#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ALPK2	115701	hgsc.bcm.edu	37	18	56246466	56246466	+	Silent	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr18:56246466C>T	ENST00000361673.3	-	4	1755	c.1542G>A	c.(1540-1542)acG>acA	p.T514T	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	514						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T514T(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGTCAGCTGCCGTCTCCCAAC	0.512											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	18											204.0	204.0	204.0					18																	56246466		2203	4300	6503	54397446	SO:0001819	synonymous_variant	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1542G>A	18.37:g.56246466C>T		Somatic	1014	Capture	SOLID	Phase_IV	54397446	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2	SNP	23	Baylor																																																																																				0.512	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		Silent
ARFGEF2	10564	hgsc.bcm.edu	37	20	47605044	47605044	+	Missense_Mutation	SNP	C	C	G	rs532986318		TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr20:47605044C>G	ENST00000371917.4	+	18	2378	c.2378C>G	c.(2377-2379)aCg>aGg	p.T793R		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	793					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.T793R(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AATAAAATGACGAAAGAGCAG	0.299																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)											1	Substitution - Missense(1)	ovary(1)	20											41.0	45.0	43.0					20																	47605044		2189	4291	6480	47038451	SO:0001583	missense	10564			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.2378C>G	20.37:g.47605044C>G	ENSP00000360985:p.Thr793Arg	Somatic		Capture	SOLID	Phase_IV	47038451	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	37	CCDS13411.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787901	0.90367	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.81163	-1.46	5.74	5.74	0.90152	SEC7-like, alpha orthogonal bundle (1);Armadillo-type fold (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	D	0.92593	0.7647	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93413	0.6770	10	0.87932	D	0	.	20.2982	0.98569	0.0:1.0:0.0:0.0	.	793	Q9Y6D5	BIG2_HUMAN	R	793	ENSP00000360985:T793R	ENSP00000360985:T793R	T	+	2	0	ARFGEF2	47038451	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.776000	0.85560	2.873000	0.98535	0.563000	0.77884	ACG		0.299	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420		Missense_Mutation
ARL2	402	hgsc.bcm.edu	37	11	64786128	64786128	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr11:64786128A>G	ENST00000246747.4	+	3	357	c.262A>G	c.(262-264)Atc>Gtc	p.I88V	ARL2_ENST00000533729.1_Missense_Mutation_p.I88V|RP11-399J13.3_ENST00000301886.3_Missense_Mutation_p.I88V|ARL2_ENST00000529384.1_Missense_Mutation_p.I88V	NM_001667.3	NP_001658.2	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	88					cell cycle (GO:0007049)|centrosome organization (GO:0051297)|GTP catabolic process (GO:0006184)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of GTPase activity (GO:0034260)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of microtubule polymerization (GO:0031116)|regulation of microtubule polymerization (GO:0031113)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|tubulin complex assembly (GO:0007021)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|GTPase inhibitor activity (GO:0005095)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	5						CGATGGCCTCATCTGGGTAGT	0.622																																																0			11											57.0	55.0	55.0					11																	64786128		2200	4297	6497	64542704	SO:0001583	missense	402			AF493888	CCDS8088.1, CCDS55770.1	11q13	2014-05-09			ENSG00000213465	ENSG00000213465		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	693	protein-coding gene	gene with protein product		601175				8415637, 9253601	Standard	NM_001667		Approved	ARFL2	uc001och.4	P36404	OTTHUMG00000165728	ENST00000246747.4:c.262A>G	11.37:g.64786128A>G	ENSP00000246747:p.Ile88Val	Somatic		Capture	SOLID	Phase_IV	64542704	G3V184|Q9BUK8	Missense_Mutation	SNP	ENST00000246747.4	37	CCDS8088.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025297	0.54683	.	.	ENSG00000213465	ENST00000246747;ENST00000529384;ENST00000533729	D;D;D	0.83914	-1.78;-1.78;-1.78	5.06	2.68	0.31781	Small GTP-binding protein domain (1);	0.073161	0.53938	U	0.000042	T	0.68933	0.3055	L	0.28115	0.83	0.80722	D	1	B;B	0.17465	0.022;0.001	B;B	0.20955	0.032;0.024	T	0.56956	-0.7893	10	0.33940	T	0.23	-19.0413	5.3772	0.16172	0.7582:0.0:0.0864:0.1553	.	88;88	B4DGG0;P36404	.;ARL2_HUMAN	V	88	ENSP00000246747:I88V;ENSP00000436021:I88V;ENSP00000432971:I88V	ENSP00000246747:I88V	I	+	1	0	ARL2	64542704	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.910000	0.56371	0.381000	0.24851	0.528000	0.53228	ATC		0.622	ARL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385963.1	NM_001667		Missense_Mutation
ATAD3B	83858	hgsc.bcm.edu	37	1	1424626	1424626	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr1:1424626C>A	ENST00000308647.7	+	13	1425	c.1309C>A	c.(1309-1311)Ctg>Atg	p.L437M		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	437						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)	p.L437M(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GAACGCCTTCCTGTACCACAT	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	126.0	128.0					1																	1424626		2203	4295	6498	1414489	SO:0001583	missense	83858			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1309C>A	1.37:g.1424626C>A	ENSP00000311766:p.Leu437Met	Somatic		Capture	SOLID	Phase_IV	1414489	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	ENST00000308647.7	37	CCDS30.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	.	14.15	2.449882	0.43531	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.95482	-3.72	1.57	1.57	0.23409	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.085032	0.51477	D	0.000097	D	0.97377	0.9142	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.97152	0.9832	10	0.87932	D	0	.	11.0805	0.48057	0.0:1.0:0.0:0.0	.	391;437	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	M	239;437	ENSP00000311766:L437M	ENSP00000311766:L437M	L	+	1	2	ATAD3B	1414489	1.000000	0.71417	0.413000	0.26509	0.012000	0.07955	1.587000	0.36622	1.192000	0.43071	0.194000	0.17425	CTG		0.602	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921		Missense_Mutation
ABHD16A	7920	hgsc.bcm.edu	37	6	31669881	31669881	+	Silent	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr6:31669881C>T	ENST00000395952.3	-	2	321	c.159G>A	c.(157-159)ctG>ctA	p.L53L	ABHD16A_ENST00000538874.1_5'UTR|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000375842.4_5'UTR|ABHD16A_ENST00000440843.2_Intron|MIR4646_ENST00000580775.1_RNA	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	53						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.L53L(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CATGTTTCTCCAGGGCACGGG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	6											157.0	106.0	124.0					6																	31669881		1511	2709	4220	31777860	SO:0001819	synonymous_variant	7920			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.159G>A	6.37:g.31669881C>T		Somatic		Capture	SOLID	Phase_IV	31777860	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Silent	SNP	ENST00000395952.3	37	CCDS4713.1	SNP	21	Baylor																																																																																				0.562	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4			Silent
