0.28115	0.83	0.49051	D	0.999746	B;B;B;B;B	0.33807	0.372;0.372;0.372;0.426;0.426	B;B;B;B;B	0.37304	0.159;0.159;0.159;0.246;0.246	T	0.04991	-1.0913	9	.	.	.	.	16.4948	0.84237	0.0:1.0:0.0:0.0	.	918;918;918;918;928	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	Q	928;918;918;918;918;918	ENSP00000334941:H928Q;ENSP00000362884:H918Q;ENSP00000349333:H918Q;ENSP00000314987:H918Q;ENSP00000392332:H918Q;ENSP00000432906:H918Q	.	H	+	3	2	PTPRU	29504461	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.477000	0.45180	2.556000	0.86216	0.563000	0.77884	CAC		0.567	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1			Missense_Mutation
PODN	127435	broad.mit.edu	37	1	53540316	53540316	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:53540316A>C	ENST00000312553.5	+	4	596	c.589A>C	c.(589-591)Aat>Cat	p.N197H	PODN_ENST00000395871.2_Intron|PODN_ENST00000371500.3_Missense_Mutation_p.N178H|RP11-334A14.5_ENST00000447867.1_RNA	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	149					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)	p.N197H(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GACCAACCTCAATTACCTGTA	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											162.0	160.0	161.0					1																	53540316		2203	4300	6503	53312904	SO:0001583	missense	127435			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.589A>C	1.37:g.53540316A>C	ENSP00000308315:p.Asn197His	Unknown		x	x	x	53312904	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	ENST00000312553.5	37	CCDS573.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202929	0.79127	.	.	ENSG00000174348	ENST00000371500;ENST00000312553	T;T	0.57436	0.4;0.4	5.51	4.32	0.51571	.	0.151959	0.64402	D	0.000019	T	0.57095	0.2030	L	0.33189	0.99	0.80722	D	1	D;D	0.71674	0.998;0.994	P;P	0.62560	0.904;0.879	T	0.57991	-0.7715	10	0.48119	T	0.1	.	12.2276	0.54470	0.858:0.142:0.0:0.0	.	178;197	Q7Z5L7-2;Q7Z5L7-3	.;.	H	178;197	ENSP00000360555:N178H;ENSP00000308315:N197H	ENSP00000308315:N197H	N	+	1	0	PODN	53312904	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.422000	0.52749	2.077000	0.62373	0.533000	0.62120	AAT		0.562	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024735.1	NM_153703		Missense_Mutation
LPPR4	9890	broad.mit.edu	37	1	99771604	99771604	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:99771604T>A	ENST00000370185.3	+	7	1827	c.1330T>A	c.(1330-1332)Tca>Aca	p.S444T	LPPR4_ENST00000370184.1_Missense_Mutation_p.S286T|LPPR4_ENST00000457765.1_Missense_Mutation_p.S386T	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		444					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.S444T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TTCCGCTCGATCAAAGCAGCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	69.0	69.0					1																	99771604		2203	4300	6503	99544192	SO:0001583	missense	9890																														ENST00000370185.3:c.1330T>A	1.37:g.99771604T>A	ENSP00000359204:p.Ser444Thr	Unknown		x	x	x	99544192	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	16.54	3.152933	0.57259	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.37584	1.76;1.47;1.19	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.45558	0.1348	L	0.54323	1.7	0.58432	D	0.999999	D;P	0.61697	0.99;0.897	D;B	0.72982	0.979;0.443	T	0.36648	-0.9739	9	.	.	.	-15.8703	15.6012	0.76626	0.0:0.0:0.0:1.0	.	386;444	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	T	444;386;444;286	ENSP00000359204:S444T;ENSP00000394913:S386T;ENSP00000359203:S286T	.	S	+	1	0	RP4-788L13.1	99544192	1.000000	0.71417	0.738000	0.30950	0.619000	0.37552	7.613000	0.82986	2.082000	0.62665	0.528000	0.53228	TCA		0.498	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			Missense_Mutation
SHE	126669	broad.mit.edu	37	1	154461579	154461579	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:154461579C>A	ENST00000304760.2	-	3	1058	c.972G>T	c.(970-972)gaG>gaT	p.E324D		NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	324								p.E324D(1)		breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCTGCTCGTACTCTGCCGCGG	0.687																																																1	Substitution - Missense(1)	ovary(1)	1											41.0	44.0	43.0					1																	154461579		2203	4299	6502	152728203	SO:0001583	missense	126669			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.972G>T	1.37:g.154461579C>A	ENSP00000307369:p.Glu324Asp	Unknown		x	x	x	152728203	Q8TEQ5	Missense_Mutation	SNP	ENST00000304760.2	37	CCDS30877.1	SNP	20	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.69|15.69	2.908549|2.908549	0.52439|0.52439	.|.	.|.	ENSG00000169291|ENSG00000169291	ENST00000304760|ENST00000555188	T|.	0.35789|.	1.29|.	5.61|5.61	4.68|4.68	0.58851|0.58851	.|.	0.174924|.	0.49916|.	D|.	0.000137|.	T|T	0.56804|0.56804	0.2010|0.2010	L|L	0.58101|0.58101	1.795|1.795	0.51012|0.51012	D|D	0.999905|0.999905	B|.	0.25351|.	0.124|.	B|.	0.18263|.	0.021|.	T|T	0.51826|0.51826	-0.8656|-0.8656	10|5	0.44086|.	T|.	0.13|.	-10.1471|-10.1471	13.9446|13.9446	0.64077|0.64077	0.0:0.925:0.0:0.075|0.0:0.925:0.0:0.075	.|.	324|.	Q5VZ18|.	SHE_HUMAN|.	D|L	324|22	ENSP00000307369:E324D|.	ENSP00000307369:E324D|.	E|V	-|-	3|1	2|0	SHE|SHE	152728203|152728203	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.206000|0.206000	0.24218|0.24218	2.757000|2.757000	0.47557|0.47557	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GAG|GTA		0.687	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846		Missense_Mutation
INSRR	3645	broad.mit.edu	37	1	156823766	156823766	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:156823766C>G	ENST00000368195.3	-	2	811	c.415G>C	c.(415-417)Gtg>Ctg	p.V139L	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	139					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V139L(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCACACGCACAGCCCCACGC	0.627																																																2	Substitution - Missense(2)	ovary(2)	1											59.0	53.0	55.0					1																	156823766		2203	4300	6503	155090390	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.415G>C	1.37:g.156823766C>G	ENSP00000357178:p.Val139Leu	Unknown		x	x	x	155090390	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953421	0.73902	.	.	ENSG00000027644	ENST00000368195	D	0.83419	-1.72	5.06	5.06	0.68205	EGF receptor, L domain (1);	0.000000	0.43579	D	0.000551	D	0.82907	0.5139	.	.	.	0.47476	D	0.999437	P	0.51933	0.949	P	0.50378	0.639	D	0.85317	0.1082	9	0.62326	D	0.03	.	15.916	0.79517	0.0:1.0:0.0:0.0	.	139	P14616	INSRR_HUMAN	L	139	ENSP00000357178:V139L	ENSP00000357178:V139L	V	-	1	0	INSRR	155090390	0.938000	0.31826	0.958000	0.39756	0.987000	0.75469	1.851000	0.39338	2.367000	0.80283	0.557000	0.71058	GTG		0.627	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215		Missense_Mutation
SPTA1	6708	broad.mit.edu	37	1	158651358	158651358	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:158651358C>G	ENST00000368147.4	-	4	670	c.490G>C	c.(490-492)Gta>Cta	p.V164L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	164					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.V164L(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACTCCTGTACATACTGCTGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											228.0	230.0	230.0					1																	158651358		2035	4195	6230	156917982	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.490G>C	1.37:g.158651358C>G	ENSP00000357129:p.Val164Leu	Unknown		x	x	x	156917982	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.293563	0.00245	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.47869	0.83;0.83	5.15	-1.04	0.10068	.	.	.	.	.	T	0.02727	0.0082	N	0.00656	-1.285	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.30880	-0.9963	9	0.08381	T	0.77	.	0.3116	0.00288	0.3859:0.1378:0.2203:0.256	.	164	P02549	SPTA1_HUMAN	L	164	ENSP00000357130:V164L;ENSP00000357129:V164L	ENSP00000357129:V164L	V	-	1	0	SPTA1	156917982	1.000000	0.71417	0.005000	0.12908	0.017000	0.09413	2.307000	0.43682	-0.358000	0.08162	-2.746000	0.00125	GTA		0.552	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		Missense_Mutation
AIM2	9447	broad.mit.edu	37	1	159036107	159036107	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:159036107G>T	ENST00000368130.4	-	4	697	c.409C>A	c.(409-411)Cag>Aag	p.Q137K	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	137					activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)	p.Q137K(1)		breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					GCCACCATCTGTTTCTGTTCA	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											48.0	53.0	51.0					1																	159036107		2203	4298	6501	157302731	SO:0001583	missense	9447			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.409C>A	1.37:g.159036107G>T	ENSP00000357112:p.Gln137Lys	Unknown		x	x	x	157302731	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	ENST00000368130.4	37	CCDS1181.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	2.703	-0.270455	0.05716	.	.	ENSG00000163568	ENST00000368130	T	0.06933	3.24	3.05	1.09	0.20402	.	.	.	.	.	T	0.00998	0.0033	L	0.27053	0.805	0.09310	N	1	B	0.29862	0.259	B	0.24394	0.053	T	0.46992	-0.9151	9	0.02654	T	1	-1.9445	3.731	0.08493	0.136:0.0:0.6239:0.2401	.	137	O14862	AIM2_HUMAN	K	137	ENSP00000357112:Q137K	ENSP00000357112:Q137K	Q	-	1	0	AIM2	157302731	0.001000	0.12720	0.005000	0.12908	0.240000	0.25518	-0.058000	0.11750	0.137000	0.18759	0.491000	0.48974	CAG		0.448	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833		Missense_Mutation
HMCN1	83872	broad.mit.edu	37	1	185834950	185834950	+	Silent	SNP	A	A	C	rs377577511		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:185834950A>C	ENST00000271588.4	+	4	805	c.576A>C	c.(574-576)acA>acC	p.T192T	HMCN1_ENST00000367492.2_Silent_p.T192T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	192	VWFA.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T192T(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTGCCTCTACAAGTTCTGGTC	0.343																																																1	Substitution - coding silent(1)	ovary(1)	1						A		1,4405	2.1+/-5.4	0,1,2202	84.0	87.0	86.0		576	3.3	1.0	1		86	0,8600		0,0,4300	no	coding-synonymous	HMCN1	NM_031935.2		0,1,6502	CC,CA,AA		0.0,0.0227,0.0077		192/5636	185834950	1,13005	2203	4300	6503	184101573	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.576A>C	1.37:g.185834950A>C		Unknown		x	x	x	184101573	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	5	Broad																																																																																				0.343	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Silent
CACNA1S	779	broad.mit.edu	37	1	201039521	201039521	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr1:201039521C>T	ENST00000362061.3	-	17	2465	c.2239G>A	c.(2239-2241)Gaa>Aaa	p.E747K	CACNA1S_ENST00000367338.3_Missense_Mutation_p.E747K	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	747					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.E747K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTCATCTTCCTCGTCATCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	71.0	70.0					1																	201039521		2203	4300	6503	199306144	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2239G>A	1.37:g.201039521C>T	ENSP00000355192:p.Glu747Lys	Unknown		x	x	x	199306144	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403402	0.83230	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96334	-3.98;-3.89	4.18	4.18	0.49190	.	0.296036	0.32386	N	0.006174	D	0.97813	0.9282	M	0.74546	2.27	0.58432	D	0.999998	D	0.76494	0.999	D	0.85130	0.997	D	0.98628	1.0670	10	0.62326	D	0.03	.	16.8708	0.86040	0.0:1.0:0.0:0.0	.	747	Q13698	CAC1S_HUMAN	K	747	ENSP00000355192:E747K;ENSP00000356307:E747K	ENSP00000355192:E747K	E	-	1	0	CACNA1S	199306144	1.000000	0.71417	0.995000	0.50966	0.549000	0.35272	7.770000	0.85390	2.032000	0.59987	0.643000	0.83706	GAA		0.597	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		Missense_Mutation
