#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PRPF4B	8899	genome.wustl.edu	37	6	4032298	4032298	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:4032298C>T	ENST00000337659.6	+	2	647	c.547C>T	c.(547-549)Cga>Tga	p.R183*	PRPF4B_ENST00000538861.1_Nonsense_Mutation_p.R169*	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	183	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R183*(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TACAAAGAAACGAAGTAAAAG	0.348																																																1	Substitution - Nonsense(1)	ovary(1)	6											94.0	106.0	102.0					6																	4032298		2202	4298	6500	3977297	SO:0001587	stop_gained	8899			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.547C>T	6.37:g.4032298C>T	ENSP00000337194:p.Arg183*	Somatic		Capture	Illumina GAIIx	4	3977297	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Nonsense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.848124	0.97023	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	.	.	.	5.35	3.5	0.40072	.	0.104901	0.41097	D	0.000960	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5323	0.39202	0.3762:0.4856:0.1382:0.0	.	.	.	.	X	183;169	.	ENSP00000337194:R183X	R	+	1	2	PRPF4B	3977297	0.887000	0.30362	0.996000	0.52242	0.947000	0.59692	0.516000	0.22817	0.576000	0.29452	0.462000	0.41574	CGA		0.348	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2			Nonsense_Mutation
OTOP1	133060	genome.wustl.edu	37	4	4190683	4190683	+	Silent	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr4:4190683G>A	ENST00000296358.4	-	6	1710	c.1686C>T	c.(1684-1686)gcC>gcT	p.A562A		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	562					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GACAGCCAAAGGCGGGAGGTA	0.517																																																0			4											48.0	51.0	50.0					4																	4190683		2202	4300	6502	4241584	SO:0001819	synonymous_variant	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1686C>T	4.37:g.4190683G>A		Germline		Capture	Illumina GAIIx	4	4241584	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1	SNP	35	WashU																																																																																				0.517	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998		Silent
RASSF2	9770	genome.wustl.edu	37	20	4766926	4766926	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr20:4766926G>C	ENST00000379400.3	-	11	1057	c.862C>G	c.(862-864)Cag>Gag	p.Q288E	RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_Missense_Mutation_p.Q288E	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	288	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q288E(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						TGGAGCTTCTGAATGAAGCTT	0.498																																					Melanoma(158;1891 3343 50738)											1	Substitution - Missense(1)	ovary(1)	20											171.0	183.0	179.0					20																	4766926		2203	4300	6503	4714926	SO:0001583	missense	9770			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.862C>G	20.37:g.4766926G>C	ENSP00000368710:p.Gln288Glu	Somatic		Capture	Illumina GAIIx	4	4714926	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	37	CCDS13083.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	9.682	1.149523	0.21288	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.09350	2.99;2.99	5.29	5.29	0.74685	SARAH (1);	0.285201	0.39687	N	0.001292	T	0.05868	0.0153	N	0.11560	0.145	0.36856	D	0.88817	B	0.06786	0.001	B	0.06405	0.002	T	0.34079	-0.9843	10	0.10377	T	0.69	.	13.3971	0.60861	0.0:0.1579:0.8421:0.0	.	288	P50749	RASF2_HUMAN	E	288	ENSP00000368710:Q288E;ENSP00000368684:Q288E	ENSP00000368684:Q288E	Q	-	1	0	RASSF2	4714926	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.487000	0.60293	2.756000	0.94617	0.561000	0.74099	CAG		0.498	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	NM_014737		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-04-1542-01	TCGA-04-1542-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	Illumina GAIIx	4	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ODF4	146852	genome.wustl.edu	37	17	8248732	8248732	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr17:8248732T>A	ENST00000328248.2	+	2	714	c.526T>A	c.