#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ESPN	83715	broad.mit.edu	37	1	6500439	6500439	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:6500439A>G	ENST00000377828.1	+	3	782	c.614A>G	c.(613-615)gAc>gGc	p.D205G	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	205					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)	p.D205G(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CGCGCCCACGACGGCATGACC	0.741																																																1	Substitution - Missense(1)	ovary(1)	1											8.0	9.0	8.0					1																	6500439		2170	4248	6418	6423026	SO:0001583	missense	83715			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.614A>G	1.37:g.6500439A>G	ENSP00000367059:p.Asp205Gly	Unknown		x	x	x	6423026	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	37	CCDS70.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	a	21.3	4.127894	0.77549	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.71579	-0.58;-0.58	3.85	3.85	0.44370	Ankyrin repeat-containing domain (3);	0.349408	0.25744	N	0.028591	T	0.65439	0.2691	L	0.47716	1.5	0.80722	D	1	B	0.20887	0.049	B	0.29716	0.106	T	0.66093	-0.6009	10	0.56958	D	0.05	-20.4961	11.7702	0.51953	1.0:0.0:0.0:0.0	.	205	B1AK53	ESPN_HUMAN	G	205;1	ENSP00000367059:D205G;ENSP00000401793:D1G	ENSP00000367059:D205G	D	+	2	0	ESPN	6423026	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.926000	0.92839	1.651000	0.50673	0.382000	0.24955	GAC		0.741	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475		Missense_Mutation
SMPDL3B	27293	broad.mit.edu	37	1	28280902	28280902	+	Silent	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:28280902G>T	ENST00000373894.3	+	5	746	c.555G>T	c.(553-555)ggG>ggT	p.G185G	SMPDL3B_ENST00000373888.4_Silent_p.G185G|SMPDL3B_ENST00000549094.1_Silent_p.G137G|RP11-460I13.2_ENST00000448015.1_RNA	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	185					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.G185G(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		GTCCCAGCGGGGCTGGGCGAA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											128.0	135.0	132.0					1																	28280902		2203	4300	6503	28153489	SO:0001819	synonymous_variant	27293			Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.555G>T	1.37:g.28280902G>T		Unknown		x	x	x	28153489	B7ZB35|Q5T0Z0|Q96CB7	Silent	SNP	ENST00000373894.3	37	CCDS30655.1	SNP	43	Broad																																																																																				0.607	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011170.1	NM_014474		Silent
GNL2	29889	broad.mit.edu	37	1	38040287	38040287	+	Silent	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:38040287G>A	ENST00000373062.3	-	11	1379	c.1281C>T	c.(1279-1281)ttC>ttT	p.F427F		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	427					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.F427F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				TCCCAGTCCGGAAAGCGAGCT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	1											72.0	67.0	68.0					1																	38040287		2203	4300	6503	37812874	SO:0001819	synonymous_variant	29889			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1281C>T	1.37:g.38040287G>A		Unknown		x	x	x	37812874	Q9BWN7	Silent	SNP	ENST00000373062.3	37	CCDS421.1	SNP	41	Broad																																																																																				0.413	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285		Silent
CDC7	8317	broad.mit.edu	37	1	91989864	91989864	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:91989864G>C	ENST00000428239.1	+	12	1856	c.1597G>C	c.(1597-1599)Gaa>Caa	p.E533Q	CDC7_ENST00000234626.6_Missense_Mutation_p.E533Q|CDC7_ENST00000430031.2_Missense_Mutation_p.E505Q	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	533	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E533Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		TACCAATTTAGAAGGCTGGAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											144.0	149.0	147.0					1																	91989864		2203	4300	6503	91762452	SO:0001583	missense	8317			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1597G>C	1.37:g.91989864G>C	ENSP00000393139:p.Glu533Gln	Unknown		x	x	x	91762452	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125689	0.37533	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.52526	0.66;0.81;0.81	5.94	2.76	0.32466	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.828896	0.11529	N	0.554884	T	0.12135	0.0295	N	0.21448	0.665	0.21878	N	0.999497	B;B;B	0.21381	0.033;0.019;0.055	B;B;B	0.24541	0.021;0.045;0.054	T	0.28839	-1.0031	10	0.20519	T	0.43	-2.0819	5.1686	0.15098	0.5412:0.0:0.4588:0.0	.	505;533;533	B7Z5H7;B2R6V2;O00311	.;.;CDC7_HUMAN	Q	505;533;533	ENSP00000407477:E505Q;ENSP00000234626:E533Q;ENSP00000393139:E533Q	ENSP00000234626:E533Q	E	+	1	0	CDC7	91762452	0.950000	0.32346	0.954000	0.39281	0.962000	0.63368	1.621000	0.36986	0.866000	0.35629	0.650000	0.86243	GAA		0.388	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503		Missense_Mutation
ITGA10	8515	broad.mit.edu	37	1	145533916	145533916	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:145533916G>A	ENST00000369304.3	+	13	1737	c.1562G>A	c.(1561-1563)cGt>cAt	p.R521H	ITGA10_ENST00000538811.1_Missense_Mutation_p.R390H|ITGA10_ENST00000539363.1_Missense_Mutation_p.R378H	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	521					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.R521H(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GAAACAGGACGTGTTTATGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											92.0	84.0	87.0					1																	145533916		2203	4300	6503	144245273	SO:0001583	missense	8515			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1562G>A	1.37:g.145533916G>A	ENSP00000358310:p.Arg521His	Somatic		x	x	x	144245273	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547924	0.65311	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.11277	2.79;2.79;2.79	5.27	3.36	0.38483	.	0.229765	0.35124	N	0.003428	T	0.19366	0.0465	M	0.81179	2.53	0.43750	D	0.996253	D;D;D;D	0.89917	0.972;0.972;1.0;0.977	P;B;D;B	0.70716	0.55;0.445;0.97;0.425	T	0.01259	-1.1403	10	0.87932	D	0	.	8.5873	0.33666	0.0855:0.1549:0.7596:0.0	.	487;390;378;521	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	H	521;487;378;390	ENSP00000358310:R521H;ENSP00000439894:R378H;ENSP00000440011:R390H	ENSP00000358310:R521H	R	+	2	0	ITGA10	144245273	0.991000	0.36638	0.986000	0.45419	0.999000	0.98932	4.102000	0.57776	0.587000	0.29643	0.655000	0.94253	CGT		0.547	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637		Missense_Mutation
FAM63A	55793	broad.mit.edu	37	1	150970610	150970610	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:150970610G>A	ENST00000361936.5	-	9	2075	c.1121C>T	c.(1120-1122)cCt>cTt	p.P374L	FAM63A_ENST00000361738.6_Missense_Mutation_p.P422L|FAM63A_ENST00000470877.1_5'Flank|FAM63A_ENST00000312210.5_Missense_Mutation_p.P232L|FAM63A_ENST00000493834.2_Missense_Mutation_p.P279L	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A	374						extracellular vesicular exosome (GO:0070062)		p.P374L(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTCTGCTCCAGGCCCCTTGCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	120.0	120.0					1																	150970610		2203	4300	6503	149237234	SO:0001583	missense	55793			BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.1121C>T	1.37:g.150970610G>A	ENSP00000354814:p.Pro374Leu	Unknown		x	x	x	149237234	B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	Missense_Mutation	SNP	ENST00000361936.5	37	CCDS976.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.31	1.901007	0.33535	.	.	ENSG00000143409	ENST00000312210;ENST00000361936;ENST00000361738;ENST00000493834	T;T;T;T	0.50813	0.79;0.77;0.73;0.81	4.36	2.38	0.29361	.	0.493926	0.22305	N	0.061802	T	0.18045	0.0433	L	0.43152	1.355	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.18561	0.022;0.007	T	0.21143	-1.0254	10	0.39692	T	0.17	-0.044	8.3583	0.32344	0.0:0.1637:0.6538:0.1824	.	422;374	Q8N5J2-3;Q8N5J2	.;FA63A_HUMAN	L	232;374;422;279	ENSP00000310923:P232L;ENSP00000354814:P374L;ENSP00000354669:P422L;ENSP00000437174:P279L	ENSP00000310923:P232L	P	-	2	0	FAM63A	149237234	0.975000	0.34042	0.003000	0.11579	0.965000	0.64279	4.102000	0.57776	0.422000	0.26005	0.555000	0.69702	CCT		0.562	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411753.1	NM_018379		Missense_Mutation
APCS	325	broad.mit.edu	37	1	159558225	159558225	+	Silent	SNP	G	G	A	rs151221908		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:159558225G>A	ENST00000255040.2	+	2	496	c.399G>A	c.(397-399)ttG>ttA	p.L133L		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	133	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)	p.L133L(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					GGACACCTTTGGTGAAAAAGG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	1											74.0	74.0	74.0					1																	159558225		2203	4300	6503	157824849	SO:0001819	synonymous_variant	325				CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.399G>A	1.37:g.159558225G>A		Unknown		x	x	x	157824849		Silent	SNP	ENST00000255040.2	37	CCDS1186.1	SNP	47	Broad																																																																																				0.498	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639		Silent
ARHGAP21	57584	broad.mit.edu	37	10	24884683	24884683	+	Silent	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:24884683G>C	ENST00000396432.2	-	19	4161	c.3675C>G	c.(3673-3675)tcC>tcG	p.S1225S	ARHGAP21_ENST00000493154.1_5'Flank|ARHGAP21_ENST00000320481.6_Silent_p.S1012S	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1224	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.S1224S(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						TTCTGAAGAAGGATTTTAGTA	0.368																																																1	Substitution - coding silent(1)	ovary(1)	10											65.0	64.0	65.0					10																	24884683		2203	4300	6503	24924689	SO:0001819	synonymous_variant	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3675C>G	10.37:g.24884683G>C		Unknown		x	x	x	24924689	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	ENST00000396432.2	37	CCDS7144.2	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	8.760	0.923449	0.18056	.	.	ENSG00000107863	ENST00000418033	.	.	.	5.27	-1.59	0.08453	.	.	.	.	.	T	0.42675	0.1213	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31586	-0.9938	4	.	.	.	.	3.5055	0.07689	0.1283:0.1038:0.4253:0.3426	.	.	.	.	V	39	.	.	L	-	1	0	ARHGAP21	24924689	0.995000	0.38212	0.998000	0.56505	0.991000	0.79684	0.253000	0.18296	0.029000	0.15352	-0.122000	0.15005	CTT		0.368	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824		Silent
CCDC6	8030	broad.mit.edu	37	10	61574446	61574446	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1367-01	TCGA-04-1367-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:61574446A>G	ENST00000263102.6	-	4	881	c.650T>C	c.(649-651)cTc>cCc	p.L217P		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	217	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)	p.L217P(1)	CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		CCTTTTCCAGAGGCGATTAAC	0.428			T	RET	NSCLC																																		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	1	Substitution - Missense(1)	ovary(1)	10											349.0	251.0	284.0					10																	61574446		2203	4300	6503	61244452	SO:0001583	missense	8030			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.650T>C	10.37:g.61574446A>G	ENSP00000263102:p.Leu217Pro	Somatic		x	x	x	61244452	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	27.2	4.810914	0.90707	.	.	ENSG00000108091	ENST00000263102	D	0.81579	-1.51	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.90089	0.6904	M	0.81614	2.55	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.91348	0.5102	10	0.87932	D	0	-12.6367	16.1937	0.82011	1.0:0.0:0.0:0.0	.	217	Q16204	CCDC6_HUMAN	P	217	ENSP00000263102:L217P	ENSP00000263102:L217P	L	-	2	0	CCDC6	61244452	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.932000	0.92897	2.220000	0.72140	0.533000	0.62120	CTC		0.428	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436		Missense_Mutation
CDK1	983	broad.mit.edu	37	10	62545444	62545444	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:62545444G>C	ENST00000395284.3	+	4	359	c.217G>C	c.(217-219)Gat>Cat	p.D73H	CDK1_ENST00000316629.4_Missense_Mutation_p.D73H|CDK1_ENST00000373809.2_Missense_Mutation_p.D73H|CDK1_ENST00000448257.2_Missense_Mutation_p.D73H	NM_001786.4	NP_001777.1	P06493	CDK1_HUMAN	cyclin-dependent kinase 1	73	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell aging (GO:0007569)|cell migration (GO:0016477)|cellular response to hydrogen peroxide (GO:0070301)|centrosome cycle (GO:0007098)|chromosome condensation (GO:0030261)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|pronuclear fusion (GO:0007344)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|Ras protein signal transduction (GO:0007265)|regulation of embryonic development (GO:0045995)|regulation of Schwann cell differentiation (GO:0014038)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to activity (GO:0014823)|response to amine (GO:0014075)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organic cyclic compound (GO:0014070)|response to toxic substance (GO:0009636)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|histone kinase activity (GO:0035173)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.D73H(2)		ovary(1)	1						GCTTATGCAGGATTCCAGGTT	0.368																																																2	Substitution - Missense(2)	ovary(2)	10											208.0	216.0	213.0					10																	62545444		2203	4300	6503	62215450	SO:0001583	missense				BC014563	CCDS7260.1, CCDS44408.1	10q21.2	2011-11-08	2009-12-16	2009-12-16	ENSG00000170312	ENSG00000170312		"""Cyclin-dependent kinases"""	1722	protein-coding gene	gene with protein product		116940	"""cell division cycle 2, G1 to S and G2 to M"""	CDC2		3553962, 19884882	Standard	NM_001786		Approved	CDC28A	uc001jld.3	P06493	OTTHUMG00000018290	ENST00000395284.3:c.217G>C	10.37:g.62545444G>C	ENSP00000378699:p.Asp73His	Somatic		x	x	x	62215450	A8K7C4|C9J497|O60764	Missense_Mutation	SNP	ENST00000395284.3	37	CCDS44408.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638807	0.67130	.	.	ENSG00000170312	ENST00000519078;ENST00000395284;ENST00000316629;ENST00000448257;ENST00000373809	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	6.04	6.04	0.98038	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.085303	0.85682	D	0.000000	T	0.74642	0.3743	L	0.58428	1.81	0.58432	D	0.999993	D;P;P;P	0.58970	0.984;0.831;0.86;0.86	P;P;P;P	0.57009	0.778;0.712;0.811;0.811	T	0.75107	-0.3434	10	0.87932	D	0	-16.0166	20.5948	0.99439	0.0:0.0:1.0:0.0	.	73;73;75;73	B7Z3D6;P06493-2;Q5H9N4;P06493	.;.;.;CDK1_HUMAN	H	73	ENSP00000378699:D73H;ENSP00000325970:D73H;ENSP00000397973:D73H;ENSP00000362915:D73H	ENSP00000325970:D73H	D	+	1	0	CDK1	62215450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.018000	0.88722	2.873000	0.98535	0.563000	0.77884	GAT		0.368	CDK1-007	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048211.2	NM_001786		Missense_Mutation
SUPV3L1	6832	broad.mit.edu	37	10	70951411	70951411	+	Splice_Site	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:70951411G>T	ENST00000359655.4	+	6	802	c.742G>T	c.(742-744)Ggt>Tgt	p.G248C	SUPV3L1_ENST00000483572.1_3'UTR	NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	248	Helicase ATP-binding.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.G248C(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTCTTTCTAGGGTGTGCCATG	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											157.0	139.0	145.0					10																	70951411		2203	4300	6503	70621417	SO:0001630	splice_region_variant	6832			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.742-1G>T	10.37:g.70951411G>T		Unknown		x	x	x	70621417	A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	37	CCDS7287.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287298	0.80803	.	.	ENSG00000156502	ENST00000359655	T	0.19250	2.16	5.66	5.66	0.87406	.	0.102292	0.64402	D	0.000003	T	0.61489	0.2351	H	0.98351	4.21	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.74275	-0.3718	9	.	.	.	0.0399	10.7998	0.46483	0.1148:0.0:0.8852:0.0	.	248	Q8IYB8	SUV3_HUMAN	C	248	ENSP00000352678:G248C	.	G	+	1	0	SUPV3L1	70621417	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.728000	0.84847	2.670000	0.90874	0.591000	0.81541	GGT		0.393	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171	Missense_Mutation	Missense_Mutation