BCL11A	53335	hgsc.bcm.edu	37	2	60689485	60689485	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:60689485G>A	ENST00000335712.6	-	4	789	c.562C>T	c.(562-564)Cac>Tac	p.H188Y	BCL11A_ENST00000358510.4_Missense_Mutation_p.H154Y|BCL11A_ENST00000537768.1_Missense_Mutation_p.H36Y|BCL11A_ENST00000359629.5_Missense_Mutation_p.H188Y|BCL11A_ENST00000356842.4_Missense_Mutation_p.H188Y|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000538214.1_Missense_Mutation_p.H154Y	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	188	Required for nuclear body formation and for SUMO1 recruitment. {ECO:0000250}.				B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.H188Y(1)		NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TTCTGTGCGTGTTGCAAGAGA	0.473			T	IGH@	B-CLL																																		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	1	Substitution - Missense(1)	ovary(1)	2											94.0	94.0	94.0					2																	60689485		2203	4300	6503	60542989	SO:0001583	missense	53335			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.562C>T	2.37:g.60689485G>A	ENSP00000338774:p.His188Tyr	Somatic		Capture	SOLID	Phase_IV	60542989	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313205	0.81358	.	.	ENSG00000119866	ENST00000356842;ENST00000359629;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T;T	0.76709	0.99;-1.04;0.51;-1.04;-1.04;0.54	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	D	0.88640	0.6491	M	0.75615	2.305	0.40991	D	0.984856	D;P;P;D;D;D	0.89917	0.999;0.851;0.908;1.0;0.996;1.0	D;P;P;D;D;D	0.91635	0.999;0.775;0.888;0.999;0.986;0.999	D	0.89012	0.3429	10	0.66056	D	0.02	-3.0925	20.0332	0.97547	0.0:0.0:1.0:0.0	.	154;36;154;188;188;188	F5H2Y4;B4DT16;Q9H165-6;Q9H165;Q9H165-3;D9YZV9	.;.;.;BC11A_HUMAN;.;.	Y	188;188;224;154;36;188;154	ENSP00000349300:H188Y;ENSP00000352648:H188Y;ENSP00000438303:H154Y;ENSP00000443712:H36Y;ENSP00000338774:H188Y;ENSP00000351307:H154Y	ENSP00000338774:H188Y	H	-	1	0	BCL11A	60542989	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.777000	0.99008	2.749000	0.94314	0.491000	0.48974	CAC		0.473	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893		Missense_Mutation
C19orf47	126526	hgsc.bcm.edu	37	19	40842028	40842028	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr19:40842028C>T	ENST00000582783.1	-	4	334	c.322G>A	c.(322-324)Gtg>Atg	p.V108M	Y_RNA_ENST00000384551.1_RNA|C19orf47_ENST00000392035.2_Missense_Mutation_p.V41M	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	108						nucleus (GO:0005634)		p.V41M(1)		endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			TGACGGTGCACCACTTTGGCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	19											124.0	94.0	104.0					19																	40842028		2203	4300	6503	45533868	SO:0001583	missense	126526			AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.322G>A	19.37:g.40842028C>T	ENSP00000463159:p.Val108Met	Somatic		Capture	SOLID	Phase_IV	45533868	Q8IZ33|Q8N0V9	Missense_Mutation	SNP	ENST00000582783.1	37	CCDS58662.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.25	2.479009	0.44044	.	.	ENSG00000160392	ENST00000357884;ENST00000392035	.	.	.	5.6	5.6	0.85130	Sterile alpha motif/pointed domain (2);	0.000000	0.85682	D	0.000000	T	0.77942	0.4206	M	0.82823	2.61	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	T	0.77029	-0.2739	9	0.33141	T	0.24	-4.7315	12.4853	0.55868	0.0:0.9191:0.0:0.0809	.	108	Q8N9M1	CS047_HUMAN	M	108;41	.	ENSP00000350556:V108M	V	-	1	0	C19orf47	45533868	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.501000	0.66950	2.625000	0.88918	0.561000	0.74099	GTG		0.572	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444488.1	NM_178830		Missense_Mutation
C19orf18	147685	hgsc.bcm.edu	37	19	58470047	58470047	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr19:58470047G>C	ENST00000314391.3	-	6	672	c.571C>G	c.(571-573)Ctg>Gtg	p.L191V		NM_152474.4	NP_689687.1	Q8NEA5	CS018_HUMAN	chromosome 19 open reading frame 18	191						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L191V(1)		large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		TCTTCCTTCAGTTTCTTCTTA	0.328																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	56.0	57.0					19																	58470047		2202	4300	6502	63161859	SO:0001583	missense	147685			BC033933	CCDS12967.1	19q13.43	2013-03-11			ENSG00000177025	ENSG00000177025			28642	protein-coding gene	gene with protein product						12477932	Standard	NM_152474		Approved	MGC41906	uc002qqv.3	Q8NEA5	OTTHUMG00000183450	ENST00000314391.3:c.571C>G	19.37:g.58470047G>C	ENSP00000321519:p.Leu191Val	Somatic		Capture	SOLID	Phase_IV	63161859		Missense_Mutation	SNP	ENST00000314391.3	37	CCDS12967.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530170	0.27387	.	.	ENSG00000177025	ENST00000314391	T	0.58940	0.3	3.14	-1.64	0.08318	.	.	.	.	.	T	0.49864	0.1582	L	0.27053	0.805	0.09310	N	1	D	0.60160	0.987	P	0.55999	0.789	T	0.41215	-0.9521	9	0.62326	D	0.03	-33.0796	3.3259	0.07067	0.3813:0.0:0.4056:0.2131	.	191	Q8NEA5	CS018_HUMAN	V	191	ENSP00000321519:L191V	ENSP00000321519:L191V	L	-	1	2	C19orf18	63161859	0.000000	0.05858	0.100000	0.21137	0.027000	0.11550	-0.963000	0.03837	-0.460000	0.07003	-0.350000	0.07774	CTG		0.328	C19orf18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466704.1	NM_152474		Missense_Mutation
C2orf71	388939	hgsc.bcm.edu	37	2	29287926	29287927	+	In_Frame_Ins	INS	-	-	GCT	rs139768554|rs72122505|rs201781577|rs35753661	byFrequency	TCGA-04-1364-01	TCGA-04-1364-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:29287926_29287927insGCT	ENST00000331664.5	-	2	3674_3675	c.3675_3676insAGC	c.(3673-3678)agcgag>agcAGCgag	p.1225_1226insS	C2orf71_ENST00000602958.1_5'Flank	NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	1225			S -> SS. {ECO:0000269|PubMed:21412943}.		response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)		p.S1225_E1226insS(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GGGCTCTCCTCGCTGCTGCTGC	0.624														1871	0.373602	0.5257	0.2637	5008	,	,		17644	0.4931		0.2545	False		,,,				2504	0.2454															2	Insertion - In frame(2)	ovary(1)|breast(1)	2								1580,1994		462,656,669						5.2	1.0		dbSNP_130	16	1923,5511		406,1111,2200	no	coding	C2orf71	NM_001029883.1		868,1767,2869	A1A1,A1R,RR		25.8676,44.2082,31.8223				3503,7505				29141431	SO:0001652	inframe_insertion	388939				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.3673_3675dupAGC	2.37:g.29287933_29287935dupGCT	ENSP00000332809:p.Ser1225_Ser1225dup	Somatic		Capture	SOLID	Phase_IV	29141430		In_Frame_Ins	INS	ENST00000331664.5	37	CCDS42669.1	INS	31	Baylor																																																																																				0.624	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883		In_Frame_Ins
FAXC	84553	hgsc.bcm.edu	37	6	99739653	99739653	+	Silent	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr6:99739653G>A	ENST00000389677.5	-	5	1149	c.867C>T	c.(865-867)gaC>gaT	p.D289D	FAXC_ENST00000538471.1_Silent_p.D9D	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	289						integral component of membrane (GO:0016021)		p.D289D(1)									AGACAGTGGCGTCAAGAGTGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	6											189.0	175.0	180.0					6																	99739653		2203	4300	6503	99846374	SO:0001819	synonymous_variant	84553			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.867C>T	6.37:g.99739653G>A		Somatic		Capture	SOLID	Phase_IV	99846374	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Silent	SNP	ENST00000389677.5	37	CCDS34500.1	SNP	40	Baylor																																																																																				0.512	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041589.4	NM_032511		Silent
CDC73	79577	hgsc.bcm.edu	37	1	193181559	193181559	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr1:193181559C>A	ENST00000367435.3	+	13	1290	c.1106C>A	c.(1105-1107)aCc>aAc	p.T369N		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	369	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.T369N(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						GCAGCTACCACCTCTTTAATA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	159.0	153.0					1																	193181559		2203	4298	6501	191448182	SO:0001583	missense	79577			AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1106C>A	1.37:g.193181559C>A	ENSP00000356405:p.Thr369Asn	Somatic		Capture	SOLID	Phase_IV	191448182	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	SNP	18	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.354238|4.354238	0.82243|0.82243	.|.	.|.	ENSG00000134371|ENSG00000134371	ENST00000445394|ENST00000367435	.|T	.|0.63580	.|-0.05	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66046|0.66046	0.2750|0.2750	L|L	0.50847|0.50847	1.595|1.595	0.80722|0.80722	D|D	1|1	.|P	.|0.50066	.|0.931	.|P	.|0.46940	.|0.532	T|T	0.63386|0.63386	-0.6649|-0.6649	6|10	0.72032|0.40728	D|T	0.01|0.16	-12.2481|-12.2481	20.6593|20.6593	0.99626|0.99626	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|369	.|Q6P1J9	.|CDC73_HUMAN	Q|N	310|369	.|ENSP00000356405:T369N	ENSP00000398808:H310Q|ENSP00000356405:T369N	H|T	+|+	3|2	2|0	CDC73|CDC73	191448182|191448182	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.991000|0.991000	0.79684|0.79684	6.911000|6.911000	0.75746|0.75746	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CAC|ACC		0.318	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529		Missense_Mutation
