#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
AMPD3	272	hgsc.bcm.edu	37	11	10506457	10506457	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1514-01	TCGA-04-1514-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr11:10506457G>T	ENST00000396554.3	+	5	1048	c.707G>T	c.(706-708)gGc>gTc	p.G236V	AMPD3_ENST00000444303.2_Missense_Mutation_p.G68V	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	227					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.G236V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		ATGCAGGGGGGCATCCTCTTT	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											102.0	87.0	92.0					11																	10506457		2201	4294	6495	10463033	SO:0001583	missense	272			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.707G>T	11.37:g.10506457G>T	ENSP00000379802:p.Gly236Val	Somatic		Capture	SOLID	Phase_IV	10463033	A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	37	CCDS7802.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.140118	0.94560	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	D;D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.97365	0.9138	M	0.93939	3.475	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.938;1.0	D	0.97752	1.0215	10	0.87932	D	0	-24.3068	20.0893	0.97812	0.0:0.0:1.0:0.0	.	234;227;236	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	V	68;236;227;227;234;227	ENSP00000396000:G68V;ENSP00000379802:G236V;ENSP00000433284:G227V;ENSP00000379801:G227V;ENSP00000436987:G234V;ENSP00000431648:G227V	ENSP00000379801:G227V	G	+	2	0	AMPD3	10463033	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.869000	0.99810	2.761000	0.94854	0.655000	0.94253	GGC		0.577	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480		Missense_Mutation
ANKRD52	283373	hgsc.bcm.edu	37	12	56647530	56647530	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr12:56647530G>A	ENST00000267116.7	-	9	1082	c.961C>T	c.(961-963)Cgc>Tgc	p.R321C		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	321								p.R321C(1)		endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						ATCTGGGAGCGTGTGAAACGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											110.0	121.0	117.0					12																	56647530		1932	4138	6070	54933797	SO:0001583	missense	283373			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.961C>T	12.37:g.56647530G>A	ENSP00000267116:p.Arg321Cys	Somatic		Capture	SOLID	Phase_IV	54933797	A6NE79|B1Q2K2	Missense_Mutation	SNP	ENST00000267116.7	37	CCDS44920.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107604	0.77096	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	T	0.62639	0.01	4.62	4.62	0.57501	Ankyrin repeat-containing domain (4);	0.059138	0.64402	D	0.000001	T	0.30978	0.0782	N	0.00413	-1.525	0.80722	D	1	P	0.47545	0.897	B	0.40444	0.329	T	0.58148	-0.7687	10	0.54805	T	0.06	.	16.7736	0.85545	0.0:0.0:1.0:0.0	.	321	Q8NB46	ANR52_HUMAN	C	321	ENSP00000267116:R321C	ENSP00000267116:R321C	R	-	1	0	ANKRD52	54933797	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	6.428000	0.73383	2.553000	0.86117	0.655000	0.94253	CGC		0.488	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595		Missense_Mutation
NOA1	84273	hgsc.bcm.edu	37	4	57830619	57830619	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr4:57830619C>A	ENST00000264230.4	-	6	3075	c.1838G>T	c.(1837-1839)gGa>gTa	p.G613V		NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	613					apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.G613V(1)									TGCCCCCAGTCCTTCTTTTAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											179.0	184.0	182.0					4																	57830619		2203	4300	6503	57525376	SO:0001583	missense	84273			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.1838G>T	4.37:g.57830619C>A	ENSP00000264230:p.Gly613Val	Somatic		Capture	SOLID	Phase_IV	57525376	Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	ENST00000264230.4	37	CCDS3510.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268429	0.40095	.	.	ENSG00000084092	ENST00000264230	T	0.35605	1.3	5.37	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.48537	0.1505	L	0.31926	0.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49799	-0.8901	10	0.59425	D	0.04	.	13.7844	0.63102	0.0:0.925:0.0:0.075	.	613	Q8NC60	CD014_HUMAN	V	613	ENSP00000264230:G613V	ENSP00000264230:G613V	G	-	2	0	C4orf14	57525376	1.000000	0.71417	0.548000	0.28192	0.011000	0.07611	3.306000	0.51881	1.392000	0.46585	0.557000	0.71058	GGA		0.408	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2	NM_032313		Missense_Mutation
C9orf50	375759	hgsc.bcm.edu	37	9	132375843	132375843	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr9:132375843G>C	ENST00000372478.4	-	5	1115	c.914C>G	c.(913-915)gCc>gGc	p.A305G	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	305								p.A305G(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				CACTGGCAGGGCGGCCTTCTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											69.0	70.0	70.0					9																	132375843		2203	4300	6503	131415664	SO:0001583	missense	375759			AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.914C>G	9.37:g.132375843G>C	ENSP00000361556:p.Ala305Gly	Somatic		Capture	SOLID	Phase_IV	131415664	Q2M1I2|Q8NA65	Missense_Mutation	SNP	ENST00000372478.4	37	CCDS35159.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.786	0.710495	0.15239	.	.	ENSG00000179058	ENST00000372478	T	0.23348	1.91	3.27	-0.707	0.11245	.	1.186270	0.06534	N	0.742079	T	0.11623	0.0283	N	0.12182	0.205	0.09310	N	1	P	0.36837	0.571	B	0.36335	0.222	T	0.15350	-1.0440	10	0.31617	T	0.26	0.0666	0.6758	0.00866	0.2333:0.1896:0.3829:0.1943	.	305	Q5SZB4	CI050_HUMAN	G	305	ENSP00000361556:A305G	ENSP00000361556:A305G	A	-	2	0	C9orf50	131415664	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.246000	0.18160	-0.137000	0.11455	0.456000	0.33151	GCC		0.627	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054593.1	NM_199350		Missense_Mutation