PRF1	5551	broad.mit.edu	37	10	72357809	72357809	+	Nonstop_Mutation	SNP	T	T	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:72357809T>A	ENST00000441259.1	-	3	1828	c.1668A>T	c.(1666-1668)tgA>tgT	p.*556C	PRF1_ENST00000373209.2_Nonstop_Mutation_p.*556C	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	0					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)	p.*556C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CTCACTGTTCTCACCACACGG	0.587			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																													yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	1	Nonstop extension(1)	ovary(1)	10											51.0	53.0	52.0					10																	72357809		2203	4300	6503	72027815	SO:0001578	stop_lost	5551	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1668A>T	10.37:g.72357809T>A		Unknown		x	x	x	72027815	B2R6X4|Q59F57|Q86WX7	Nonstop_Mutation	SNP	ENST00000441259.1	37	CCDS7305.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	6.759	0.508972	0.12883	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	.	.	.	5.97	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7196	0.34432	0.0:0.085:0.0:0.915	.	.	.	.	C	556	.	.	X	-	3	0	PRF1	72027815	0.012000	0.17670	0.213000	0.23690	0.142000	0.21351	1.563000	0.36364	1.091000	0.41335	0.533000	0.62120	TGA		0.587	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041		Nonstop_Mutation
SYNPO2L	79933	broad.mit.edu	37	10	75407108	75407108	+	Missense_Mutation	SNP	G	G	C	rs371474010		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:75407108G>C	ENST00000394810.2	-	4	2451	c.2302C>G	c.(2302-2304)Cgt>Ggt	p.R768G	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.R544G	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	768	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)		p.R544G(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CTGTCCGCACGGCTCTGCCGC	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	98.0	95.0					10																	75407108		2203	4300	6503	75077114	SO:0001583	missense	79933			AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.2302C>G	10.37:g.75407108G>C	ENSP00000378289:p.Arg768Gly	Unknown		x	x	x	75077114	A5PKV9|Q68A20	Missense_Mutation	SNP	ENST00000394810.2	37	CCDS44438.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142810	0.57044	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.56103	0.48;0.7	4.72	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	M	0.80183	2.485	0.48341	D	0.999639	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75227	-0.3392	10	0.51188	T	0.08	-8.5017	14.3387	0.66608	0.0:0.0:0.8515:0.1485	.	768;544	Q9H987;Q9H987-2	SYP2L_HUMAN;.	G	544;768	ENSP00000361964:R544G;ENSP00000378289:R768G	ENSP00000361964:R544G	R	-	1	0	SYNPO2L	75077114	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.030000	0.49720	2.443000	0.82685	0.313000	0.20887	CGT		0.617	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316562.2	NM_024875		Missense_Mutation
ZNF503	84858	broad.mit.edu	37	10	77158576	77158576	+	Silent	SNP	T	T	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:77158576T>G	ENST00000372524.4	-	2	2358	c.1872A>C	c.(1870-1872)ggA>ggC	p.G624G	ZNF503-AS2_ENST00000466942.2_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Silent_p.G624G	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	624					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G624G(1)		lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					AGTAGTACGGTCCGGTGGCGG	0.726																																																1	Substitution - coding silent(1)	ovary(1)	10											10.0	11.0	11.0					10																	77158576		2191	4268	6459	76828582	SO:0001819	synonymous_variant	84858			AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1872A>C	10.37:g.77158576T>G		Unknown		x	x	x	76828582	Q8NAC5|Q96E25|Q96IJ0	Silent	SNP	ENST00000372524.4	37	CCDS7350.1	SNP	58	Broad																																																																																				0.726	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772		Silent
COX15	1355	broad.mit.edu	37	10	101487250	101487250	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr10:101487250C>T	ENST00000016171.5	-	3	393	c.343G>A	c.(343-345)Gag>Aag	p.E115K	CUTC_ENST00000493385.1_Intron|COX15_ENST00000370483.5_Missense_Mutation_p.E115K			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	115					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)	p.E115K(1)		endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		TCCCATTCCTCTTGGCTTGTA	0.393																																																1	Substitution - Missense(1)	ovary(1)	10											198.0	195.0	196.0					10																	101487250		2203	4300	6503	101477240	SO:0001583	missense	1355			AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.343G>A	10.37:g.101487250C>T	ENSP00000016171:p.Glu115Lys	Somatic		x	x	x	101477240	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	37	CCDS7482.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071313	0.55646	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	D;D	0.83250	-1.7;-1.7	4.49	3.56	0.40772	Peptidase cysteine/serine, trypsin-like (1);	0.227915	0.42964	D	0.000629	T	0.79015	0.4375	L	0.51422	1.61	0.46356	D	0.999	B;B	0.15719	0.014;0.002	B;B	0.22152	0.037;0.038	T	0.75116	-0.3431	10	0.39692	T	0.17	-9.5272	14.0275	0.64594	0.0:0.6396:0.3604:0.0	.	115;115	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	K	115	ENSP00000359514:E115K;ENSP00000016171:E115K	ENSP00000016171:E115K	E	-	1	0	COX15	101477240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.500000	0.60387	1.219000	0.43474	0.563000	0.77884	GAG		0.393	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870		Missense_Mutation
INSC	387755	broad.mit.edu	37	11	15134029	15134029	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr11:15134029C>T	ENST00000379554.3	+	1	60	c.14C>T	c.(13-15)cCt>cTt	p.P5L	INSC_ENST00000424273.1_5'Flank|INSC_ENST00000379556.3_5'Flank	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	5					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.P5L(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						AGACGGCCCCCTGGCAATGGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											49.0	60.0	57.0					11																	15134029		1950	4124	6074	15090605	SO:0001583	missense	387755			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.14C>T	11.37:g.15134029C>T	ENSP00000368872:p.Pro5Leu	Unknown		x	x	x	15090605	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369799	0.24771	.	.	ENSG00000188487	ENST00000379554	T	0.36157	1.27	4.07	1.2	0.21068	.	.	.	.	.	T	0.17916	0.0430	N	0.08118	0	0.25451	N	0.988001	B	0.02656	0.0	B	0.06405	0.002	T	0.20438	-1.0275	9	0.87932	D	0	-0.4928	5.9383	0.19179	0.0:0.6721:0.0:0.3279	.	5	Q1MX18	INSC_HUMAN	L	5	ENSP00000368872:P5L	ENSP00000368872:P5L	P	+	2	0	INSC	15090605	0.373000	0.25073	0.268000	0.24571	0.051000	0.14879	1.663000	0.37429	0.287000	0.22375	0.561000	0.74099	CCT		0.622	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		Missense_Mutation
SDHAF2	54949	broad.mit.edu	37	11	61205108	61205108	+	Silent	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr11:61205108G>T	ENST00000543265.1	+	2	51	c.48G>T	c.(46-48)ctG>ctT	p.L16L	RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000534878.1_Silent_p.L16L|SDHAF2_ENST00000537782.1_Silent_p.L16L|RP11-286N22.8_ENST00000543044.1_Silent_p.L4L|SDHAF2_ENST00000301761.2_Silent_p.L16L|SDHAF2_ENST00000542074.1_Intron					succinate dehydrogenase complex assembly factor 2									p.L16L(1)		large_intestine(3)|lung(4)|ovary(2)	9						TGCTTGCTCTGTCAAGGCACA	0.413																																																1	Substitution - coding silent(1)	ovary(1)	11											184.0	181.0	182.0					11																	61205108		2202	4299	6501	60961684	SO:0001819	synonymous_variant	54949			AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.48G>T	11.37:g.61205108G>T		Unknown		x	x	x	60961684		Silent	SNP	ENST00000543265.1	37		SNP	48	Broad																																																																																				0.413	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398484.1	NM_017841		Silent
LRP5	4041	broad.mit.edu	37	11	68154140	68154140	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr11:68154140C>G	ENST00000294304.7	+	6	1478	c.1372C>G	c.(1372-1374)Ctg>Gtg	p.L458V		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	458	Beta-propeller 2.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.L458V(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTCGGAGGACCTGGACGAGCC	0.697																																																1	Substitution - Missense(1)	ovary(1)	11											35.0	32.0	33.0					11																	68154140		2200	4292	6492	67910716	SO:0001583	missense	4041			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1372C>G	11.37:g.68154140C>G	ENSP00000294304:p.Leu458Val	Unknown		x	x	x	67910716	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848591	0.71603	.	.	ENSG00000162337	ENST00000294304	D	0.97959	-4.63	3.94	3.0	0.34707	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.38381	U	0.001708	D	0.97455	0.9167	M	0.74647	2.275	0.54753	D	0.999989	P	0.52316	0.952	P	0.50754	0.649	D	0.97183	0.9852	10	0.87932	D	0	.	13.0459	0.58925	0.1624:0.8376:0.0:0.0	.	458	O75197	LRP5_HUMAN	V	458	ENSP00000294304:L458V	ENSP00000294304:L458V	L	+	1	2	LRP5	67910716	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	2.333000	0.43912	0.997000	0.38969	0.455000	0.32223	CTG		0.697	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		Missense_Mutation
KIRREL3	84623	broad.mit.edu	37	11	126316769	126316769	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr11:126316769A>T	ENST00000525144.2	-	9	1259	c.1010T>A	c.(1009-1011)aTg>aAg	p.M337K	KIRREL3_ENST00000525704.2_Missense_Mutation_p.M337K|KIRREL3_ENST00000529097.2_Missense_Mutation_p.M337K	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	337	Ig-like C2-type 4.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M296K(1)		central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TTCTGTGGTCATCCGGGGCCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											37.0	41.0	40.0					11																	126316769		2086	4193	6279	125821979	SO:0001583	missense	84623			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1010T>A	11.37:g.126316769A>T	ENSP00000435466:p.Met337Lys	Unknown		x	x	x	125821979	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	19.75	3.885198	0.72410	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.67698	-0.28;-0.28;-0.28	4.73	4.73	0.59995	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.094278	0.64402	D	0.000001	T	0.63792	0.2541	L	0.43152	1.355	0.80722	D	1	P;B;B	0.51933	0.949;0.369;0.409	P;B;B	0.45881	0.496;0.222;0.216	T	0.69320	-0.5176	10	0.87932	D	0	.	13.8687	0.63605	1.0:0.0:0.0:0.0	.	337;337;337	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	K	337	ENSP00000435466:M337K;ENSP00000434081:M337K;ENSP00000435094:M337K	ENSP00000435466:M337K	M	-	2	0	KIRREL3	125821979	1.000000	0.71417	0.853000	0.33588	0.791000	0.44710	9.297000	0.96120	1.753000	0.51906	0.247000	0.18012	ATG		0.592	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531		Missense_Mutation
TAS2R50	259296	broad.mit.edu	37	12	11139426	11139426	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr12:11139426G>C	ENST00000506868.1	-	1	85	c.34C>G	c.(34-36)Cta>Gta	p.L12V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	12					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)	p.L12V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						ACCATTATTAGAATTGAAAAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											31.0	37.0	35.0					12																	11139426		2181	4285	6466	11030693	SO:0001583	missense	259296			AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.34C>G	12.37:g.11139426G>C	ENSP00000424040:p.Leu12Val	Unknown		x	x	x	11030693	P59545|Q2M255|Q645Y0	Missense_Mutation	SNP	ENST00000506868.1	37	CCDS8638.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	1.746	-0.490519	0.04322	.	.	ENSG00000212126	ENST00000506868	T	0.00669	5.9	2.49	0.271	0.15640	.	1.413770	0.06301	U	0.700907	T	0.01061	0.0035	L	0.55990	1.75	0.09310	N	1	B	0.30889	0.299	B	0.34824	0.19	T	0.47935	-0.9078	10	0.27082	T	0.32	.	2.3661	0.04319	0.3018:0.0:0.4596:0.2387	.	12	P59544	T2R50_HUMAN	V	12	ENSP00000424040:L12V	ENSP00000424040:L12V	L	-	1	2	TAS2R50	11030693	0.000000	0.05858	0.001000	0.08648	0.045000	0.14185	-2.268000	0.01169	0.251000	0.21505	0.313000	0.20887	CTA		0.318	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	NM_176890		Missense_Mutation
EEA1	8411	broad.mit.edu	37	12	93192686	93192686	+	Silent	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr12:93192686T>C	ENST00000322349.8	-	21	3213	c.2949A>G	c.(2947-2949)aaA>aaG	p.K983K		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	983	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.K983K(1)		endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						AAACAGCAATTTTAAGCTCTC	0.308																																																1	Substitution - coding silent(1)	ovary(1)	12											117.0	111.0	113.0					12																	93192686		2202	4299	6501	91716817	SO:0001819	synonymous_variant	8411			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2949A>G	12.37:g.93192686T>C		Unknown		x	x	x	91716817	Q14221	Silent	SNP	ENST00000322349.8	37	CCDS31874.1	SNP	64	Broad																																																																																				0.308	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566		Silent
CUX2	23316	broad.mit.edu	37	12	111776155	111776155	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr12:111776155C>T	ENST00000261726.6	+	20	3416	c.3262C>T	c.(3262-3264)Cgg>Tgg	p.R1088W	RNA5SP373_ENST00000517271.1_RNA	NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1088					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.R1088W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCTGCTGTCCCGGCCCAAACC	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											49.0	56.0	53.0					12																	111776155		1981	4169	6150	110260538	SO:0001583	missense	23316			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.3262C>T	12.37:g.111776155C>T	ENSP00000261726:p.Arg1088Trp	Unknown		x	x	x	110260538	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418494	0.83559	.	.	ENSG00000111249	ENST00000261726	T	0.54866	0.55	5.32	3.43	0.39272	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.68201	0.2975	M	0.68317	2.08	0.80722	D	1	D	0.69078	0.997	D	0.68353	0.957	T	0.70608	-0.4825	10	0.87932	D	0	-31.5786	13.4294	0.61046	0.6091:0.3909:0.0:0.0	.	1088	O14529	CUX2_HUMAN	W	1088	ENSP00000261726:R1088W	ENSP00000261726:R1088W	R	+	1	2	CUX2	110260538	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.689000	0.61723	0.571000	0.29365	0.655000	0.94253	CGG		0.617	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267		Missense_Mutation
KNTC1	9735	broad.mit.edu	37	12	123057757	123057757	+	Silent	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr12:123057757C>A	ENST00000333479.7	+	26	2385	c.2208C>A	c.(2206-2208)atC>atA	p.I736I	KNTC1_ENST00000450485.2_Silent_p.I699I	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	736					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.I736I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTCCCTCCATCTTAGAGAAGT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	12											145.0	142.0	143.0					12																	123057757		1832	4085	5917	121623710	SO:0001819	synonymous_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2208C>A	12.37:g.123057757C>A		Unknown		x	x	x	121623710	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	37	CCDS45002.1	SNP	32	Broad																																																																																				0.388	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Silent
AMER2	219287	broad.mit.edu	37	13	25745687	25745687	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr13:25745687C>A	ENST00000515384.1	-	1	738	c.71G>T	c.(70-72)gGg>gTg	p.G24V	AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000357816.2_Missense_Mutation_p.G24V|AMER2_ENST00000381853.3_Missense_Mutation_p.G24V			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	24	Gly-rich.				ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G24V(1)									CCTGCAGACCCCCACGGACGC	0.736																																																1	Substitution - Missense(1)	ovary(1)	13											6.0	7.0	7.0					13																	25745687		1986	4091	6077	24643687	SO:0001583	missense	219287			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.71G>T	13.37:g.25745687C>A	ENSP00000426528:p.Gly24Val	Unknown		x	x	x	24643687	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	CCDS53859.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657879	0.29425	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.26810	1.74;1.74;1.71	3.42	3.42	0.39159	.	0.207811	0.23914	N	0.043304	T	0.37598	0.1009	L	0.47716	1.5	0.54753	D	0.999989	D;D	0.67145	0.994;0.996	P;D	0.65573	0.865;0.936	T	0.15867	-1.0422	10	0.87932	D	0	-12.0497	8.2622	0.31793	0.0:0.8699:0.0:0.1301	.	24;24	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	V	24	ENSP00000350469:G24V;ENSP00000371277:G24V;ENSP00000426528:G24V	ENSP00000350469:G24V	G	-	2	0	FAM123A	24643687	0.595000	0.26857	1.000000	0.80357	0.314000	0.28054	1.149000	0.31626	1.890000	0.54733	0.462000	0.41574	GGG		0.736	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		Missense_Mutation