CHST15	51363	hgsc.bcm.edu	37	10	125798162	125798162	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr10:125798162C>T	ENST00000346248.5	-	5	1701	c.1059G>A	c.(1057-1059)tgG>tgA	p.W353*	CHST15_ENST00000435907.1_Nonsense_Mutation_p.W353*|CHST15_ENST00000421115.1_Nonsense_Mutation_p.W353*	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	353					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)	p.W353*(1)		endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						CATTATTATCCCACATCGTGG	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	10											95.0	79.0	84.0					10																	125798162		2203	4300	6503	125788152	SO:0001587	stop_gained	51363			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1059G>A	10.37:g.125798162C>T	ENSP00000333947:p.Trp353*	Somatic		Capture	SOLID	Phase_IV	125788152	O60338|O60474|Q86VM4	Nonsense_Mutation	SNP	ENST00000346248.5	37	CCDS7638.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	47	13.007337	0.99713	.	.	ENSG00000182022	ENST00000346248;ENST00000435907;ENST00000546346;ENST00000421115	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.8109	19.3887	0.94570	0.0:1.0:0.0:0.0	.	.	.	.	X	353	.	ENSP00000333947:W353X	W	-	3	0	CHST15	125788152	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.615000	0.83006	2.826000	0.97356	0.655000	0.94253	TGG		0.567	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892		Nonsense_Mutation
DOK2	9046	hgsc.bcm.edu	37	8	21767059	21767060	+	Frame_Shift_Ins	INS	-	-	A			TCGA-04-1364-01	TCGA-04-1364-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr8:21767059_21767060insA	ENST00000276420.4	-	5	1259_1260	c.1001_1002insT	c.(1000-1002)gagfs	p.E334fs	DOK2_ENST00000544659.1_Frame_Shift_Ins_p.E180fs	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	334	Pro-rich.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)	p.E334fs*9(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GCAGGGTCTCCTCAATGCTGTC	0.639																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								21823006	SO:0001589	frameshift_variant	9046			AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.1001_1002insT	8.37:g.21767059_21767060insA	ENSP00000276420:p.Glu334fs	Somatic		Capture	SOLID	Phase_IV	21823005	Q8N5A4	Frame_Shift_Ins	INS	ENST00000276420.4	37	CCDS6016.1	INS	24	Baylor																																																																																				0.639	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253735.3	NM_003974		Frame_Shift_Ins
EPHA6	285220	hgsc.bcm.edu	37	3	96706268	96706268	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr3:96706268G>C	ENST00000389672.5	+	3	583	c.545G>C	c.(544-546)cGt>cCt	p.R182P	EPHA6_ENST00000542517.1_Missense_Mutation_p.R88P|EPHA6_ENST00000470610.2_Missense_Mutation_p.R182P	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	88	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.R88H(2)|p.R88P(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AACTGGCTTCGTACAAACTGG	0.433																																																4	Substitution - Missense(4)	ovary(2)|stomach(2)	3											96.0	95.0	95.0					3																	96706268		1880	4105	5985	98188958	SO:0001583	missense	285220			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.545G>C	3.37:g.96706268G>C	ENSP00000374323:p.Arg182Pro	Somatic		Capture	SOLID	Phase_IV	98188958	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	37	CCDS46876.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963717	0.74016	.	.	ENSG00000080224	ENST00000470610;ENST00000389672;ENST00000542517	T;T;T	0.04234	3.67;3.67;3.67	5.74	5.74	0.90152	.	0.315711	0.27836	U	0.017648	T	0.28962	0.0719	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.06391	-1.0829	10	0.87932	D	0	.	15.0648	0.71986	0.0696:0.0:0.9304:0.0	.	182;182	B3KS12;E7EU71	.;.	P	182;182;88	ENSP00000420598:R182P;ENSP00000374323:R182P;ENSP00000439758:R88P	ENSP00000374323:R182P	R	+	2	0	EPHA6	98188958	1.000000	0.71417	0.996000	0.52242	0.939000	0.58152	5.559000	0.67326	2.703000	0.92315	0.655000	0.94253	CGT		0.433	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		Missense_Mutation
ERBB2	2064	hgsc.bcm.edu	37	17	37881617	37881617	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr17:37881617G>A	ENST00000269571.5	+	22	2846	c.2687G>A	c.(2686-2688)cGc>cAc	p.R896H	MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.R881H|ERBB2_ENST00000445658.2_Missense_Mutation_p.R620H|ERBB2_ENST00000584601.1_Missense_Mutation_p.R866H|ERBB2_ENST00000540147.1_Missense_Mutation_p.R866H|ERBB2_ENST00000406381.2_Missense_Mutation_p.R866H|ERBB2_ENST00000584450.1_Missense_Mutation_p.R896H			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	896	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.R896H(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TCCATTCTCCGCCGGCGGTTC	0.607		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	1	Substitution - Missense(1)	ovary(1)	17											65.0	65.0	65.0					17																	37881617		2203	4300	6503	35135143	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2687G>A	17.37:g.37881617G>A	ENSP00000269571:p.Arg896His	Somatic		Capture	SOLID	Phase_IV	35135143	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534053	0.45073	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	5.62	3.53	0.40419	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.29684	0.0741	N	0.03983	-0.305	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.23726	-1.0180	9	0.02654	T	1	.	6.9134	0.24347	0.1528:0.1449:0.7022:0.0	.	620;881;896	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	H	866;881;620;896;866	ENSP00000385185:R866H;ENSP00000446466:R881H;ENSP00000404047:R620H;ENSP00000269571:R896H;ENSP00000443562:R866H	ENSP00000269571:R896H	R	+	2	0	ERBB2	35135143	0.947000	0.32204	0.996000	0.52242	0.951000	0.60555	2.095000	0.41729	1.382000	0.46385	0.563000	0.77884	CGC		0.607	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			Missense_Mutation
FADS2	9415	hgsc.bcm.edu	37	11	61596023	61596024	+	Frame_Shift_Ins	INS	-	-	G			TCGA-04-1364-01	TCGA-04-1364-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr11:61596023_61596024insG	ENST00000278840.4	+	1	791_792	c.161_162insG	c.(160-165)ccggggfs	p.PG54fs	FADS2_ENST00000257261.6_Intron|FADS2_ENST00000522056.1_Intron|FADS2_ENST00000521849.1_Frame_Shift_Ins_p.PG54fs	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	54	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.Q57fs*22(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	ATCCAGCACCCGGGGGGCCAGC	0.604											OREG0021015	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Insertion - Frameshift(1)	ovary(1)	11																																								61352600	SO:0001589	frameshift_variant	9415			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.167dupG	11.37:g.61596029_61596029dupG	ENSP00000278840:p.Pro54fs	Somatic	1054	Capture	SOLID	Phase_IV	61352599	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Frame_Shift_Ins	INS	ENST00000278840.4	37	CCDS8012.1	INS	23	Baylor																																																																																				0.604	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375586.2	NM_004265		Frame_Shift_Ins
GTF2IRD1	9569	hgsc.bcm.edu	37	7	74005218	74005218	+	Silent	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr7:74005218C>T	ENST00000265755.3	+	24	2901	c.2508C>T	c.(2506-2508)gaC>gaT	p.D836D	GTF2IRD1_ENST00000476977.1_Silent_p.D821D|GTF2IRD1_ENST00000455841.2_Silent_p.D853D|GTF2IRD1_ENST00000424337.2_Silent_p.D821D	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	836					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D836D(2)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ACAGCCCAGACGCCGTGGAGG	0.602																																																2	Substitution - coding silent(2)	ovary(2)	7											61.0	55.0	57.0					7																	74005218		2203	4300	6503	73643154	SO:0001819	synonymous_variant	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2508C>T	7.37:g.74005218C>T		Somatic		Capture	SOLID	Phase_IV	73643154	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	CCDS5571.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	1.456	-0.563771	0.03939	.	.	ENSG00000006704	ENST00000470715	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.59418	0.2192	.	.	.	0.41778	D	0.989804	.	.	.	.	.	.	T	0.76865	-0.2801	4	.	.	.	-17.5779	15.5739	0.76359	0.0808:0.6979:0.0818:0.1395	.	.	.	.	C	199	.	.	R	+	1	0	GTF2IRD1	73643154	0.000000	0.05858	0.017000	0.16124	0.205000	0.24178	-3.385000	0.00489	-3.796000	0.00106	-2.069000	0.00389	CGC		0.602	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		Silent