CDH9	1007	hgsc.bcm.edu	37	5	26988429	26988429	+	Silent	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr5:26988429G>A	ENST00000231021.4	-	2	184	c.12C>T	c.(10-12)taC>taT	p.Y4Y		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	4					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y4Y(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTATATAATGGTAAGTCCTCA	0.323																																					Melanoma(8;187 585 15745 40864 52829)											1	Substitution - coding silent(1)	ovary(1)	5											115.0	121.0	119.0					5																	26988429		2203	4300	6503	27024186	SO:0001819	synonymous_variant	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.12C>T	5.37:g.26988429G>A		Somatic		Capture	SOLID	Phase_IV	27024186	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1	SNP	44	Baylor																																																																																				0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279		Silent
CHD8	57680	hgsc.bcm.edu	37	14	21870226	21870226	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1514-01	TCGA-04-1514-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr14:21870226C>A	ENST00000557364.1	-	20	4215	c.3952G>T	c.(3952-3954)Gaa>Taa	p.E1318*	CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000430710.3_Nonsense_Mutation_p.E1039*|CHD8_ENST00000399982.2_Nonsense_Mutation_p.E1318*			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1318					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.E1318*(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TCATCATCTTCCTCCATGATG	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	14											140.0	133.0	135.0					14																	21870226		2029	4222	6251	20940066	SO:0001587	stop_gained	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3952G>T	14.37:g.21870226C>A	ENSP00000451601:p.Glu1318*	Somatic		Capture	SOLID	Phase_IV	20940066	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Nonsense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.114213|6.114213	0.97296|0.97296	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364|ENST00000555935	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.79997	.|0.4543	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.76767	.|-0.2838	.|3	0.66056|.	D|.	0.02|.	-22.9691|-22.9691	19.6509|19.6509	0.95805|0.95805	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	1039;1318;1038;1318|543	.|.	ENSP00000262707:E1038X|.	E|G	-|-	1|2	0|0	CHD8|CHD8	20940066|20940066	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.776000|7.776000	0.85560|0.85560	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|GGA		0.388	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920		Nonsense_Mutation
CHN1	1123	hgsc.bcm.edu	37	2	175816915	175816915	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:175816915C>G	ENST00000409900.3	-	2	348	c.35G>C	c.(34-36)aGa>aCa	p.R12T	CHN1_ENST00000488080.1_5'UTR|CHN1_ENST00000409156.3_Missense_Mutation_p.R12T	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	12					ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.R12T(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			AACAGGAGGTCTATATTCATC	0.229			T	TAF15	extraskeletal myxoid chondrosarcoma																																		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	1	Substitution - Missense(1)	ovary(1)	2											26.0	26.0	26.0					2																	175816915		1778	4022	5800	175525161	SO:0001583	missense	1123				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.35G>C	2.37:g.175816915C>G	ENSP00000386741:p.Arg12Thr	Somatic		Capture	SOLID	Phase_IV	175525161	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	ENST00000409900.3	37	CCDS46455.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.49	1.952794	0.34471	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	T;T	0.70869	-0.52;-0.11	5.6	5.6	0.85130	.	.	.	.	.	T	0.63224	0.2493	L	0.44542	1.39	0.48830	D	0.999718	B;B	0.23540	0.087;0.041	B;B	0.28011	0.085;0.085	T	0.57207	-0.7851	9	0.12766	T	0.61	.	15.1252	0.72478	0.0:1.0:0.0:0.0	.	12;12	B4DV19;P15882	.;CHIN_HUMAN	T	12	ENSP00000386741:R12T;ENSP00000386470:R12T	ENSP00000386470:R12T	R	-	2	0	CHN1	175525161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.064000	0.64338	2.636000	0.89361	0.655000	0.94253	AGA		0.229	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1	NM_001822		Missense_Mutation