(526-528)Tcc>Acc	p.S176T	ODF4_ENST00000584943.1_Missense_Mutation_p.S61T	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	176					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)		p.S176T(1)		endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						AAGGAATGTATCCATCCCCAT	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											292.0	254.0	267.0					17																	8248732		2203	4300	6503	8189457	SO:0001583	missense	146852			AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.526T>A	17.37:g.8248732T>A	ENSP00000331086:p.Ser176Thr	Somatic		Capture	Illumina GAIIx	4	8189457	Q8J021	Missense_Mutation	SNP	ENST00000328248.2	37	CCDS11140.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	2.166	-0.390999	0.04932	.	.	ENSG00000184650	ENST00000328248	T	0.27256	1.68	4.59	2.18	0.27775	.	0.000000	0.38663	N	0.001606	T	0.27832	0.0685	L	0.27053	0.805	0.09310	N	1	D	0.71674	0.998	D	0.66196	0.942	T	0.03278	-1.1053	10	0.56958	D	0.05	-8.8169	3.6185	0.08086	0.1916:0.1042:0.0:0.7042	.	176	Q2M2E3	ODFP4_HUMAN	T	176	ENSP00000331086:S176T	ENSP00000331086:S176T	S	+	1	0	ODF4	8189457	0.086000	0.21541	0.019000	0.16419	0.047000	0.14425	1.871000	0.39539	0.888000	0.36160	0.460000	0.39030	TCC		0.517	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1			Missense_Mutation
PLOD1	5351	genome.wustl.edu	37	1	12016982	12016982	+	Missense_Mutation	SNP	G	G	A	rs372534520		TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:12016982G>A	ENST00000196061.4	+	7	679	c.652G>A	c.(652-654)Gtg>Atg	p.V218M	PLOD1_ENST00000485046.1_3'UTR|PLOD1_ENST00000376369.3_Missense_Mutation_p.V265M	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	218					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)	p.V218M(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	AGATGAGGTCGTGCTCAAGTT	0.597																																																1	Substitution - Missense(1)	ovary(1)	1						G	MET/VAL	0,4406		0,0,2203	156.0	129.0	138.0		652	4.2	0.9	1		138	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLOD1	NM_000302.3	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	218/728	12016982	1,13005	2203	4300	6503	11939569	SO:0001583	missense	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.652G>A	1.37:g.12016982G>A	ENSP00000196061:p.Val218Met	Somatic		Capture	Illumina GAIIx	4	11939569	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	CCDS142.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252949	0.80135	0.0	1.16E-4	ENSG00000083444	ENST00000376369;ENST00000196061	T;T	0.24151	1.87;1.87	4.22	4.22	0.49857	.	0.067021	0.64402	D	0.000014	T	0.48660	0.1512	M	0.78637	2.42	0.58432	D	0.999998	D;P	0.76494	0.999;0.855	P;B	0.61201	0.885;0.17	T	0.53711	-0.8400	10	0.49607	T	0.09	.	15.775	0.78207	0.0:0.0:1.0:0.0	.	265;218	B4DR87;Q02809	.;PLOD1_HUMAN	M	265;218	ENSP00000365548:V265M;ENSP00000196061:V218M	ENSP00000196061:V218M	V	+	1	0	PLOD1	11939569	1.000000	0.71417	0.915000	0.36163	0.982000	0.71751	7.749000	0.85096	2.191000	0.70037	0.561000	0.74099	GTG		0.597	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302		Missense_Mutation
LDLRAD4	753	genome.wustl.edu	37	18	13438245	13438245	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr18:13438245T>A	ENST00000359446.5	+	3	511	c.43T>A	c.(43-45)Tgc>Agc	p.C15S	LDLRAD4_ENST00000399848.3_Missense_Mutation_p.C15S|LDLRAD4_ENST00000361205.4_Missense_Mutation_p.C15S	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	15					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)	p.C15S(1)									TTTTTCAGAGTGCAAATTCAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	18											121.0	116.0	117.0					18																	13438245		2203	4300	6503	13428245	SO:0001583	missense	753			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.43T>A	18.37:g.13438245T>A	ENSP00000352420:p.Cys15Ser	Somatic		Capture	Illumina GAIIx	4	13428245	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	ENST00000359446.5	37	CCDS32793.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607244	0.87157	.	.	ENSG00000168675	ENST00000361205;ENST00000399848	D;D	0.90385	-2.66;-2.66	5.22	5.22	0.72569	.	0.480333	0.20394	N	0.093182	D	0.89347	0.6689	N	0.04018	-0.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.92205	0.5771	10	0.87932	D	0	-0.3558	15.1181	0.72419	0.0:0.0:0.0:1.0	.	15;15	O15165-2;O15165	.;CR001_HUMAN	S	15	ENSP00000354753:C15S;ENSP00000382741:C15S	ENSP00000354753:C15S	C	+	1	0	C18orf1	13428245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.200000	0.77838	1.982000	0.57802	0.533000	0.62120	TGC		0.458	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458326.1	NM_181481		Missense_Mutation