IMPG2	50939	hgsc.bcm.edu	37	3	100964726	100964726	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr3:100964726G>C	ENST00000193391.7	-	12	1650	c.1463C>G	c.(1462-1464)tCt>tGt	p.S488C		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	488					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)	p.S488C(1)		NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CGGGGTGACAGAATGAAGAGT	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	110.0	109.0					3																	100964726		2203	4300	6503	102447416	SO:0001583	missense	50939			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1463C>G	3.37:g.100964726G>C	ENSP00000193391:p.Ser488Cys	Somatic		Capture	SOLID	Phase_IV	102447416	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121155	0.77436	.	.	ENSG00000081148	ENST00000193391	T	0.25912	1.77	6.02	6.02	0.97574	.	0.377447	0.25055	N	0.033490	T	0.30603	0.0770	L	0.32530	0.975	0.36409	D	0.863631	D;D	0.69078	0.997;0.997	P;P	0.55667	0.781;0.781	T	0.18840	-1.0324	10	0.51188	T	0.08	-5.4965	9.3737	0.38270	0.1178:0.0:0.8822:0.0	.	488;488	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	C	488	ENSP00000193391:S488C	ENSP00000193391:S488C	S	-	2	0	IMPG2	102447416	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.107000	0.50329	2.857000	0.98124	0.650000	0.86243	TCT		0.478	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3			Missense_Mutation
KCTD8	386617	hgsc.bcm.edu	37	4	44177010	44177010	+	Missense_Mutation	SNP	G	G	A	rs143160739		TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr4:44177010G>A	ENST00000360029.3	-	2	1502	c.1219C>T	c.(1219-1221)Cgc>Tgc	p.R407C		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	407					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.R407S(1)|p.R407C(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CTGTTTCTGCGTTTGTCTGGT	0.463										HNSCC(17;0.042)																																						2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	4						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	208.0	214.0	212.0		1219	3.9	1.0	4	dbSNP_134	212	0,8600		0,0,4300	no	missense	KCTD8	NM_198353.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	407/474	44177010	1,13005	2203	4300	6503	43871767	SO:0001583	missense	386617			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1219C>T	4.37:g.44177010G>A	ENSP00000353129:p.Arg407Cys	Somatic		Capture	SOLID	Phase_IV	43871767	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692140	0.30052	2.27E-4	0.0	ENSG00000183783	ENST00000360029	T	0.44881	0.91	4.76	3.9	0.45041	.	0.120720	0.35151	N	0.003420	T	0.52092	0.1713	L	0.32530	0.975	0.50813	D	0.999892	D	0.89917	1.0	D	0.75020	0.985	T	0.56739	-0.7929	10	0.87932	D	0	.	13.8329	0.63391	0.0:0.0:0.846:0.154	.	407	Q6ZWB6	KCTD8_HUMAN	C	407	ENSP00000353129:R407C	ENSP00000353129:R407C	R	-	1	0	KCTD8	43871767	1.000000	0.71417	1.000000	0.80357	0.063000	0.16089	4.675000	0.61619	1.338000	0.45544	0.650000	0.86243	CGC		0.463	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1			Missense_Mutation
KL	9365	hgsc.bcm.edu	37	13	33638043	33638043	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr13:33638043G>A	ENST00000380099.3	+	5	2767	c.2759G>A	c.(2758-2760)cGc>cAc	p.R920H	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	920	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.R920H(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TTTAACGACCGCACAGCTCCG	0.418																																																1	Substitution - Missense(1)	ovary(1)	13											162.0	161.0	161.0					13																	33638043		2203	4300	6503	32536043	SO:0001583	missense	9365			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2759G>A	13.37:g.33638043G>A	ENSP00000369442:p.Arg920His	Somatic		Capture	SOLID	Phase_IV	32536043	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	CCDS9347.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446141	0.43429	.	.	ENSG00000133116	ENST00000380099	T	0.29917	1.55	5.33	4.48	0.54585	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.122451	0.56097	D	0.000037	T	0.29524	0.0736	L	0.57536	1.79	0.35545	D	0.803359	P	0.46656	0.882	B	0.39379	0.298	T	0.47446	-0.9117	10	0.59425	D	0.04	-19.3595	11.0489	0.47876	0.1617:0.0:0.8383:0.0	.	920	Q9UEF7	KLOT_HUMAN	H	920	ENSP00000369442:R920H	ENSP00000369442:R920H	R	+	2	0	KL	32536043	0.868000	0.29978	0.947000	0.38551	0.024000	0.10985	1.421000	0.34815	1.242000	0.43836	0.655000	0.94253	CGC		0.418	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1			Missense_Mutation
KRTAP19-4	337971	hgsc.bcm.edu	37	21	31869398	31869398	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr21:31869398G>T	ENST00000334058.2	-	1	53	c.31C>A	c.(31-33)Ctg>Atg	p.L11M		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	11						intermediate filament (GO:0005882)		p.L11M(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						CCATAGCCCAGGCCTCTGTAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	21											111.0	116.0	114.0					21																	31869398		2203	4300	6503	30791269	SO:0001583	missense	337971			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.31C>A	21.37:g.31869398G>T	ENSP00000335567:p.Leu11Met	Somatic		Capture	SOLID	Phase_IV	30791269	Q17RT4|Q17RT6	Missense_Mutation	SNP	ENST00000334058.2	37	CCDS33534.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.425	-0.332307	0.05314	.	.	ENSG00000186967	ENST00000334058	T	0.11930	2.73	3.91	3.03	0.35002	.	.	.	.	.	T	0.31167	0.0788	.	.	.	0.19300	N	0.999971	D	0.89917	1.0	D	0.72982	0.979	T	0.03717	-1.1010	8	0.87932	D	0	.	7.6851	0.28536	0.1167:0.0:0.8833:0.0	.	11	Q3LI73	KR194_HUMAN	M	11	ENSP00000335567:L11M	ENSP00000335567:L11M	L	-	1	2	KRTAP19-4	30791269	0.961000	0.32948	0.987000	0.45799	0.014000	0.08584	1.595000	0.36708	1.224000	0.43551	0.585000	0.79938	CTG		0.547	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128219.2			Missense_Mutation
MYT1L	23040	hgsc.bcm.edu	37	2	1891311	1891311	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:1891311C>A	ENST00000399161.2	-	17	3338	c.2591G>T	c.(2590-2592)aGt>aTt	p.S864I	MYT1L_ENST00000428368.2_Missense_Mutation_p.S862I	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	864					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S864I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGGTTTGGGACTTGGGATGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	2											185.0	181.0	182.0					2																	1891311		1923	4132	6055	1870318	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2591G>T	2.37:g.1891311C>A	ENSP00000382114:p.Ser864Ile	Somatic		Capture	SOLID	Phase_IV	1870318	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450401	0.84101	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.56103	0.48;0.48	5.55	5.55	0.83447	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.73380	0.98;0.961	T	0.78109	-0.2332	10	0.72032	D	0.01	-27.8399	19.5067	0.95121	0.0:1.0:0.0:0.0	.	864;862	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	I	864;810;862	ENSP00000382114:S864I;ENSP00000396103:S862I	ENSP00000295067:S810I	S	-	2	0	MYT1L	1870318	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	5.658000	0.68003	2.609000	0.88269	0.650000	0.86243	AGT		0.483	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		Missense_Mutation
MYO7B	4648	hgsc.bcm.edu	37	2	128384572	128384572	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1364-01	TCGA-04-1364-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:128384572T>G	ENST00000409816.2	+	30	4192	c.4160T>G	c.(4159-4161)gTc>gGc	p.V1387G	MYO7B_ENST00000428314.1_Missense_Mutation_p.V1387G|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000389524.4_Missense_Mutation_p.V1387G|MYO7B_ENST00000409090.1_Missense_Mutation_p.V240G			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1387	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CAGAAGCAAGTCACACCACTG	0.597																																																0			2											27.0	30.0	29.0					2																	128384572		2011	4177	6188	128101042	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4160T>G	2.37:g.128384572T>G	ENSP00000386461:p.Val1387Gly	Somatic		Capture	SOLID	Phase_IV	128101042	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	c	8.828	0.939205	0.18281	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000272666;ENST00000409816;ENST00000409090	D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79	4.44	1.61	0.23674	Band 4.1 domain (1);FERM domain (1);	0.635253	0.15925	N	0.237934	T	0.80565	0.4647	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.66634	-0.5874	10	0.41790	T	0.15	.	2.7584	0.05299	0.3376:0.3407:0.0:0.3217	.	1387	Q6PIF6	MYO7B_HUMAN	G	1387;1387;240;1387;240	ENSP00000374175:V1387G;ENSP00000415090:V1387G;ENSP00000386461:V1387G;ENSP00000386850:V240G	ENSP00000272666:V240G	V	+	2	0	MYO7B	128101042	0.001000	0.12720	0.001000	0.08648	0.105000	0.19272	0.244000	0.18124	0.148000	0.19059	-0.251000	0.11542	GTC		0.597	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		Missense_Mutation