COPS8	10920	hgsc.bcm.edu	37	2	237998543	237998543	+	Silent	SNP	A	A	G			TCGA-04-1514-01	TCGA-04-1514-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:237998543A>G	ENST00000354371.2	+	4	890	c.237A>G	c.(235-237)caA>caG	p.Q79Q	COPS8_ENST00000409334.1_Silent_p.Q79Q|COPS8_ENST00000409629.1_Silent_p.Q79Q|COPS8_ENST00000392008.2_Silent_p.Q30Q	NM_006710.4	NP_006701.1	Q99627	CSN8_HUMAN	COP9 signalosome subunit 8	79	PCI.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cullin deneddylation (GO:0010388)|negative regulation of cell proliferation (GO:0008285)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.Q79Q(1)		large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Breast(86;0.000162)|Renal(207;0.00339)|all_hematologic(139;0.0123)|Ovarian(221;0.0694)|Acute lymphoblastic leukemia(138;0.0775)|all_lung(227;0.169)|all_neural(83;0.211)		Epithelial(121;7.41e-23)|OV - Ovarian serous cystadenocarcinoma(60;5.42e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000175)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0258)		CAGTAGGACAAAGAATCTGGC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											76.0	77.0	76.0					2																	237998543		2203	4300	6503	237663282	SO:0001819	synonymous_variant	10920				CCDS2517.1, CCDS42835.1	2q37.3	2013-03-14	2013-03-14		ENSG00000198612	ENSG00000198612			24335	protein-coding gene	gene with protein product			"""COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)"""			7634324, 12732143	Standard	NM_006710		Approved	COP9, CSN8, MGC1297, SGN8	uc002vwh.3	Q99627	OTTHUMG00000133297	ENST00000354371.2:c.237A>G	2.37:g.237998543A>G		Somatic		Capture	SOLID	Phase_IV	237663282	A8K1H6|Q53QS9	Silent	SNP	ENST00000354371.2	37	CCDS2517.1	SNP	1	Baylor																																																																																				0.433	COPS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257082.3	NM_006710		Silent
CTNNB1	1499	hgsc.bcm.edu	37	3	41275769	41275769	+	Missense_Mutation	SNP	G	G	C	rs186068630		TCGA-04-1514-01	TCGA-04-1514-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr3:41275769G>C	ENST00000349496.5	+	10	1944	c.1664G>C	c.(1663-1665)gGg>gCg	p.G555A	CTNNB1_ENST00000396183.3_Missense_Mutation_p.G555A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G555A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G555A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.G548A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	555					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G555A(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCCATGGGTGGGACACAGCAG	0.473		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	1	Substitution - Missense(1)	ovary(1)	3											122.0	103.0	109.0					3																	41275769		2203	4300	6503	41250773	SO:0001583	missense	1499	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1664G>C	3.37:g.41275769G>C	ENSP00000344456:p.Gly555Ala	Somatic		Capture	SOLID	Phase_IV	41250773	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202203	0.58234	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	5.96	5.96	0.96718	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56396	0.1982	L	0.42744	1.35	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.51787	-0.8661	10	0.13470	T	0.59	-16.878	20.422	0.99049	0.0:0.0:1.0:0.0	.	483;555	B4DSW9;P35222	.;CTNB1_HUMAN	A	555;555;555;548;555	ENSP00000385604:G555A;ENSP00000379486:G555A;ENSP00000344456:G555A;ENSP00000411226:G548A;ENSP00000379488:G555A	ENSP00000344456:G555A	G	+	2	0	CTNNB1	41250773	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.415000	0.97375	2.832000	0.97577	0.655000	0.94253	GGG		0.473	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210		Missense_Mutation
CXorf22	170063	hgsc.bcm.edu	37	X	35985797	35985797	+	Silent	SNP	C	C	T			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chrX:35985797C>T	ENST00000297866.5	+	10	1728	c.1662C>T	c.(1660-1662)cgC>cgT	p.R554R		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	554								p.R554R(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TGGCAAAACGCAAGAATTATG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	X											124.0	102.0	110.0					X																	35985797		2202	4300	6502	35895718	SO:0001819	synonymous_variant	170063			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1662C>T	X.37:g.35985797C>T		Somatic		Capture	SOLID	Phase_IV	35895718	Q5JRM8|Q8N6X8	Silent	SNP	ENST00000297866.5	37	CCDS14237.2	SNP	25	Baylor																																																																																				0.398	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		Silent
GPR114	221188	hgsc.bcm.edu	37	16	57600565	57600566	+	Frame_Shift_Ins	INS	-	-	G	rs201845314		TCGA-04-1514-01	TCGA-04-1514-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr16:57600565_57600566insG	ENST00000340339.4	+	7	1124_1125	c.601_602insG	c.(601-603)tggfs	p.W201fs	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Frame_Shift_Ins_p.W201fs	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	201	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W204fs*4(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						GAAACAGCCCTGGGGGGGCTGG	0.604																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								56158067	SO:0001589	frameshift_variant	221188			AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.608dupG	16.37:g.57600572_57600572dupG	ENSP00000342981:p.Trp201fs	Somatic		Capture	SOLID	Phase_IV	56158066	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Frame_Shift_Ins	INS	ENST00000340339.4	37	CCDS10785.1	INS	55	Baylor																																																																																				0.604	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837		Frame_Shift_Ins