FAM105A	54491	genome.wustl.edu	37	5	14609106	14609106	+	Missense_Mutation	SNP	G	G	A	rs181133009	byFrequency	TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr5:14609106G>A	ENST00000274217.3	+	7	997	c.877G>A	c.(877-879)Gac>Aac	p.D293N		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	293	OTU.							p.D293N(1)		large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TTCTGTAGGCGACACATGTGG	0.458													G|||	4	0.000798722	0.0	0.0	5008	,	,		19242	0.004		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											157.0	161.0	159.0					5																	14609106		2203	4300	6503	14662106	SO:0001583	missense	54491				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.877G>A	5.37:g.14609106G>A	ENSP00000274217:p.Asp293Asn	Somatic		Capture	Illumina GAIIx	4	14662106	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	SNP	37	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	11.28	1.590714	0.28357	.	.	ENSG00000145569	ENST00000274217	T	0.16073	2.37	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000001	T	0.37348	0.1000	L	0.53249	1.67	0.38229	D	0.940987	D	0.89917	1.0	D	0.87578	0.998	T	0.11916	-1.0568	10	0.22706	T	0.39	-25.1344	18.3844	0.90462	0.0:0.0:1.0:0.0	.	293	Q9NUU6	F105A_HUMAN	N	293	ENSP00000274217:D293N	ENSP00000274217:D293N	D	+	1	0	FAM105A	14662106	1.000000	0.71417	0.902000	0.35471	0.019000	0.09904	4.731000	0.62022	2.327000	0.79052	0.650000	0.86243	GAC		0.458	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018		Missense_Mutation
PGLYRP2	114770	genome.wustl.edu	37	19	15587150	15587150	+	Missense_Mutation	SNP	C	C	A	rs372029985		TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr19:15587150C>A	ENST00000340880.4	-	2	811	c.331G>T	c.(331-333)Gtg>Ttg	p.V111L	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.V111L	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	111					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.V111L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GGTGCCAGCACCACCCCATAT	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											170.0	124.0	140.0					19																	15587150		2203	4300	6503	15448150	SO:0001583	missense	114770			AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.331G>T	19.37:g.15587150C>A	ENSP00000345968:p.Val111Leu	Somatic		Capture	Illumina GAIIx	4	15448150	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	37	CCDS12330.2	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468304	0.63625	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.14516	2.58;2.5	5.27	4.21	0.49690	.	0.000000	0.64402	D	0.000006	T	0.35828	0.0945	M	0.74647	2.275	0.33540	D	0.594711	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.54556	-0.8276	10	0.87932	D	0	-17.902	11.7575	0.51884	0.0:0.8222:0.1778:0.0	.	111;111	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	L	111	ENSP00000345968:V111L;ENSP00000292609:V111L	ENSP00000292609:V111L	V	-	1	0	PGLYRP2	15448150	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	4.180000	0.58296	1.176000	0.42840	0.563000	0.77884	GTG		0.612	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890		Missense_Mutation
CCDC144A	9720	genome.wustl.edu	37	17	16610838	16610838	+	Silent	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr17:16610838C>T	ENST00000360524.8	+	4	796	c.720C>T	c.(718-720)tgC>tgT	p.C240C	CCDC144A_ENST00000399273.1_Silent_p.C240C|CCDC144A_ENST00000443444.2_Silent_p.C240C|CCDC144A_ENST00000456009.1_Silent_p.C240C|RP11-219A15.1_ENST00000448331.3_Silent_p.C240C|RN7SL620P_ENST00000580704.1_RNA|CCDC144A_ENST00000436374.1_3'UTR|CCDC144A_ENST00000340621.5_Silent_p.C239C	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	240								p.C240C(1)									TTAAAGGATGCGAAAATAAGC	0.348																																																1	Substitution - coding silent(1)	ovary(1)	17											36.0	38.0	37.0					17																	16610838		1828	4078	5906	16551563	SO:0001819	synonymous_variant	9720			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.720C>T	17.37:g.16610838C>T		Somatic		Capture	Illumina GAIIx	4	16551563	O60311|Q6ZU57	Silent	SNP	ENST00000360524.8	37	CCDS45621.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	.	1.236	-0.622772	0.03636	.	.	ENSG00000170160	ENST00000328495	.	.	.	1.72	1.72	0.24424	.	.	.	.	.	T	0.24353	0.0590	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24119	-1.0169	4	.	.	.	.	3.7817	0.08683	0.0:0.2187:0.0:0.7813	.	.	.	.	V	4	.	.	A	+	2	0	CCDC144A	16551563	0.111000	0.22076	0.001000	0.08648	0.020000	0.10135	0.866000	0.27954	-0.038000	0.13624	-1.514000	0.00941	GCG		0.348	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			Silent