PFKFB3	5209	broad.mit.edu	37	10	6262679	6262679	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr10:6262679C>T	ENST00000379775.4	+	8	1012	c.682C>T	c.(682-684)Cag>Tag	p.Q228*	PFKFB3_ENST00000360521.2_Nonsense_Mutation_p.Q228*|PFKFB3_ENST00000379782.3_Nonsense_Mutation_p.Q228*|PFKFB3_ENST00000540253.1_Nonsense_Mutation_p.Q242*|PFKFB3_ENST00000317350.4_Nonsense_Mutation_p.Q228*|PFKFB3_ENST00000379785.1_Nonsense_Mutation_p.Q228*|PFKFB3_ENST00000379789.4_Nonsense_Mutation_p.Q208*|PFKFB3_ENST00000536985.1_3'UTR	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	228	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)	p.Q228*(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						GAACCGGGTGCAGGACCACAT	0.607																																																1	Substitution - Nonsense(1)	ovary(1)	10											164.0	129.0	141.0					10																	6262679		2203	4300	6503	6302685	SO:0001587	stop_gained	5209				CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.682C>T	10.37:g.6262679C>T	ENSP00000369100:p.Gln228*	Unknown		x	x	x	6302685	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Nonsense_Mutation	SNP	ENST00000379775.4	37	CCDS7078.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	39	7.807899	0.98501	.	.	ENSG00000170525	ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.93	5.93	0.95920	.	0.105167	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-16.469	20.3437	0.98782	0.0:1.0:0.0:0.0	.	.	.	.	X	208;242;228;228;228;228;228;228	.	ENSP00000369105:Q228X	Q	+	1	0	PFKFB3	6302685	1.000000	0.71417	0.969000	0.41365	0.998000	0.95712	5.781000	0.68964	2.815000	0.96918	0.561000	0.74099	CAG		0.607	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1			Nonsense_Mutation
KRTAP5-3	387266	broad.mit.edu	37	11	1629565	1629565	+	Silent	SNP	A	A	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:1629565A>G	ENST00000399685.1	-	1	128	c.51T>C	c.(49-51)tgT>tgC	p.C17C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	17						keratin filament (GO:0045095)		p.C17C(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		AGCTGGAGCCACAGCCCCCAC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	11											47.0	61.0	56.0					11																	1629565		2189	4284	6473	1586141	SO:0001819	synonymous_variant	387266			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.51T>C	11.37:g.1629565A>G		Unknown		x	x	x	1586141	Q6PL44|Q701N3	Silent	SNP	ENST00000399685.1	37	CCDS41591.1	SNP	6	Broad																																																																																				0.662	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1			Silent
ACCSL	390110	broad.mit.edu	37	11	44075012	44075012	+	Silent	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:44075012C>A	ENST00000378832.1	+	8	1061	c.1005C>A	c.(1003-1005)atC>atA	p.I335I		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	335					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)	p.I335I(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TGGGTGACATCTACTCCCCAG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	11											111.0	104.0	106.0					11																	44075012		1863	4095	5958	44031588	SO:0001819	synonymous_variant	390110				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1005C>A	11.37:g.44075012C>A		Unknown		x	x	x	44031588		Silent	SNP	ENST00000378832.1	37	CCDS41636.1	SNP	32	Broad																																																																																				0.438	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854		Silent
NUP160	23279	broad.mit.edu	37	11	47869819	47869819	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:47869819C>G	ENST00000378460.2	-	1	200	c.154G>C	c.(154-156)Gag>Cag	p.E52Q	NUP160_ENST00000530326.1_5'UTR|NUP160_ENST00000526870.1_Missense_Mutation_p.E52Q|NUP160_ENST00000532747.1_Missense_Mutation_p.E18Q	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	52					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.E52Q(1)		NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CTTTCGCGCTCAGCTCCGCTT	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											63.0	65.0	64.0					11																	47869819		2201	4298	6499	47826395	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.154G>C	11.37:g.47869819C>G	ENSP00000367721:p.Glu52Gln	Unknown		x	x	x	47826395	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	ENST00000378460.2	37	CCDS31484.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131427	0.56828	.	.	ENSG00000030066	ENST00000378460;ENST00000532747;ENST00000526870	T;T;T	0.54479	1.3;0.61;0.57	5.01	4.09	0.47781	.	0.067343	0.56097	D	0.000022	T	0.51991	0.1707	N	0.24115	0.695	0.28169	N	0.928651	D;D	0.76494	0.999;0.966	D;P	0.64776	0.929;0.462	T	0.43065	-0.9414	10	0.54805	T	0.06	.	7.7716	0.29012	0.1646:0.7478:0.0:0.0876	.	52;52	Q12769-2;Q12769	.;NU160_HUMAN	Q	52;18;52	ENSP00000367721:E52Q;ENSP00000432437:E18Q;ENSP00000431495:E52Q	ENSP00000367721:E52Q	E	-	1	0	NUP160	47826395	0.987000	0.35691	0.943000	0.38184	0.182000	0.23217	1.741000	0.38238	2.487000	0.83934	0.491000	0.48974	GAG		0.667	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231		Missense_Mutation
FADD	8772	broad.mit.edu	37	11	70052294	70052294	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1356-01	TCGA-04-1356-11			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:70052294G>C	ENST00000301838.4	+	2	639	c.342G>C	c.(340-342)agG>agC	p.R114S	RP11-805J14.5_ENST00000526174.1_RNA|RP11-805J14.5_ENST00000527232.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	114	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)	p.R114S(1)		endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			ATTGGAGAAGGCTGGCTCGTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											82.0	68.0	73.0					11																	70052294		2200	4294	6494	69729942	SO:0001583	missense	8772			U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.342G>C	11.37:g.70052294G>C	ENSP00000301838:p.Arg114Ser	Somatic		x	x	x	69729942	Q14866|Q6IBR4	Missense_Mutation	SNP	ENST00000301838.4	37	CCDS8196.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	12.69	2.013362	0.35511	.	.	ENSG00000168040	ENST00000301838	D	0.86097	-2.07	4.99	-9.98	0.00438	Death (3);DEATH-like (3);	0.355549	0.30658	N	0.009150	D	0.83649	0.5300	L	0.50919	1.6	0.21719	N	0.999578	D	0.59767	0.986	P	0.53760	0.734	T	0.83308	-0.0024	10	0.52906	T	0.07	-19.7511	19.5181	0.95174	0.1117:0.0:0.7917:0.0966	.	114	Q13158	FADD_HUMAN	S	114	ENSP00000301838:R114S	ENSP00000301838:R114S	R	+	3	2	FADD	69729942	0.261000	0.24063	0.000000	0.03702	0.291000	0.27294	-0.159000	0.10056	-2.069000	0.00882	-1.069000	0.02264	AGG		0.498	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393902.1	NM_003824		Missense_Mutation
RSF1	51773	broad.mit.edu	37	11	77378188	77378188	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:77378188T>C	ENST00000308488.6	-	16	4402	c.4100A>G	c.(4099-4101)gAc>gGc	p.D1367G	RSF1_ENST00000480887.1_Missense_Mutation_p.D1115G|RSF1_ENST00000360355.2_Missense_Mutation_p.D1336G			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1367					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.D1367G(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TGAAGGTAAGTCCACTAAGCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											135.0	122.0	126.0					11																	77378188		2200	4292	6492	77055836	SO:0001583	missense	51773			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.4100A>G	11.37:g.77378188T>C	ENSP00000311513:p.Asp1367Gly	Unknown		x	x	x	77055836	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	37	CCDS8253.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	16.47	3.132250	0.56828	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355	D;D;D	0.87571	-2.25;-2.27;-2.25	4.83	4.83	0.62350	.	0.121113	0.37393	N	0.002119	D	0.86418	0.5928	N	0.22421	0.69	0.48696	D	0.999691	D	0.61697	0.99	P	0.57204	0.815	D	0.88465	0.3058	10	0.72032	D	0.01	-16.0851	14.5242	0.67875	0.0:0.0:0.0:1.0	.	1367	Q96T23	RSF1_HUMAN	G	1367;1115;1336	ENSP00000311513:D1367G;ENSP00000434509:D1115G;ENSP00000353511:D1336G	ENSP00000311513:D1367G	D	-	2	0	RSF1	77055836	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.203000	0.65174	2.165000	0.68154	0.379000	0.24179	GAC		0.498	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578		Missense_Mutation
CARD18	59082	broad.mit.edu	37	11	105009751	105009751	+	Missense_Mutation	SNP	G	G	T	rs375563255		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr11:105009751G>T	ENST00000530950.1	-	2	61	c.62C>A	c.(61-63)aCa>aAa	p.T21K	CARD18_ENST00000526823.1_5'UTR|CARD18_ENST00000532895.1_5'UTR	NM_021571.3	NP_067546.1	P57730	CAR18_HUMAN	caspase recruitment domain family, member 18	21	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				inflammatory response (GO:0006954)|regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.T21K(1)		central_nervous_system(1)|ovary(1)	2						GGCATTTATTGTGCCTGCACC	0.388																																																1	Substitution - Missense(1)	ovary(1)	11											142.0	128.0	133.0					11																	105009751		1889	4116	6005	104514961	SO:0001583	missense	59082			AY358231	CCDS53705.1	11q22.3	2008-09-02				ENSG00000255501			28861	protein-coding gene	gene with protein product		605354				11051551	Standard	NM_021571		Approved	UNQ5804, ICEBERG, pseudo-ICE	uc021qpy.1	P57730		ENST00000530950.1:c.62C>A	11.37:g.105009751G>T	ENSP00000436691:p.Thr21Lys	Unknown		x	x	x	104514961	A2RRF8	Missense_Mutation	SNP	ENST00000530950.1	37	CCDS53705.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	.	14.69	2.609658	0.46527	.	.	ENSG00000255501	ENST00000530950	T	0.21361	2.01	2.85	1.89	0.25635	DEATH-like (2);Caspase Recruitment (3);	0.504996	0.20525	U	0.090635	T	0.38108	0.1028	.	.	.	0.09310	N	0.999996	D	0.71674	0.998	D	0.77004	0.989	T	0.05225	-1.0898	9	0.66056	D	0.02	.	6.944	0.24508	0.0:0.0:0.7266:0.2734	.	21	P57730	CAR18_HUMAN	K	21	ENSP00000436691:T21K	ENSP00000436691:T21K	T	-	2	0	CARD18	104514961	0.000000	0.05858	0.012000	0.15200	0.320000	0.28249	0.363000	0.20301	0.740000	0.32651	0.552000	0.68991	ACA		0.388	CARD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388183.2	NM_021571		Missense_Mutation
VWF	7450	broad.mit.edu	37	12	6128552	6128552	+	Silent	SNP	G	G	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr12:6128552G>A	ENST00000261405.5	-	28	4286	c.4032C>T	c.(4030-4032)gcC>gcT	p.A1344A		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1344	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.A1344A(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TCACCTGGCTGGCAATGCGCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	12											51.0	47.0	48.0					12																	6128552		2203	4300	6503	5998813	SO:0001819	synonymous_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4032C>T	12.37:g.6128552G>A		Unknown		x	x	x	5998813	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1	SNP	47	Broad																																																																																				0.617	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		Silent