NBPF1	55672	hgsc.bcm.edu	37	1	16891363	16891365	+	In_Frame_Del	DEL	TCG	TCG	-	rs2289552		TCGA-04-1364-01	TCGA-04-1364-10	TCG	TCG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr1:16891363_16891365delTCG	ENST00000430580.2	-	28	4000_4002	c.3113_3115delCGA	c.(3112-3117)acgaag>aag	p.T1038del		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1026	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		cttcttttcttcgttgatcttct	0.419																																																0			1																																								16763952	SO:0001651	inframe_deletion	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3113_3115delCGA	1.37:g.16891363_16891365delTCG	ENSP00000474456:p.Thr1038del	Somatic		Capture	SOLID	Phase_IV	16763950	Q8N4E8|Q9C0H0	In_Frame_Del	DEL	ENST00000430580.2	37		DEL	62	Baylor																																																																																				0.419	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940		In_Frame_Del
NBPF12	149013	hgsc.bcm.edu	37	1	146462752	146462752	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr1:146462752C>A	ENST00000442909.2	+	78	10176	c.9340C>A	c.(9340-9342)Cct>Act	p.P3114T	NBPF12_ENST00000309471.8_Intron|NBPF12_ENST00000446760.2_Intron|NBPF12_ENST00000446080.2_Missense_Mutation_p.P52T			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	52						cytoplasm (GO:0005737)		p.P52T(1)		ovary(2)	2						TCTTGAACTGCCTGACTTAGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	1																																								144929375	SO:0001583	missense	440675			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.9340C>A	1.37:g.146462752C>A	ENSP00000391116:p.Pro3114Thr	Somatic		Capture	SOLID	Phase_IV	144929375	O95877	Missense_Mutation	SNP	ENST00000442909.2	37		SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	N	0.008	-1.910675	0.00508	.	.	ENSG00000186275	ENST00000442909;ENST00000446080	T;T	0.05925	3.37;3.37	0.583	-1.17	0.09648	.	.	.	.	.	T	0.01287	0.0042	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.46345	-0.9198	5	0.34782	T	0.22	.	.	.	.	.	.	.	.	T	3114;52	ENSP00000391116:P3114T;ENSP00000407570:P52T	ENSP00000391116:P3114T	P	+	1	0	NBPF12	144929375	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.405000	0.02492	-1.215000	0.02610	-0.507000	0.04495	CCT		0.498	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000102086.3	XM_003119146		Missense_Mutation
NR4A2	4929	hgsc.bcm.edu	37	2	157186373	157186374	+	Frame_Shift_Ins	INS	-	-	G			TCGA-04-1364-01	TCGA-04-1364-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:157186373_157186374insG	ENST00000339562.4	-	3	687_688	c.325_326insC	c.(325-327)cagfs	p.Q109fs	NR4A2_ENST00000409108.2_Frame_Shift_Ins_p.Q109fs|NR4A2_ENST00000429376.1_Frame_Shift_Ins_p.Q46fs|NR4A2_ENST00000409572.1_Frame_Shift_Ins_p.Q109fs|NR4A2_ENST00000426264.1_Frame_Shift_Ins_p.Q46fs|NR4A2_ENST00000539077.1_Frame_Shift_Ins_p.Q120fs	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	109	Gln-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Q109fs*3(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CTCCTCAGACTGGGGGGGCAGG	0.604																																																1	Insertion - Frameshift(1)	ovary(1)	2																																								156894620	SO:0001589	frameshift_variant	4929			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.326dupC	2.37:g.157186380_157186380dupG	ENSP00000344479:p.Gln109fs	Somatic		Capture	SOLID	Phase_IV	156894619	Q16311|Q53RZ2|Q6NXU0	Frame_Shift_Ins	INS	ENST00000339562.4	37	CCDS2201.1	INS	55	Baylor																																																																																				0.604	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2			Frame_Shift_Ins
PDE12	201626	hgsc.bcm.edu	37	3	57542932	57542932	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr3:57542932A>T	ENST00000311180.8	+	1	929	c.826A>T	c.(826-828)Acc>Tcc	p.T276S	PDE12_ENST00000487257.1_Missense_Mutation_p.T276S	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	276					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)	p.T276S(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TGGGCCTGGCACCTGCACTTT	0.592																																					Colon(125;308 1634 19198 50622 50717)											1	Substitution - Missense(1)	ovary(1)	3											85.0	84.0	85.0					3																	57542932		2203	4300	6503	57517972	SO:0001583	missense	201626			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.826A>T	3.37:g.57542932A>T	ENSP00000309142:p.Thr276Ser	Somatic		Capture	SOLID	Phase_IV	57517972	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Missense_Mutation	SNP	ENST00000311180.8	37	CCDS33772.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.230	1.035505	0.19590	.	.	ENSG00000174840	ENST00000487257;ENST00000311180	T;T	0.23754	1.89;1.92	5.18	3.8	0.43715	.	0.553767	0.20646	N	0.088317	T	0.12732	0.0309	L	0.27053	0.805	0.25553	N	0.987066	B;B	0.18310	0.016;0.027	B;B	0.21917	0.017;0.037	T	0.33445	-0.9868	10	0.06757	T	0.87	-21.7025	3.7601	0.08601	0.6146:0.2246:0.1608:0.0	.	276;276	Q6L8Q7;F6T1Q0	PDE12_HUMAN;.	S	276	ENSP00000420626:T276S;ENSP00000309142:T276S	ENSP00000309142:T276S	T	+	1	0	PDE12	57517972	0.982000	0.34865	1.000000	0.80357	0.850000	0.48378	2.236000	0.43052	1.957000	0.56846	0.459000	0.35465	ACC		0.592	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		Missense_Mutation
PGAP1	80055	hgsc.bcm.edu	37	2	197737199	197737199	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr2:197737199A>C	ENST00000354764.4	-	18	1808	c.1694T>G	c.(1693-1695)tTt>tGt	p.F565C	PGAP1_ENST00000409475.1_Missense_Mutation_p.F565C	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	565					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.F565C(3)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GTACATTTTAAATAATGCCAC	0.323																																																3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	2											106.0	104.0	104.0					2																	197737199		2203	4300	6503	197445444	SO:0001583	missense	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1694T>G	2.37:g.197737199A>C	ENSP00000346809:p.Phe565Cys	Somatic		Capture	SOLID	Phase_IV	197445444	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518077	0.44763	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475	.	.	.	5.06	5.06	0.68205	.	0.078689	0.53938	D	0.000060	T	0.36386	0.0965	N	0.08118	0	0.80722	D	1	B;B	0.32507	0.373;0.187	B;B	0.36418	0.224;0.121	T	0.44329	-0.9335	9	0.87932	D	0	-6.0755	13.1918	0.59715	1.0:0.0:0.0:0.0	.	565;565	Q75T13-3;Q75T13	.;PGAP1_HUMAN	C	345;565;565	.	ENSP00000346809:F565C	F	-	2	0	PGAP1	197445444	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	5.462000	0.66707	2.141000	0.66446	0.477000	0.44152	TTT		0.323	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989		Missense_Mutation
RPA1	6117	hgsc.bcm.edu	37	17	1800443	1800444	+	Frame_Shift_Ins	INS	-	-	G			TCGA-04-1364-01	TCGA-04-1364-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr17:1800443_1800444insG	ENST00000254719.5	+	17	1935_1936	c.1825_1826insG	c.(1825-1827)agcfs	p.S609fs		NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	609					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)	p.S609fs*>9(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						GCTGGTCATGAGCATCAGGAGA	0.51								Nucleotide excision repair (NER)																																								1	Insertion - Frameshift(1)	ovary(1)	17																																								1747194	SO:0001589	frameshift_variant	6117			M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.1826dupG	17.37:g.1800444_1800444dupG	ENSP00000254719:p.Ser609fs	Somatic		Capture	SOLID	Phase_IV	1747193	A8K0Y9|Q59ES9	Frame_Shift_Ins	INS	ENST00000254719.5	37	CCDS11014.1	INS	11	Baylor																																																																																				0.510	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945		Frame_Shift_Ins