HIVEP1	3096	hgsc.bcm.edu	37	6	12122613	12122613	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr6:12122613G>A	ENST00000379388.2	+	4	2917	c.2585G>A	c.(2584-2586)aGa>aAa	p.R862K		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	862					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R862K(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CATCCACTAAGAGGAAGTCAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	106.0	108.0					6																	12122613		1912	4138	6050	12230599	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.2585G>A	6.37:g.12122613G>A	ENSP00000368698:p.Arg862Lys	Somatic		Capture	SOLID	Phase_IV	12230599	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.285159	0.95517	.	.	ENSG00000095951	ENST00000379388	T	0.47177	0.85	6.02	6.02	0.97574	.	0.000000	0.39615	N	0.001312	T	0.71005	0.3289	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72371	-0.4314	9	.	.	.	-30.8482	20.5407	0.99260	0.0:0.0:1.0:0.0	.	862	P15822	ZEP1_HUMAN	K	862	ENSP00000368698:R862K	.	R	+	2	0	HIVEP1	12230599	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	AGA		0.453	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		Missense_Mutation
HNRNPH3	3189	hgsc.bcm.edu	37	10	70101791	70101791	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr10:70101791G>A	ENST00000265866.7	+	10	1186	c.1021G>A	c.(1021-1023)Gga>Aga	p.G341R	HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000441000.2_Missense_Mutation_p.G233R|HNRNPH3_ENST00000354695.5_Missense_Mutation_p.G326R	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	341	Gly-rich.				epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G341R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						GAGTGGAGGTGGATGGCGTGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	10											125.0	105.0	112.0					10																	70101791		2203	4300	6503	69771797	SO:0001583	missense	3189				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.1021G>A	10.37:g.70101791G>A	ENSP00000265866:p.Gly341Arg	Somatic		Capture	SOLID	Phase_IV	69771797	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Missense_Mutation	SNP	ENST00000265866.7	37	CCDS7278.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985323	0.53934	.	.	ENSG00000096746	ENST00000265866;ENST00000441000;ENST00000354695	T;T;T	0.19105	2.73;2.17;2.62	6.04	6.04	0.98038	.	0.187753	0.37809	N	0.001927	T	0.16981	0.0408	N	0.14661	0.345	0.80722	D	1	B;B;B	0.25904	0.137;0.087;0.137	B;B;B	0.20384	0.022;0.029;0.013	T	0.06180	-1.0841	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	233;326;341	B4DHY1;P31942-2;P31942	.;.;HNRH3_HUMAN	R	341;233;326	ENSP00000265866:G341R;ENSP00000409869:G233R;ENSP00000346726:G326R	ENSP00000265866:G341R	G	+	1	0	HNRNPH3	69771797	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.473000	0.60196	2.873000	0.98535	0.563000	0.77884	GGA		0.438	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1			Missense_Mutation
HOOK3	84376	hgsc.bcm.edu	37	8	42814397	42814397	+	Silent	SNP	A	A	C			TCGA-04-1514-01	TCGA-04-1514-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr8:42814397A>C	ENST00000307602.4	+	8	755	c.555A>C	c.(553-555)ctA>ctC	p.L185L		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	185					cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.L185L(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			CAGAGGAACTAAATGAAGCTT	0.343			T	RET	papillary thyroid																																		Dom	yes		8	8p11.21	84376	hook homolog 3		E	1	Substitution - coding silent(1)	ovary(1)	8											106.0	106.0	106.0					8																	42814397		2203	4300	6503	42933554	SO:0001819	synonymous_variant	84376			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.555A>C	8.37:g.42814397A>C		Somatic		Capture	SOLID	Phase_IV	42933554	D3DSY8|Q8NBH0|Q9BY13	Silent	SNP	ENST00000307602.4	37	CCDS6139.1	SNP	13	Baylor																																																																																				0.343	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410		Silent
MARCO	8685	hgsc.bcm.edu	37	2	119732118	119732118	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:119732118C>G	ENST00000327097.4	+	6	725	c.590C>G	c.(589-591)cCa>cGa	p.P197R	MARCO_ENST00000541757.1_Missense_Mutation_p.P119R	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	197	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.P197R(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CCCCAAGGCCCACCGGGAGTC	0.552																																					GBM(8;18 374 7467 11269 32796)											1	Substitution - Missense(1)	ovary(1)	2											66.0	70.0	69.0					2																	119732118		2203	4300	6503	119448588	SO:0001583	missense	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.590C>G	2.37:g.119732118C>G	ENSP00000318916:p.Pro197Arg	Somatic		Capture	SOLID	Phase_IV	119448588	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.55	1.380963	0.24944	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.98684	-5.07;-5.07	5.08	4.14	0.48551	.	0.263421	0.32687	N	0.005773	D	0.98432	0.9478	L	0.60957	1.885	0.36013	D	0.838233	D	0.89917	1.0	D	0.76575	0.988	D	0.99916	1.1227	9	.	.	.	.	8.5303	0.33331	0.0:0.884:0.0:0.116	.	197	Q9UEW3	MARCO_HUMAN	R	197;197;119	ENSP00000318916:P197R;ENSP00000441769:P119R	.	P	+	2	0	MARCO	119448588	0.023000	0.18921	0.988000	0.46212	0.856000	0.48823	0.091000	0.15046	1.381000	0.46364	0.655000	0.94253	CCA		0.552	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		Missense_Mutation
MGAT5	4249	hgsc.bcm.edu	37	2	135075162	135075163	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-04-1514-01	TCGA-04-1514-10	GA	GA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:135075162_135075163delGA	ENST00000409645.1	+	4	721_722	c.469_470delGA	c.(469-471)gagfs	p.E157fs	MGAT5_ENST00000281923.2_Frame_Shift_Del_p.E157fs			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	157					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.E157fs*34(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CCCTCACTGTGAGGGAAAGATC	0.431																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								134791633	SO:0001589	frameshift_variant	4249			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.469_470delGA	2.37:g.135075162_135075163delGA	ENSP00000386377:p.Glu157fs	Somatic		Capture	SOLID	Phase_IV	134791632	D3DP70	Frame_Shift_Del	DEL	ENST00000409645.1	37	CCDS2171.1	DEL	45	Baylor																																																																																				0.431	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410		Frame_Shift_Del