ATP11A	23250	broad.mit.edu	37	13	113473658	113473658	+	Missense_Mutation	SNP	A	A	G	rs575639303		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr13:113473658A>G	ENST00000487903.1	+	7	699	c.611A>G	c.(610-612)gAg>gGg	p.E204G	ATP11A_ENST00000375630.2_Missense_Mutation_p.E204G|ATP11A_ENST00000283558.8_Missense_Mutation_p.E204G|ATP11A_ENST00000375645.3_Missense_Mutation_p.E204G			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	204					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E204G(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TTCCACACAGAGGAGGATATC	0.537													A|||	1	0.000199681	0.0	0.0	5008	,	,		17824	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	13											116.0	104.0	108.0					13																	113473658		2203	4300	6503	112521659	SO:0001583	missense	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.611A>G	13.37:g.113473658A>G	ENSP00000420387:p.Glu204Gly	Unknown		x	x	x	112521659	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	SNP	11	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.601|4.601	0.111680|0.111680	0.08831|0.08831	.|.	.|.	ENSG00000068650|ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558|ENST00000418678	T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83|.	5.54|5.54	1.38|1.38	0.22167|0.22167	ATPase, P-type, ATPase-associated domain (1);|.	0.155235|.	0.56097|.	D|.	0.000030|.	T|T	0.65080|0.65080	0.2657|0.2657	L|L	0.56280|0.56280	1.765|1.765	0.48395|0.48395	D|D	0.999645|0.999645	B;B;B|.	0.30973|.	0.302;0.013;0.048|.	B;B;B|.	0.39935|.	0.314;0.024;0.158|.	T|T	0.61695|0.61695	-0.7010|-0.7010	10|5	0.25751|.	T|.	0.34|.	.|.	13.025|13.025	0.58810|0.58810	0.6147:0.3853:0.0:0.0|0.6147:0.3853:0.0:0.0	.|.	204;204;204|.	E9PCW5;E9PEJ6;P98196|.	.;.;AT11A_HUMAN|.	G|G	204|179	ENSP00000420387:E204G;ENSP00000364781:E204G;ENSP00000364796:E204G;ENSP00000283558:E204G|.	ENSP00000283558:E204G|.	E|R	+|+	2|1	0|2	ATP11A|ATP11A	112521659|112521659	1.000000|1.000000	0.71417|0.71417	0.016000|0.016000	0.15963|0.15963	0.013000|0.013000	0.08279|0.08279	4.333000|4.333000	0.59285|0.59285	0.346000|0.346000	0.23899|0.23899	-0.313000|-0.313000	0.08912|0.08912	GAG|AGG		0.537	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205		Missense_Mutation
HECTD1	25831	broad.mit.edu	37	14	31583260	31583260	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr14:31583260G>C	ENST00000399332.1	-	32	6167	c.5679C>G	c.(5677-5679)tgC>tgG	p.C1893W	HECTD1_ENST00000553700.1_Missense_Mutation_p.C1893W	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1893					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.C1893W(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CTATAGACCAGCAACCCTACA	0.413																																																1	Substitution - Missense(1)	ovary(1)	14											88.0	77.0	81.0					14																	31583260		1907	4126	6033	30653011	SO:0001583	missense	25831			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.5679C>G	14.37:g.31583260G>C	ENSP00000382269:p.Cys1893Trp	Unknown		x	x	x	30653011	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	SNP	34	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.95|14.95	2.688510|2.688510	0.48097|0.48097	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000554882|ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	.|T;T;T	.|0.09163	.|3.01;3.01;3.01	5.69|5.69	4.75|4.75	0.60458|0.60458	.|.	.|0.212494	.|0.36167	.|U	.|0.002747	T|T	0.12092|0.12092	0.0294|0.0294	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;D	.|0.65815	.|0.995;0.995	.|D;D	.|0.70935	.|0.971;0.971	T|T	0.29671|0.29671	-1.0004|-1.0004	5|10	.|0.37606	.|T	.|0.19	-6.1603|-6.1603	6.3401|6.3401	0.21319|0.21319	0.2454:0.0:0.7546:0.0|0.2454:0.0:0.7546:0.0	.|.	.|1893;1893	.|D3DS86;Q9ULT8	.|.;HECD1_HUMAN	G|W	259|1893;1895;1893;1320	.|ENSP00000450697:C1893W;ENSP00000382269:C1893W;ENSP00000451860:C1320W	.|ENSP00000261312:C1895W	A|C	-|-	2|3	0|2	HECTD1|HECTD1	30653011|30653011	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.255000|5.255000	0.65462|0.65462	1.243000|1.243000	0.43853|0.43853	0.650000|0.650000	0.86243|0.86243	GCT|TGC		0.413	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			Missense_Mutation
EIF2S1	1965	broad.mit.edu	37	14	67831487	67831487	+	Start_Codon_SNP	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr14:67831487G>T	ENST00000256383.4	+	2	464	c.3G>T	c.(1-3)atG>atT	p.M1I	EIF2S1_ENST00000466499.2_Start_Codon_SNP_p.M1I	NM_004094.4	NP_004085.1	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa	1					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|protein autophosphorylation (GO:0046777)|regulation of translational initiation in response to stress (GO:0043558)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.M1I(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		attgcagaatgccgggtctaa	0.348																																																1	Substitution - Missense(1)	ovary(1)	14											58.0	58.0	58.0					14																	67831487		2203	4300	6503	66901240	SO:0001582	initiator_codon_variant	1965			J02645	CCDS9781.1	14q21.3	2011-01-07	2002-08-29		ENSG00000134001	ENSG00000134001			3265	protein-coding gene	gene with protein product		603907	"""eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kD )"""	EIF2		2948954	Standard	NM_004094		Approved	EIF-2alpha, EIF2A	uc001xjg.3	P05198	OTTHUMG00000029800	ENST00000256383.4:c.3G>T	14.37:g.67831487G>T	ENSP00000256383:p.Met1Ile	Unknown		x	x	x	66901240		Missense_Mutation	SNP	ENST00000256383.4	37	CCDS9781.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.199621	0.94997	.	.	ENSG00000134001	ENST00000256383;ENST00000437108;ENST00000557310;ENST00000466499	.	.	.	5.93	5.93	0.95920	.	0.035673	0.85682	D	0.000000	D	0.84014	0.5379	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84854	0.0815	8	0.87932	D	0	-20.4652	20.3465	0.98790	0.0:0.0:1.0:0.0	.	1	P05198	IF2A_HUMAN	I	1	.	ENSP00000256383:M1I	M	+	3	0	EIF2S1	66901240	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.798000	0.96311	0.655000	0.94253	ATG		0.348	EIF2S1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074342.3	NM_004094	Missense_Mutation	Missense_Mutation
CCDC88C	440193	broad.mit.edu	37	14	91755617	91755617	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr14:91755617G>A	ENST00000389857.6	-	25	4359	c.4273C>T	c.(4273-4275)Cgc>Tgc	p.R1425C		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1425					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.R1425C(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GATTTTAAGCGTTCCCTCGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	14											228.0	237.0	234.0					14																	91755617		1957	4150	6107	90825370	SO:0001583	missense	440193				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4273C>T	14.37:g.91755617G>A	ENSP00000374507:p.Arg1425Cys	Unknown		x	x	x	90825370	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076392	0.55753	.	.	ENSG00000015133	ENST00000389857	T	0.19669	2.13	5.44	5.44	0.79542	.	0.155625	0.29752	U	0.011285	T	0.44329	0.1288	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.37454	-0.9705	10	0.87932	D	0	-26.4566	12.8708	0.57965	0.0:0.0:0.7152:0.2848	.	1425	Q9P219	DAPLE_HUMAN	C	1425	ENSP00000374507:R1425C	ENSP00000374507:R1425C	R	-	1	0	CCDC88C	90825370	0.998000	0.40836	0.971000	0.41717	0.391000	0.30476	3.049000	0.49869	2.541000	0.85698	0.462000	0.41574	CGC		0.557	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		Missense_Mutation
DISP2	85455	broad.mit.edu	37	15	40661535	40661535	+	Silent	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr15:40661535C>A	ENST00000267889.3	+	8	3309	c.3222C>A	c.(3220-3222)ggC>ggA	p.G1074G	LINC00594_ENST00000561261.1_lincRNA|RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1074					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.G1074G(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TTGCGGCAGGCGTGCTCATGC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	15											44.0	43.0	43.0					15																	40661535		2202	4298	6500	38448827	SO:0001819	synonymous_variant	85455			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.3222C>A	15.37:g.40661535C>A		Unknown		x	x	x	38448827	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1	SNP	27	Broad																																																																																				0.622	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510		Silent
VPS39	23339	broad.mit.edu	37	15	42480024	42480024	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr15:42480024T>C	ENST00000348544.4	-	7	405	c.406A>G	c.(406-408)Atg>Gtg	p.M136V	VPS39_ENST00000318006.5_Missense_Mutation_p.M125V			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	136	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)	p.M125V(1)		breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		GCCACACACATCCGTAACACC	0.453																																																1	Substitution - Missense(1)	ovary(1)	15											193.0	191.0	192.0					15																	42480024		2203	4299	6502	40267316	SO:0001583	missense	23339			AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.406A>G	15.37:g.42480024T>C	ENSP00000335193:p.Met136Val	Unknown		x	x	x	40267316	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	37	CCDS10083.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	14.23	2.472857	0.43942	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.04454	3.62;3.62	4.95	2.38	0.29361	Citron-like (2);	0.082226	0.85682	D	0.000000	T	0.03783	0.0107	L	0.32530	0.975	0.58432	D	0.999997	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.44937	-0.9295	10	0.22109	T	0.4	-19.873	7.8683	0.29549	0.1366:0.0:0.1428:0.7207	.	136;125	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	V	125;136	ENSP00000326534:M125V;ENSP00000335193:M136V	ENSP00000326534:M125V	M	-	1	0	VPS39	40267316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.786000	0.55431	0.805000	0.34159	0.533000	0.62120	ATG		0.453	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289		Missense_Mutation
DUOX1	53905	broad.mit.edu	37	15	45444641	45444641	+	Silent	SNP	C	C	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr15:45444641C>G	ENST00000321429.4	+	26	3758	c.3351C>G	c.(3349-3351)ctC>ctG	p.L1117L	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Silent_p.L1117L|DUOX1_ENST00000561166.1_Silent_p.L763L	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1117	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.L1117L(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		AAACCTTCCTCAACCGCTACG	0.612																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	15											207.0	160.0	176.0					15																	45444641		2198	4298	6496	43231933	SO:0001819	synonymous_variant	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3351C>G	15.37:g.45444641C>G		Unknown		x	x	x	43231933	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	CCDS32221.1	SNP	29	Broad																																																																																				0.612	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		Silent
DNAJA4	55466	broad.mit.edu	37	15	78557132	78557132	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr15:78557132C>A	ENST00000394852.3	+	1	217	c.27C>A	c.(25-27)gaC>gaA	p.D9E	DNAJA4_ENST00000343789.3_Missense_Mutation_p.D9E|DNAJA4_ENST00000489435.2_Missense_Mutation_p.D38E|DNAJA4_ENST00000394855.3_Missense_Mutation_p.D38E|DNAJA4_ENST00000446172.2_5'Flank|RP11-762H8.3_ENST00000559954.1_RNA|RP11-762H8.3_ENST00000558971.1_RNA	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	9	J.				negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.D9E(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						AGTACTATGACATCCTGGGCG	0.687																																																1	Substitution - Missense(1)	ovary(1)	15											33.0	30.0	31.0					15																	78557132		2196	4292	6488	76344187	SO:0001583	missense	55466			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.27C>A	15.37:g.78557132C>A	ENSP00000378321:p.Asp9Glu	Unknown		x	x	x	76344187	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	37	CCDS45316.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557694	0.27827	.	.	ENSG00000140403	ENST00000394855;ENST00000489435;ENST00000343789;ENST00000394852	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.01	0.59	0.17458	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.41073	0.1143	N	0.01209	-0.955	0.80722	D	1	P;P	0.46142	0.873;0.852	P;P	0.48227	0.571;0.559	T	0.23048	-1.0199	10	0.18710	T	0.47	-11.7156	5.4279	0.16436	0.0:0.4328:0.1376:0.4296	.	9;38	Q8WW22;Q8WW22-2	DNJA4_HUMAN;.	E	38;38;9;9	ENSP00000378324:D38E;ENSP00000438263:D38E;ENSP00000339581:D9E;ENSP00000378321:D9E	ENSP00000339581:D9E	D	+	3	2	DNAJA4	76344187	0.999000	0.42202	0.006000	0.13384	0.033000	0.12548	0.905000	0.28504	-0.156000	0.11079	0.557000	0.71058	GAC		0.687	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602		Missense_Mutation
NR2F2	7026	broad.mit.edu	37	15	96875659	96875659	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr15:96875659A>T	ENST00000394166.3	+	1	1714	c.325A>T	c.(325-327)Agg>Tgg	p.R109W	NR2F2_ENST00000394171.2_5'Flank|NR2F2_ENST00000421109.2_Intron|MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000453270.2_5'Flank	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	109					anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R109W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			CAGCGTGCGGAGGAACCTGAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	15											82.0	68.0	72.0					15																	96875659		2197	4298	6495	94676663	SO:0001583	missense	7026			M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.325A>T	15.37:g.96875659A>T	ENSP00000377721:p.Arg109Trp	Unknown		x	x	x	94676663	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	37	CCDS10375.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	20.9	4.061236	0.76187	.	.	ENSG00000185551	ENST00000394166	D	0.97480	-4.4	4.61	4.61	0.57282	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.64402	D	0.000001	D	0.98012	0.9345	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98391	1.0563	10	0.87932	D	0	.	9.249	0.37543	0.8178:0.1822:0.0:0.0	.	109	P24468	COT2_HUMAN	W	109	ENSP00000377721:R109W	ENSP00000377721:R109W	R	+	1	2	NR2F2	94676663	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.194000	0.51005	1.705000	0.51264	0.379000	0.24179	AGG		0.602	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1			Missense_Mutation
MSLNL	401827	broad.mit.edu	37	16	830433	830433	+	Intron	SNP	G	G	T	rs202228997		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:830433G>T	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Missense_Mutation_p.R190S			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R190S(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						CAGTGTGCACGGGTAGGTGAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											213.0	189.0	197.0					16																	830433		2178	4274	6452	770434	SO:0001627	intron_variant	401827					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-271C>A	16.37:g.830433G>T		Unknown		x	x	x	770434		Missense_Mutation	SNP	ENST00000442466.1	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	7.806	0.714594	0.15306	.	.	ENSG00000162006	ENST00000293892	T	0.18338	2.22	1.33	0.33	0.15929	.	.	.	.	.	T	0.10551	0.0258	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35351	-0.9792	5	.	.	.	.	3.4078	0.07347	0.2778:0.0:0.7222:0.0	.	.	.	.	S	190	ENSP00000293892:R190S	.	R	-	1	0	MSLNL	770434	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-4.195000	0.00276	0.125000	0.18397	0.411000	0.27672	CGT		0.567	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001025190		Missense_Mutation
PRSS21	10942	broad.mit.edu	37	16	2871383	2871383	+	Missense_Mutation	SNP	C	C	G	rs368336428		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:2871383C>G	ENST00000005995.3	+	6	764	c.722C>G	c.(721-723)cCc>cGc	p.P241R	PRSS21_ENST00000575739.1_Intron|PRSS21_ENST00000455114.1_Missense_Mutation_p.P239R|PRSS21_ENST00000450020.3_Missense_Mutation_p.P227R			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	241	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.P241R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						TCAGGTGGACCCTTGGCCTGT	0.627																																																1	Substitution - Missense(1)	ovary(1)	16											54.0	59.0	58.0					16																	2871383		2198	4300	6498	2811384	SO:0001583	missense	10942			AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.722C>G	16.37:g.2871383C>G	ENSP00000005995:p.Pro241Arg	Unknown		x	x	x	2811384	Q9NS34|Q9P2V6	Missense_Mutation	SNP	ENST00000005995.3	37	CCDS10478.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	22.4	4.287151	0.80803	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	D;D;D	0.94497	-3.44;-3.44;-3.44	3.96	3.96	0.45880	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.98557	0.9518	H	0.99668	4.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.98688	1.0695	9	0.87932	D	0	.	13.6181	0.62121	0.0:1.0:0.0:0.0	.	241;239;227	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	R	239;227;241	ENSP00000400632:P239R;ENSP00000407741:P227R;ENSP00000005995:P241R	ENSP00000005995:P241R	P	+	2	0	PRSS21	2811384	1.000000	0.71417	0.778000	0.31720	0.527000	0.34593	6.624000	0.74243	2.065000	0.61736	0.567000	0.79289	CCC		0.627	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799		Missense_Mutation