CLSTN3	9746	broad.mit.edu	37	12	7280886	7280886	+	5'Flank	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr12:7280886C>G	ENST00000266546.6	+	0	0				RBP5_ENST00000542370.1_Missense_Mutation_p.G68R|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA|RBP5_ENST00000266560.3_Missense_Mutation_p.G68R	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.G68R(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						AACTCCACTCCCACATCAAAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	12											167.0	133.0	145.0					12																	7280886		2203	4300	6503	7172153	SO:0001631	upstream_gene_variant	83758			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7280886C>G	Exception_encountered	Unknown		x	x	x	7172153	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576150	0.65878	.	.	ENSG00000139194	ENST00000266560;ENST00000542370	T;T	0.59502	0.26;0.26	3.55	3.55	0.40652	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.78065	0.4225	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83475	0.0061	10	0.87932	D	0	.	16.4215	0.83760	0.0:1.0:0.0:0.0	.	68	P82980	RET5_HUMAN	R	68	ENSP00000266560:G68R;ENSP00000438083:G68R	ENSP00000266560:G68R	G	-	1	0	RBP5	7172153	1.000000	0.71417	0.541000	0.28102	0.173000	0.22820	5.571000	0.67404	2.270000	0.75569	0.491000	0.48974	GGA		0.587	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718		Missense_Mutation
CD163L1	283316	broad.mit.edu	37	12	7527906	7527906	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr12:7527906T>C	ENST00000313599.3	-	11	3029	c.2972A>G	c.(2971-2973)cAt>cGt	p.H991R	CD163L1_ENST00000396630.1_Missense_Mutation_p.H991R|CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.H1001R			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	991	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.H991R(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AGTATTTCCATGGATACAGGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											81.0	71.0	74.0					12																	7527906		2203	4300	6503	7419173	SO:0001583	missense	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2972A>G	12.37:g.7527906T>C	ENSP00000315945:p.His991Arg	Unknown		x	x	x	7419173	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	13.85	2.360019	0.41801	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.33438	1.41;1.41;1.41	2.29	-4.58	0.03410	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.406548	0.19898	U	0.103584	T	0.33323	0.0859	M	0.66939	2.045	0.09310	N	1	P;P	0.52170	0.951;0.888	P;P	0.50659	0.647;0.647	T	0.23440	-1.0188	10	0.56958	D	0.05	.	7.7559	0.28923	0.0:0.1223:0.661:0.2167	.	1001;991	E7EVK4;Q9NR16	.;C163B_HUMAN	R	991;1001;991	ENSP00000315945:H991R;ENSP00000393474:H1001R;ENSP00000379871:H991R	ENSP00000315945:H991R	H	-	2	0	CD163L1	7419173	0.000000	0.05858	0.000000	0.03702	0.309000	0.27889	-0.643000	0.05421	-1.236000	0.02542	0.374000	0.22700	CAT		0.438	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		Missense_Mutation
PXN	5829	broad.mit.edu	37	12	120652010	120652010	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr12:120652010G>C	ENST00000228307.7	-	10	1430	c.1289C>G	c.(1288-1290)aCa>aGa	p.T430R	PXN-AS1_ENST00000535200.1_RNA|PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000458477.2_Missense_Mutation_p.T263R|PXN_ENST00000267257.7_Missense_Mutation_p.T444R|PXN_ENST00000397506.3_Missense_Mutation_p.T242R|PXN_ENST00000536957.1_Missense_Mutation_p.T428R|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000424649.2_Missense_Mutation_p.T396R|PXN-AS1_ENST00000539446.1_RNA	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	430	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTCAAGGGCTGTCACCACTTT	0.592																																																0			12											27.0	29.0	28.0					12																	120652010		1887	3853	5740	119136393	SO:0001583	missense	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.1289C>G	12.37:g.120652010G>C	ENSP00000228307:p.Thr430Arg	Unknown		x	x	x	119136393	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.228553	0.95173	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000397506;ENST00000331257;ENST00000541856	D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.63	5.63	0.86233	Zinc finger, LIM-type (5);	.	.	.	.	D	0.91901	0.7436	L	0.52573	1.65	0.80722	D	1	P;D;P;P	0.53151	0.928;0.958;0.722;0.941	P;P;P;P	0.57244	0.614;0.816;0.733;0.803	D	0.91510	0.5226	9	0.51188	T	0.08	.	19.6972	0.96030	0.0:0.0:1.0:0.0	.	396;444;242;430	P49023-2;P49023-3;E7EMK8;P49023	.;.;.;PAXI_HUMAN	R	263;430;396;428;444;242;58;155	ENSP00000395536:T263R;ENSP00000228307:T430R;ENSP00000391283:T396R;ENSP00000443887:T428R;ENSP00000267257:T444R;ENSP00000380643:T242R	ENSP00000228307:T430R	T	-	2	0	PXN	119136393	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.677000	0.98645	2.663000	0.90544	0.650000	0.86243	ACA		0.592	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859		Missense_Mutation
RNF31	55072	broad.mit.edu	37	14	24619652	24619652	+	Missense_Mutation	SNP	C	C	A	rs371872565		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr14:24619652C>A	ENST00000324103.6	+	7	1512	c.1192C>A	c.(1192-1194)Ctt>Att	p.L398I	RNF31_ENST00000382687.3_Missense_Mutation_p.L247I|RP11-468E2.4_ENST00000558468.1_5'Flank|RNF31_ENST00000559275.1_Missense_Mutation_p.L247I	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	398	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L398I(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		CCTGCAACCCCTTCAGGTAAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											60.0	64.0	63.0					14																	24619652		2025	4177	6202	23689492	SO:0001583	missense	55072			AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1192C>A	14.37:g.24619652C>A	ENSP00000315112:p.Leu398Ile	Unknown		x	x	x	23689492	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	37	CCDS41931.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	8.591	0.884620	0.17467	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.46063	0.88;0.91	5.44	3.64	0.41730	.	0.340268	0.27113	N	0.020874	T	0.39279	0.1072	M	0.68952	2.095	0.80722	D	1	B;B;B	0.30851	0.297;0.003;0.005	B;B;B	0.31390	0.129;0.004;0.017	T	0.24621	-1.0155	10	0.46703	T	0.11	-4.931	8.0681	0.30672	0.0:0.8202:0.0:0.1798	.	213;398;247	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	I	398;247	ENSP00000315112:L398I;ENSP00000372134:L247I	ENSP00000315112:L398I	L	+	1	0	RNF31	23689492	0.998000	0.40836	1.000000	0.80357	0.850000	0.48378	0.690000	0.25451	0.864000	0.35578	0.655000	0.94253	CTT		0.542	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999		Missense_Mutation
SHC4	399694	broad.mit.edu	37	15	49160022	49160022	+	Silent	SNP	A	A	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr15:49160022A>G	ENST00000332408.4	-	6	1367	c.939T>C	c.(937-939)aaT>aaC	p.N313N	SHC4_ENST00000396535.3_Silent_p.N70N|SHC4_ENST00000537958.1_Silent_p.N27N	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	313	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.N313N(1)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TACCTCGTTGATTAACTGGAT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	15											124.0	123.0	123.0					15																	49160022		2197	4295	6492	46947314	SO:0001819	synonymous_variant	399694			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.939T>C	15.37:g.49160022A>G		Unknown		x	x	x	46947314	Q6UXQ3|Q8IYW3	Silent	SNP	ENST00000332408.4	37	CCDS10130.1	SNP	12	Broad																																																																																				0.333	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349		Silent
HCN4	10021	broad.mit.edu	37	15	73617422	73617422	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr15:73617422G>T	ENST00000261917.3	-	6	2845	c.1852C>A	c.(1852-1854)Cct>Act	p.P618T		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	618					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.P618T(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TAGTCCCCAGGCTGGAAGACC	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											141.0	116.0	124.0					15																	73617422		2198	4297	6495	71404475	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1852C>A	15.37:g.73617422G>T	ENSP00000261917:p.Pro618Thr	Unknown		x	x	x	71404475	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.13	3.556380	0.65425	.	.	ENSG00000138622	ENST00000261917	D	0.97505	-4.41	3.65	3.65	0.41850	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.98182	0.9399	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99267	1.0892	9	0.87932	D	0	.	15.5397	0.76031	0.0:0.0:1.0:0.0	.	618	Q9Y3Q4	HCN4_HUMAN	T	618	ENSP00000261917:P618T	ENSP00000261917:P618T	P	-	1	0	HCN4	71404475	1.000000	0.71417	0.988000	0.46212	0.966000	0.64601	9.494000	0.97962	1.877000	0.54381	0.561000	0.74099	CCT		0.562	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477		Missense_Mutation
PPL	5493	broad.mit.edu	37	16	4940197	4940197	+	Silent	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr16:4940197C>T	ENST00000345988.2	-	18	2390	c.2301G>A	c.(2299-2301)ctG>ctA	p.L767L	PPL_ENST00000590782.2_Silent_p.L765L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	767					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.L767L(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TCTGGTTCTTCAGCTTGGTCT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	16											153.0	116.0	129.0					16																	4940197		2197	4300	6497	4880198	SO:0001819	synonymous_variant	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2301G>A	16.37:g.4940197C>T		Unknown		x	x	x	4880198	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1	SNP	29	Broad																																																																																				0.597	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705		Silent
DCUN1D3	123879	broad.mit.edu	37	16	20873513	20873513	+	Silent	SNP	A	A	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr16:20873513A>G	ENST00000324344.4	-	2	633	c.348T>C	c.(346-348)aaT>aaC	p.N116N	ERI2_ENST00000564349.1_Intron|DCUN1D3_ENST00000563934.1_Silent_p.N116N	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	116	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)		p.N116N(1)		NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		CACACAGGTCATTGCAAAAGC	0.493																																																1	Substitution - coding silent(1)	ovary(1)	16											144.0	116.0	125.0					16																	20873513		2201	4300	6501	20781014	SO:0001819	synonymous_variant	123879			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.348T>C	16.37:g.20873513A>G		Unknown		x	x	x	20781014	B3KVY4	Silent	SNP	ENST00000324344.4	37	CCDS10592.1	SNP	8	Broad																																																																																				0.493	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475		Silent
PRSS36	146547	broad.mit.edu	37	16	31154693	31154693	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr16:31154693C>T	ENST00000268281.4	-	8	1128	c.1070G>A	c.(1069-1071)tGg>tAg	p.W357*	PRSS36_ENST00000418068.2_Nonsense_Mutation_p.W357*|PRSS36_ENST00000569305.1_Nonsense_Mutation_p.W357*	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	357	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)	p.W357*(1)		kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						TGCCAAGACCCAGCTTTCAGA	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	16											42.0	50.0	47.0					16																	31154693		2197	4300	6497	31062194	SO:0001587	stop_gained	146547			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.1070G>A	16.37:g.31154693C>T	ENSP00000268281:p.Trp357*	Unknown		x	x	x	31062194	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Nonsense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.513564	0.96402	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	.	.	.	4.26	3.31	0.37934	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6404	0.28290	0.0:0.8851:0.0:0.1149	.	.	.	.	X	357	.	ENSP00000268281:W357X	W	-	2	0	PRSS36	31062194	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.126000	0.42026	1.010000	0.39314	0.491000	0.48974	TGG		0.632	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	NM_173502		Nonsense_Mutation