LRP1B	53353	hgsc.bcm.edu	37	2	141625196	141625196	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1514-01	TCGA-04-1514-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:141625196A>T	ENST00000389484.3	-	27	5513	c.4542T>A	c.(4540-4542)ttT>ttA	p.F1514L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1514					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.F1514L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCTGAAGGTCAAATGGCTGTG	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											190.0	167.0	175.0					2																	141625196		2203	4300	6503	141341666	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4542T>A	2.37:g.141625196A>T	ENSP00000374135:p.Phe1514Leu	Somatic		Capture	SOLID	Phase_IV	141341666	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479947	0.44044	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.90844	-2.74;-2.74	5.42	2.92	0.33932	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.88779	0.6529	N	0.25031	0.7	0.45883	D	0.998734	P;D	0.69078	0.879;0.997	P;D	0.70716	0.688;0.97	T	0.82839	-0.0259	10	0.17369	T	0.5	.	8.2768	0.31877	0.6845:0.0:0.3155:0.0	.	697;1514	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	L	1514;1452;659	ENSP00000374135:F1514L;ENSP00000413239:F659L	ENSP00000374135:F1514L	F	-	3	2	LRP1B	141341666	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.719000	0.25881	0.312000	0.23038	0.533000	0.62120	TTT		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
MORN1	79906	hgsc.bcm.edu	37	1	2305979	2305979	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr1:2305979G>T	ENST00000378531.3	-	7	728	c.555C>A	c.(553-555)gaC>gaA	p.D185E	MORN1_ENST00000606372.1_5'UTR|MORN1_ENST00000378529.3_Missense_Mutation_p.D185E|RP4-740C4.9_ENST00000606642.1_RNA	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	185								p.D185E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CACTGAAGACGTCGCTGTGCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											86.0	59.0	68.0					1																	2305979		2199	4297	6496	2295839	SO:0001583	missense	79906			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.555C>A	1.37:g.2305979G>T	ENSP00000367792:p.Asp185Glu	Somatic		Capture	SOLID	Phase_IV	2295839	A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	ENST00000378531.3	37	CCDS40.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037416	0.54896	.	.	ENSG00000116151	ENST00000378531;ENST00000378529;ENST00000419785;ENST00000378527	T;T	0.49432	0.78;0.78	5.07	-1.76	0.08006	.	0.222951	0.29286	N	0.012589	T	0.67979	0.2951	M	0.92691	3.335	0.09310	N	0.999997	D;D	0.71674	0.969;0.998	P;D	0.67725	0.749;0.953	T	0.61098	-0.7131	10	0.59425	D	0.04	.	9.3769	0.38288	0.5917:0.0:0.4083:0.0	.	185;185	Q5T089-2;Q5T089	.;MORN1_HUMAN	E	185;185;54;54	ENSP00000367792:D185E;ENSP00000367790:D185E	ENSP00000367788:D54E	D	-	3	2	MORN1	2295839	0.000000	0.05858	0.050000	0.19076	0.988000	0.76386	-0.579000	0.05834	-0.203000	0.10251	-0.258000	0.10820	GAC		0.617	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848		Missense_Mutation
OR10W1	81341	hgsc.bcm.edu	37	11	58034596	58034596	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr11:58034596G>T	ENST00000395079.2	-	1	1136	c.735C>A	c.(733-735)tgC>tgA	p.C245*		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C245*(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				TGAAGGCACAGCAGCCATACT	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	11											80.0	76.0	77.0					11																	58034596		2201	4295	6496	57791172	SO:0001587	stop_gained	81341			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.735C>A	11.37:g.58034596G>T	ENSP00000378516:p.Cys245*	Somatic		Capture	SOLID	Phase_IV	57791172	A2RUD2|A8MTE1|Q6UXQ2	Nonsense_Mutation	SNP	ENST00000395079.2	37	CCDS7968.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.131378	0.94473	.	.	ENSG00000172772	ENST00000395079	.	.	.	5.8	-6.83	0.01693	.	0.000000	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	16.7264	0.85423	0.469:0.0:0.531:0.0	.	.	.	.	X	245	.	ENSP00000378516:C245X	C	-	3	2	OR10W1	57791172	0.000000	0.05858	0.231000	0.23993	0.641000	0.38312	-3.462000	0.00463	-1.412000	0.02030	-0.122000	0.15005	TGC		0.592	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394704.1	NM_207374		Nonsense_Mutation
PAPPA	5069	hgsc.bcm.edu	37	9	119093633	119093633	+	Silent	SNP	C	C	A			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr9:119093633C>A	ENST00000328252.3	+	11	3627	c.3258C>A	c.(3256-3258)ctC>ctA	p.L1086L	PAPPA_ENST00000534838.1_Silent_p.L124L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1086					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L1086L(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CTTTTTGGCTCCGGGTAAGCT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	9											91.0	78.0	82.0					9																	119093633		2203	4300	6503	118133454	SO:0001819	synonymous_variant	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3258C>A	9.37:g.119093633C>A		Somatic		Capture	SOLID	Phase_IV	118133454	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.852	0.944734	0.18356	.	.	ENSG00000182752	ENST00000443904	.	.	.	6.06	5.15	0.70609	.	.	.	.	.	T	0.71753	0.3377	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74318	-0.3704	5	0.62326	D	0.03	-11.8919	11.3792	0.49746	0.1309:0.6164:0.2527:0.0	.	.	.	.	T	530	.	ENSP00000400477:P530T	P	+	1	0	PAPPA	118133454	0.998000	0.40836	1.000000	0.80357	0.844000	0.47949	0.459000	0.21908	1.552000	0.49463	0.655000	0.94253	CCG		0.522	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581		Silent