DNAH3	55567	broad.mit.edu	37	16	20999161	20999161	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:20999161T>C	ENST00000261383.3	-	46	6735	c.6736A>G	c.(6736-6738)Atg>Gtg	p.M2246V	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2246	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.M2246V(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGGACCAGCATCTTTCCGTAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	16											114.0	92.0	100.0					16																	20999161		2201	4300	6501	20906662	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.6736A>G	16.37:g.20999161T>C	ENSP00000261383:p.Met2246Val	Unknown		x	x	x	20906662	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	8.669	0.902352	0.17760	.	.	ENSG00000158486	ENST00000261383	T	0.34472	1.36	5.18	4.08	0.47627	.	0.283692	0.37095	N	0.002260	T	0.21962	0.0529	N	0.25332	0.735	0.80722	D	1	B	0.14012	0.009	B	0.12156	0.007	T	0.06075	-1.0847	10	0.16896	T	0.51	.	7.6179	0.28169	0.14:0.0:0.1466:0.7133	.	2246	Q8TD57	DYH3_HUMAN	V	2246	ENSP00000261383:M2246V	ENSP00000261383:M2246V	M	-	1	0	DNAH3	20906662	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	2.812000	0.47994	0.804000	0.34136	0.477000	0.44152	ATG		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
SLC5A11	115584	broad.mit.edu	37	16	24902190	24902190	+	Splice_Site	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:24902190G>T	ENST00000347898.3	+	9	1287	c.665G>T	c.(664-666)aGt>aTt	p.S222I	SLC5A11_ENST00000567758.1_Splice_Site_p.S187I|SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000545376.1_Splice_Site_p.S152I|SLC5A11_ENST00000539472.1_Splice_Site_p.S158I|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000424767.2_Splice_Site_p.S187I|SLC5A11_ENST00000565769.1_Splice_Site_p.S158I|SLC5A11_ENST00000568579.1_Splice_Site_p.S152I	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.S222I(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TGAATTCTAGGTTTTGCCGCG	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											113.0	117.0	116.0					16																	24902190		2197	4300	6497	24809691	SO:0001630	splice_region_variant	115584			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.665-1G>T	16.37:g.24902190G>T		Unknown		x	x	x	24809691		Missense_Mutation	SNP	ENST00000347898.3	37	CCDS10625.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099028	0.76870	.	.	ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	5.9	5.9	0.94986	.	0.037548	0.85682	D	0.000000	D	0.95736	0.8613	M	0.91972	3.26	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.79784	0.993;0.984;0.973	D	0.96052	0.9032	9	.	.	.	.	17.7564	0.88450	0.0:0.0:1.0:0.0	.	152;187;222	B7Z329;Q8WWX8-2;Q8WWX8	.;.;SC5AB_HUMAN	I	222;187;152;158	ENSP00000289932:S222I;ENSP00000416782:S187I;ENSP00000441384:S152I;ENSP00000441018:S158I	.	S	+	2	0	SLC5A11	24809691	1.000000	0.71417	0.899000	0.35326	0.325000	0.28411	6.311000	0.72835	2.802000	0.96397	0.650000	0.86243	AGT		0.542	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	Missense_Mutation	Missense_Mutation
CES3	23491	broad.mit.edu	37	16	67000683	67000683	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:67000683A>G	ENST00000303334.4	+	8	1048	c.977A>G	c.(976-978)aAg>aGg	p.K326R	CES3_ENST00000543856.1_5'Flank|CES3_ENST00000394037.1_Missense_Mutation_p.K326R	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	326						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)	p.K326R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AAAAGCCCCAAGGAACTCCTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											148.0	149.0	149.0					16																	67000683		2200	4300	6500	65558184	SO:0001583	missense	23491			AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.977A>G	16.37:g.67000683A>G	ENSP00000304782:p.Lys326Arg	Unknown		x	x	x	65558184	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543567	0.45280	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.66995	-0.24;-0.24	3.97	1.71	0.24356	Carboxylesterase, type B (1);	1.181010	0.06374	N	0.714123	T	0.50103	0.1596	N	0.14661	0.345	0.26159	N	0.980023	B	0.15141	0.012	B	0.22152	0.038	T	0.43491	-0.9388	10	0.52906	T	0.07	.	6.6997	0.23219	0.7923:0.0:0.2077:0.0	.	326	Q6UWW8	EST3_HUMAN	R	326	ENSP00000304782:K326R;ENSP00000377602:K326R	ENSP00000304782:K326R	K	+	2	0	CES3	65558184	0.181000	0.23161	0.099000	0.21106	0.535000	0.34838	3.412000	0.52679	0.147000	0.19030	0.524000	0.50904	AAG		0.537	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922		Missense_Mutation
TXNL4B	54957	broad.mit.edu	37	16	72120641	72120641	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:72120641C>A	ENST00000268483.3	-	4	666	c.345G>T	c.(343-345)ttG>ttT	p.L115F	RP11-384M15.3_ENST00000561827.1_RNA|TXNL4B_ENST00000426362.2_Missense_Mutation_p.L115F|TXNL4B_ENST00000423037.1_Missense_Mutation_p.L115F	NM_001142318.1|NM_017853.2	NP_001135790.1|NP_060323.1	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	115					mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)		p.L115F(1)		cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)	8						TTACTTCAATCAAATCTATGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	16											106.0	99.0	101.0					16																	72120641		2198	4300	6498	70678142	SO:0001583	missense	54957			BC009646	CCDS10906.1	16q22.2	2012-11-19			ENSG00000140830	ENSG00000140830			26041	protein-coding gene	gene with protein product						15161931	Standard	NM_017853		Approved	FLJ20511, DLP, Dim2	uc010vmn.2	Q9NX01	OTTHUMG00000173453	ENST00000268483.3:c.345G>T	16.37:g.72120641C>A	ENSP00000268483:p.Leu115Phe	Unknown		x	x	x	70678142	D3DWS6	Missense_Mutation	SNP	ENST00000268483.3	37	CCDS10906.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505753	0.85282	.	.	ENSG00000140830	ENST00000268483;ENST00000426362;ENST00000423037	.	.	.	5.87	4.91	0.64330	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.69196	0.3084	L	0.61218	1.895	0.80722	D	1	D	0.67145	0.996	D	0.71414	0.973	T	0.70368	-0.4891	9	0.87932	D	0	.	8.9815	0.35968	0.0:0.7664:0.1523:0.0813	.	115	Q9NX01	TXN4B_HUMAN	F	115	.	ENSP00000268483:L115F	L	-	3	2	TXNL4B	70678142	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.481000	0.35476	2.941000	0.99782	0.655000	0.94253	TTG		0.383	TXNL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269007.2	NM_017853		Missense_Mutation
ANKRD11	29123	broad.mit.edu	37	16	89348397	89348397	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:89348397G>C	ENST00000301030.4	-	9	5013	c.4553C>G	c.(4552-4554)tCc>tGc	p.S1518C	ANKRD11_ENST00000378330.2_Missense_Mutation_p.S1518C	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1518	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S1518C(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTCGTCCCTGGACTTGTCTTT	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											72.0	69.0	70.0					16																	89348397		2198	4300	6498	87875898	SO:0001583	missense	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4553C>G	16.37:g.89348397G>C	ENSP00000301030:p.Ser1518Cys	Unknown		x	x	x	87875898	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460470	0.43736	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.40476	1.03;1.03	5.11	3.08	0.35506	.	0.513014	0.20207	N	0.096970	T	0.39384	0.1076	M	0.64997	1.995	0.80722	D	1	B	0.16166	0.016	B	0.12156	0.007	T	0.29243	-1.0018	10	0.66056	D	0.02	.	9.701	0.40187	0.0742:0.2686:0.6572:0.0	.	1518	Q6UB99	ANR11_HUMAN	C	1518	ENSP00000301030:S1518C;ENSP00000367581:S1518C	ENSP00000301030:S1518C	S	-	2	0	ANKRD11	87875898	1.000000	0.71417	0.310000	0.25168	0.179000	0.23085	5.120000	0.64685	0.611000	0.30052	-0.300000	0.09419	TCC		0.622	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275		Missense_Mutation
CHMP1A	5119	broad.mit.edu	37	16	89712366	89712366	+	3'UTR	SNP	C	C	G	rs200889805		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr16:89712366C>G	ENST00000397901.3	-	0	955				CHMP1A_ENST00000535997.2_3'UTR|CHMP1A_ENST00000550102.1_3'UTR|CHMP1A_ENST00000547614.1_5'Flank|CHMP1A_ENST00000253475.5_Missense_Mutation_p.A227P	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A						cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.A227P(1)		endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		AGAGTGGCTGCCGGCCGCAGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	16											36.0	47.0	43.0					16																	89712366		2011	4163	6174	88239867	SO:0001624	3_prime_UTR_variant	5119			U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.*108G>C	16.37:g.89712366C>G		Unknown		x	x	x	88239867	A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	ENST00000397901.3	37	CCDS45552.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	8.442	0.851094	0.17034	.	.	ENSG00000131165	ENST00000253475	.	.	.	2.33	-0.11	0.13580	.	.	.	.	.	T	0.17619	0.0423	N	0.08118	0	0.09310	N	1	B;B	0.19583	0.004;0.037	B;B	0.20767	0.012;0.031	T	0.23190	-1.0195	8	0.87932	D	0	.	5.6047	0.17373	0.0:0.6691:0.2016:0.1294	.	227;319	A6NG32;D3DX81	.;.	P	227	.	ENSP00000253475:A227P	A	-	1	0	CHMP1A	88239867	0.000000	0.05858	0.001000	0.08648	0.097000	0.18754	0.099000	0.15210	0.043000	0.15746	0.467000	0.42956	GCA		0.652	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.S241F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	17	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	7518284	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	17.37:g.7577559G>A	ENSP00000269305:p.Ser241Phe	Unknown		x	x	x	7518284	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
NF1	4763	broad.mit.edu	37	17	29490249	29490249	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr17:29490249C>T	ENST00000358273.4	+	4	717	c.334C>T	c.(334-336)Cag>Tag	p.Q112*	NF1_ENST00000431387.4_Nonsense_Mutation_p.Q112*|NF1_ENST00000356175.3_Nonsense_Mutation_p.Q112*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	112					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.Q112*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCTGGTCAAACAGTTGCTGCC	0.373			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(4)|Substitution - Nonsense(1)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|ovary(1)	17											73.0	74.0	74.0					17																	29490249		2203	4300	6503	26514375	SO:0001587	stop_gained	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.334C>T	17.37:g.29490249C>T	ENSP00000351015:p.Gln112*	Somatic		x	x	x	26514375	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668905	0.88348	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.1295	0.97995	0.0:1.0:0.0:0.0	.	.	.	.	X	112	.	ENSP00000348498:Q112X	Q	+	1	0	NF1	26514375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.161000	0.77505	2.758000	0.94735	0.591000	0.81541	CAG		0.373	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Nonsense_Mutation
CIC	23152	broad.mit.edu	37	19	42790965	42790965	+	Missense_Mutation	SNP	G	G	C	rs77130411		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr19:42790965G>C	ENST00000575354.2	+	2	150	c.110G>C	c.(109-111)tGg>tCg	p.W37S	CIC_ENST00000160740.3_Missense_Mutation_p.W37S|CIC_ENST00000572681.2_Missense_Mutation_p.W946S|CIC_ENST00000575839.2_3'UTR	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	37	Interaction with ATXN1. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.W37S(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GTGTTCCCTTGGCACTCCTTA	0.647			"""Mis, F, S"""		oligodendroglioma																																		Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	ovary(1)	19											87.0	80.0	82.0					19																	42790965		2203	4300	6503	47482805	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.110G>C	19.37:g.42790965G>C	ENSP00000458663:p.Trp37Ser	Unknown		x	x	x	47482805	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	13.09	2.131829	0.37630	.	.	ENSG00000079432	ENST00000160740	.	.	.	3.68	2.62	0.31277	.	.	.	.	.	T	0.47619	0.1455	L	0.32530	0.975	0.58432	D	0.999999	P	0.52316	0.952	P	0.49140	0.601	T	0.48779	-0.9005	8	0.87932	D	0	-6.1105	10.2863	0.43568	0.0:0.0:0.8018:0.1982	.	37	Q96RK0	CIC_HUMAN	S	37	.	ENSP00000160740:W37S	W	+	2	0	CIC	47482805	1.000000	0.71417	0.995000	0.50966	0.928000	0.56348	8.705000	0.91357	0.746000	0.32786	0.306000	0.20318	TGG		0.647	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			Missense_Mutation
SIGLEC11	114132	broad.mit.edu	37	19	50464030	50464030	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr19:50464030G>C	ENST00000447370.2	-	2	329	c.239C>G	c.(238-240)cCa>cGa	p.P80R	SIGLEC11_ENST00000426971.2_Missense_Mutation_p.P80R|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	80	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P68R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		ACCCGTCTTTGGGCTGGTCCG	0.597																																																1	Substitution - Missense(1)	ovary(1)	19											47.0	41.0	43.0					19																	50464030		2202	4300	6502	55155842	SO:0001583	missense	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.239C>G	19.37:g.50464030G>C	ENSP00000412361:p.Pro80Arg	Unknown		x	x	x	55155842		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	SNP	47	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.552|6.552	0.470126|0.470126	0.12461|0.12461	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000447370;ENST00000458019|ENST00000426971	T|.	0.68181|.	-0.31|.	2.63|2.63	-4.07|-4.07	0.03975|0.03975	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);|.	2.604410|.	0.01293|.	N|.	0.010064|.	T|T	0.27384|0.27384	0.0672|0.0672	L|L	0.33189|0.33189	0.99|0.99	0.09310|0.09310	N|N	1|1	B;B|.	0.33103|.	0.397;0.311|.	B;B|.	0.43413|.	0.419;0.158|.	T|T	0.31888|0.31888	-0.9927|-0.9927	10|5	0.17832|.	T|.	0.49|.	.|.	4.7231|4.7231	0.12927|0.12927	0.1335:0.0:0.2412:0.6254|0.1335:0.0:0.2412:0.6254	.|.	80;80|.	Q96RL6-2;Q96RL6|.	.;SIG11_HUMAN|.	R|E	80|70	ENSP00000412361:P80R|.	ENSP00000412361:P80R|.	P|Q	-|-	2|1	0|0	SIGLEC11|SIGLEC11	55155842|55155842	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.081000|-0.081000	0.11321|0.11321	-0.732000|-0.732000	0.04856|0.04856	0.561000|0.561000	0.74099|0.74099	CCA|CAA		0.597	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		Missense_Mutation
PEG3	5178	broad.mit.edu	37	19	57333111	57333111	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr19:57333111G>A	ENST00000326441.9	-	7	940	c.577C>T	c.(577-579)Cgg>Tgg	p.R193W	PEG3_ENST00000423103.2_Missense_Mutation_p.R193W|ZIM2_ENST00000593711.1_Missense_Mutation_p.R68W|PEG3_ENST00000593695.1_Missense_Mutation_p.R67W|ZIM2_ENST00000599935.1_Missense_Mutation_p.R68W|PEG3_ENST00000598410.1_Missense_Mutation_p.R68W|ZIM2_ENST00000601070.1_Missense_Mutation_p.R68W|PEG3_ENST00000594706.1_5'Flank|ZIM2_ENST00000391708.3_Missense_Mutation_p.R68W|ZIM2_ENST00000221722.5_Missense_Mutation_p.R68W	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	193					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R68W(1)|p.R193W(1)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GAAAGATCCCGCGGAGGCATC	0.547																																																2	Substitution - Missense(2)	ovary(2)	19											127.0	116.0	120.0					19																	57333111		2203	4300	6503	62024923	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.577C>T	19.37:g.57333111G>A	ENSP00000326581:p.Arg193Trp	Unknown		x	x	x	62024923	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064148	0.55432	.	.	ENSG00000198300	ENST00000391708;ENST00000221722;ENST00000326441;ENST00000423103;ENST00000292074	T;T;T;T	0.06608	3.28;3.28;3.98;3.98	3.57	2.54	0.30619	.	0.499126	0.15460	N	0.261194	T	0.10852	0.0265	L	0.27053	0.805	.	.	.	B;B;D;B	0.76494	0.078;0.078;0.999;0.425	B;B;D;B	0.64877	0.009;0.005;0.93;0.035	T	0.14008	-1.0488	9	0.87932	D	0	-6.3031	6.8095	0.23796	0.1271:0.0:0.8729:0.0	.	68;193;127;68	A7E2B8;Q9GZU2;Q96Q96;Q9NZV7	.;PEG3_HUMAN;.;ZIM2_HUMAN	W	68;68;193;193;193	ENSP00000375589:R68W;ENSP00000221722:R68W;ENSP00000326581:R193W;ENSP00000403051:R193W	ENSP00000221722:R68W	R	-	1	2	ZIM2	62024923	0.014000	0.17966	0.477000	0.27303	0.896000	0.52359	1.845000	0.39279	1.105000	0.41606	0.563000	0.77884	CGG		0.547	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			Missense_Mutation
NPHP1	4867	broad.mit.edu	37	2	110922218	110922218	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:110922218A>C	ENST00000393272.3	-	8	915	c.818T>G	c.(817-819)aTa>aGa	p.I273R	NPHP1_ENST00000417665.1_Intron|NPHP1_ENST00000355301.4_Intron|NPHP1_ENST00000316534.4_Missense_Mutation_p.I273R|NPHP1_ENST00000445609.2_Intron	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	273					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.I273R(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						CATCAGAACTATTAGGTAGCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											175.0	174.0	174.0					2																	110922218		2203	4300	6503	110279507	SO:0001583	missense	4867			AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.818T>G	2.37:g.110922218A>C	ENSP00000376953:p.Ile273Arg	Unknown		x	x	x	110279507	O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	9.044	0.990357	0.18966	.	.	ENSG00000144061	ENST00000316534;ENST00000393272	T;T	0.64438	-0.09;-0.1	4.17	0.256	0.15567	.	0.540328	0.15115	U	0.279711	T	0.42743	0.1216	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.15983	-1.0418	10	0.24483	T	0.36	.	3.2137	0.06691	0.5183:0.2167:0.265:0.0	.	273;273	O15259;O15259-4	NPHP1_HUMAN;.	R	273	ENSP00000313169:I273R;ENSP00000376953:I273R	ENSP00000313169:I273R	I	-	2	0	NPHP1	110279507	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.071000	0.11505	0.211000	0.20683	-0.460000	0.05396	ATA		0.468	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272		Missense_Mutation