KIF13A	63971	genome.wustl.edu	37	6	17834246	17834246	+	Silent	SNP	T	T	C			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:17834246T>C	ENST00000259711.6	-	12	1317	c.1212A>G	c.(1210-1212)aaA>aaG	p.K404K	KIF13A_ENST00000378816.5_Silent_p.K404K|KIF13A_ENST00000378814.5_Silent_p.K404K|KIF13A_ENST00000378826.2_Silent_p.K404K|KIF13A_ENST00000378843.2_Silent_p.K404K	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	404					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K404K(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CTGTTAGTTCTTTTATCAGCT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	6											143.0	130.0	134.0					6																	17834246		1834	4082	5916	17942225	SO:0001819	synonymous_variant	63971			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1212A>G	6.37:g.17834246T>C		Somatic		Capture	Illumina GAIIx	4	17942225	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Silent	SNP	ENST00000259711.6	37	CCDS47381.1	SNP	56	WashU																																																																																				0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4			Silent
PRPS1L1	221823	genome.wustl.edu	37	7	18067261	18067261	+	Missense_Mutation	SNP	G	G	A	rs112075478	byFrequency	TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:18067261G>A	ENST00000506618.2	-	1	225	c.145C>T	c.(145-147)Cgt>Tgt	p.R49C		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	49					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.R49C(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					TCCTCTCCACGCACACTCTCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											321.0	313.0	316.0					7																	18067261		2203	4300	6503	18033786	SO:0001583	missense	221823			M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.145C>T	7.37:g.18067261G>A	ENSP00000424595:p.Arg49Cys	Somatic		Capture	Illumina GAIIx	4	18033786	Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	CCDS47552.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255583	0.59321	.	.	ENSG00000229937	ENST00000506618	D	0.93604	-3.25	4.1	2.13	0.27403	.	.	.	.	.	D	0.97751	0.9262	H	0.99705	4.715	.	.	.	D	0.76494	0.999	D	0.67900	0.954	D	0.96569	0.9421	8	0.87932	D	0	.	6.6742	0.23085	0.1025:0.0:0.7208:0.1767	.	49	P21108	PRPS3_HUMAN	C	49	ENSP00000424595:R49C	ENSP00000424595:R49C	R	-	1	0	PRPS1L1	18033786	1.000000	0.71417	0.428000	0.26697	0.908000	0.53690	3.248000	0.51430	1.077000	0.40990	0.555000	0.69702	CGT		0.488	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		Missense_Mutation
OSBPL1A	114876	genome.wustl.edu	37	18	21776114	21776114	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr18:21776114C>G	ENST00000319481.3	-	18	1858	c.1652G>C	c.(1651-1653)aGc>aCc	p.S551T	OSBPL1A_ENST00000399443.3_Missense_Mutation_p.S38T|OSBPL1A_ENST00000357041.4_Missense_Mutation_p.S169T	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	551					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.S551T(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TCTGAGGATGCTCCAGATACT	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											86.0	82.0	83.0					18																	21776114		2203	4300	6503	20030112	SO:0001583	missense	114876			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1652G>C	18.37:g.21776114C>G	ENSP00000320291:p.Ser551Thr	Somatic		Capture	Illumina GAIIx	4	20030112	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413876	0.83449	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	T;T;T	0.34275	1.37;1.37;1.37	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	M	0.64676	1.99	0.80722	D	1	D;D	0.76494	0.999;0.979	D;D	0.81914	0.995;0.982	T	0.55585	-0.8118	10	0.41790	T	0.15	-4.1201	17.891	0.88872	0.0:1.0:0.0:0.0	.	551;551	B0YJ56;Q9BXW6	.;OSBL1_HUMAN	T	551;38;169	ENSP00000320291:S551T;ENSP00000382372:S38T;ENSP00000349545:S169T	ENSP00000320291:S551T	S	-	2	0	OSBPL1A	20030112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.769000	0.74985	2.501000	0.84356	0.655000	0.94253	AGC		0.318	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597		Missense_Mutation