RGS9	8787	hgsc.bcm.edu	37	17	63221256	63221256	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr17:63221256G>A	ENST00000262406.9	+	18	1611	c.1544G>A	c.(1543-1545)cGg>cAg	p.R515Q	RGS9_ENST00000443584.3_Missense_Mutation_p.R512Q|RGS9_ENST00000449996.3_Missense_Mutation_p.R512Q	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	515					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.R515Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CGCTTCATCCGGCGACCCAGC	0.662																																																1	Substitution - Missense(1)	ovary(1)	17											91.0	109.0	103.0					17																	63221256		2074	4206	6280	60651718	SO:0001583	missense	8787			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1544G>A	17.37:g.63221256G>A	ENSP00000262406:p.Arg515Gln	Somatic		Capture	SOLID	Phase_IV	60651718	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800955	0.50315	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.31510	1.5;1.49	3.91	2.82	0.32997	.	0.303719	0.23598	N	0.046463	T	0.19327	0.0464	L	0.51422	1.61	0.21290	N	0.999733	P;P;P	0.48089	0.787;0.847;0.905	B;B;B	0.35114	0.104;0.096;0.196	T	0.15093	-1.0449	10	0.13853	T	0.58	.	8.6609	0.34093	0.0:0.2355:0.7645:0.0	.	515;515;512	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	Q	515;512	ENSP00000262406:R515Q;ENSP00000396329:R512Q	ENSP00000262406:R515Q	R	+	2	0	RGS9	60651718	0.061000	0.20836	0.946000	0.38457	0.917000	0.54804	2.551000	0.45820	2.128000	0.65567	0.561000	0.74099	CGG		0.662	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835		Missense_Mutation
RUNX2	860	hgsc.bcm.edu	37	6	45514707	45514707	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr6:45514707G>A	ENST00000371438.1	+	8	1589	c.1231G>A	c.(1231-1233)Ggt>Agt	p.G411S	RUNX2_ENST00000352853.5_Missense_Mutation_p.G479S|RUNX2_ENST00000465038.2_Missense_Mutation_p.G411S|RUNX2_ENST00000541979.1_Missense_Mutation_p.G457S|RUNX2_ENST00000371436.6_Missense_Mutation_p.G389S|RUNX2_ENST00000371432.3_Missense_Mutation_p.G375S|RUNX2_ENST00000359524.5_Missense_Mutation_p.G397S|RUNX2_ENST00000576263.1_Intron	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	411	Interaction with KAT6A. {ECO:0000250}.|Interaction with KAT6B.|Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G411S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CATGTCCCTCGGTATGTCCGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	116.0	126.0					6																	45514707		2203	4300	6503	45622685	SO:0001583	missense	860			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1231G>A	6.37:g.45514707G>A	ENSP00000360493:p.Gly411Ser	Somatic		Capture	SOLID	Phase_IV	45622685	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109934	0.77210	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	D;D;D;D;D;D;D	0.97328	-4.29;-4.34;-4.26;-4.29;-4.25;-4.3;-4.27	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.96781	0.8949	L	0.41710	1.295	0.80722	D	1	D;D;D	0.76494	0.986;0.998;0.999	P;P;P	0.62560	0.555;0.762;0.904	D	0.95328	0.8427	10	0.31617	T	0.26	-6.6236	19.922	0.97089	0.0:0.0:1.0:0.0	.	457;411;397	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	S	411;479;457;411;389;397;375	ENSP00000420707:G411S;ENSP00000319087:G479S;ENSP00000446290:G457S;ENSP00000360493:G411S;ENSP00000360491:G389S;ENSP00000352514:G397S;ENSP00000360486:G375S	ENSP00000319087:G479S	G	+	1	0	RUNX2	45622685	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.780000	0.95670	0.655000	0.94253	GGT		0.577	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348		Missense_Mutation
SEC14L3	266629	hgsc.bcm.edu	37	22	30860822	30860822	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1364-01	TCGA-04-1364-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr22:30860822T>A	ENST00000215812.4	-	8	739	c.649A>T	c.(649-651)Att>Ttt	p.I217F	SEC14L3_ENST00000415957.2_Missense_Mutation_p.I158F|SEC14L3_ENST00000539629.1_Missense_Mutation_p.I158F|SEC14L3_ENST00000401751.1_Missense_Mutation_p.I158F|SEC14L3_ENST00000403066.1_Missense_Mutation_p.I158F|SEC14L3_ENST00000540910.1_Missense_Mutation_p.I140F|SEC14L3_ENST00000402286.1_Missense_Mutation_p.I140F	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	217	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.I217F(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	AACACAATAATTTTCCTGCGA	0.463																																					Esophageal Squamous(108;290 1516 3584 23771 37333)											1	Substitution - Missense(1)	ovary(1)	22											180.0	154.0	163.0					22																	30860822		2203	4300	6503	29190822	SO:0001583	missense	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.649A>T	22.37:g.30860822T>A	ENSP00000215812:p.Ile217Phe	Somatic		Capture	SOLID	Phase_IV	29190822	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	SNP	52	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.28|17.28	3.349499|3.349499	0.61183|0.61183	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910|ENST00000435069	T;T;T;T;T;T;T|T	0.66638|0.52983	-0.22;-0.22;-0.22;1.34;-0.22;-0.22;1.34|0.64	5.5|5.5	5.5|5.5	0.81552|0.81552	Cellular retinaldehyde-binding/triple function, C-terminal (5);|.	0.106946|.	0.64402|.	D|.	0.000005|.	T|T	0.59224|0.59224	0.2178|0.2178	M|M	0.67569|0.67569	2.06|2.06	0.80722|0.80722	D|D	1|1	P;P|.	0.45011|.	0.848;0.727|.	P;P|.	0.49140|.	0.471;0.601|.	T|T	0.63341|0.63341	-0.6659|-0.6659	10|7	0.87932|0.87932	D|D	0|0	-16.5085|-16.5085	10.7724|10.7724	0.46330|0.46330	0.0:0.076:0.0:0.924|0.0:0.076:0.0:0.924	.|.	140;217|.	E9PE57;Q9UDX4|.	.;S14L3_HUMAN|.	F|N	158;158;217;140;158;158;140|182	ENSP00000385941:I158F;ENSP00000401864:I158F;ENSP00000215812:I217F;ENSP00000385004:I140F;ENSP00000383896:I158F;ENSP00000444691:I158F;ENSP00000439752:I140F|ENSP00000402986:K182N	ENSP00000215812:I217F|ENSP00000402986:K182N	I|K	-|-	1|3	0|2	SEC14L3|SEC14L3	29190822|29190822	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.475000|0.475000	0.33008|0.33008	4.737000|4.737000	0.62066|0.62066	2.096000|2.096000	0.63516|0.63516	0.533000|0.533000	0.62120|0.62120	ATT|AAA		0.463	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975		Missense_Mutation
SLC9A8	23315	hgsc.bcm.edu	37	20	48431625	48431625	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr20:48431625C>T	ENST00000361573.2	+	2	149	c.107C>T	c.(106-108)cCg>cTg	p.P36L	SLC9A8_ENST00000417961.1_Missense_Mutation_p.P36L|SLC9A8_ENST00000541138.1_5'UTR|SLC9A8_ENST00000539601.1_5'UTR			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	36					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)	p.P36L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			CTGGTGCTCCCGACCCCTGGC	0.572																																																1	Substitution - Missense(1)	ovary(1)	20											106.0	92.0	97.0					20																	48431625		2203	4300	6503	47865032	SO:0001583	missense	23315			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.107C>T	20.37:g.48431625C>T	ENSP00000354966:p.Pro36Leu	Somatic		Capture	SOLID	Phase_IV	47865032	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.261052	0.95368	.	.	ENSG00000197818	ENST00000417961;ENST00000361573	T;T	0.64991	-0.13;-0.12	5.53	5.53	0.82687	.	0.229313	0.45126	D	0.000394	T	0.69351	0.3101	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.988	T	0.73509	-0.3960	10	0.66056	D	0.02	.	19.1301	0.93402	0.0:1.0:0.0:0.0	.	36;36	Q9Y2E8-2;Q9Y2E8	.;SL9A8_HUMAN	L	36	ENSP00000416418:P36L;ENSP00000354966:P36L	ENSP00000354966:P36L	P	+	2	0	SLC9A8	47865032	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	5.864000	0.69575	2.602000	0.87976	0.644000	0.83932	CCG		0.572	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524		Missense_Mutation