CYTIP	9595	broad.mit.edu	37	2	158272527	158272527	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:158272527T>A	ENST00000264192.3	-	8	863	c.742A>T	c.(742-744)Agc>Tgc	p.S248C	CYTIP_ENST00000540637.1_Missense_Mutation_p.S142C	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	248	Ser-rich.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)		p.S248C(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CTCAGCCAGCTCTTACAGCTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	62.0	63.0					2																	158272527		2203	4300	6503	157980773	SO:0001583	missense	9595			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.742A>T	2.37:g.158272527T>A	ENSP00000264192:p.Ser248Cys	Unknown		x	x	x	157980773	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	37	CCDS2204.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	24.6	4.552069	0.86127	.	.	ENSG00000115165	ENST00000264192;ENST00000540637	T;T	0.55234	1.77;0.53	5.45	5.45	0.79879	.	0.091449	0.64402	D	0.000001	T	0.68311	0.2987	L	0.57536	1.79	0.49213	D	0.999762	D	0.89917	1.0	D	0.71184	0.972	T	0.70655	-0.4812	10	0.59425	D	0.04	-18.491	15.167	0.72837	0.0:0.0:0.0:1.0	.	248	O60759	CYTIP_HUMAN	C	248;142	ENSP00000264192:S248C;ENSP00000440801:S142C	ENSP00000264192:S248C	S	-	1	0	CYTIP	157980773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.903000	0.69877	2.065000	0.61736	0.533000	0.62120	AGC		0.552	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288		Missense_Mutation
TANC1	85461	broad.mit.edu	37	2	160035144	160035144	+	Silent	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:160035144G>A	ENST00000263635.6	+	14	2217	c.1980G>A	c.(1978-1980)ctG>ctA	p.L660L	TANC1_ENST00000454300.1_Silent_p.L554L	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	660					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.L660L(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACAGTGACCTGCACGCCTACG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	2											58.0	60.0	59.0					2																	160035144		2158	4258	6416	159743390	SO:0001819	synonymous_variant	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.1980G>A	2.37:g.160035144G>A		Unknown		x	x	x	159743390	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	46	Broad																																																																																				0.512	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Silent
FASTKD1	79675	broad.mit.edu	37	2	170393765	170393765	+	Silent	SNP	C	C	T	rs372027328		TCGA-04-1367-01	TCGA-04-1367-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:170393765C>T	ENST00000453153.2	-	12	2506	c.2160G>A	c.(2158-2160)tcG>tcA	p.S720S	FASTKD1_ENST00000453929.2_Silent_p.S677S|FASTKD1_ENST00000495505.1_Intron	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	720					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.S720S(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						GCGTAAGAACCGAGGCTTTTA	0.328																																																1	Substitution - coding silent(1)	ovary(1)	2						C		1,4405	2.1+/-5.4	0,1,2202	129.0	125.0	127.0		2160	-11.0	0.0	2		127	0,8600		0,0,4300	no	coding-synonymous	FASTKD1	NM_024622.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		720/848	170393765	1,13005	2203	4300	6503	170102011	SO:0001819	synonymous_variant	79675			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.2160G>A	2.37:g.170393765C>T		Somatic		x	x	x	170102011	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Silent	SNP	ENST00000453153.2	37	CCDS33318.1	SNP	23	Broad																																																																																				0.328	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622		Silent
HOXD10	3236	broad.mit.edu	37	2	176982198	176982198	+	Missense_Mutation	SNP	G	G	A	rs542394792		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:176982198G>A	ENST00000249501.4	+	1	892	c.637G>A	c.(637-639)Gtc>Atc	p.V213I	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	213					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V213I(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GCCCACCAAAGTCTCCCAGGT	0.652																																																1	Substitution - Missense(1)	ovary(1)	2											22.0	27.0	25.0					2																	176982198		2196	4276	6472	176690444	SO:0001583	missense	3236				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.637G>A	2.37:g.176982198G>A	ENSP00000249501:p.Val213Ile	Unknown		x	x	x	176690444	Q6NT10	Missense_Mutation	SNP	ENST00000249501.4	37	CCDS2266.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867828	0.32977	.	.	ENSG00000128710	ENST00000249501	D	0.93426	-3.22	5.96	5.96	0.96718	.	0.301827	0.38111	N	0.001809	D	0.90109	0.6910	L	0.31294	0.92	0.32113	N	0.5891	B	0.06786	0.001	B	0.10450	0.005	D	0.85387	0.1123	10	0.37606	T	0.19	.	20.4559	0.99141	0.0:0.0:1.0:0.0	.	213	P28358	HXD10_HUMAN	I	213	ENSP00000249501:V213I	ENSP00000249501:V213I	V	+	1	0	HOXD10	176690444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.943000	0.75934	2.843000	0.97960	0.650000	0.86243	GTC		0.652	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			Missense_Mutation
IRS1	3667	broad.mit.edu	37	2	227659994	227659994	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:227659994C>A	ENST00000305123.5	-	1	4481	c.3461G>T	c.(3460-3462)gGg>gTg	p.G1154V	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	1154					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.G1154V(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CCCAAGCTCCCCAGGCCTCAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	2											48.0	56.0	53.0					2																	227659994		2203	4300	6503	227368238	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.3461G>T	2.37:g.227659994C>A	ENSP00000304895:p.Gly1154Val	Unknown		x	x	x	227368238		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876521	0.51801	.	.	ENSG00000169047	ENST00000305123	T	0.59502	0.26	5.92	5.04	0.67666	.	0.077356	0.51477	D	0.000089	T	0.40886	0.1135	L	0.38175	1.15	0.51012	D	0.999906	P	0.35077	0.483	B	0.24394	0.053	T	0.38265	-0.9669	10	0.46703	T	0.11	-11.9747	7.8625	0.29517	0.1239:0.6906:0.1196:0.0658	.	1154	P35568	IRS1_HUMAN	V	1154	ENSP00000304895:G1154V	ENSP00000304895:G1154V	G	-	2	0	IRS1	227368238	0.001000	0.12720	1.000000	0.80357	0.971000	0.66376	0.729000	0.26028	1.486000	0.48398	0.655000	0.94253	GGG		0.607	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Missense_Mutation
COL6A3	1293	broad.mit.edu	37	2	238287412	238287412	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr2:238287412C>A	ENST00000295550.4	-	6	2816	c.2364G>T	c.(2362-2364)caG>caT	p.Q788H	COL6A3_ENST00000353578.4_Missense_Mutation_p.Q582H|COL6A3_ENST00000392004.3_Missense_Mutation_p.Q582H|COL6A3_ENST00000392003.2_Missense_Mutation_p.Q381H|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000347401.3_Missense_Mutation_p.Q587H|COL6A3_ENST00000409809.1_Missense_Mutation_p.Q582H|COL6A3_ENST00000346358.4_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	788	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q788H(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TAAAAGCAATCTGCTCAAGCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	69.0	71.0					2																	238287412		2203	4300	6503	237952151	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2364G>T	2.37:g.238287412C>A	ENSP00000295550:p.Gln788His	Unknown		x	x	x	237952151	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920168	0.33908	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000409809;ENST00000392004;ENST00000392003	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.52	3.66	0.41972	von Willebrand factor, type A (3);	0.141202	0.32430	N	0.006115	T	0.72028	0.3410	L	0.35341	1.055	0.80722	D	1	B;B;B;B	0.31227	0.001;0.006;0.314;0.02	B;B;B;B	0.35240	0.008;0.012;0.198;0.018	T	0.65232	-0.6218	10	0.45353	T	0.12	.	3.3173	0.07038	0.1504:0.571:0.1364:0.1422	.	381;582;582;788	A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	H	788;587;582;582;582;381	ENSP00000295550:Q788H;ENSP00000315609:Q587H;ENSP00000315873:Q582H;ENSP00000386844:Q582H;ENSP00000375861:Q582H;ENSP00000375860:Q381H	ENSP00000295550:Q788H	Q	-	3	2	COL6A3	237952151	0.900000	0.30661	0.998000	0.56505	0.997000	0.91878	0.066000	0.14489	0.632000	0.30432	0.655000	0.94253	CAG		0.522	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Missense_Mutation
CLIC6	54102	broad.mit.edu	37	21	36080253	36080253	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1367-01	TCGA-04-1367-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr21:36080253A>T	ENST00000360731.3	+	4	1550	c.1550A>T	c.(1549-1551)gAc>gTc	p.D517V	CLIC6_ENST00000349499.2_Missense_Mutation_p.D499V			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	517						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)	p.D499V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						AAACCCGCAGACCTGCAGAAC	0.502																																																1	Substitution - Missense(1)	ovary(1)	21											75.0	68.0	71.0					21																	36080253		2203	4300	6503	35002123	SO:0001583	missense	54102			AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.1550A>T	21.37:g.36080253A>T	ENSP00000353959:p.Asp517Val	Somatic		x	x	x	35002123	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	24.0	4.481489	0.84747	.	.	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.26373	1.74;1.74	4.96	4.96	0.65561	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.40619	0.1124	L	0.33624	1.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	T	0.33111	-0.9881	10	0.87932	D	0	-7.9027	14.8309	0.70149	1.0:0.0:0.0:0.0	.	517;499	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	V	517;499	ENSP00000353959:D517V;ENSP00000290332:D499V	ENSP00000290332:D499V	D	+	2	0	CLIC6	35002123	1.000000	0.71417	0.989000	0.46669	0.952000	0.60782	9.099000	0.94207	2.076000	0.62316	0.533000	0.62120	GAC		0.502	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1			Missense_Mutation
DSCAM	1826	broad.mit.edu	37	21	41457667	41457667	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr21:41457667T>A	ENST00000400454.1	-	23	4471	c.3994A>T	c.(3994-3996)Att>Ttt	p.I1332F		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1332	Ig-like C2-type 10.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.I1332F(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGCCCATCAATCGTTACTAGA	0.443																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Missense(1)	ovary(1)	21											84.0	78.0	79.0					21																	41457667		1887	4125	6012	40379537	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3994A>T	21.37:g.41457667T>A	ENSP00000383303:p.Ile1332Phe	Unknown		x	x	x	40379537	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175136	0.38413	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.29917	1.55;1.55	5.52	-0.00932	0.14001	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.170372	0.49916	D	0.000130	T	0.16428	0.0395	N	0.17631	0.505	0.26986	N	0.965257	P	0.48162	0.906	P	0.46049	0.502	T	0.27773	-1.0064	10	0.07644	T	0.81	.	6.8209	0.23857	0.0:0.2869:0.1178:0.5953	.	1332	O60469	DSCAM_HUMAN	F	1332;1084	ENSP00000383303:I1332F;ENSP00000385342:I1084F	ENSP00000383303:I1332F	I	-	1	0	DSCAM	40379537	0.965000	0.33210	0.998000	0.56505	0.987000	0.75469	0.800000	0.27042	0.068000	0.16574	0.533000	0.62120	ATT		0.443	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Missense_Mutation
ITGB2	3689	broad.mit.edu	37	21	46319077	46319077	+	Splice_Site	SNP	C	C	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr21:46319077C>G	ENST00000397850.2	-	9	1350	c.898G>C	c.(898-900)Gac>Cac	p.D300H	ITGB2_ENST00000397857.1_Splice_Site_p.D300H|ITGB2_ENST00000355153.4_Splice_Site_p.D300H|ITGB2_ENST00000397852.1_Splice_Site_p.D300H|ITGB2_ENST00000397854.3_Splice_Site_p.D243H|ITGB2_ENST00000302347.5_Splice_Site_p.D300H			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	300	VWFA.		D -> V (in LAD1; dbSNP:rs179363874). {ECO:0000269|PubMed:20529581}.		apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.D300H(1)		breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GATGGGTAGTCCTGGAGAGAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	21											101.0	75.0	84.0					21																	46319077		2203	4300	6503	45143505	SO:0001630	splice_region_variant	3689			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.898-1G>C	21.37:g.46319077C>G		Unknown		x	x	x	45143505	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	CCDS13716.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511820	0.85389	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414;ENST00000320216	D;D;D;D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6;-3.6;-3.6;-3.6	4.92	4.92	0.64577	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	.	.	.	.	D	0.98150	0.9389	H	0.96142	3.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99383	1.0923	9	0.87932	D	0	.	15.9907	0.80202	0.0:1.0:0.0:0.0	.	243;300	A8MYE6;P05107	.;ITB2_HUMAN	H	300;300;243;300;300;300;243;291	ENSP00000380950:D300H;ENSP00000380955:D300H;ENSP00000380952:D243H;ENSP00000347279:D300H;ENSP00000380948:D300H;ENSP00000303242:D300H;ENSP00000317697:D291H	ENSP00000303242:D300H	D	-	1	0	ITGB2	45143505	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.048000	0.76606	2.462000	0.83206	0.561000	0.74099	GAC		0.632	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	Missense_Mutation	Missense_Mutation
ISX	91464	broad.mit.edu	37	22	35481585	35481585	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr22:35481585C>A	ENST00000308700.6	+	4	1589	c.637C>A	c.(637-639)Cct>Act	p.P213T	ISX_ENST00000404699.2_Missense_Mutation_p.P213T	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	213					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.P213T(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						GGAAACACAGCCTGTCCCAGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	22											223.0	152.0	176.0					22																	35481585		2203	4300	6503	33811585	SO:0001583	missense	91464			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.637C>A	22.37:g.35481585C>A	ENSP00000311492:p.Pro213Thr	Unknown		x	x	x	33811585	Q68DJ5	Missense_Mutation	SNP	ENST00000308700.6	37	CCDS33640.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775048	0.49786	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.90620	-2.7;-2.7	5.14	1.35	0.21983	.	0.142348	0.32901	N	0.005502	D	0.87047	0.6080	M	0.62723	1.935	0.09310	N	1	P	0.50066	0.931	P	0.45310	0.476	T	0.77696	-0.2491	10	0.33141	T	0.24	.	5.5834	0.17262	0.0:0.6238:0.1695:0.2066	.	213	Q2M1V0	ISX_HUMAN	T	213	ENSP00000311492:P213T;ENSP00000386037:P213T	ENSP00000311492:P213T	P	+	1	0	ISX	33811585	0.000000	0.05858	0.009000	0.14445	0.012000	0.07955	0.435000	0.21510	0.545000	0.28902	0.655000	0.94253	CCT		0.572	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494		Missense_Mutation
GGA1	26088	broad.mit.edu	37	22	38021949	38021949	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr22:38021949G>A	ENST00000343632.4	+	11	1472	c.1086G>A	c.(1084-1086)atG>atA	p.M362I	GGA1_ENST00000337437.4_Missense_Mutation_p.M329I|GGA1_ENST00000406772.1_Missense_Mutation_p.M289I|GGA1_ENST00000381756.5_Missense_Mutation_p.M379I|GGA1_ENST00000325180.8_Intron	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	362	Unstructured hinge.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.M362I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					ACGAGCTCATGTCTCTGGGTG	0.672																																																1	Substitution - Missense(1)	ovary(1)	22											51.0	48.0	49.0					22																	38021949		2203	4299	6502	36351895	SO:0001583	missense	26088			AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.1086G>A	22.37:g.38021949G>A	ENSP00000341344:p.Met362Ile	Unknown		x	x	x	36351895	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Missense_Mutation	SNP	ENST00000343632.4	37	CCDS13951.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	g	18.41	3.619015	0.66787	.	.	ENSG00000100083	ENST00000343632;ENST00000381756;ENST00000337437;ENST00000406772	T;T;T;T	0.29655	2.57;2.31;1.56;1.58	4.86	4.86	0.63082	.	0.281557	0.44688	N	0.000440	T	0.35189	0.0923	M	0.65498	2.005	0.80722	D	1	B;B	0.25441	0.126;0.046	B;B	0.21151	0.033;0.027	T	0.16512	-1.0400	10	0.38643	T	0.18	-14.9512	17.993	0.89174	0.0:0.0:1.0:0.0	.	379;362	Q6IC75;Q9UJY5	.;GGA1_HUMAN	I	362;379;329;289	ENSP00000341344:M362I;ENSP00000371175:M379I;ENSP00000338647:M329I;ENSP00000385287:M289I	ENSP00000338647:M329I	M	+	3	0	GGA1	36351895	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.500000	0.97977	2.258000	0.74832	0.558000	0.71614	ATG		0.672	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075873.3	NM_013365		Missense_Mutation