PFN4	375189	hgsc.bcm.edu	37	2	24345401	24345401	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:24345401C>T	ENST00000313213.4	-	2	376	c.5G>A	c.(4-6)aGc>aAc	p.S2N	FAM228B_ENST00000407625.1_5'Flank|PFN4_ENST00000465360.1_Intron|FAM228B_ENST00000420135.2_5'Flank|RP11-507M3.1_ENST00000584973.1_5'Flank	NM_199346.1	NP_955378.1	Q8NHR9	PROF4_HUMAN	profilin family, member 4	2					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	lipid binding (GO:0008289)	p.S2N(1)		breast(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCAAATGGCTCATGTTCCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	130.0	130.0					2																	24345401		2203	4300	6503	24198905	SO:0001583	missense	375189			BC029523	CCDS1709.1	2p24.1	2008-02-05			ENSG00000176732	ENSG00000176732			31103	protein-coding gene	gene with protein product							Standard	NM_199346		Approved		uc002rfa.1	Q8NHR9	OTTHUMG00000090816	ENST00000313213.4:c.5G>A	2.37:g.24345401C>T	ENSP00000322170:p.Ser2Asn	Somatic		Capture	SOLID	Phase_IV	24198905	Q53TL9	Missense_Mutation	SNP	ENST00000313213.4	37	CCDS1709.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.02	2.708194	0.48412	.	.	ENSG00000176732	ENST00000313213;ENST00000436622	.	.	.	5.05	4.11	0.48088	.	0.173320	0.40818	N	0.001018	T	0.13286	0.0322	N	0.02916	-0.46	0.30154	N	0.802779	P	0.51791	0.948	P	0.46237	0.508	T	0.05616	-1.0874	9	0.05959	T	0.93	-0.3848	10.9666	0.47416	0.0:0.811:0.189:0.0	.	2	Q8NHR9	PROF4_HUMAN	N	2	.	ENSP00000322170:S2N	S	-	2	0	PFN4	24198905	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	0.733000	0.26087	2.524000	0.85096	0.561000	0.74099	AGC		0.463	PFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207617.2	NM_199346		Missense_Mutation
PREP	5550	hgsc.bcm.edu	37	6	105821390	105821390	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr6:105821390C>T	ENST00000369110.3	-	5	641	c.449G>A	c.(448-450)tGg>tAg	p.W150*		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	150					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.W150*(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	GATTGTCACCCAGTCTGAGCC	0.473																																																1	Substitution - Nonsense(1)	ovary(1)	6											127.0	111.0	116.0					6																	105821390		2203	4300	6503	105928083	SO:0001587	stop_gained	5550				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.449G>A	6.37:g.105821390C>T	ENSP00000358106:p.Trp150*	Somatic		Capture	SOLID	Phase_IV	105928083	Q8N6D4	Nonsense_Mutation	SNP	ENST00000369110.3	37	CCDS5053.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	40	8.186839	0.98696	.	.	ENSG00000085377	ENST00000369110	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0746	20.5373	0.99239	0.0:1.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000358106:W150X	W	-	2	0	PREP	105928083	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	TGG		0.473	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1			Nonsense_Mutation
PSME4	23198	hgsc.bcm.edu	37	2	54093979	54093979	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr2:54093979C>T	ENST00000404125.1	-	45	5357	c.5302G>A	c.(5302-5304)Gca>Aca	p.A1768T	PSME4_ENST00000476586.1_5'UTR|PSME4_ENST00000421748.2_Missense_Mutation_p.A912T	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1768					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.A1654T(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAACACATGCACCAAGTCCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											135.0	114.0	121.0					2																	54093979		2203	4300	6503	53947483	SO:0001583	missense	23198			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.5302G>A	2.37:g.54093979C>T	ENSP00000384211:p.Ala1768Thr	Somatic		Capture	SOLID	Phase_IV	53947483	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	36	5.780041	0.96929	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.65732	-0.17;-0.17	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84151	0.5409	M	0.90650	3.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;0.998	D	0.86491	0.1797	10	0.87932	D	0	0.0189	20.0745	0.97737	0.0:1.0:0.0:0.0	.	1143;912;912;1768	Q14997-2;Q14997-3;F8WB44;Q14997	.;.;.;PSME4_HUMAN	T	912;1768	ENSP00000410830:A912T;ENSP00000384211:A1768T	ENSP00000384211:A1768T	A	-	1	0	PSME4	53947483	1.000000	0.71417	0.997000	0.53966	0.889000	0.51656	7.794000	0.85869	2.748000	0.94277	0.462000	0.41574	GCA		0.443	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158		Missense_Mutation