ARMC5	79798	broad.mit.edu	37	16	31476261	31476261	+	Intron	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr16:31476261C>A	ENST00000563544.1	+	5	2410				ARMC5_ENST00000538189.1_Intron|ARMC5_ENST00000268314.4_Intron|ARMC5_ENST00000457010.2_Silent_p.S639S|ARMC5_ENST00000408912.3_Intron|ARMC5_ENST00000412665.2_Intron			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5											central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CCCCATCCTCCCCCATGGCTT	0.667																																																0			16											35.0	40.0	38.0					16																	31476261		2025	4172	6197	31383762	SO:0001627	intron_variant	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1864+53C>A	16.37:g.31476261C>A		Unknown		x	x	x	31383762	Q86WM9|Q9H7P8|Q9H925	Silent	SNP	ENST00000563544.1	37	CCDS45472.1	SNP	22	Broad																																																																																				0.667	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742		Silent
CNOT1	23019	broad.mit.edu	37	16	58576378	58576378	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr16:58576378G>C	ENST00000317147.5	-	32	4861	c.4529C>G	c.(4528-4530)aCt>aGt	p.T1510S	CNOT1_ENST00000569240.1_Missense_Mutation_p.T1505S|CNOT1_ENST00000245138.4_Missense_Mutation_p.T361S	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1510	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.T1510S(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTCTACTGCAGTCTTCTGAAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	16											170.0	185.0	180.0					16																	58576378		2198	4300	6498	57133879	SO:0001583	missense	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4529C>G	16.37:g.58576378G>C	ENSP00000320949:p.Thr1510Ser	Unknown		x	x	x	57133879	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409902	0.62399	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T	0.47177	0.85	5.56	5.56	0.83823	CCR4-Not complex, Not1 subunit, domain of unknown function DUF3819 (1);	0.101255	0.64402	D	0.000002	T	0.42154	0.1190	L	0.33137	0.985	0.80722	D	1	B;P;B	0.35077	0.209;0.483;0.427	B;B;B	0.36464	0.038;0.225;0.144	T	0.16512	-1.0400	10	0.24483	T	0.36	-34.8762	19.5451	0.95291	0.0:0.0:1.0:0.0	.	361;1510;1505	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	S	1510;361;1505	ENSP00000320949:T1510S	ENSP00000245138:T361S	T	-	2	0	CNOT1	57133879	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.030000	0.88816	2.629000	0.89072	0.655000	0.94253	ACT		0.393	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		Missense_Mutation
DNAH17	8632	broad.mit.edu	37	17	76523057	76523057	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr17:76523057T>G	ENST00000585328.1	-	23	3644	c.3520A>C	c.(3520-3522)Aat>Cat	p.N1174H	DNAH17_ENST00000389840.5_Missense_Mutation_p.N1177H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1177	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N1174H(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTCTTGGTATTTGCCCAGTGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											28.0	28.0	28.0					17																	76523057		2024	4166	6190	74034652	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.3520A>C	17.37:g.76523057T>G	ENSP00000465516:p.Asn1174His	Unknown		x	x	x	74034652	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	12.03	1.814153	0.32053	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.23950	1.88	4.45	3.3	0.37823	.	.	.	.	.	T	0.34658	0.0905	L	0.60957	1.885	0.32167	N	0.582107	.	.	.	.	.	.	T	0.42515	-0.9447	7	0.46703	T	0.11	.	10.3363	0.43852	0.0:0.0:0.3094:0.6906	.	.	.	.	H	1174;1177	ENSP00000374490:N1177H	ENSP00000300671:N1174H	N	-	1	0	DNAH17	74034652	0.851000	0.29673	0.913000	0.36048	0.783000	0.44284	1.218000	0.32467	1.874000	0.54306	0.459000	0.35465	AAT		0.512	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		Missense_Mutation
NFATC1	4772	broad.mit.edu	37	18	77211065	77211065	+	Silent	SNP	C	C	T	rs141454060	byFrequency	TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr18:77211065C>T	ENST00000427363.2	+	5	1701	c.1701C>T	c.(1699-1701)caC>caT	p.H567H	NFATC1_ENST00000318065.5_Silent_p.H554H|NFATC1_ENST00000545796.1_Silent_p.H95H|NFATC1_ENST00000329101.4_Silent_p.H554H|NFATC1_ENST00000253506.5_Silent_p.H567H|NFATC1_ENST00000586434.1_Silent_p.H554H|NFATC1_ENST00000592223.1_Silent_p.H554H|NFATC1_ENST00000397790.2_Silent_p.H95H|NFATC1_ENST00000587635.1_Intron|NFATC1_ENST00000542384.1_Silent_p.H567H|NFATC1_ENST00000591814.1_Silent_p.H567H			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	567	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.H554H(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	TCCGCGTTCACGTCCCGCAAC	0.607																																					GBM(151;1210 2593 28719 45011)											1	Substitution - coding silent(1)	ovary(1)	18						C	,,,,	0,4406		0,0,2203	99.0	95.0	97.0		1701,1662,285,1662,1701	3.5	1.0	18	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NFATC1	NM_006162.3,NM_172387.1,NM_172388.1,NM_172389.1,NM_172390.1	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	567/826,554/931,95/354,554/813,567/717	77211065	1,13005	2203	4300	6503	75312053	SO:0001819	synonymous_variant	4772			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1701C>T	18.37:g.77211065C>T		Unknown		x	x	x	75312053	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Silent	SNP	ENST00000427363.2	37		SNP	19	Broad																																																																																				0.607	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390		Silent
P2RY11	5032	broad.mit.edu	37	19	10225200	10225200	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:10225200A>C	ENST00000321826.4	+	2	1095	c.911A>C	c.(910-912)cAg>cCg	p.Q304P	PPAN-P2RY11_ENST00000428358.1_3'UTR|PPAN_ENST00000556468.1_Missense_Mutation_p.Q724P|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.Q724P	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	304					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)	p.Q724P(1)|p.Q304P(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			GTGGGCTACCAGGTGATGCGG	0.687																																																2	Substitution - Missense(2)	ovary(2)	19											37.0	43.0	41.0					19																	10225200		2203	4300	6503	10086200	SO:0001583	missense	692312			AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.911A>C	19.37:g.10225200A>C	ENSP00000323872:p.Gln304Pro	Unknown		x	x	x	10086200	B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	ENST00000321826.4	37	CCDS12226.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	15.76	2.929000	0.52759	.	.	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.36878	1.23;1.23;1.23	3.9	2.85	0.33270	GPCR, rhodopsin-like superfamily (1);	0.082342	0.50627	U	0.000101	T	0.55210	0.1906	M	0.81942	2.565	0.40724	D	0.982688	D	0.89917	1.0	D	0.80764	0.994	T	0.53005	-0.8499	10	0.35671	T	0.21	-16.8107	7.427	0.27105	0.7976:0.0:0.0:0.2024	.	304	Q96G91	P2Y11_HUMAN	P	724;724;304	ENSP00000377385:Q724P;ENSP00000450710:Q724P;ENSP00000323872:Q304P	ENSP00000323872:Q304P	Q	+	2	0	PPAN;P2RY11;PPAN-P2RY11	10086200	1.000000	0.71417	0.129000	0.21949	0.781000	0.44180	3.390000	0.52523	0.529000	0.28599	0.454000	0.30748	CAG		0.687	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316664.2	NM_002566		Missense_Mutation
APLP1	333	broad.mit.edu	37	19	36370071	36370071	+	Silent	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:36370071C>G	ENST00000221891.4	+	16	2001	c.1809C>G	c.(1807-1809)ctC>ctG	p.L603L	APLP1_ENST00000537454.2_Silent_p.L563L|RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000586861.1_Silent_p.L596L	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	602					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.L603L(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCATGCTGCTCCTGCGCAGGA	0.647																																																1	Substitution - coding silent(1)	ovary(1)	19											58.0	59.0	59.0					19																	36370071		2203	4300	6503	41061911	SO:0001819	synonymous_variant	333			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1809C>G	19.37:g.36370071C>G		Unknown		x	x	x	41061911	O00113|Q96A92	Silent	SNP	ENST00000221891.4	37	CCDS32997.1	SNP	30	Broad																																																																																				0.647	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807		Silent
ZNF224	7767	broad.mit.edu	37	19	44610799	44610799	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:44610799C>G	ENST00000336976.6	+	6	740	c.486C>G	c.(484-486)caC>caG	p.H162Q	AC084219.4_ENST00000592946.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	162			H -> L (in dbSNP:rs4239529). {ECO:0000269|PubMed:10585455, ECO:0000269|PubMed:12239212, ECO:0000269|PubMed:15489334}.		negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H162Q(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				ATGTCTCCCACTTTGATTTTC	0.418																																																1	Substitution - Missense(1)	ovary(1)	19											100.0	99.0	99.0					19																	44610799		2203	4300	6503	49302639	SO:0001583	missense	7767			AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.486C>G	19.37:g.44610799C>G	ENSP00000337368:p.His162Gln	Somatic		x	x	x	49302639	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Missense_Mutation	SNP	ENST00000336976.6	37	CCDS33046.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	c	1.943	-0.443117	0.04604	.	.	ENSG00000186019	ENST00000336976	T	0.15256	2.44	2.66	-2.06	0.07298	.	.	.	.	.	T	0.09024	0.0223	N	0.21324	0.655	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.36915	-0.9728	9	0.27082	T	0.32	.	4.667	0.12671	0.0:0.5224:0.165:0.3126	.	162	Q9NZL3	ZN224_HUMAN	Q	162	ENSP00000337368:H162Q	ENSP00000337368:H162Q	H	+	3	2	ZNF224	49302639	0.000000	0.05858	0.000000	0.03702	0.186000	0.23388	-2.346000	0.01096	-0.350000	0.08262	0.591000	0.81541	CAC		0.418	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460477.1	NM_013398		Missense_Mutation
PPP1R13L	10848	broad.mit.edu	37	19	45901284	45901284	+	Silent	SNP	C	C	A	rs372792420		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:45901284C>A	ENST00000418234.2	-	3	255	c.177G>T	c.(175-177)ccG>ccT	p.P59P	PPP1R13L_ENST00000360957.5_Silent_p.P59P	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	59	Pro-rich.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P59P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GTCCGGCCTGCGGGCCAGGAG	0.617																																					Pancreas(61;1447 1663 31419 50578)											1	Substitution - coding silent(1)	ovary(1)	19											34.0	39.0	37.0					19																	45901284		2203	4300	6503	50593124	SO:0001819	synonymous_variant	10848			AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.177G>T	19.37:g.45901284C>A		Unknown		x	x	x	50593124	Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Silent	SNP	ENST00000418234.2	37	CCDS33050.1	SNP	27	Broad																																																																																				0.617	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663		Silent