ATXN10	25814	broad.mit.edu	37	22	46088947	46088947	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr22:46088947C>G	ENST00000252934.5	+	3	645	c.380C>G	c.(379-381)tCt>tGt	p.S127C	ATXN10_ENST00000381061.4_Missense_Mutation_p.S63C|ATXN10_ENST00000498009.1_3'UTR	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10	127					cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.S127C(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		GAACAGGAATCTCTGTTGACA	0.333																																																1	Substitution - Missense(1)	ovary(1)	22											146.0	141.0	143.0					22																	46088947		2203	4300	6503	44467611	SO:0001583	missense	25814			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.380C>G	22.37:g.46088947C>G	ENSP00000252934:p.Ser127Cys	Unknown		x	x	x	44467611	A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	ENST00000252934.5	37	CCDS14070.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795108	0.50208	.	.	ENSG00000130638	ENST00000381061;ENST00000252934;ENST00000396011	T;T	0.52526	0.66;0.66	5.69	5.69	0.88448	Armadillo-like helical (1);Armadillo-type fold (1);	0.993388	0.08190	N	0.984096	T	0.38639	0.1048	N	0.14661	0.345	0.09310	N	1	D;P	0.56746	0.977;0.949	P;B	0.46076	0.503;0.401	T	0.23976	-1.0173	10	0.56958	D	0.05	-14.9884	10.8023	0.46495	0.0:0.9141:0.0:0.0859	.	63;127	A6NLC4;Q9UBB4	.;ATX10_HUMAN	C	63;127;127	ENSP00000370449:S63C;ENSP00000252934:S127C	ENSP00000252934:S127C	S	+	2	0	ATXN10	44467611	0.009000	0.17119	0.056000	0.19401	0.888000	0.51559	2.028000	0.41088	2.690000	0.91761	0.655000	0.94253	TCT		0.333	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318142.2	NM_013236		Missense_Mutation
CELSR1	9620	broad.mit.edu	37	22	46790131	46790131	+	Missense_Mutation	SNP	A	A	C	rs199586660	byFrequency	TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr22:46790131A>C	ENST00000262738.3	-	14	5871	c.5872T>G	c.(5872-5874)Tgg>Ggg	p.W1958G		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1958	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.W1958G(3)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GGGTTCCCCCACCAGCCTCTG	0.567																																																3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	22											45.0	41.0	42.0					22																	46790131		2203	4300	6503	45168795	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5872T>G	22.37:g.46790131A>C	ENSP00000262738:p.Trp1958Gly	Unknown		x	x	x	45168795	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425084	0.62733	.	.	ENSG00000075275	ENST00000262738	T	0.70164	-0.46	3.47	3.47	0.39725	.	0.000000	0.64402	U	0.000003	T	0.80270	0.4592	M	0.81112	2.525	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.971	T	0.82940	-0.0208	10	0.87932	D	0	.	11.945	0.52924	1.0:0.0:0.0:0.0	.	279;1958	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	G	1958	ENSP00000262738:W1958G	ENSP00000262738:W1958G	W	-	1	0	CELSR1	45168795	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	8.638000	0.91019	1.360000	0.45960	0.379000	0.24179	TGG		0.567	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		Missense_Mutation
CELSR3	1951	broad.mit.edu	37	3	48697377	48697377	+	Silent	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:48697377C>A	ENST00000164024.4	-	1	2971	c.2691G>T	c.(2689-2691)ctG>ctT	p.L897L	CELSR3_ENST00000544264.1_Silent_p.L897L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	897	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.L897L(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGTTGTCCTCCAGGAGATAGG	0.522																																																1	Substitution - coding silent(1)	ovary(1)	3											101.0	89.0	93.0					3																	48697377		2203	4300	6503	48672381	SO:0001819	synonymous_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2691G>T	3.37:g.48697377C>A		Unknown		x	x	x	48672381	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	21	Broad																																																																																				0.522	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Silent
SLC38A3	10991	broad.mit.edu	37	3	50257508	50257508	+	RNA	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:50257508C>A	ENST00000420502.1	+	0	1567									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TCCACAGGCCCTGTGTTTTGC	0.572																																																0			3											100.0	94.0	96.0					3																	50257508		2038	4179	6217	50232512			10991			U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50257508C>A		Unknown		x	x	x	50232512		Missense_Mutation	SNP	ENST00000420502.1	37		SNP	24	Broad																																																																																				0.572	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841		Missense_Mutation
EPHA3	2042	broad.mit.edu	37	3	89456515	89456515	+	Missense_Mutation	SNP	T	T	A	rs536008328		TCGA-04-1367-01	TCGA-04-1367-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:89456515T>A	ENST00000336596.2	+	8	1916	c.1691T>A	c.(1690-1692)aTt>aAt	p.I564N	EPHA3_ENST00000494014.1_Missense_Mutation_p.I564N	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	564			I -> V (in dbSNP:rs55712516). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.I564N(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TATGTTTTGATTGGGAGGTGA	0.413										TSP Lung(6;0.00050)																																						1	Substitution - Missense(1)	ovary(1)	3											191.0	158.0	170.0					3																	89456515		2203	4300	6503	89539205	SO:0001583	missense	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1691T>A	3.37:g.89456515T>A	ENSP00000337451:p.Ile564Asn	Somatic		x	x	x	89539205	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	11.52	1.662232	0.29515	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.11930	2.73;2.73	5.89	4.74	0.60224	.	0.047591	0.85682	D	0.000000	T	0.17066	0.0410	M	0.72894	2.215	0.58432	D	0.999992	B	0.24823	0.112	B	0.21360	0.034	T	0.02070	-1.1219	9	.	.	.	.	12.0932	0.53739	0.0:0.0668:0.0:0.9332	.	564	P29320	EPHA3_HUMAN	N	564	ENSP00000337451:I564N;ENSP00000419190:I564N	.	I	+	2	0	EPHA3	89539205	1.000000	0.71417	0.999000	0.59377	0.218000	0.24690	3.926000	0.56491	1.055000	0.40461	-0.254000	0.11334	ATT		0.413	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		Missense_Mutation
KIAA2018	205717	broad.mit.edu	37	3	113379976	113379976	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:113379976G>C	ENST00000478658.1	-	5	570	c.553C>G	c.(553-555)Cca>Gca	p.P185A	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.P185A			Q68DE3	K2018_HUMAN	KIAA2018	185						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.P185A(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CTCTGTACTGGCACCACATTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	3											131.0	132.0	131.0					3																	113379976		1930	4125	6055	114862666	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.553C>G	3.37:g.113379976G>C	ENSP00000420721:p.Pro185Ala	Unknown		x	x	x	114862666	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	37	CCDS43133.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798184	0.50208	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.17528	2.27;2.27	5.95	5.95	0.96441	.	0.141155	0.49305	D	0.000141	T	0.31638	0.0803	L	0.27053	0.805	0.58432	D	0.999995	D	0.67145	0.996	D	0.65443	0.935	T	0.02196	-1.1197	10	0.87932	D	0	-12.8325	20.3854	0.98941	0.0:0.0:1.0:0.0	.	185	Q68DE3	K2018_HUMAN	A	185	ENSP00000320794:P185A;ENSP00000420721:P185A	ENSP00000320794:P185A	P	-	1	0	KIAA2018	114862666	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.065000	0.64344	2.825000	0.97269	0.655000	0.94253	CCA		0.463	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		Missense_Mutation
ACAD11	84129	broad.mit.edu	37	3	132378583	132378583	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:132378583C>A	ENST00000264990.6	-	1	984	c.13G>T	c.(13-15)Gct>Tct	p.A5S	UBA5_ENST00000473651.1_5'Flank|ACAD11_ENST00000355458.3_Missense_Mutation_p.A5S|ACAD11_ENST00000489991.1_5'UTR|ACAD11_ENST00000481970.2_Missense_Mutation_p.A5S|ACAD11_ENST00000545291.1_5'UTR|UBA5_ENST00000356232.4_5'UTR|UBA5_ENST00000264991.4_Intron|UBA5_ENST00000494238.2_5'Flank|UBA5_ENST00000493720.2_5'Flank	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	5					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)	p.A5S(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						TCGCCAGTAGCACCTGGCTTC	0.607											OREG0015804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											67.0	69.0	69.0					3																	132378583		2203	4300	6503	133861273	SO:0001583	missense	84129			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.13G>T	3.37:g.132378583C>A	ENSP00000264990:p.Ala5Ser	Unknown	1594	x	x	x	133861273	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.33	2.503451	0.44558	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	D;D;T	0.96619	-4.03;-4.07;1.91	5.86	2.12	0.27331	.	.	.	.	.	D	0.93324	0.7872	L	0.60455	1.87	0.09310	N	0.999994	B;B	0.28713	0.22;0.043	B;B	0.25140	0.058;0.027	D	0.84386	0.0552	8	.	.	.	.	7.8768	0.29599	0.0:0.6718:0.0:0.3282	.	5;5	D6RDI8;Q709F0	.;ACD11_HUMAN	S	5	ENSP00000347636:A5S;ENSP00000264990:A5S;ENSP00000420907:A5S	.	A	-	1	0	ACAD11	133861273	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.390000	0.20768	0.112000	0.17975	-0.157000	0.13467	GCT		0.607	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169		Missense_Mutation
LRRC31	79782	broad.mit.edu	37	3	169578465	169578465	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:169578465T>C	ENST00000316428.5	-	3	428	c.371A>G	c.(370-372)aAt>aGt	p.N124S	LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Missense_Mutation_p.N124S|LRRC31_ENST00000264676.5_Intron	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	124								p.N124S(1)		cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TACAAAACCATTCCAGGAGAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											122.0	113.0	116.0					3																	169578465		1911	4135	6046	171061159	SO:0001583	missense	79782			AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.371A>G	3.37:g.169578465T>C	ENSP00000325978:p.Asn124Ser	Unknown		x	x	x	171061159	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Missense_Mutation	SNP	ENST00000316428.5	37	CCDS43167.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	16.87	3.240780	0.58995	.	.	ENSG00000114248	ENST00000316428;ENST00000523069	T;T	0.58652	0.32;0.32	5.24	2.88	0.33553	.	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	M	0.86420	2.815	0.32726	N	0.509631	D	0.89917	1.0	D	0.85130	0.997	T	0.77648	-0.2509	10	0.37606	T	0.19	-10.2284	8.9177	0.35592	0.0:0.1531:0.0:0.8469	.	124	Q6UY01	LRC31_HUMAN	S	124	ENSP00000325978:N124S;ENSP00000429145:N124S	ENSP00000325978:N124S	N	-	2	0	LRRC31	171061159	1.000000	0.71417	0.953000	0.39169	0.632000	0.37999	3.691000	0.54720	0.334000	0.23590	0.528000	0.53228	AAT		0.443	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727		Missense_Mutation
DLG1	1739	broad.mit.edu	37	3	196792600	196792600	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr3:196792600T>C	ENST00000419354.1	-	22	2498	c.2212A>G	c.(2212-2214)Aaa>Gaa	p.K738E	DLG1_ENST00000448528.2_Missense_Mutation_p.K738E|DLG1_ENST00000357674.4_Missense_Mutation_p.K727E|DLG1_ENST00000443183.1_Missense_Mutation_p.K634E|DLG1_ENST00000346964.2_Missense_Mutation_p.K760E|DLG1_ENST00000314062.3_Missense_Mutation_p.K687E|DLG1_ENST00000450955.1_Missense_Mutation_p.K727E|DLG1_ENST00000422288.1_Missense_Mutation_p.K687E|DLG1_ENST00000392382.2_Missense_Mutation_p.K705E|DLG1_ENST00000452595.1_Missense_Mutation_p.K622E			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	738	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)	p.K760E(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GATCCAAATTTGTCAGGAAAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											113.0	108.0	110.0					3																	196792600		2203	4297	6500	198276997	SO:0001583	missense	1739			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.2212A>G	3.37:g.196792600T>C	ENSP00000407531:p.Lys738Glu	Unknown		x	x	x	198276997	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	19.35	3.809876	0.70797	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955	T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.43	5.43	0.79202	Src homology-3 domain (1);Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.63885	0.2549	M	0.74647	2.275	0.80722	D	1	B;P;D;P;D	0.89917	0.45;0.538;0.999;0.68;1.0	B;B;D;P;D	0.72625	0.237;0.219;0.978;0.629;0.978	T	0.66372	-0.5940	10	0.51188	T	0.08	.	14.6597	0.68861	0.0:0.0:0.0:1.0	.	727;622;634;738;760	Q12959-4;E9PG21;E7EWL7;Q12959;Q12959-2	.;.;.;DLG1_HUMAN;.	E	760;751;727;725;687;738;622;687;738;634;705;727	ENSP00000345731:K760E;ENSP00000350303:K727E;ENSP00000321087:K687E;ENSP00000407531:K738E;ENSP00000398939:K622E;ENSP00000413238:K687E;ENSP00000391732:K738E;ENSP00000396658:K634E;ENSP00000376187:K705E;ENSP00000411278:K727E	ENSP00000321087:K687E	K	-	1	0	DLG1	198276997	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	8.040000	0.89188	2.063000	0.61619	0.383000	0.25322	AAA		0.338	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087		Missense_Mutation
C4orf50	389197	broad.mit.edu	37	4	5975454	5975454	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr4:5975454G>T	ENST00000324058.5	-	4	429	c.340C>A	c.(340-342)Cag>Aag	p.Q114K	C4orf50_ENST00000531445.1_Missense_Mutation_p.Q588K			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	114								p.Q114K(1)		breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						AGCATGTTCTGCGCCAGCTCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	4											121.0	115.0	117.0					4																	5975454		2203	4300	6503	6026355	SO:0001583	missense	389197			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.340C>A	4.37:g.5975454G>T	ENSP00000317287:p.Gln114Lys	Unknown		x	x	x	6026355		Missense_Mutation	SNP	ENST00000324058.5	37		SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	9.011	0.982578	0.18889	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	T;T	0.23950	1.88;1.88	4.6	2.67	0.31697	.	0.899723	0.09194	N	0.835637	T	0.27241	0.0668	L	0.56769	1.78	0.09310	N	1	B	0.28291	0.206	B	0.31101	0.124	T	0.22695	-1.0209	10	0.37606	T	0.19	-0.6713	9.1545	0.36985	0.0:0.0:0.5781:0.4219	.	114	Q6ZRC1	CD050_HUMAN	K	588;114	ENSP00000437121:Q588K;ENSP00000317287:Q114K	ENSP00000317287:Q114K	Q	-	1	0	C4orf50	6026355	0.004000	0.15560	0.001000	0.08648	0.003000	0.03518	1.501000	0.35693	1.154000	0.42482	0.561000	0.74099	CAG		0.637	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_207405		Missense_Mutation
MARCH1	55016	broad.mit.edu	37	4	165118288	165118288	+	Intron	SNP	C	C	T	rs374180838		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr4:165118288C>T	ENST00000503008.1	-	2	864				MARCH1_ENST00000514618.1_Intron|MARCH1_ENST00000508725.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E192E(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				cttcaccttcctcctcctcct	0.552																																																1	Substitution - coding silent(1)	ovary(1)	4											176.0	138.0	151.0					4																	165118288		2203	4300	6503	165337738	SO:0001627	intron_variant	23520			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-85474G>A	4.37:g.165118288C>T		Unknown		x	x	x	165337738	D3DP29|Q9NWR0	Silent	SNP	ENST00000503008.1	37	CCDS54814.1	SNP	24	Broad																																																																																				0.552	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		Silent
IQGAP2	10788	broad.mit.edu	37	5	75866444	75866444	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr5:75866444C>T	ENST00000274364.6	+	4	640	c.343C>T	c.(343-345)Cag>Tag	p.Q115*	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	115	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.Q115*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TAATACCGTCCAGTGGTTAAG	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	5											174.0	163.0	167.0					5																	75866444		2203	4300	6503	75902200	SO:0001587	stop_gained	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.343C>T	5.37:g.75866444C>T	ENSP00000274364:p.Gln115*	Unknown		x	x	x	75902200	A8K4V1|B7Z8A4|J3KR91	Nonsense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	38	7.072557	0.98044	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-20.9745	19.4372	0.94801	0.0:1.0:0.0:0.0	.	.	.	.	X	115;88;65	.	ENSP00000274364:Q115X	Q	+	1	0	IQGAP2	75902200	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.656000	0.83736	2.601000	0.87937	0.655000	0.94253	CAG		0.448	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		Nonsense_Mutation