ROR1	4919	hgsc.bcm.edu	37	1	64515405	64515405	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1514-01	TCGA-04-1514-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr1:64515405C>T	ENST00000371079.1	+	3	581	c.206C>T	c.(205-207)aCg>aTg	p.T69M	ROR1_ENST00000482426.1_3'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.T69M	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	69	Ig-like C2-type.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.T69M(2)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AACATCACCACGTCTCTGGGC	0.547																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	1											139.0	134.0	136.0					1																	64515405		2203	4300	6503	64287993	SO:0001583	missense	4919			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.206C>T	1.37:g.64515405C>T	ENSP00000360120:p.Thr69Met	Somatic		Capture	SOLID	Phase_IV	64287993	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134388	0.77662	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.67345	-0.26;-0.26	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.44285	D	0.000470	T	0.72550	0.3474	L	0.41079	1.255	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.74674	0.881;0.984	T	0.72293	-0.4336	10	0.52906	T	0.07	.	20.062	0.97678	0.0:1.0:0.0:0.0	.	69;69	Q01973;Q66K77	ROR1_HUMAN;.	M	69;69;72	ENSP00000360121:T69M;ENSP00000360120:T69M	ENSP00000360120:T69M	T	+	2	0	ROR1	64287993	0.998000	0.40836	0.972000	0.41901	0.961000	0.63080	3.803000	0.55560	2.730000	0.93505	0.563000	0.77884	ACG		0.547	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012		Missense_Mutation
STAB2	55576	hgsc.bcm.edu	37	12	104155079	104155079	+	Splice_Site	SNP	C	C	T	rs529403514		TCGA-04-1514-01	TCGA-04-1514-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr12:104155079C>T	ENST00000388887.2	+	66	7454	c.7250C>T	c.(7249-7251)aCg>aTg	p.T2417M	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.T2417M(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTTCCCTAGACGGAGACCAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											143.0	123.0	130.0					12																	104155079		2203	4300	6503	102679209	SO:0001630	splice_region_variant	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7249-1C>T	12.37:g.104155079C>T		Somatic		Capture	SOLID	Phase_IV	102679209		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.164	0.028883	0.08054	.	.	ENSG00000136011	ENST00000388887	D	0.90676	-2.71	3.45	2.26	0.28386	FAS1 domain (4);	1.025530	0.07768	U	0.951213	D	0.83580	0.5285	L	0.29908	0.895	0.27552	N	0.950459	B	0.27380	0.177	B	0.19391	0.025	T	0.71417	-0.4599	10	0.46703	T	0.11	.	6.6327	0.22865	0.4311:0.4749:0.094:0.0	.	2417	Q8WWQ8	STAB2_HUMAN	M	2417	ENSP00000373539:T2417M	ENSP00000373539:T2417M	T	+	2	0	STAB2	102679209	0.100000	0.21855	0.884000	0.34674	0.300000	0.27592	0.113000	0.15499	0.229000	0.21039	-0.266000	0.10368	ACG		0.512	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		Missense_Mutation	Missense_Mutation
TMEM132D	121256	hgsc.bcm.edu	37	12	129558549	129558549	+	Missense_Mutation	SNP	G	G	T	rs74724941	byFrequency	TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr12:129558549G>T	ENST00000422113.2	-	9	3497	c.3171C>A	c.(3169-3171)gaC>gaA	p.D1057E	TMEM132D_ENST00000389441.4_Missense_Mutation_p.D595E	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1057					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.D1057E(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGGGGTACTCGTCGTCTGAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											155.0	152.0	153.0					12																	129558549		2203	4300	6503	128124502	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3171C>A	12.37:g.129558549G>T	ENSP00000408581:p.Asp1057Glu	Somatic		Capture	SOLID	Phase_IV	128124502	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.321	1.058107	0.19987	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.08720	3.06;3.86	4.16	-5.43	0.02632	.	0.175073	0.37577	N	0.002040	T	0.04137	0.0115	L	0.32530	0.975	0.09310	N	1	B;B	0.15719	0.014;0.009	B;B	0.16722	0.008;0.016	T	0.33497	-0.9866	9	.	.	.	-15.9856	4.171	0.10329	0.558:0.1066:0.2281:0.1073	.	1057;595	Q14C87;Q14C87-2	T132D_HUMAN;.	E	595;1057	ENSP00000374092:D595E;ENSP00000408581:D1057E	.	D	-	3	2	TMEM132D	128124502	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.923000	0.04000	-1.018000	0.03363	-0.244000	0.11960	GAC		0.512	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	T	C			TCGA-04-1514-01	TCGA-04-1514-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr17:7578556T>C	ENST00000269305.4	-	5	565		c.e5-2		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(34)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGAGTACTGTAGGAAGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Unknown(34)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(19)|breast(7)|central_nervous_system(4)|ovary(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)	17											41.0	42.0	41.0					17																	7578556		2203	4300	6503	7519281	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-2A>G	17.37:g.7578556T>C		Somatic		Capture	SOLID	Phase_IV	7519281	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336894	0.60963	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6026	0.45375	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519281	1.000000	0.71417	0.994000	0.49952	0.902000	0.53008	6.214000	0.72200	2.078000	0.62432	0.533000	0.62120	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
TRO	7216	hgsc.bcm.edu	37	X	54957066	54957066	+	Silent	SNP	T	T	G			TCGA-04-1514-01	TCGA-04-1514-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chrX:54957066T>G	ENST00000173898.7	+	12	4021	c.3909T>G	c.(3907-3909)ctT>ctG	p.L1303L	TRO_ENST00000375041.2_Silent_p.L906L|TRO_ENST00000319167.8_Intron|TRO_ENST00000420798.2_Silent_p.L834L|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1303	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GCAGCACACTTGGCACCAGTG	0.577																																																0			X											76.0	71.0	73.0					X																	54957066		2128	4219	6347	54973791	SO:0001819	synonymous_variant	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3909T>G	X.37:g.54957066T>G		Somatic		Capture	SOLID	Phase_IV	54973791	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	CCDS43959.1	SNP	63	Baylor																																																																																				0.577	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		Silent