ARHGAP35	2909	broad.mit.edu	37	19	47423944	47423944	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:47423944T>A	ENST00000404338.3	+	1	2012	c.2012T>A	c.(2011-2013)cTa>cAa	p.L671Q		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	671					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.L671Q(1)									AAGGAATCGCTATCCTATGTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	19											36.0	37.0	37.0					19																	47423944		1909	4133	6042	52115784	SO:0001583	missense	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2012T>A	19.37:g.47423944T>A	ENSP00000385720:p.Leu671Gln	Unknown		x	x	x	52115784	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	14.36	2.512282	0.44660	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.16196	2.36	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.43634	0.1256	M	0.76328	2.33	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.39165	-0.9627	10	0.87932	D	0	-18.7632	15.27	0.73693	0.0:0.0:0.0:1.0	.	671	Q9NRY4-2	.	Q	671	ENSP00000385720:L671Q	ENSP00000324820:L671Q	L	+	2	0	ARHGAP35	52115784	1.000000	0.71417	0.026000	0.17262	0.273000	0.26683	8.009000	0.88606	2.248000	0.74166	0.528000	0.53228	CTA		0.473	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		Missense_Mutation
ABCG5	64240	broad.mit.edu	37	2	44051194	44051194	+	Silent	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:44051194C>A	ENST00000260645.1	-	9	1321	c.1182G>T	c.(1180-1182)ctG>ctT	p.L394L	ABCG5_ENST00000543989.1_5'UTR|ABCG5_ENST00000405322.1_Silent_p.L223L	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	394	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.L394L(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AACCCATGATCAGATTCTGAA	0.458																																																1	Substitution - coding silent(1)	ovary(1)	2											82.0	83.0	83.0					2																	44051194		2203	4300	6503	43904698	SO:0001819	synonymous_variant	64240			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1182G>T	2.37:g.44051194C>A		Unknown		x	x	x	43904698	Q2T9G2|Q96QZ2|Q96QZ3	Silent	SNP	ENST00000260645.1	37	CCDS1814.1	SNP	29	Broad																																																																																				0.458	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436		Silent
PAPOLG	64895	broad.mit.edu	37	2	60998660	60998660	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:60998660C>G	ENST00000238714.3	+	7	748	c.499C>G	c.(499-501)Cta>Gta	p.L167V		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	167					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.L167V(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AAAGATTGATCTAGTCTTTGC	0.368																																					GBM(183;1497 2932 21839 46797)											1	Substitution - Missense(1)	ovary(1)	2											62.0	64.0	63.0					2																	60998660		2202	4300	6502	60852164	SO:0001583	missense	64895			AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.499C>G	2.37:g.60998660C>G	ENSP00000238714:p.Leu167Val	Unknown		x	x	x	60852164	B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	ENST00000238714.3	37	CCDS1863.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396588	0.62177	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.38	2.62	0.31277	Nucleotidyl transferase domain (1);Poly(A) polymerase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.73690	0.3619	M	0.87269	2.87	0.53688	D	0.999977	P	0.46220	0.874	P	0.53760	0.734	T	0.74051	-0.3789	9	0.72032	D	0.01	-29.2594	8.7397	0.34550	0.0:0.7046:0.0:0.2954	.	167	Q9BWT3	PAPOG_HUMAN	V	167	.	ENSP00000238714:L167V	L	+	1	2	PAPOLG	60852164	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.558000	0.36309	0.356000	0.24157	0.586000	0.80456	CTA		0.368	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251577.3	NM_022894		Missense_Mutation
BMP10	27302	broad.mit.edu	37	2	69092852	69092852	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:69092852G>A	ENST00000295379.1	-	2	1344	c.1186C>T	c.(1186-1188)Ccc>Tcc	p.P396S		NM_014482.1	NP_055297.1	O95393	BMP10_HUMAN	bone morphogenetic protein 10	396					activin receptor signaling pathway (GO:0032924)|adult heart development (GO:0007512)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heart trabecula formation (GO:0060347)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction (GO:0055117)|sarcomere organization (GO:0045214)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Z disc (GO:0030018)	hormone activity (GO:0005179)|receptor serine/threonine kinase binding (GO:0033612)	p.P396S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(15)|ovary(2)	27						ATGGAGATGGGCTCTAGCTTT	0.493																																																1	Substitution - Missense(1)	ovary(1)	2											159.0	158.0	159.0					2																	69092852		2203	4300	6503	68946356	SO:0001583	missense	27302			AF101441	CCDS1890.1	2p13.2	2014-09-17			ENSG00000163217	ENSG00000163217		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	20869	protein-coding gene	gene with protein product		608748				10072785	Standard	NM_014482		Approved		uc002sez.1	O95393	OTTHUMG00000129573	ENST00000295379.1:c.1186C>T	2.37:g.69092852G>A	ENSP00000295379:p.Pro396Ser	Unknown		x	x	x	68946356	Q53R17|Q6NTE0	Missense_Mutation	SNP	ENST00000295379.1	37	CCDS1890.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	21.6	4.177756	0.78564	.	.	ENSG00000163217	ENST00000295379	D	0.88586	-2.4	6.17	6.17	0.99709	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91761	0.7394	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91400	0.5142	10	0.52906	T	0.07	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	396	O95393	BMP10_HUMAN	S	396	ENSP00000295379:P396S	ENSP00000295379:P396S	P	-	1	0	BMP10	68946356	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	CCC		0.493	BMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251768.1	NM_014482		Missense_Mutation
LRRTM1	347730	broad.mit.edu	37	2	80530192	80530192	+	Silent	SNP	C	C	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:80530192C>A	ENST00000295057.3	-	2	1409	c.753G>T	c.(751-753)tcG>tcT	p.S251S	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.S251S|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	251					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.S251S(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CCCAGTCCAGCGAGCTGACCA	0.592										HNSCC(69;0.2)																																						1	Substitution - coding silent(1)	ovary(1)	2											87.0	84.0	85.0					2																	80530192		2203	4300	6503	80383703	SO:0001819	synonymous_variant	347730			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.753G>T	2.37:g.80530192C>A		Unknown		x	x	x	80383703	A8K397|D6W5K1|Q96DN1	Silent	SNP	ENST00000295057.3	37	CCDS1966.1	SNP	27	Broad																																																																																				0.592	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839		Silent
ZSWIM2	151112	broad.mit.edu	37	2	187692976	187692976	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:187692976T>C	ENST00000295131.2	-	9	1676	c.1637A>G	c.(1636-1638)aAa>aGa	p.K546R		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	546					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K546R(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TTTACAGCCTTTGGTCATCCG	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	93.0	95.0					2																	187692976		2203	4300	6503	187401221	SO:0001583	missense	151112			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1637A>G	2.37:g.187692976T>C	ENSP00000295131:p.Lys546Arg	Unknown		x	x	x	187401221	B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	37	CCDS33348.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	0.891	-0.725535	0.03158	.	.	ENSG00000163012	ENST00000295131	T	0.26067	1.76	5.4	1.59	0.23543	.	0.213391	0.33272	N	0.005082	T	0.14013	0.0339	L	0.28192	0.835	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.15780	-1.0425	10	0.34782	T	0.22	-10.8098	4.4195	0.11474	0.0:0.1882:0.1682:0.6436	.	546	Q8NEG5	ZSWM2_HUMAN	R	546	ENSP00000295131:K546R	ENSP00000295131:K546R	K	-	2	0	ZSWIM2	187401221	0.475000	0.25894	0.032000	0.17829	0.100000	0.18952	0.652000	0.24888	0.358000	0.24211	-0.619000	0.04042	AAA		0.398	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		Missense_Mutation
SEL1L2	80343	broad.mit.edu	37	20	13867034	13867034	+	Missense_Mutation	SNP	G	G	A	rs139504161	byFrequency	TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr20:13867034G>A	ENST00000284951.5	-	9	874	c.800C>T	c.(799-801)aCg>aTg	p.T267M	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Missense_Mutation_p.T267M			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	267						integral component of membrane (GO:0016021)		p.T267M(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AGGTCTTTCCGTTAGTCTCAC	0.373													G|||	2	0.000399361	0.0	0.0	5008	,	,		17036	0.0		0.002	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											131.0	120.0	123.0					20																	13867034		1837	4095	5932	13815034	SO:0001583	missense	80343			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.800C>T	20.37:g.13867034G>A	ENSP00000284951:p.Thr267Met	Unknown		x	x	x	13815034	B4DXX5	Missense_Mutation	SNP	ENST00000284951.5	37		SNP	40	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	19.81	3.895768	0.72639	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.24908	1.83;2.17	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000003	T	0.33177	0.0854	N	0.22421	0.69	0.41574	D	0.988708	P;D	0.89917	0.734;1.0	B;P	0.60609	0.115;0.877	T	0.02333	-1.1175	10	0.33940	T	0.23	-15.1749	15.5171	0.75833	0.0:0.0:1.0:0.0	.	267;267	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	M	267	ENSP00000367312:T267M;ENSP00000284951:T267M	ENSP00000284951:T267M	T	-	2	0	SEL1L2	13815034	0.994000	0.37717	1.000000	0.80357	0.953000	0.61014	2.855000	0.48333	2.732000	0.93576	0.555000	0.69702	ACG		0.373	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078067.3	NM_025229		Missense_Mutation
BOC	91653	broad.mit.edu	37	3	112969452	112969452	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr3:112969452G>A	ENST00000495514.1	+	4	852	c.148G>A	c.(148-150)Gga>Aga	p.G50R	BOC_ENST00000273395.4_Missense_Mutation_p.G50R|BOC_ENST00000484034.1_Missense_Mutation_p.G50R|BOC_ENST00000485230.1_Missense_Mutation_p.G50R|BOC_ENST00000355385.3_Missense_Mutation_p.G50R			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	50	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.G50R(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CCAGAAGCCCGGAGGCACTGT	0.577																																																1	Substitution - Missense(1)	ovary(1)	3											124.0	117.0	120.0					3																	112969452		2203	4300	6503	114452142	SO:0001583	missense	91653			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.148G>A	3.37:g.112969452G>A	ENSP00000418663:p.Gly50Arg	Unknown		x	x	x	114452142	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	33	5.267577	0.95399	.	.	ENSG00000144857	ENST00000464546;ENST00000495514;ENST00000485230;ENST00000273395;ENST00000355385;ENST00000484034	D;T;T;T;T;T	0.84223	-1.82;0.11;0.11;0.11;0.11;0.11	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94994	0.8380	H	0.94658	3.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.95507	0.8582	10	0.66056	D	0.02	.	20.025	0.97521	0.0:0.0:1.0:0.0	.	50;50;50;50	C9J2L7;Q9BWV1-3;Q9BWV1;Q96DN7	.;.;BOC_HUMAN;.	R	50	ENSP00000417362:G50R;ENSP00000418663:G50R;ENSP00000420154:G50R;ENSP00000273395:G50R;ENSP00000347546:G50R;ENSP00000417337:G50R	ENSP00000273395:G50R	G	+	1	0	BOC	114452142	1.000000	0.71417	0.815000	0.32552	0.950000	0.60333	9.331000	0.96430	2.730000	0.93505	0.651000	0.88453	GGA		0.577	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254		Missense_Mutation