ADAM19	8728	broad.mit.edu	37	5	156932760	156932760	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr5:156932760G>T	ENST00000517905.1	-	11	1091	c.1047C>A	c.(1045-1047)caC>caA	p.H349Q	ADAM19_ENST00000257527.4_Missense_Mutation_p.H349Q|ADAM19_ENST00000394020.1_Missense_Mutation_p.H351Q|ADAM19_ENST00000430702.2_Missense_Mutation_p.H82Q			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	349	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.H350Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCCAAAGTTGTGGCCCATCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	5											63.0	50.0	54.0					5																	156932760		2203	4300	6503	156865338	SO:0001583	missense	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.1047C>A	5.37:g.156932760G>T	ENSP00000428654:p.His349Gln	Unknown		x	x	x	156865338	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450665	0.84101	.	.	ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	T;D;D;D	0.98666	1.63;-5.06;-5.06;-5.06	5.91	5.03	0.67393	.	0.000000	0.64402	D	0.000001	D	0.99102	0.9691	M	0.89287	3.02	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98810	1.0743	10	0.87932	D	0	.	11.4794	0.50316	0.1369:0.0:0.8631:0.0	.	349;82	Q9H013-2;E9PD32	.;.	Q	82;349;351;349	ENSP00000414088:H82Q;ENSP00000257527:H349Q;ENSP00000377588:H351Q;ENSP00000428654:H349Q	ENSP00000257527:H349Q	H	-	3	2	ADAM19	156865338	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.962000	0.56766	2.793000	0.96121	0.655000	0.94253	CAC		0.577	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		Missense_Mutation
TNXB	7148	broad.mit.edu	37	6	32047024	32047024	+	Silent	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr6:32047024C>T	ENST00000375244.3	-	11	4362	c.4161G>A	c.(4159-4161)tcG>tcA	p.S1387S	TNXB_ENST00000375247.2_Silent_p.S1387S|RNA5SP206_ENST00000516703.1_RNA			P22105	TENX_HUMAN	tenascin XB	1474	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.S1474S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGAGGCTCAGCGAATCAGGGG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	6											98.0	109.0	105.0					6																	32047024		1253	2527	3780	32155002	SO:0001819	synonymous_variant	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.4161G>A	6.37:g.32047024C>T		Unknown		x	x	x	32155002	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37		SNP	27	Broad																																																																																				0.682	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		Silent
B3GAT2	135152	broad.mit.edu	37	6	71571589	71571589	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr6:71571589G>C	ENST00000230053.6	-	3	1437	c.829C>G	c.(829-831)Ctc>Gtc	p.L277V	SMAP1_ENST00000370455.3_3'UTR	NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	277					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)	p.L277V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						ATCTGTTTGAGAAAGTCAGAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											178.0	177.0	177.0					6																	71571589		2203	4300	6503	71628310	SO:0001583	missense	135152			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.829C>G	6.37:g.71571589G>C	ENSP00000230053:p.Leu277Val	Somatic		x	x	x	71628310	Q5JS09|Q8TF38|Q96NK4	Missense_Mutation	SNP	ENST00000230053.6	37	CCDS4974.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801662	0.70682	.	.	ENSG00000112309	ENST00000230053	T	0.58797	0.31	5.51	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.65554	0.2702	M	0.78285	2.405	0.80722	D	1	D;D	0.71674	0.998;0.99	D;D	0.76575	0.988;0.961	T	0.67799	-0.5577	10	0.39692	T	0.17	-8.0275	10.5683	0.45186	0.1482:0.0:0.8518:0.0	.	205;277	Q29RV3;Q9NPZ5	.;B3GA2_HUMAN	V	277	ENSP00000230053:L277V	ENSP00000230053:L277V	L	-	1	0	B3GAT2	71628310	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	6.586000	0.74067	1.322000	0.45245	0.650000	0.86243	CTC		0.433	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742		Missense_Mutation
AC005013.5	0	broad.mit.edu	37	7	28997131	28997131	+	lincRNA	SNP	A	A	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:28997131A>G	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							AGGTTGCCCAAGGGAGCGAAG	0.652																																																0			7											28.0	35.0	32.0					7																	28997131		2035	4168	6203	28963656			9865																															7.37:g.28997131A>G		Unknown		x	x	x	28963656		Silent	SNP	ENST00000436594.1	37		SNP	3	Broad																																																																																				0.652	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3			Silent
SCRN1	9805	broad.mit.edu	37	7	29980316	29980316	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:29980316T>A	ENST00000426154.1	-	5	897	c.721A>T	c.(721-723)Agc>Tgc	p.S241C	SCRN1_ENST00000425819.2_Missense_Mutation_p.S173C|SCRN1_ENST00000434476.2_Missense_Mutation_p.S261C|SCRN1_ENST00000242059.5_Missense_Mutation_p.S241C|SCRN1_ENST00000416113.2_Intron|SCRN1_ENST00000409497.1_Missense_Mutation_p.S241C	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	241					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)	p.S241C(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						TTTTCTAAGCTGTCTTTGCCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											131.0	122.0	125.0					7																	29980316		2203	4300	6503	29946841	SO:0001583	missense	9805			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.721A>T	7.37:g.29980316T>A	ENSP00000409068:p.Ser241Cys	Unknown		x	x	x	29946841	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	ENST00000426154.1	37	CCDS5422.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	14.24	2.477627	0.44044	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000425819;ENST00000544388;ENST00000409497;ENST00000434476;ENST00000421434	T;T;T;T;T;T	0.19532	3.24;3.24;3.09;3.24;3.22;2.14	5.67	5.67	0.87782	.	0.272996	0.37261	N	0.002163	T	0.21674	0.0522	L	0.51422	1.61	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.003;0.005;0.003	T	0.03364	-1.1044	9	.	.	.	-10.5716	14.7167	0.69275	0.0:0.0:0.0:1.0	.	261;261;241	C9JPG0;B4DHM0;Q12765	.;.;SCRN1_HUMAN	C	241;241;173;45;241;261;241	ENSP00000242059:S241C;ENSP00000409068:S241C;ENSP00000414245:S173C;ENSP00000386872:S241C;ENSP00000388942:S261C;ENSP00000413184:S241C	.	S	-	1	0	SCRN1	29946841	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	3.001000	0.49488	2.159000	0.67721	0.482000	0.46254	AGC		0.473	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766		Missense_Mutation
HERPUD2	64224	broad.mit.edu	37	7	35674832	35674832	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:35674832C>T	ENST00000396081.1	-	6	1658	c.854G>A	c.(853-855)cGa>cAa	p.R285Q	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Missense_Mutation_p.R285Q	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	285					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R285Q(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						AATCGCAGCTCGTGAGAACGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											184.0	165.0	172.0					7																	35674832		2203	4300	6503	35641357	SO:0001583	missense	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.854G>A	7.37:g.35674832C>T	ENSP00000379390:p.Arg285Gln	Unknown		x	x	x	35641357	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	37	CCDS5446.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.743175	0.96873	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	T;T	0.20738	2.05;2.05	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.46983	0.1421	L	0.58510	1.815	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.24905	-1.0147	10	0.66056	D	0.02	-32.1447	20.422	0.99049	0.0:1.0:0.0:0.0	.	285	Q9BSE4	HERP2_HUMAN	Q	285	ENSP00000379390:R285Q;ENSP00000310729:R285Q	ENSP00000310729:R285Q	R	-	2	0	HERPUD2	35641357	1.000000	0.71417	0.566000	0.28421	0.991000	0.79684	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	CGA		0.418	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373		Missense_Mutation
MUC17	140453	broad.mit.edu	37	7	100683272	100683272	+	Missense_Mutation	SNP	G	G	A	rs373142874		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:100683272G>A	ENST00000306151.4	+	3	8639	c.8575G>A	c.(8575-8577)Gtg>Atg	p.V2859M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2859	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.V2859M(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGGTATCGTCGTGCCAATCTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	7						A	MET/VAL	3,4403	825.9+/-416.6	0,3,2200	250.0	257.0	255.0		8575	-1.4	0.0	7		255	0,8600		0,0,4300	no	missense	MUC17	NM_001040105.1	21	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	2859/4494	100683272	3,13003	2203	4300	6503	100469992	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8575G>A	7.37:g.100683272G>A	ENSP00000302716:p.Val2859Met	Unknown		x	x	x	100469992	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	A	0.762	-0.768961	0.02974	6.81E-4	0.0	ENSG00000169876	ENST00000306151	T	0.02763	4.17	0.673	-1.35	0.09114	.	.	.	.	.	T	0.01189	0.0039	N	0.02539	-0.55	0.09310	N	1	D	0.64830	0.994	B	0.41764	0.366	T	0.43956	-0.9359	9	0.30078	T	0.28	.	3.8288	0.08865	0.4477:0.0:0.3822:0.1701	.	2859	Q685J3	MUC17_HUMAN	M	2859	ENSP00000302716:V2859M	ENSP00000302716:V2859M	V	+	1	0	MUC17	100469992	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.513000	0.00446	-4.167000	0.00068	-3.222000	0.00052	GTG		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
CUX1	1523	broad.mit.edu	37	7	101559405	101559405	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:101559405A>T	ENST00000292535.7	+	2	79	c.41A>T	c.(40-42)gAt>gTt	p.D14V	CUX1_ENST00000547394.2_Missense_Mutation_p.D25V|CUX1_ENST00000550008.2_Missense_Mutation_p.D14V|CUX1_ENST00000292538.4_Missense_Mutation_p.D25V|CUX1_ENST00000546411.2_Missense_Mutation_p.D14V|CUX1_ENST00000425244.2_Missense_Mutation_p.D25V|CUX1_ENST00000556210.1_Missense_Mutation_p.D14V|CUX1_ENST00000360264.3_Missense_Mutation_p.D25V|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.D14V|CUX1_ENST00000437600.4_Missense_Mutation_p.D25V|CUX1_ENST00000560541.1_3'UTR	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	14					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.D25V(1)|p.D14V(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AGAGAACTCGATGCCACCGCA	0.502																																																2	Substitution - Missense(2)	ovary(2)	7											154.0	149.0	151.0					7																	101559405		2203	4300	6503	101346125	SO:0001583	missense	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.41A>T	7.37:g.101559405A>T	ENSP00000292535:p.Asp14Val	Unknown		x	x	x	101346125	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193367	0.78902	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000393824;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.59638	1.4;0.25;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	T	0.73377	0.3579	M	0.64404	1.975	0.80722	D	1	P;D;D;D;D;D	0.89917	0.954;0.999;1.0;0.993;0.999;0.99	P;D;D;D;P;P	0.87578	0.637;0.996;0.998;0.955;0.897;0.901	T	0.76231	-0.3035	10	0.87932	D	0	-15.4583	14.5506	0.68065	1.0:0.0:0.0:0.0	.	14;25;25;25;25;25	P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	CUX1_HUMAN;.;.;.;CASP_HUMAN;.	V	25;25;25;25;25;25;14;14;14;14;14	ENSP00000292538:D25V;ENSP00000449371:D25V;ENSP00000353401:D25V;ENSP00000409745:D25V;ENSP00000414091:D25V;ENSP00000292535:D14V;ENSP00000446630:D14V;ENSP00000447373:D14V;ENSP00000450125:D14V;ENSP00000451558:D14V	ENSP00000292535:D14V	D	+	2	0	CUX1	101346125	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.294000	0.89934	2.169000	0.68431	0.533000	0.62120	GAT		0.502	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		Missense_Mutation
CDHR3	222256	broad.mit.edu	37	7	105655652	105655652	+	Nonsense_Mutation	SNP	C	C	G			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:105655652C>G	ENST00000317716.9	+	10	1400	c.1320C>G	c.(1318-1320)taC>taG	p.Y440*	CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000542731.1_Nonsense_Mutation_p.Y440*|CDHR3_ENST00000343407.5_Nonsense_Mutation_p.Y157*|CDHR3_ENST00000478080.1_Nonsense_Mutation_p.Y352*	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	440	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y440*(1)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CCCCCCCTTACTATAAAAGCA	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	7											55.0	51.0	52.0					7																	105655652		1859	4092	5951	105442888	SO:0001587	stop_gained	222256			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.1320C>G	7.37:g.105655652C>G	ENSP00000325954:p.Tyr440*	Unknown		x	x	x	105442888	Q8TCI7	Nonsense_Mutation	SNP	ENST00000317716.9	37	CCDS47684.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.537371	0.96460	.	.	ENSG00000128536	ENST00000542731;ENST00000343407;ENST00000317716;ENST00000478080;ENST00000466045	.	.	.	5.73	1.86	0.25419	.	0.486593	0.20594	N	0.089285	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7307	6.1725	0.20424	0.12:0.6179:0.0:0.2621	.	.	.	.	X	440;157;440;352;198	.	ENSP00000325954:Y440X	Y	+	3	2	CDHR3	105442888	0.999000	0.42202	0.982000	0.44146	0.502000	0.33828	0.484000	0.22308	0.350000	0.24002	0.655000	0.94253	TAC		0.418	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750		Nonsense_Mutation
NRCAM	4897	broad.mit.edu	37	7	107824978	107824978	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr7:107824978T>C	ENST00000425651.2	-	18	2115	c.2116A>G	c.(2116-2118)Aca>Gca	p.T706A	NRCAM_ENST00000413765.2_Missense_Mutation_p.T687A|NRCAM_ENST00000379028.3_Missense_Mutation_p.T706A|NRCAM_ENST00000379024.4_Missense_Mutation_p.T687A|NRCAM_ENST00000379022.4_Missense_Mutation_p.T706A|NRCAM_ENST00000351718.4_Missense_Mutation_p.T690A	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	706	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)	p.T690A(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						AGCTGGGCTGTGGTCTGTGTT	0.522																																																1	Substitution - Missense(1)	ovary(1)	7											96.0	91.0	93.0					7																	107824978		2203	4300	6503	107612214	SO:0001583	missense	4897				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2116A>G	7.37:g.107824978T>C	ENSP00000401244:p.Thr706Ala	Somatic		x	x	x	107612214	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	37	CCDS47686.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313535	0.60414	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979	T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55	5.28	4.12	0.48240	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	L	0.55213	1.73	0.80722	D	1	B;B;B;B;B	0.22800	0.007;0.075;0.008;0.007;0.005	B;B;B;B;B	0.29176	0.028;0.099;0.062;0.037;0.022	T	0.25187	-1.0139	10	0.12430	T	0.62	.	11.1957	0.48711	0.0:0.0726:0.0:0.9274	.	706;687;687;690;706	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	A	706;706;687;706;690;687;706;706;690	ENSP00000368314:T706A;ENSP00000407858:T687A;ENSP00000325269:T690A;ENSP00000368310:T687A;ENSP00000401244:T706A;ENSP00000368308:T706A	ENSP00000325269:T690A	T	-	1	0	NRCAM	107612214	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.967000	0.70403	0.823000	0.34589	0.482000	0.46254	ACA		0.522	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132		Missense_Mutation
RP1	6101	broad.mit.edu	37	8	55541830	55541830	+	Silent	SNP	G	G	T	rs183370413		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr8:55541830G>T	ENST00000220676.1	+	4	5536	c.5388G>T	c.(5386-5388)acG>acT	p.T1796T		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1796					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.T1796T(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CAGGCCCAACGATGGATGAAC	0.448																																					Colon(91;1014 1389 7634 14542 40420)											1	Substitution - coding silent(1)	ovary(1)	8											76.0	73.0	74.0					8																	55541830		2203	4300	6503	55704383	SO:0001819	synonymous_variant	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5388G>T	8.37:g.55541830G>T		Unknown		x	x	x	55704383		Silent	SNP	ENST00000220676.1	37	CCDS6160.1	SNP	37	Broad																																																																																				0.448	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269		Silent
MYBL1	4603	broad.mit.edu	37	8	67477044	67477044	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr8:67477044T>C	ENST00000522677.3	-	16	2557	c.2147A>G	c.(2146-2148)gAa>gGa	p.E716G	MYBL1_ENST00000524176.2_Missense_Mutation_p.E656G|MYBL1_ENST00000517885.1_Missense_Mutation_p.E374G|MYBL1_ENST00000522419.1_5'Flank	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	716					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E716G(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			AACCACTGTTTCCCATTCACA	0.318																																																1	Substitution - Missense(1)	ovary(1)	8											102.0	94.0	96.0					8																	67477044		1851	4079	5930	67639598	SO:0001583	missense	4603			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.2147A>G	8.37:g.67477044T>C	ENSP00000429633:p.Glu716Gly	Unknown		x	x	x	67639598	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	37	CCDS47867.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170869	0.57584	.	.	ENSG00000185697	ENST00000522677;ENST00000517885;ENST00000524176	T;T;T	0.21543	2.53;2.08;2.0	5.3	5.3	0.74995	.	0.052101	0.85682	D	0.000000	T	0.45357	0.1338	M	0.73217	2.22	0.45867	D	0.998728	D;D;D	0.89917	0.988;0.988;1.0	P;P;D	0.69142	0.761;0.761;0.962	T	0.44757	-0.9307	10	0.62326	D	0.03	-18.9445	15.2779	0.73756	0.0:0.0:0.0:1.0	.	656;655;716	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	G	716;374;656	ENSP00000429633:E716G;ENSP00000428265:E374G;ENSP00000428011:E656G	ENSP00000428265:E374G	E	-	2	0	MYBL1	67639598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.306000	0.78905	2.000000	0.58554	0.533000	0.62120	GAA		0.318	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274		Missense_Mutation