SNCB	6620	hgsc.bcm.edu	37	5	176048262	176048262	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr5:176048262C>T	ENST00000310112.3	-	6	575	c.325G>A	c.(325-327)Gag>Aag	p.E109K	SNCB_ENST00000510387.1_Missense_Mutation_p.E109K|SNCB_ENST00000393693.2_Missense_Mutation_p.E109K|SNCB_ENST00000506696.1_Missense_Mutation_p.E109K	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	109					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)	p.E109K(1)		breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCAGGGGCTCAATCAGTGGT	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											61.0	60.0	60.0					5																	176048262		2203	4300	6503	175980868	SO:0001583	missense	6620			AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.325G>A	5.37:g.176048262C>T	ENSP00000308057:p.Glu109Lys	Somatic		Capture	SOLID	Phase_IV	175980868	Q6IAX7	Missense_Mutation	SNP	ENST00000310112.3	37	CCDS4406.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820669	0.71028	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	4.98	4.98	0.66077	.	0.060456	0.64402	D	0.000004	D	0.86598	0.5971	L	0.38175	1.15	0.80722	D	1	D	0.52996	0.957	D	0.65233	0.933	D	0.85969	0.1475	10	0.38643	T	0.18	-13.1542	18.246	0.89986	0.0:1.0:0.0:0.0	.	109	Q16143	SYUB_HUMAN	K	109	ENSP00000308057:E109K;ENSP00000377296:E109K;ENSP00000424073:E109K;ENSP00000422223:E109K	ENSP00000308057:E109K	E	-	1	0	SNCB	175980868	1.000000	0.71417	0.985000	0.45067	0.725000	0.41563	5.908000	0.69916	2.315000	0.78130	0.650000	0.86243	GAG		0.602	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253152.2	NM_001001502		Missense_Mutation
SPOP	8405	hgsc.bcm.edu	37	17	47688778	47688778	+	Silent	SNP	A	A	G			TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr17:47688778A>G	ENST00000393328.2	-	7	887	c.522T>C	c.(520-522)aaT>aaC	p.N174N	SPOP_ENST00000503676.1_Silent_p.N174N|SPOP_ENST00000347630.2_Silent_p.N174N|SPOP_ENST00000504102.1_Silent_p.N174N|SPOP_ENST00000393331.3_Silent_p.N174N	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	174	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Required for nuclear localization.				glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						TGTTCATGGTATTCTGGCCAG	0.478										Prostate(2;0.17)																																						0			17											138.0	142.0	141.0					17																	47688778		2203	4300	6503	45043777	SO:0001819	synonymous_variant	8405			AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.522T>C	17.37:g.47688778A>G		Somatic		Capture	SOLID	Phase_IV	45043777	B2R6S3|D3DTW7|Q53HJ1	Silent	SNP	ENST00000393328.2	37	CCDS11551.1	SNP	16	Baylor																																																																																				0.478	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	NM_003563		Silent
SYNE2	23224	hgsc.bcm.edu	37	14	64685176	64685176	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr14:64685176G>C	ENST00000344113.4	+	108	19746	c.19534G>C	c.(19534-19536)Ggc>Cgc	p.G6512R	SYNE2_ENST00000458046.2_Missense_Mutation_p.G169R|SYNE2_ENST00000555022.1_Missense_Mutation_p.G390R|SYNE2_ENST00000441438.2_Missense_Mutation_p.G43R|SYNE2_ENST00000357395.3_Missense_Mutation_p.G2897R|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.G3169R|SYNE2_ENST00000394768.2_Missense_Mutation_p.G2897R|SYNE2_ENST00000358025.3_Missense_Mutation_p.G6535R|SYNE2_ENST00000554584.1_Intron|SYNE2_ENST00000554805.1_Missense_Mutation_p.G295R	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6512					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.G6535R(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGTCCTGAATGGCAACCCACA	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											72.0	74.0	73.0					14																	64685176		2203	4300	6503	63754929	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.19534G>C	14.37:g.64685176G>C	ENSP00000341781:p.Gly6512Arg	Somatic		Capture	SOLID	Phase_IV	63754929	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632602	0.29068	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805;ENST00000458046;ENST00000441438	T;T;T;T;T;T;T;T;T	0.47869	0.83;4.14;0.84;4.17;4.14;3.8;3.32;2.96;2.79	5.03	3.1	0.35709	.	0.403035	0.21357	N	0.075876	T	0.52273	0.1724	L	0.60455	1.87	0.29672	N	0.842383	P;B;P;P;B;B;D	0.65815	0.818;0.292;0.935;0.935;0.286;0.073;0.995	B;B;P;P;B;B;P	0.57960	0.219;0.137;0.664;0.491;0.187;0.029;0.83	T	0.48779	-0.9005	10	0.33940	T	0.23	.	5.2163	0.15344	0.1082:0.0:0.6917:0.2001	.	169;2897;43;169;900;6512;6535	B4DND7;Q8WXH0-7;Q8WXH0-6;Q8WXH0-5;Q7Z362;Q8WXH0;Q8WXH0-2	.;.;.;.;.;SYNE2_HUMAN;.	R	6535;2897;6512;3169;2897;390;295;169;43	ENSP00000350719:G6535R;ENSP00000349969:G2897R;ENSP00000341781:G6512R;ENSP00000450831:G3169R;ENSP00000378249:G2897R;ENSP00000451009:G390R;ENSP00000450605:G295R;ENSP00000391937:G169R;ENSP00000396794:G43R	ENSP00000341781:G6512R	G	+	1	0	SYNE2	63754929	0.962000	0.33011	0.015000	0.15790	0.009000	0.06853	2.798000	0.47884	0.619000	0.30197	0.561000	0.74099	GGC		0.527	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		Missense_Mutation
TACC1	6867	hgsc.bcm.edu	37	8	38677207	38677207	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr8:38677207G>A	ENST00000317827.4	+	3	824	c.445G>A	c.(445-447)Gtg>Atg	p.V149M	TACC1_ENST00000518415.1_Missense_Mutation_p.V104M|TACC1_ENST00000379931.3_Missense_Mutation_p.V149M|TACC1_ENST00000520973.1_5'UTR|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000443286.2_Missense_Mutation_p.V165M|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000520340.1_Missense_Mutation_p.V113M|TACC1_ENST00000520615.1_5'UTR|TACC1_ENST00000519416.1_5'UTR	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	149					cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)		p.V149M(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			AATTTCCATCGTGAGGCCATT	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											97.0	94.0	95.0					8																	38677207		2203	4300	6503	38796364	SO:0001583	missense	6867			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.445G>A	8.37:g.38677207G>A	ENSP00000321703:p.Val149Met	Somatic		Capture	SOLID	Phase_IV	38796364	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404520	0.42613	.	.	ENSG00000147526	ENST00000443286;ENST00000518415;ENST00000522904;ENST00000317827;ENST00000379931	T;T;T;T;T	0.12774	2.84;2.83;2.65;2.87;2.88	5.48	5.48	0.80851	.	0.176346	0.37178	N	0.002202	T	0.31136	0.0787	M	0.69823	2.125	0.29281	N	0.870035	D;D;D	0.89917	0.981;1.0;0.999	P;P;D	0.64687	0.474;0.894;0.928	T	0.14559	-1.0468	10	0.36615	T	0.2	-10.6275	10.382	0.44117	0.0893:0.0:0.9107:0.0	.	165;149;104	B4E302;O75410;O75410-7	.;TACC1_HUMAN;.	M	165;104;121;149;149	ENSP00000393647:V165M;ENSP00000428706:V104M;ENSP00000430355:V121M;ENSP00000321703:V149M;ENSP00000369263:V149M	ENSP00000321703:V149M	V	+	1	0	TACC1	38796364	0.998000	0.40836	0.953000	0.39169	0.150000	0.21749	3.109000	0.50345	2.563000	0.86464	0.563000	0.77884	GTG		0.448	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578202	7578202	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr17:7578202A>C	ENST00000269305.4	-	6	836	c.647T>G	c.(646-648)gTg>gGg	p.V216G	TP53_ENST00000455263.2_Missense_Mutation_p.V216G|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.V216G|TP53_ENST00000445888.2_Missense_Mutation_p.V216G|TP53_ENST00000420246.2_Missense_Mutation_p.V216G|TP53_ENST00000359597.4_Missense_Mutation_p.V216G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(10)|p.V216del(8)|p.0?(8)|p.V216E(7)|p.V216G(6)|p.V216A(3)|p.V216fs*31(2)|p.H214fs*5(2)|p.V84G(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*6(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.V84E(1)|p.V123G(1)|p.V123E(1)|p.S215_V218>R(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCACCACCACACTATGTCG	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	62	Substitution - Missense(20)|Deletion - In frame(11)|Deletion - Frameshift(10)|Unknown(10)|Whole gene deletion(8)|Complex - deletion inframe(2)|Insertion - Frameshift(1)	ovary(9)|lung(8)|haematopoietic_and_lymphoid_tissue(6)|biliary_tract(5)|endometrium(5)|oesophagus(4)|liver(4)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(2)|central_nervous_system(2)|breast(2)|urinary_tract(2)|soft_tissue(1)|skin(1)|pancreas(1)	17											123.0	111.0	115.0					17																	7578202		2203	4300	6503	7518927	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.647T>G	17.37:g.7578202A>C	ENSP00000269305:p.Val216Gly	Somatic		Capture	SOLID	Phase_IV	7518927	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.2	4.618155	0.87359	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	M	0.88181	2.935	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D	0.96404	0.9299	10	0.87932	D	0	-12.2832	13.4753	0.61306	1.0:0.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216G;ENSP00000352610:V216G;ENSP00000269305:V216G;ENSP00000398846:V216G;ENSP00000391127:V216G;ENSP00000391478:V216G;ENSP00000425104:V84G;ENSP00000423862:V123G	ENSP00000269305:V216G	V	-	2	0	TP53	7518927	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	9.287000	0.95975	2.128000	0.65567	0.460000	0.39030	GTG		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