MACC1	346389	genome.wustl.edu	37	7	20199641	20199641	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:20199641A>T	ENST00000400331.5	-	5	651	c.343T>A	c.(343-345)Tcc>Acc	p.S115T	MACC1_ENST00000332878.4_Missense_Mutation_p.S115T|MACC1_ENST00000589011.1_Missense_Mutation_p.S115T	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	115					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S115T(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TCACCGGAGGAATCAAAAGAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	7											47.0	46.0	46.0					7																	20199641		2203	4300	6503	20166166	SO:0001583	missense	346389				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.343T>A	7.37:g.20199641A>T	ENSP00000383185:p.Ser115Thr	Somatic		Capture	Illumina GAIIx	4	20166166	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	12.83	2.055927	0.36277	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.10005	2.92;2.92	5.97	4.83	0.62350	.	0.052421	0.85682	D	0.000000	T	0.11623	0.0283	L	0.49126	1.545	0.46609	D	0.99912	B	0.22909	0.077	B	0.18871	0.023	T	0.05037	-1.0910	10	0.33141	T	0.24	-3.2097	12.0577	0.53544	0.9329:0.0:0.0671:0.0	.	115	Q6ZN28	MACC1_HUMAN	T	115	ENSP00000383185:S115T;ENSP00000328410:S115T	ENSP00000328410:S115T	S	-	1	0	MACC1	20166166	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.038000	0.64177	1.087000	0.41251	0.477000	0.44152	TCC		0.333	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762		Missense_Mutation
SLCO1C1	53919	genome.wustl.edu	37	12	20890097	20890097	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr12:20890097G>A	ENST00000266509.2	+	11	1807	c.1439G>A	c.(1438-1440)tGc>tAc	p.C480Y	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.C431Y|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.C480Y|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.C480Y|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.C362Y	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	480	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.C480Y(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	AACTCAAGATGCAAATGTTCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	89.0	92.0					12																	20890097		2203	4300	6503	20781364	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1439G>A	12.37:g.20890097G>A	ENSP00000266509:p.Cys480Tyr	Somatic		Capture	Illumina GAIIx	4	20781364	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276070	0.80580	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.02	5.02	0.67125	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.84370	0.5457	M	0.93720	3.45	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.88017	0.2766	10	0.72032	D	0.01	.	17.0689	0.86568	0.0:0.0:1.0:0.0	.	362;431;480;480	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	Y	480;431;480;480;362	ENSP00000444149:C480Y;ENSP00000438665:C431Y;ENSP00000266509:C480Y;ENSP00000370964:C480Y;ENSP00000444527:C362Y	ENSP00000266509:C480Y	C	+	2	0	SLCO1C1	20781364	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.795000	0.91872	2.770000	0.95276	0.650000	0.86243	TGC		0.388	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		Missense_Mutation
TEFM	79736	genome.wustl.edu	37	17	29227563	29227563	+	Silent	SNP	T	T	G			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr17:29227563T>G	ENST00000581216.1	-	3	1134	c.513A>C	c.(511-513)atA>atC	p.I171I	TEFM_ENST00000580840.1_Silent_p.I171I|TEFM_ENST00000579183.1_5'Flank	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	171					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)	p.I171I(1)									AAACGATAGATATGATACTAT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	17											99.0	93.0	95.0					17																	29227563		1848	4098	5946	26251689	SO:0001819	synonymous_variant	79736				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.513A>C	17.37:g.29227563T>G		Somatic		Capture	Illumina GAIIx	4	26251689	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Silent	SNP	ENST00000581216.1	37	CCDS42291.1	SNP	49	WashU																																																																																				0.388	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444498.1	NM_024683		Silent