FAM83A	84985	broad.mit.edu	37	8	124195422	124195422	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr8:124195422C>T	ENST00000518448.1	+	2	2340	c.326C>T	c.(325-327)gCc>gTc	p.A109V	FAM83A_ENST00000536633.1_Missense_Mutation_p.A109V|RP11-539E17.5_ENST00000522383.1_RNA|FAM83A_ENST00000546351.1_Missense_Mutation_p.A109V|FAM83A_ENST00000276699.6_Missense_Mutation_p.A109V|FAM83A_ENST00000318462.6_Missense_Mutation_p.A109V|FAM83A_ENST00000522648.1_Missense_Mutation_p.A109V|U3_ENST00000408534.1_RNA			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	109								p.A109V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TTCCCTGTGGCCTCAGAGGGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	8											60.0	63.0	62.0					8																	124195422		2203	4300	6503	124264603	SO:0001583	missense	84985			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.326C>T	8.37:g.124195422C>T	ENSP00000428876:p.Ala109Val	Unknown		x	x	x	124264603	Q71HL2|Q8N7I1|Q96I47	Missense_Mutation	SNP	ENST00000518448.1	37	CCDS6340.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	7.306	0.614075	0.14066	.	.	ENSG00000147689	ENST00000518448;ENST00000546351;ENST00000536633;ENST00000318462;ENST00000522648;ENST00000276699	T;T;T;T;T;T	0.11712	2.75;2.93;2.75;2.75;2.93;2.75	5.46	3.17	0.36434	.	1.028510	0.07646	N	0.931163	T	0.07503	0.0189	L	0.32530	0.975	0.18873	N	0.999986	B;B;B	0.18461	0.01;0.023;0.028	B;B;B	0.15052	0.007;0.012;0.012	T	0.40421	-0.9564	10	0.16420	T	0.52	-20.8259	3.0737	0.06239	0.482:0.3597:0.0:0.1583	.	109;109;109	Q86UY5-2;Q86UY5-3;Q86UY5	.;.;FA83A_HUMAN	V	109	ENSP00000428876:A109V;ENSP00000440565:A109V;ENSP00000445218:A109V;ENSP00000323034:A109V;ENSP00000427979:A109V;ENSP00000276699:A109V	ENSP00000276699:A109V	A	+	2	0	FAM83A	124264603	0.991000	0.36638	0.910000	0.35882	0.292000	0.27327	2.276000	0.43408	2.548000	0.85928	0.561000	0.74099	GCC		0.647	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381737.1	NM_032899		Missense_Mutation
FER1L6	654463	broad.mit.edu	37	8	125107259	125107259	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr8:125107259G>T	ENST00000522917.1	+	35	4881	c.4675G>T	c.(4675-4677)Gat>Tat	p.D1559Y	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Missense_Mutation_p.D1559Y	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1559						integral component of membrane (GO:0016021)		p.D1559Y(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GTACCACAAGGATAAGCCAGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	8											83.0	76.0	78.0					8																	125107259		1919	4147	6066	125176440	SO:0001583	missense	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4675G>T	8.37:g.125107259G>T	ENSP00000428280:p.Asp1559Tyr	Unknown		x	x	x	125176440		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210887	0.79240	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.86030	-2.06;-2.06	5.52	4.64	0.57946	.	0.183179	0.44902	U	0.000420	D	0.90438	0.7006	M	0.74258	2.255	0.58432	D	0.999997	D	0.89917	1.0	D	0.72982	0.979	D	0.88311	0.2956	10	0.14252	T	0.57	-24.3396	14.3995	0.67034	0.0709:0.0:0.9291:0.0	.	1559	Q2WGJ9	FR1L6_HUMAN	Y	1559	ENSP00000428280:D1559Y;ENSP00000381982:D1559Y	ENSP00000381982:D1559Y	D	+	1	0	FER1L6	125176440	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.752000	0.68728	1.470000	0.48102	0.551000	0.68910	GAT		0.473	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		Missense_Mutation
SECISBP2	79048	broad.mit.edu	37	9	91940489	91940489	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr9:91940489G>C	ENST00000375807.3	+	3	401	c.330G>C	c.(328-330)caG>caC	p.Q110H	SECISBP2_ENST00000339901.4_Missense_Mutation_p.Q37H|SECISBP2_ENST00000534113.2_Missense_Mutation_p.Q42H|SECISBP2_ENST00000470305.1_3'UTR	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	110					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.Q110H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CTGGCTCCCAGTATCTTTATA	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											214.0	203.0	207.0					9																	91940489		2203	4300	6503	91130309	SO:0001583	missense	79048			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.330G>C	9.37:g.91940489G>C	ENSP00000364965:p.Gln110His	Unknown		x	x	x	91130309	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.590	-0.295382	0.05532	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.77877	-1.09;-1.13;-1.07	4.17	-2.73	0.05950	.	1.082170	0.07022	N	0.827008	T	0.61788	0.2375	L	0.29908	0.895	0.09310	N	0.99999	B;B;B;B;B	0.13594	0.008;0.0;0.003;0.002;0.001	B;B;B;B;B	0.11329	0.006;0.001;0.004;0.003;0.003	T	0.45775	-0.9238	10	0.49607	T	0.09	-0.2068	3.2655	0.06864	0.1521:0.3807:0.3369:0.1303	.	130;110;37;110;42	Q59H19;B4DZC7;Q96T21-2;Q96T21;F8W892	.;.;.;SEBP2_HUMAN;.	H	110;130;37;42	ENSP00000364965:Q110H;ENSP00000364959:Q37H;ENSP00000436650:Q42H	ENSP00000364959:Q37H	Q	+	3	2	SECISBP2	91130309	0.000000	0.05858	0.008000	0.14137	0.056000	0.15407	0.145000	0.16157	-0.715000	0.04968	-1.373000	0.01185	CAG		0.418	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077		Missense_Mutation
IKBKAP	8518	broad.mit.edu	37	9	111670665	111670665	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr9:111670665G>T	ENST00000374647.5	-	13	1687	c.1380C>A	c.(1378-1380)gaC>gaA	p.D460E	IKBKAP_ENST00000537196.1_Missense_Mutation_p.D111E	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	460					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)	p.D460E(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TCACTGTAGGGTCAGCACTTG	0.368																																																1	Substitution - Missense(1)	ovary(1)	9											66.0	66.0	66.0					9																	111670665		2203	4300	6503	110710486	SO:0001583	missense	8518			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1380C>A	9.37:g.111670665G>T	ENSP00000363779:p.Asp460Glu	Unknown		x	x	x	110710486	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	37	CCDS6773.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098246	0.56183	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.25749	1.78;1.78	5.56	2.28	0.28536	.	0.462954	0.25277	N	0.031825	T	0.41396	0.1157	M	0.76838	2.35	0.25592	N	0.986686	D	0.76494	0.999	D	0.72075	0.976	T	0.32981	-0.9886	10	0.11182	T	0.66	-18.4579	6.4128	0.21700	0.4534:0.0:0.5466:0.0	.	460	O95163	ELP1_HUMAN	E	460;111	ENSP00000363779:D460E;ENSP00000439367:D111E	ENSP00000363779:D460E	D	-	3	2	IKBKAP	110710486	1.000000	0.71417	0.571000	0.28486	0.685000	0.39939	0.558000	0.23469	0.492000	0.27815	0.655000	0.94253	GAC		0.368	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1			Missense_Mutation
FKBP15	23307	broad.mit.edu	37	9	115950085	115950085	+	Silent	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr9:115950085G>C	ENST00000238256.3	-	14	1488	c.1371C>G	c.(1369-1371)gcC>gcG	p.A457A		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	457					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)		p.A482A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GAAAGGATTGGGCATTTCCAG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											74.0	72.0	72.0					9																	115950085		1928	4122	6050	114989906	SO:0001819	synonymous_variant	23307			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.1371C>G	9.37:g.115950085G>C		Unknown		x	x	x	114989906	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	CCDS48007.1	SNP	43	Broad																																																																																				0.418	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258		Silent
MAN1B1	11253	broad.mit.edu	37	9	139983342	139983342	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr9:139983342A>T	ENST00000371589.4	+	3	423	c.350A>T	c.(349-351)gAa>gTa	p.E117V	AL807752.1_ENST00000596585.1_5'Flank|MAN1B1_ENST00000474902.1_5'Flank	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	117					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.E117V(1)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		AGGCTAGAGGAAGAGCAGAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	9											79.0	85.0	83.0					9																	139983342		2203	4300	6503	139103163	SO:0001583	missense	11253			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.350A>T	9.37:g.139983342A>T	ENSP00000360645:p.Glu117Val	Unknown		x	x	x	139103163	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	ENST00000371589.4	37	CCDS7029.1	SNP	9	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.47|14.47	2.544792|2.544792	0.45280|0.45280	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000371589|ENST00000540346	T|.	0.73047|.	-0.71|.	4.47|4.47	4.47|4.47	0.54385|0.54385	.|.	0.089950|.	0.47455|.	U|.	0.000235|.	T|.	0.61009|.	0.2313|.	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	D;P;P;D|.	0.76494|.	0.998;0.949;0.454;0.999|.	D;B;B;D|.	0.64687|.	0.928;0.443;0.153;0.922|.	T|.	0.59295|.	-0.7481|.	9|.	.|.	.|.	.|.	.|.	12.9408|12.9408	0.58342|0.58342	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	18;81;117;18|.	B4DPS9;B4DR05;Q9UKM7;Q68D80|.	.;.;MA1B1_HUMAN;.|.	V|X	117|114	ENSP00000360645:E117V|.	.|.	E|K	+|+	2|1	0|0	MAN1B1|MAN1B1	139103163|139103163	0.989000|0.989000	0.36119|0.36119	0.030000|0.030000	0.17652|0.17652	0.019000|0.019000	0.09904|0.09904	2.839000|2.839000	0.48207|0.48207	1.645000|1.645000	0.50612|0.50612	0.459000|0.459000	0.35465|0.35465	GAA|AAG		0.443	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219		Missense_Mutation
ARL13A	392509	broad.mit.edu	37	X	100243217	100243217	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chrX:100243217G>C	ENST00000450049.2	+	7	802	c.689G>C	c.(688-690)aGa>aCa	p.R230T		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	230					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)	p.R230T(1)		endometrium(1)|ovary(1)	2						AAGGAGAAAAGACAGCATCTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	62.0	66.0					X																	100243217		1941	4120	6061	100129873	SO:0001583	missense	392509				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.689G>C	X.37:g.100243217G>C	ENSP00000398637:p.Arg230Thr	Unknown		x	x	x	100129873	B2RTT6|B4DX50	Missense_Mutation	SNP	ENST00000450049.2	37	CCDS55463.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774659	0.49786	.	.	ENSG00000174225	ENST00000450049;ENST00000372953	T	0.64803	-0.12	3.52	2.66	0.31614	.	0.609780	0.16512	N	0.211186	T	0.51143	0.1657	L	0.34521	1.04	0.23798	N	0.996811	D;D	0.58620	0.983;0.983	P;B	0.46389	0.515;0.435	T	0.42464	-0.9450	10	0.59425	D	0.04	.	6.0891	0.19985	0.1433:0.0:0.8567:0.0	.	230;230	B2RTT6;Q5H913	.;AR13A_HUMAN	T	230;104	ENSP00000398637:R230T	ENSP00000362044:R104T	R	+	2	0	ARL13A	100129873	0.000000	0.05858	0.765000	0.31456	0.182000	0.23217	-0.117000	0.10708	0.878000	0.35920	0.436000	0.28706	AGA		0.413	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000057504.2	XM_373358		Missense_Mutation
F8	2157	broad.mit.edu	37	X	154156922	154156922	+	Nonsense_Mutation	SNP	G	G	A	rs137852439		TCGA-04-1367-01	TCGA-04-1367-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chrX:154156922G>A	ENST00000360256.4	-	14	5343	c.5143C>T	c.(5143-5145)Cga>Tga	p.R1715*		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1715	F5/8 type A 3.|Plastocyanin-like 5.		R -> G (in HEMA; mild). {ECO:0000269|PubMed:1349567, ECO:0000269|PubMed:9886318}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.R1715*(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AAATAGTGTCGTGTTTTCTTT	0.398																																																2	Substitution - Nonsense(2)	ovary(2)	X	GRCh37	CM900094|CM920258	F8	M	rs137852439						73.0	63.0	67.0					X																	154156922		2203	4300	6503	153810116	SO:0001587	stop_gained	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5143C>T	X.37:g.154156922G>A	ENSP00000353393:p.Arg1715*	Somatic		x	x	x	153810116	Q14286|Q5HY69	Nonsense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	47	12.971596	0.99710	.	.	ENSG00000185010	ENST00000360256	.	.	.	5.01	4.11	0.48088	.	0.303929	0.32147	N	0.006514	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.3121	9.6412	0.39839	0.0:0.0:0.7916:0.2084	.	.	.	.	X	1715	.	ENSP00000353393:R1715X	R	-	1	2	F8	153810116	1.000000	0.71417	0.820000	0.32676	0.984000	0.73092	3.491000	0.53252	0.838000	0.34948	0.544000	0.68410	CGA		0.398	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4			Nonsense_Mutation
SEC16B	89866	broad.mit.edu	37	1	177928095	177928105	+	Frame_Shift_Del	DEL	CTTATGTACAT	CTTATGTACAT	-	rs188833273		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:177928095_177928105delCTTATGTACAT	ENST00000308284.6	-	9	1093_1103	c.1004_1014delATGTACATAAG	c.(1003-1014)gatgtacataagfs	p.DVHK335fs	SEC16B_ENST00000464631.2_Frame_Shift_Del_p.DVHK336fs|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	335					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.D336fs*18(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						TAATATCCACCTTATGTACATCTTCCCTACA	0.507																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								176194728	SO:0001589	frameshift_variant	89866			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1004_1014delATGTACATAAG	1.37:g.177928095_177928105delCTTATGTACAT	ENSP00000308339:p.Asp335fs	Unknown		Capture	Illumina GAIIx	Phase_I	176194718	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Frame_Shift_Del	DEL	ENST00000308284.6	37	CCDS44281.1	DEL	24	Broad																																																																																				0.507	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		Frame_Shift_Del
DHX9	1660	broad.mit.edu	37	1	182822552	182822566	+	Splice_Site	DEL	CGGTAAGGCCAGCAC	CGGTAAGGCCAGCAC	-	rs201554390|rs544355760		TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr1:182822552_182822566delCGGTAAGGCCAGCAC	ENST00000367549.3	+	5	586_587	c.476_477delCGGTAAGGCCAGCAC	c.(475-477)gcg>g	p.A159del		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	159	Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.?(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GAAGTGCAAGCGGTAAGGCCAGCACCGTAGGTTAC	0.465																																					Colon(69;210 1162 3697 13559 39565)											1	Unknown(1)	ovary(1)	1																																								181089189	SO:0001630	splice_region_variant	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.477+1CGGTAAGGCCAGCAC>-	1.37:g.182822552_182822566delCGGTAAGGCCAGCAC		Unknown		Capture	Illumina GAIIx	Phase_I	181089175	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Splice_Site_Del	DEL	ENST00000367549.3	37	CCDS41444.1	DEL	27	Broad																																																																																				0.465	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	In_Frame_Del	Splice_Site_Del
HEPHL1	341208	broad.mit.edu	37	11	93819323	93819330	+	Frame_Shift_Del	DEL	CCACAACA	CCACAACA	-			TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr11:93819323_93819330delCCACAACA	ENST00000315765.9	+	11	2056_2063	c.2048_2055delCCACAACA	c.(2047-2055)gccacaacafs	p.ATT683fs		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	683	Plastocyanin-like 4.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.A687fs*12(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCCCACATGGCCACAACAGCATTCATGC	0.519																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								93458978	SO:0001589	frameshift_variant	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2048_2055delCCACAACA	11.37:g.93819323_93819330delCCACAACA	ENSP00000313699:p.Ala683fs	Unknown		Capture	Illumina GAIIx	Phase_I	93458971	Q3C1W7	Frame_Shift_Del	DEL	ENST00000315765.9	37	CCDS44710.1	DEL	26	Broad																																																																																				0.519	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947		Frame_Shift_Del
KRT82	3888	broad.mit.edu	37	12	52797542	52797554	+	Frame_Shift_Del	DEL	ACGCGGTCCCCGG	ACGCGGTCCCCGG	-	rs144174481|rs148502413|rs113026141|rs200534923	byFrequency	TCGA-04-1367-01	TCGA-04-1367-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-04-1367-01	TCGA-04-1367-10	g.chr12:52797542_52797554delACGCGGTCCCCGG	ENST00000257974.2	-	2	628_640	c.551_563delCCGGGGACCGCGT	c.(550-564)tccggggaccgcgtgfs	p.SGDRV184fs	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	184	Coil 1B.|Rod.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.G185R(1)|p.S184fs*1(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		CTCTAGCCTCACGCGGTCCCCGGACACACAGTC	0.592																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|large_intestine(1)	12																																								51083821	SO:0001589	frameshift_variant	3888			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.551_563delCCGGGGACCGCGT	12.37:g.52797542_52797554delACGCGGTCCCCGG	ENSP00000257974:p.Ser184fs	Unknown		Capture	Illumina GAIIx	Phase_I	51083809		Frame_Shift_Del	DEL	ENST00000257974.2	37	CCDS8826.1	DEL	6	Broad																																																																																				0.592	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033		Frame_Shift_Del