YIPF1	54432	hgsc.bcm.edu	37	1	54332041	54332041	+	Silent	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr1:54332041G>A	ENST00000072644.1	-	9	999	c.663C>T	c.(661-663)atC>atT	p.I221I	YIPF1_ENST00000469457.1_5'UTR|YIPF1_ENST00000371399.1_Silent_p.I38I|YIPF1_ENST00000539954.1_Silent_p.I246I	NM_018982.4	NP_061855.1	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	221						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.I221I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|skin(1)|urinary_tract(2)	19						CTTTCTGGGGGATAATCCACA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	1											44.0	45.0	45.0					1																	54332041		2203	4300	6503	54104629	SO:0001819	synonymous_variant	54432			BC009674	CCDS584.1	1p33-p32.1	2008-02-05			ENSG00000058799	ENSG00000058799		"""Yip1 domain family"""	25231	protein-coding gene	gene with protein product						12477932	Standard	NM_018982		Approved	DJ167A19.1, FinGER1	uc001cvu.3	Q9Y548	OTTHUMG00000008074	ENST00000072644.1:c.663C>T	1.37:g.54332041G>A		Somatic		Capture	SOLID	Phase_IV	54104629	B2RCM7|D3DQ40|Q9NWJ1	Silent	SNP	ENST00000072644.1	37	CCDS584.1	SNP	41	Baylor																																																																																				0.488	YIPF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022103.5	NM_018982		Silent
ZNF333	84449	hgsc.bcm.edu	37	19	14828502	14828502	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1514-01	TCGA-04-1514-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr19:14828502G>C	ENST00000292530.6	+	11	948	c.857G>C	c.(856-858)aGc>aCc	p.S286T	ZNF333_ENST00000536363.1_Missense_Mutation_p.S177T|ZNF333_ENST00000540689.2_Missense_Mutation_p.S286T	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S286T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						GCAATTCCTAGCCAAGATACT	0.433																																					NSCLC(60;75 1281 16985 25154 29885)											1	Substitution - Missense(1)	ovary(1)	19											141.0	127.0	132.0					19																	14828502		2203	4300	6503	14689502	SO:0001583	missense	84449				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.857G>C	19.37:g.14828502G>C	ENSP00000292530:p.Ser286Thr	Somatic		Capture	SOLID	Phase_IV	14689502	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	ENST00000292530.6	37	CCDS12316.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.694	-0.063006	0.07273	.	.	ENSG00000160961	ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.06294	3.32;5.86;3.38	2.91	-0.537	0.11872	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.44436	-0.9328	9	0.34782	T	0.22	.	3.5629	0.07889	0.4399:0.2088:0.3513:0.0	.	286	Q96JL9	ZN333_HUMAN	T	177;286;286	ENSP00000439749:S177T;ENSP00000438130:S286T;ENSP00000292530:S286T	ENSP00000292530:S286T	S	+	2	0	ZNF333	14689502	0.000000	0.05858	0.011000	0.14972	0.003000	0.03518	-0.013000	0.12678	-0.106000	0.12110	-0.228000	0.12330	AGC		0.433	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466496.1	NM_032433		Missense_Mutation
ZNF211	10520	hgsc.bcm.edu	37	19	58153101	58153101	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1514-01	TCGA-04-1514-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-04-1514-01	TCGA-04-1514-10	g.chr19:58153101G>A	ENST00000347302.3	+	3	1426	c.1247G>A	c.(1246-1248)cGg>cAg	p.R416Q	ZNF211_ENST00000254182.7_Missense_Mutation_p.R407Q|ZNF211_ENST00000541801.1_Missense_Mutation_p.R407Q|ZNF211_ENST00000391703.3_Missense_Mutation_p.R355Q|ZNF211_ENST00000420680.1_Missense_Mutation_p.R420Q|ZNF211_ENST00000299871.5_Missense_Mutation_p.R481Q|ZNF211_ENST00000240731.4_Missense_Mutation_p.R429Q|ZNF211_ENST00000544273.1_Missense_Mutation_p.R428Q	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R429Q(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATTCACCACCGGAGACTTCAC	0.483																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	71.0	70.0					19																	58153101		2203	4300	6503	62844913	SO:0001583	missense	10520			U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.1247G>A	19.37:g.58153101G>A	ENSP00000339562:p.Arg416Gln	Somatic		Capture	SOLID	Phase_IV	62844913	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	ENST00000347302.3	37	CCDS12957.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	g	2.481	-0.319679	0.05386	.	.	ENSG00000121417	ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731	T;T;T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19;3.19;3.19	3.38	-4.13	0.03904	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01287	0.0042	N	0.00926	-1.1	0.09310	N	1	B;B;P;B;B;B	0.43607	0.128;0.366;0.812;0.09;0.06;0.155	B;B;B;B;B;B	0.26693	0.011;0.034;0.072;0.005;0.019;0.019	T	0.39542	-0.9609	9	0.02654	T	1	.	6.0353	0.19704	0.658:0.0:0.186:0.156	.	420;428;481;407;416;429	Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1	.;.;.;.;ZN211_HUMAN;.	Q	420;416;407;355;407;481;428;429	ENSP00000399193:R420Q;ENSP00000339562:R416Q;ENSP00000254182:R407Q;ENSP00000375584:R355Q;ENSP00000442601:R407Q;ENSP00000299871:R481Q;ENSP00000441386:R428Q;ENSP00000240731:R429Q	ENSP00000240731:R429Q	R	+	2	0	ZNF211	62844913	0.000000	0.05858	0.001000	0.08648	0.998000	0.95712	-0.422000	0.07043	-0.686000	0.05170	0.585000	0.79938	CGG		0.483	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1			Missense_Mutation