HERC6	55008	broad.mit.edu	37	4	89314721	89314721	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr4:89314721C>T	ENST00000264346.7	+	5	805	c.746C>T	c.(745-747)gCg>gTg	p.A249V	HERC6_ENST00000380265.5_Missense_Mutation_p.A249V|HERC6_ENST00000273960.3_Missense_Mutation_p.A249V	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	249					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A249V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GCACACACTGCGGTGCTTACC	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											96.0	94.0	95.0					4																	89314721		1887	4125	6012	89533744	SO:0001583	missense	55008			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.746C>T	4.37:g.89314721C>T	ENSP00000264346:p.Ala249Val	Unknown		x	x	x	89533744	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	ENST00000264346.7	37	CCDS47098.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	10.80	1.451789	0.26074	.	.	ENSG00000138642	ENST00000380265;ENST00000438983;ENST00000511939;ENST00000273960;ENST00000264346	D;T;D	0.84146	-1.81;-1.36;-1.81	4.49	2.73	0.32206	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.172305	0.39615	N	0.001316	T	0.73016	0.3533	L	0.33093	0.98	0.32149	N	0.584432	P;P	0.43094	0.631;0.799	B;B	0.40101	0.213;0.319	T	0.70887	-0.4750	10	0.10111	T	0.7	.	8.2081	0.31467	0.1563:0.7584:0.0:0.0853	.	249;249	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	V	249	ENSP00000369617:A249V;ENSP00000273960:A249V;ENSP00000264346:A249V	ENSP00000264346:A249V	A	+	2	0	HERC6	89533744	1.000000	0.71417	0.884000	0.34674	0.006000	0.05464	5.273000	0.65564	0.516000	0.28340	-0.291000	0.09656	GCG		0.408	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2			Missense_Mutation
LARP7	51574	broad.mit.edu	37	4	113570785	113570785	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr4:113570785T>G	ENST00000344442.5	+	9	1515	c.1237T>G	c.(1237-1239)Tca>Gca	p.S413A	LARP7_ENST00000324052.6_Missense_Mutation_p.S413A|MIR302B_ENST00000510655.1_RNA|MIR302B_ENST00000505215.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302B_ENST00000509938.1_RNA|MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000509061.1_Missense_Mutation_p.S420A|MIR302D_ENST00000362275.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR302B_ENST00000362188.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	413					RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S413A(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		AAAATCAGAGTCAGAAATGGA	0.318																																																1	Substitution - Missense(1)	ovary(1)	4											58.0	56.0	57.0					4																	113570785		2202	4299	6501	113790234	SO:0001583	missense	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1237T>G	4.37:g.113570785T>G	ENSP00000344950:p.Ser413Ala	Unknown		x	x	x	113790234	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	ENST00000344442.5	37	CCDS3701.2	SNP	58	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.816|8.816	0.936305|0.936305	0.18206|0.18206	.|.	.|.	ENSG00000174720|ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000513553;ENST00000324052|ENST00000511529	T;T;T|.	0.17213|.	2.29;2.29;2.29|.	5.64|5.64	2.99|2.99	0.34606|0.34606	.|.	0.629649|0.629649	0.15806|0.15806	N|N	0.243734|0.243734	T|T	0.40979|0.40979	0.1139|0.1139	M|M	0.65975|0.65975	2.015|2.015	0.22728|0.22728	N|N	0.998803|0.998803	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.39542|0.39542	-0.9609|-0.9609	10|6	0.16420|.	T|.	0.52|.	-14.1722|-14.1722	1.3701|1.3701	0.02209|0.02209	0.2765:0.0829:0.2776:0.3629|0.2765:0.0829:0.2776:0.3629	.|.	413|.	Q4G0J3|.	LARP7_HUMAN|.	A|R	413;420;81;413|206	ENSP00000344950:S413A;ENSP00000422626:S420A;ENSP00000314311:S413A|.	ENSP00000314311:S413A|.	S|S	+|+	1|3	0|2	LARP7|LARP7	113790234|113790234	0.978000|0.978000	0.34361|0.34361	0.907000|0.907000	0.35723|0.35723	0.794000|0.794000	0.44872|0.44872	0.602000|0.602000	0.24134|0.24134	0.927000|0.927000	0.37143|0.37143	0.482000|0.482000	0.46254|0.46254	TCA|AGT		0.318	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256417.2	NM_016648		Missense_Mutation
TNIP1	10318	broad.mit.edu	37	5	150441739	150441739	+	Silent	SNP	G	G	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr5:150441739G>C	ENST00000389378.2	-	4	894	c.306C>G	c.(304-306)gcC>gcG	p.A102A	TNIP1_ENST00000521591.1_Silent_p.A102A|TNIP1_ENST00000315050.7_Silent_p.A102A|TNIP1_ENST00000524280.1_Silent_p.A102A|TNIP1_ENST00000523200.1_Silent_p.A102A|TNIP1_ENST00000518977.1_Silent_p.A102A|TNIP1_ENST00000523338.1_Silent_p.A102A|TNIP1_ENST00000520931.1_Silent_p.A49A|TNIP1_ENST00000522226.1_Silent_p.A102A	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	102	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.A102A(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCATGCAGGGGCTGTGGGAG	0.532																																																1	Substitution - coding silent(1)	ovary(1)	5											132.0	117.0	122.0					5																	150441739		2203	4300	6503	150421932	SO:0001819	synonymous_variant	10318			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.306C>G	5.37:g.150441739G>C		Unknown		x	x	x	150421932	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	ENST00000389378.2	37	CCDS34280.1	SNP	43	Broad																																																																																				0.532	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058		Silent
SERPINB1	1992	broad.mit.edu	37	6	2834180	2834180	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr6:2834180C>T	ENST00000380739.5	-	7	1004	c.802G>A	c.(802-804)Gaa>Aaa	p.E268K	SERPINB1_ENST00000476896.1_5'Flank|SERPINB1_ENST00000537185.1_Missense_Mutation_p.E117K	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	268					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E268K(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		ACATTAACTTCAATGAAATCG	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											45.0	40.0	42.0					6																	2834180		2203	4300	6503	2779179	SO:0001583	missense	1992			M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.802G>A	6.37:g.2834180C>T	ENSP00000370115:p.Glu268Lys	Unknown		x	x	x	2779179	A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Missense_Mutation	SNP	ENST00000380739.5	37	CCDS4477.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867356	0.51588	.	.	ENSG00000021355	ENST00000380739;ENST00000542771;ENST00000537185	D;D	0.84442	-1.85;-1.85	5.48	4.6	0.57074	Serpin domain (3);	0.475569	0.23123	N	0.051670	T	0.61788	0.2375	N	0.12663	0.25	0.45118	D	0.998136	B	0.10296	0.003	B	0.11329	0.006	T	0.58418	-0.7640	10	0.32370	T	0.25	.	15.6248	0.76845	0.0:0.8621:0.1379:0.0	.	268	P30740	ILEU_HUMAN	K	268;230;117	ENSP00000370115:E268K;ENSP00000444543:E117K	ENSP00000370115:E268K	E	-	1	0	SERPINB1	2779179	1.000000	0.71417	0.025000	0.17156	0.027000	0.11550	4.707000	0.61852	1.436000	0.47453	-0.291000	0.09656	GAA		0.438	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039637.1			Missense_Mutation
AIF1	199	broad.mit.edu	37	6	31584121	31584121	+	Splice_Site	SNP	A	A	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr6:31584121A>T	ENST00000376059.3	+	5	343	c.197A>T	c.(196-198)gAt>gTt	p.D66V	AIF1_ENST00000376049.4_Splice_Site_p.D12V	NM_001623.3	NP_001614.3	P55008	AIF1_HUMAN	allograft inflammatory factor 1	66	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cellular response to interferon-gamma (GO:0071346)|inflammatory response (GO:0006954)|microglial cell activation (GO:0001774)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell proliferation (GO:0048662)|phagocytosis, engulfment (GO:0006911)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell migration (GO:2000406)|positive regulation of T cell proliferation (GO:0042102)|Rac protein signal transduction (GO:0016601)|ruffle assembly (GO:0097178)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|ruffle membrane (GO:0032587)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)	p.D78V(1)|p.D66V(1)		lung(2)|ovary(1)	3						CTGCCCCCAGATATCATGTCC	0.557																																					Ovarian(23;358 734 36938 38933 52312)											2	Substitution - Missense(2)	ovary(2)	6											77.0	67.0	70.0					6																	31584121		1510	2709	4219	31692100	SO:0001630	splice_region_variant	199			U19713	CCDS4706.1, CCDS34398.1	6p21.3	2013-01-10			ENSG00000204472	ENSG00000204472		"""EF-hand domain containing"""	352	protein-coding gene	gene with protein product	"""interferon gamma responsive transcript"", ""ionized calcium-binding adapter molecule 1"""	601833				8912632	Standard	NM_032955		Approved	IRT-1, AIF-1, Em:AF129756.17, IBA1	uc003nuy.3	P55008	OTTHUMG00000031246	ENST00000376059.3:c.197-1A>T	6.37:g.31584121A>T		Unknown		x	x	x	31692100	A8K406|O43904|Q9UIV4|Q9UKS9	Missense_Mutation	SNP	ENST00000376059.3	37	CCDS4706.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852460	0.71719	.	.	ENSG00000204472	ENST00000376059;ENST00000337917;ENST00000376049	T;T;T	0.50001	0.76;0.76;0.76	4.19	4.19	0.49359	EF-hand-like domain (1);	0.000000	0.64402	D	0.000004	T	0.68091	0.2963	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.957	T	0.76394	-0.2975	9	.	.	.	.	11.5396	0.50659	1.0:0.0:0.0:0.0	.	78;66	O43904;P55008	.;AIF1_HUMAN	V	66;80;12	ENSP00000365227:D66V;ENSP00000338776:D80V;ENSP00000365217:D12V	.	D	+	2	0	AIF1	31692100	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	8.682000	0.91232	1.903000	0.55091	0.460000	0.39030	GAT		0.557	AIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076512.3		Missense_Mutation	Missense_Mutation
LRFN2	57497	broad.mit.edu	37	6	40400152	40400152	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr6:40400152G>T	ENST00000338305.6	-	2	1243	c.701C>A	c.(700-702)cCc>cAc	p.P234H		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	234						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P234H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					AAAGGACAAGGGTGGGGCAAA	0.597																																																1	Substitution - Missense(1)	ovary(1)	6											34.0	41.0	39.0					6																	40400152		2203	4300	6503	40508130	SO:0001583	missense	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.701C>A	6.37:g.40400152G>T	ENSP00000345985:p.Pro234His	Unknown		x	x	x	40508130	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567547	0.28003	.	.	ENSG00000156564	ENST00000338305	T	0.02369	4.32	5.42	5.42	0.78866	.	0.403421	0.30285	N	0.009970	T	0.02848	0.0085	L	0.42245	1.32	0.19300	N	0.999977	P	0.40660	0.726	P	0.45913	0.497	T	0.24657	-1.0154	10	0.62326	D	0.03	.	17.7794	0.88519	0.0:0.0:1.0:0.0	.	234	Q9ULH4	LRFN2_HUMAN	H	234	ENSP00000345985:P234H	ENSP00000345985:P234H	P	-	2	0	LRFN2	40508130	1.000000	0.71417	0.016000	0.15963	0.668000	0.39293	2.638000	0.46562	2.558000	0.86282	0.563000	0.77884	CCC		0.597	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		Missense_Mutation
PRPH2	5961	broad.mit.edu	37	6	42689611	42689611	+	Missense_Mutation	SNP	C	C	G	rs61755786		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr6:42689611C>G	ENST00000230381.5	-	1	701	c.462G>C	c.(460-462)aaG>aaC	p.K154N		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	154					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.K154N(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			TGTCGATGGTCTTCTTCATGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											120.0	106.0	111.0					6																	42689611		2203	4300	6503	42797589	SO:0001583	missense	5961				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.462G>C	6.37:g.42689611C>G	ENSP00000230381:p.Lys154Asn	Unknown		x	x	x	42797589	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884164	0.51908	.	.	ENSG00000112619	ENST00000230381	T	0.79352	-1.26	5.78	5.78	0.91487	Tetraspanin, EC2 domain (1);	0.042558	0.85682	D	0.000000	T	0.55986	0.1955	L	0.45137	1.4	0.48341	D	0.99963	B	0.22480	0.07	B	0.32393	0.145	T	0.51919	-0.8644	10	0.02654	T	1	.	14.5301	0.67920	0.0:0.93:0.0:0.07	.	154	P23942	PRPH2_HUMAN	N	154	ENSP00000230381:K154N	ENSP00000230381:K154N	K	-	3	2	PRPH2	42797589	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.166000	0.31834	2.894000	0.99253	0.655000	0.94253	AAG		0.537	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322		Missense_Mutation