UBE4B	10277	hgsc.bcm.edu	37	1	10231358	10231358	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr1:10231358C>T	ENST00000253251.8	+	24	3948	c.3109C>T	c.(3109-3111)Cgg>Tgg	p.R1037W	UBE4B_ENST00000343090.6_Missense_Mutation_p.R1166W|UBE4B_ENST00000377157.3_Missense_Mutation_p.R921W					ubiquitination factor E4B									p.R1037W(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GGACTGTGCTCGGTTCGCGAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											110.0	107.0	108.0					1																	10231358		2203	4300	6503	10153945	SO:0001583	missense	10277			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.3109C>T	1.37:g.10231358C>T	ENSP00000253251:p.Arg1037Trp	Somatic		Capture	SOLID	Phase_IV	10153945		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020472	0.75275	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.44482	0.92;0.92;0.92	5.91	5.91	0.95273	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.60196	0.2250	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.67900	0.954;0.93	T	0.59193	-0.7500	10	0.72032	D	0.01	-22.5815	20.2985	0.98592	0.0:1.0:0.0:0.0	.	1166;1037	O95155;O95155-2	UBE4B_HUMAN;.	W	1037;921;1166	ENSP00000253251:R1037W;ENSP00000366362:R921W;ENSP00000343001:R1166W	ENSP00000253251:R1037W	R	+	1	2	UBE4B	10153945	1.000000	0.71417	0.542000	0.28115	0.303000	0.27691	5.981000	0.70524	2.793000	0.96121	0.655000	0.94253	CGG		0.488	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		Missense_Mutation
YTHDC2	64848	hgsc.bcm.edu	37	5	112899747	112899747	+	Silent	SNP	A	A	G	rs113562500		TCGA-04-1364-01	TCGA-04-1364-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr5:112899747A>G	ENST00000161863.4	+	20	2847	c.2634A>G	c.(2632-2634)caA>caG	p.Q878Q		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	878					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AGGCCTCTCAAAAACGTGCAG	0.428																																																0			5											152.0	149.0	150.0					5																	112899747		2202	4300	6502	112927646	SO:0001819	synonymous_variant	64848			AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.2634A>G	5.37:g.112899747A>G		Somatic		Capture	SOLID	Phase_IV	112927646	B2RP66	Silent	SNP	ENST00000161863.4	37	CCDS4113.1	SNP	1	Baylor																																																																																				0.428	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828		Silent
ZBTB7C	201501	hgsc.bcm.edu	37	18	45566835	45566835	+	Missense_Mutation	SNP	C	C	G	rs374731753		TCGA-04-1364-01	TCGA-04-1364-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr18:45566835C>G	ENST00000588982.1	-	3	1145	c.644G>C	c.(643-645)aGt>aCt	p.S215T	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.S215T|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.S215T|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.S215T|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.S215T			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	215							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						ATGGCCAGGACTGCCAGCCTG	0.582																																																0			18											65.0	64.0	64.0					18																	45566835		2203	4300	6503	43820833	SO:0001583	missense	201501			Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.644G>C	18.37:g.45566835C>G	ENSP00000468782:p.Ser215Thr	Somatic		Capture	SOLID	Phase_IV	43820833	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437047	0.25900	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.11063	2.81;2.81	5.25	5.25	0.73442	.	0.816545	0.11753	N	0.532835	T	0.04815	0.0130	N	0.08118	0	0.32791	N	0.501106	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.29822	-0.9999	10	0.09843	T	0.71	.	5.5155	0.16904	0.0:0.6565:0.1779:0.1655	.	215;215;215	B4DKU0;B2RG49;A1YPR0	.;.;ZBT7C_HUMAN	T	215	ENSP00000439781:S215T;ENSP00000328732:S215T	ENSP00000328732:S215T	S	-	2	0	ZBTB7C	43820833	1.000000	0.71417	0.948000	0.38648	0.963000	0.63663	1.371000	0.34250	2.443000	0.82685	0.491000	0.48974	AGT		0.582	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360		Missense_Mutation
ZMAT3	64393	hgsc.bcm.edu	37	3	178745286	178745286	+	Missense_Mutation	SNP	G	G	A	rs371485386		TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr3:178745286G>A	ENST00000311417.2	-	5	1324	c.583C>T	c.(583-585)Cgg>Tgg	p.R195W	ZMAT3_ENST00000432729.1_Missense_Mutation_p.R195W	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3									p.R195W(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			TTCCTGGCCCGCCGTTGACCC	0.393																																																1	Substitution - Missense(1)	ovary(1)	3						G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	78.0	85.0	82.0		583,583	0.7	0.7	3		82	0,8600		0,0,4300	no	missense,missense	ZMAT3	NM_022470.3,NM_152240.2	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	195/290,195/289	178745286	1,13005	2203	4300	6503	180227980	SO:0001583	missense	64393			AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.583C>T	3.37:g.178745286G>A	ENSP00000311221:p.Arg195Trp	Somatic		Capture	SOLID	Phase_IV	180227980		Missense_Mutation	SNP	ENST00000311417.2	37	CCDS3224.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887609	0.72410	2.27E-4	0.0	ENSG00000172667	ENST00000311417;ENST00000432729	T;T	0.57752	0.54;0.38	5.61	0.712	0.18167	.	0.049580	0.85682	D	0.000000	T	0.57932	0.2087	L	0.32530	0.975	0.51012	D	0.999905	D;D	0.76494	0.999;0.999	D;P	0.64687	0.928;0.849	T	0.59632	-0.7418	10	0.56958	D	0.05	-26.2453	14.9168	0.70805	0.0:0.0:0.3375:0.6625	.	195;195	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	W	195	ENSP00000311221:R195W;ENSP00000396506:R195W	ENSP00000311221:R195W	R	-	1	2	ZMAT3	180227980	0.880000	0.30214	0.697000	0.30258	0.987000	0.75469	0.457000	0.21875	0.141000	0.18875	0.655000	0.94253	CGG		0.393	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240		Missense_Mutation
ZNF536	9745	hgsc.bcm.edu	37	19	31025800	31025800	+	Silent	SNP	G	G	A			TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr19:31025800G>A	ENST00000355537.3	+	3	2364	c.2217G>A	c.(2215-2217)gcG>gcA	p.A739A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	739					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.A739A(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGCAACCAGCGCTGCTTCGCG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	19											115.0	116.0	116.0					19																	31025800		2203	4300	6503	35717640	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2217G>A	19.37:g.31025800G>A		Somatic		Capture	SOLID	Phase_IV	35717640	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	38	Baylor																																																																																				0.567	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Silent
ZNF235	9310	hgsc.bcm.edu	37	19	44792828	44792828	+	Missense_Mutation	SNP	G	G	A	rs536226217		TCGA-04-1364-01	TCGA-04-1364-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1364-01	TCGA-04-1364-10	g.chr19:44792828G>A	ENST00000291182.4	-	5	862	c.760C>T	c.(760-762)Cgt>Tgt	p.R254C	ZNF235_ENST00000589799.1_Intron|ZNF235_ENST00000589248.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R254C(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				TGAATACTACGCTGGGTAAGA	0.398													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20853	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											96.0	96.0	96.0					19																	44792828		2203	4300	6503	49484668	SO:0001583	missense	9310			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.760C>T	19.37:g.44792828G>A	ENSP00000291182:p.Arg254Cys	Somatic		Capture	SOLID	Phase_IV	49484668	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	g	12.13	1.845352	0.32606	.	.	ENSG00000159917	ENST00000391957;ENST00000291182;ENST00000359844	T	0.15718	2.4	4.25	-2.13	0.07144	.	2.890490	0.01220	N	0.008066	T	0.17831	0.0428	L	0.43757	1.38	0.09310	N	1	D;D	0.54964	0.969;0.958	B;B	0.43123	0.409;0.296	T	0.38779	-0.9645	10	0.66056	D	0.02	.	7.9188	0.29833	0.2913:0.1096:0.5991:0.0	.	250;254	Q14590-2;Q14590	.;ZN235_HUMAN	C	254;254;176	ENSP00000291182:R254C	ENSP00000291182:R254C	R	-	1	0	ZNF235	49484668	0.019000	0.18553	0.000000	0.03702	0.547000	0.35210	1.381000	0.34362	-0.642000	0.05480	-1.634000	0.00779	CGT		0.398	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1			Missense_Mutation