EPHA1	2041	broad.mit.edu	37	7	143094667	143094667	+	Missense_Mutation	SNP	C	C	T	rs555414886		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr7:143094667C>T	ENST00000275815.3	-	9	1785	c.1699G>A	c.(1699-1701)Gtt>Att	p.V567I		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	567					activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)	p.V567I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GACCGGAAAACGAGAATCCCA	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		17086	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	7											81.0	78.0	79.0					7																	143094667		2203	4300	6503	142804789	SO:0001583	missense	2041			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1699G>A	7.37:g.143094667C>T	ENSP00000275815:p.Val567Ile	Unknown		x	x	x	142804789	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	37	CCDS5884.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	0.038	-1.299078	0.01364	.	.	ENSG00000146904	ENST00000275815	T	0.09538	2.97	5.72	-4.79	0.03200	.	1.179830	0.06167	N	0.676995	T	0.03477	0.0100	N	0.10916	0.065	0.09310	N	0.999999	B	0.09022	0.002	B	0.01281	0.0	T	0.39643	-0.9604	10	0.06236	T	0.91	.	1.2298	0.01941	0.3618:0.1989:0.0893:0.35	.	567	P21709	EPHA1_HUMAN	I	567	ENSP00000275815:V567I	ENSP00000275815:V567I	V	-	1	0	EPHA1	142804789	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	-1.724000	0.01865	-1.007000	0.03408	0.655000	0.94253	GTT		0.612	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1			Missense_Mutation
CNBD1	168975	broad.mit.edu	37	8	88249150	88249150	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr8:88249150T>G	ENST00000518476.1	+	6	632	c.581T>G	c.(580-582)gTt>gGt	p.V194G	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	194								p.V194G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TTTTCAGTGGTTGCAAATGAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											146.0	126.0	132.0					8																	88249150		1814	4070	5884	88318266	SO:0001583	missense	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.581T>G	8.37:g.88249150T>G	ENSP00000430073:p.Val194Gly	Unknown		x	x	x	88318266		Missense_Mutation	SNP	ENST00000518476.1	37	CCDS55259.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	5.005	0.186536	0.09495	.	.	ENSG00000176571	ENST00000518476	D	0.96940	-4.18	4.29	0.356	0.16074	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	2.721960	0.01163	N	0.006684	D	0.91673	0.7368	N	0.19112	0.55	0.09310	N	1	B	0.19583	0.037	B	0.22386	0.039	T	0.82604	-0.0375	10	0.66056	D	0.02	0.0	2.8199	0.05468	0.3887:0.1191:0.0:0.4922	.	194	Q8NA66	CNBD1_HUMAN	G	194	ENSP00000430073:V194G	ENSP00000430073:V194G	V	+	2	0	CNBD1	88318266	0.168000	0.22989	0.036000	0.18154	0.197000	0.23852	0.290000	0.18975	0.051000	0.15978	0.533000	0.62120	GTT		0.348	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		Missense_Mutation
PKHD1L1	93035	broad.mit.edu	37	8	110535077	110535077	+	Silent	SNP	G	G	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr8:110535077G>A	ENST00000378402.5	+	75	12392	c.12288G>A	c.(12286-12288)caG>caA	p.Q4096Q		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4096					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.Q4100Q(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGCCAGGACAGCCATTTCCTC	0.473										HNSCC(38;0.096)																																						1	Substitution - coding silent(1)	ovary(1)	8											41.0	47.0	45.0					8																	110535077		2187	4293	6480	110604253	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12288G>A	8.37:g.110535077G>A		Unknown		x	x	x	110604253	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1	SNP	34	Broad																																																																																				0.473	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		Silent
RFX3	5991	broad.mit.edu	37	9	3301562	3301562	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr9:3301562G>C	ENST00000382004.3	-	6	844	c.533C>G	c.(532-534)tCt>tGt	p.S178C	RFX3_ENST00000358730.2_Missense_Mutation_p.S178C|RFX3_ENST00000302303.1_Missense_Mutation_p.S178C	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	178					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S178C(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GTTGAGAAGAGAGCTTCTGTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	9											158.0	136.0	144.0					9																	3301562		2203	4300	6503	3291562	SO:0001583	missense	5991			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.533C>G	9.37:g.3301562G>C	ENSP00000371434:p.Ser178Cys	Unknown		x	x	x	3291562	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756119	0.89843	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303;ENST00000451859	D;D;D;T	0.83506	-1.73;-1.73;-1.73;1.35	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.86590	0.5969	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.99;0.999	D;P;D	0.79108	0.992;0.773;0.975	D	0.87504	0.2435	10	0.62326	D	0.03	-12.8703	20.2079	0.98282	0.0:0.0:1.0:0.0	.	178;178;178	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	C	178	ENSP00000371434:S178C;ENSP00000351574:S178C;ENSP00000303847:S178C;ENSP00000411756:S178C	ENSP00000303847:S178C	S	-	2	0	RFX3	3291562	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.669000	0.74462	2.781000	0.95711	0.655000	0.94253	TCT		0.393	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919		Missense_Mutation
FCN1	2219	broad.mit.edu	37	9	137809649	137809649	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr9:137809649C>G	ENST00000371806.3	-	1	160	c.69G>C	c.(67-69)aaG>aaC	p.K23N		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	23					cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)	p.K23N(1)		endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		CAGGCAGGTTCTTGATATGCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											93.0	88.0	90.0					9																	137809649		2203	4300	6503	136949470	SO:0001583	missense	2219			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.69G>C	9.37:g.137809649C>G	ENSP00000360871:p.Lys23Asn	Unknown		x	x	x	136949470	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	37	CCDS6985.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	9.089	1.001179	0.19121	.	.	ENSG00000085265	ENST00000371807;ENST00000371806;ENST00000308299	D	0.82803	-1.65	3.92	-1.68	0.08212	.	.	.	.	.	T	0.66208	0.2766	L	0.29908	0.895	0.09310	N	1	B	0.20052	0.041	B	0.25759	0.063	T	0.49771	-0.8904	9	0.19147	T	0.46	.	0.4263	0.00464	0.1897:0.3243:0.1864:0.2996	.	23	O00602	FCN1_HUMAN	N	23	ENSP00000360871:K23N	ENSP00000308877:K23N	K	-	3	2	FCN1	136949470	0.000000	0.05858	0.000000	0.03702	0.381000	0.30169	-0.236000	0.09003	-0.204000	0.10235	0.579000	0.79373	AAG		0.582	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003		Missense_Mutation
SCML1	6322	broad.mit.edu	37	X	17768147	17768147	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:17768147G>A	ENST00000380041.3	+	6	765	c.437G>A	c.(436-438)cGt>cAt	p.R146H	SCML1_ENST00000380045.3_Missense_Mutation_p.R25H|SCML1_ENST00000380043.3_Missense_Mutation_p.R119H|SCML1_ENST00000398080.1_Missense_Mutation_p.R25H	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	146					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R25H(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					GTGTCAAGGCGTGAGAATAAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	96.0	100.0					X																	17768147		2203	4300	6503	17678068	SO:0001583	missense	6322				CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.437G>A	X.37:g.17768147G>A	ENSP00000369380:p.Arg146His	Unknown		x	x	x	17678068	B0FZN6|B2RA08|Q5H968|Q5H969	Missense_Mutation	SNP	ENST00000380041.3	37	CCDS35210.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	9.157	1.017745	0.19355	.	.	ENSG00000047634	ENST00000380045;ENST00000380041;ENST00000380043;ENST00000398080;ENST00000419185	.	.	.	3.36	-6.38	0.01957	.	1.186530	0.06384	N	0.715715	T	0.31513	0.0799	N	0.24115	0.695	0.09310	N	1	D;D	0.76494	0.999;0.998	P;P	0.59487	0.858;0.725	T	0.20207	-1.0282	9	0.15499	T	0.54	-0.4142	6.851	0.24014	0.2621:0.3336:0.4043:0.0	.	119;146	Q9UN30-2;Q9UN30	.;SCML1_HUMAN	H	25;146;119;25;119	.	ENSP00000369380:R146H	R	+	2	0	SCML1	17678068	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.248000	0.01189	-1.837000	0.01189	0.600000	0.82982	CGT		0.483	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	NM_006746		Missense_Mutation
HUWE1	10075	broad.mit.edu	37	X	53595808	53595808	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:53595808C>T	ENST00000342160.3	-	48	7008	c.6551G>A	c.(6550-6552)aGt>aAt	p.S2184N	HUWE1_ENST00000262854.6_Missense_Mutation_p.S2184N			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2184					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.S2047N(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATGATAGTACTGATGATACA	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											104.0	79.0	87.0					X																	53595808		2203	4300	6503	53612533	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6551G>A	X.37:g.53595808C>T	ENSP00000340648:p.Ser2184Asn	Unknown		x	x	x	53612533	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068409	0.76301	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.44083	0.93;0.93	5.47	5.47	0.80525	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.57125	0.2032	L	0.50333	1.59	0.58432	D	0.999997	D;D	0.61080	0.967;0.989	P;D	0.72982	0.878;0.979	T	0.49214	-0.8963	10	0.17369	T	0.5	.	17.0849	0.86609	0.0:1.0:0.0:0.0	.	2184;2184	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	N	2184	ENSP00000340648:S2184N;ENSP00000262854:S2184N	ENSP00000262854:S2184N	S	-	2	0	HUWE1	53612533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.621000	0.83083	2.299000	0.77371	0.600000	0.82982	AGT		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Missense_Mutation
DRP2	1821	broad.mit.edu	37	X	100493999	100493999	+	Silent	SNP	C	C	T			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:100493999C>T	ENST00000395209.3	+	6	995	c.468C>T	c.(466-468)ggC>ggT	p.G156G	DRP2_ENST00000402866.1_Silent_p.G156G|DRP2_ENST00000538510.1_Silent_p.G156G|DRP2_ENST00000541709.1_Silent_p.G78G	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	156				G -> A (in Ref. 1; AAC50538). {ECO:0000305}.	central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.A153A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGTCTCGGGGCCCCTACATCT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	X											131.0	117.0	122.0					X																	100493999		2203	4300	6503	100380655	SO:0001819	synonymous_variant	1821			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.468C>T	X.37:g.100493999C>T		Unknown		x	x	x	100380655	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	37	CCDS14480.2	SNP	26	Broad																																																																																				0.458	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939		Silent
ARMCX3	51566	broad.mit.edu	37	X	100880766	100880766	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:100880766T>A	ENST00000341189.4	+	5	1663	c.797T>A	c.(796-798)cTc>cAc	p.L266H	ARMCX3_ENST00000471229.2_Missense_Mutation_p.L266H|ARMCX3_ENST00000537169.1_Missense_Mutation_p.L266H|ARMCX3-AS1_ENST00000454228.1_RNA|RP4-545K15.5_ENST00000564612.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	266					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)		p.L266H(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						GTTCTGAAACTCCTTTTGAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	58.0	59.0					X																	100880766		2203	4300	6503	100767422	SO:0001583	missense	51566			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.797T>A	X.37:g.100880766T>A	ENSP00000340672:p.Leu266His	Unknown		x	x	x	100767422	Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	37	CCDS14489.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999366	0.54147	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.37915	1.17;1.17	5.34	5.34	0.76211	Armadillo-like helical (1);Armadillo-type fold (1);	0.056719	0.64402	D	0.000001	T	0.51312	0.1667	L	0.49126	1.545	0.37082	D	0.899056	D	0.89917	1.0	D	0.87578	0.998	T	0.56872	-0.7907	9	.	.	.	-5.4014	10.8491	0.46759	0.0:0.0:0.0:1.0	.	266	Q9UH62	ARMX3_HUMAN	H	266	ENSP00000340672:L266H;ENSP00000439032:L266H	.	L	+	2	0	ARMCX3	100767422	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.526000	0.60566	1.904000	0.55121	0.486000	0.48141	CTC		0.408	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607		Missense_Mutation
BEX4	56271	broad.mit.edu	37	X	102471183	102471183	+	Silent	SNP	A	A	G			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:102471183A>G	ENST00000372695.5	+	3	337	c.102A>G	c.(100-102)gaA>gaG	p.E34E	BEX4_ENST00000372691.3_Silent_p.E34E	NM_001080425.3	NP_001073894.1	Q9NWD9	BEX4_HUMAN	brain expressed, X-linked 4	34						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E360E(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	9						ATGAAGAAGAATCCCGCCATT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	X											27.0	30.0	29.0					X																	102471183		2203	4300	6503	102357839	SO:0001819	synonymous_variant	56271			AL035494	CCDS35355.1	Xq22.1-q22.3	2014-03-21	2008-11-04	2007-08-24	ENSG00000102409	ENSG00000102409			25475	protein-coding gene	gene with protein product		300692	"""brain expressed X-linked-like 1"", ""BEX family member 4"""	BEXL1		15958283, 16221301	Standard	NM_001080425		Approved	FLJ10097	uc004ejw.4	Q9NWD9	OTTHUMG00000022091	ENST00000372695.5:c.102A>G	X.37:g.102471183A>G		Unknown		x	x	x	102357839		Silent	SNP	ENST00000372695.5	37	CCDS35355.1	SNP	4	Broad																																																																																				0.542	BEX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057694.1	XM_043653		Silent
L1CAM	3897	broad.mit.edu	37	X	153130950	153130950	+	Silent	SNP	C	C	T	rs373921972		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chrX:153130950C>T	ENST00000370060.1	-	21	2742	c.2553G>A	c.(2551-2553)acG>acA	p.T851T	L1CAM_ENST00000370057.3_Silent_p.T851T|L1CAM_ENST00000361699.4_Silent_p.T851T|L1CAM_ENST00000370055.1_Silent_p.T846T|L1CAM_ENST00000538883.1_Silent_p.T853T|L1CAM_ENST00000543994.1_Silent_p.T853T|L1CAM_ENST00000361981.3_Silent_p.T846T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	851	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T851T(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCTCCAGTACGTCACCTGCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	X											169.0	123.0	138.0					X																	153130950		2203	4300	6503	152784144	SO:0001819	synonymous_variant	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2553G>A	X.37:g.153130950C>T		Unknown		x	x	x	152784144	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	19	Broad																																																																																				0.617	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Silent
TJP1	7082	broad.mit.edu	37	15	30010796	30010812	+	Frame_Shift_Del	DEL	TGGGCCCTGCTGAAGGG	TGGGCCCTGCTGAAGGG	-	rs199900091|rs376437256	byFrequency	TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr15:30010796_30010812delTGGGCCCTGCTGAAGGG	ENST00000346128.6	-	21	4008_4024	c.3534_3550delCCCTTCAGCAGGGCCCA	c.(3532-3552)cacccttcagcagggcccaagfs	p.HPSAGPK1178fs	TJP1_ENST00000545208.2_Frame_Shift_Del_p.HPSAGPK1098fs|TJP1_ENST00000356107.6_Frame_Shift_Del_p.HPSAGPK1178fs|TJP1_ENST00000400011.2_Frame_Shift_Del_p.HPSAGPK1102fs	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1178					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.H1178fs*10(1)		breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCTGCAGGCTTGGGCCCTGCTGAAGGGTGGGGCTGGG	0.553																																					Melanoma(77;681 1843 6309 6570)											1	Deletion - Frameshift(1)	ovary(1)	15																																								27798104	SO:0001589	frameshift_variant	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3534_3550delCCCTTCAGCAGGGCCCA	15.37:g.30010796_30010812delTGGGCCCTGCTGAAGGG	ENSP00000281537:p.His1178fs	Unknown		Capture	Illumina GAIIx	Phase_I	27798088	B4E3K1|Q2NKP3|Q4ZGJ6	Frame_Shift_Del	DEL	ENST00000346128.6	37	CCDS42007.1	DEL	63	Broad																																																																																				0.553	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257		Frame_Shift_Del
MYADM	91663	broad.mit.edu	37	19	54377246	54377277	+	Frame_Shift_Del	DEL	GTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	GTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	-	rs140166646|rs143914793		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr19:54377246_54377277delGTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	ENST00000391769.2	+	3	743_774	c.463_494delGTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	c.(463-495)gtggcctggacccgggcccggcccggcgagatcfs	p.VAWTRARPGEI155fs	AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391771.1_Frame_Shift_Del_p.VAWTRARPGEI155fs|MYADM_ENST00000391768.2_Frame_Shift_Del_p.VAWTRARPGEI155fs|MYADM_ENST00000391770.4_Frame_Shift_Del_p.VAWTRARPGEI155fs|MYADM_ENST00000336967.3_Frame_Shift_Del_p.VAWTRARPGEI155fs	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	155	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.E164K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CGCCACCGAAGTGGCCTGGACCCGGGCCCGGCCCGGCGAGATCACTGGCTAT	0.642																																																1	Substitution - Missense(1)	ovary(1)	19																																								59069089	SO:0001589	frameshift_variant	91663			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.463_494delGTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	19.37:g.54377246_54377277delGTGGCCTGGACCCGGGCCCGGCCCGGCGAGAT	ENSP00000375649:p.Val155fs	Unknown		Capture	Illumina GAIIx	Phase_I	59069058	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Frame_Shift_Del	DEL	ENST00000391769.2	37	CCDS12866.1	DEL	36	Broad																																																																																				0.642	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		Frame_Shift_Del
USP40	55230	broad.mit.edu	37	2	234389917	234389919	+	In_Frame_Del	DEL	ATC	ATC	-	rs10581559	byFrequency	TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr2:234389917_234389919delATC	ENST00000427112.2	-	30	3561_3563	c.3526_3528delGAT	c.(3526-3528)gatdel	p.D1176del	USP40_ENST00000251722.6_In_Frame_Del_p.D1176del|USP40_ENST00000450966.1_In_Frame_Del_p.D1188del			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1176					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TTGTACTGAAATCATCATCGTCG	0.409														44	0.00878594	0.0008	0.0605	5008	,	,		21114	0.0		0.001	False		,,,				2504	0.0															0			2								6,3608		0,6,1801						5.5	0.7		dbSNP_119	170	16,7838		0,16,3911	no	coding	USP40	NM_018218.2		0,22,5712	A1A1,A1R,RR		0.2037,0.166,0.1918				22,11446				234054658	SO:0001651	inframe_deletion	55230			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3526_3528delGAT	2.37:g.234389923_234389925delATC	ENSP00000387898:p.Asp1176del	Unknown		Capture	Illumina GAIIx	Phase_I	234054656	Q6NX38|Q70EL0	In_Frame_Del	DEL	ENST00000427112.2	37	CCDS46547.1	DEL	4	Broad																																																																																				0.409	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294		In_Frame_Del
ABCF1	23	broad.mit.edu	37	6	30550179	30550193	+	In_Frame_Del	DEL	GGAAGAAGGAGAAGG	GGAAGAAGGAGAAGG	-			TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr6:30550179_30550193delGGAAGAAGGAGAAGG	ENST00000326195.8	+	9	799_813	c.687_701delGGAAGAAGGAGAAGG	c.(685-702)gaggaagaaggagaaggg>gag	p.EEGEG230del	MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000396515.4_Intron|ABCF1_ENST00000376545.3_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	230	Glu-rich.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.G232_E236del(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						AGGGTTCagaggaagaaggagaaggggaagaagag	0.521																																																1	Deletion - In frame(1)	ovary(1)	6																																								30658172	SO:0001651	inframe_deletion	23			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.687_701delGGAAGAAGGAGAAGG	6.37:g.30550179_30550193delGGAAGAAGGAGAAGG	ENSP00000313603:p.Glu230_Gly234del	Unknown		Capture	Illumina GAIIx	Phase_I	30658158	A2BF75|O14897|Q69YP6	In_Frame_Del	DEL	ENST00000326195.8	37	CCDS34380.1	DEL	35	Broad																																																																																				0.521	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3			In_Frame_Del
FAM86B2	653333	broad.mit.edu	37	8	12291593	12291595	+	In_Frame_Del	DEL	CTG	CTG	-	rs146321506		TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr8:12291593_12291595delCTG	ENST00000262365.4	-	2	124_126	c.125_127delCAG	c.(124-129)tcagat>tat	p.42_43SD>Y	FAM86B2_ENST00000309608.5_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000351291.4_In_Frame_Del_p.42_43SD>Y	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	42			D -> Y (in dbSNP:rs2684093).							endometrium(1)|kidney(2)	3						AGCTCAGAATCTGATGAGTCTCT	0.473																																																0			8																																								12335966	SO:0001651	inframe_deletion	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.125_127delCAG	8.37:g.12291593_12291595delCTG	ENSP00000262365:p.Ser42_Asp43delinsTyr	Unknown		Capture	Illumina GAIIx	Phase_I	12335964		In_Frame_Del	DEL	ENST00000262365.4	37	CCDS59092.1	DEL	32	Broad																																																																																				0.473	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_928336		In_Frame_Del
CYHR1	50626	broad.mit.edu	37	8	145689658	145689659	+	Intron	INS	-	-	C	rs547376015	byFrequency	TCGA-04-1356-01	TCGA-04-1356-11							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1356-01	TCGA-04-1356-11	g.chr8:145689658_145689659insC	ENST00000438911.2	-	2	380				CYHR1_ENST00000530374.1_5'Flank|KIFC2_ENST00000301332.2_5'Flank|CYHR1_ENST00000403000.2_Frame_Shift_Ins_p.A144fs|CYHR1_ENST00000424149.2_Frame_Shift_Ins_p.A144fs|CTD-2517M22.16_ENST00000525461.1_RNA|CYHR1_ENST00000306145.5_Frame_Shift_Ins_p.A144fs	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1							cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)	p.A144fs*>50(1)		haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			ACCCAGCATCGCCCCCCCCCAC	0.634											OREG0019056	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	CCCCCCCCC|CCCCCCCCC|CCCCCCCCCC|insertion	17	0.00339457	0.0061	0.0	5008	,	,		19552	0.005		0.001	False		,,,				2504	0.0031															1	Insertion - Frameshift(1)	ovary(1)	8																																								145660467	SO:0001627	intron_variant	50626			AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.246+183->G	8.37:g.145689667_145689667dupC		Unknown	1696	Capture	Illumina GAIIx	Phase_I	145660466	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Frame_Shift_Ins	INS	ENST00000438911.2	37	CCDS47943.1	INS	38	Broad																																																																																				0.634	CYHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382438.1	NM_032687		Frame_Shift_Ins