MYO3A	53904	genome.wustl.edu	37	10	26463391	26463391	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr10:26463391C>T	ENST00000265944.5	+	30	4364	c.4198C>T	c.(4198-4200)Cat>Tat	p.H1400Y	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1400					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.H1400Y(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TCCCACAAAACATGAGGAAAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	10											117.0	116.0	117.0					10																	26463391		2203	4300	6503	26503397	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4198C>T	10.37:g.26463391C>T	ENSP00000265944:p.His1400Tyr	Somatic		Capture	Illumina GAIIx	4	26503397	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.705	-0.789474	0.02884	.	.	ENSG00000095777	ENST00000265944	T	0.78126	-1.15	5.94	-0.792	0.10925	.	1.064600	0.07094	N	0.839192	T	0.53012	0.1770	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40021	-0.9585	10	0.52906	T	0.07	.	0.1972	0.00141	0.2966:0.2704:0.1587:0.2743	.	1400	Q8NEV4	MYO3A_HUMAN	Y	1400	ENSP00000265944:H1400Y	ENSP00000265944:H1400Y	H	+	1	0	MYO3A	26503397	0.000000	0.05858	0.000000	0.03702	0.250000	0.25880	-0.238000	0.08977	-0.103000	0.12175	0.563000	0.77884	CAT		0.368	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		Missense_Mutation
KCNA4	3739	genome.wustl.edu	37	11	30032817	30032817	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr11:30032817G>T	ENST00000328224.6	-	2	2642	c.1409C>A	c.(1408-1410)aCc>aAc	p.T470N	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	470					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)	p.T470N(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GGCTCTGAGGGTGTGGCCCAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	11											54.0	58.0	57.0					11																	30032817		2091	4250	6341	29989393	SO:0001583	missense	3739			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.1409C>A	11.37:g.30032817G>T	ENSP00000328511:p.Thr470Asn	Somatic		Capture	Illumina GAIIx	4	29989393		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	19.75	3.884916	0.72410	.	.	ENSG00000182255	ENST00000328224	D	0.98455	-4.94	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98908	1.0779	10	0.87932	D	0	.	19.563	0.95380	0.0:0.0:1.0:0.0	.	470	P22459	KCNA4_HUMAN	N	470	ENSP00000328511:T470N	ENSP00000328511:T470N	T	-	2	0	KCNA4	29989393	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.869000	0.99810	2.619000	0.88677	0.650000	0.86243	ACC		0.527	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233		Missense_Mutation
NOTCH4	4855	genome.wustl.edu	37	6	32188309	32188309	+	Silent	SNP	C	C	G			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:32188309C>G	ENST00000375023.3	-	6	1170	c.1032G>C	c.(1030-1032)gtG>gtC	p.V344V		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	344	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.V344V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CCCAGCCACTCACACACACGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	6											104.0	103.0	103.0					6																	32188309		1511	2709	4220	32296287	SO:0001819	synonymous_variant	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1032G>C	6.37:g.32188309C>G		Somatic		Capture	Illumina GAIIx	4	32296287	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1	SNP	29	WashU																																																																																				0.602	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			Silent
DMD	1756	genome.wustl.edu	37	X	32583900	32583900	+	Silent	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chrX:32583900G>T	ENST00000357033.4	-	16	2117	c.1911C>A	c.(1909-1911)acC>acA	p.T637T	DMD_ENST00000378677.2_Silent_p.T633T|DMD_ENST00000288447.4_Silent_p.T629T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	637					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.T632T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCGTCTTCTGGGTCACTGACT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	X											164.0	135.0	145.0					X																	32583900		2202	4300	6502	32493821	SO:0001819	synonymous_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1911C>A	X.37:g.32583900G>T		Somatic		Capture	Illumina GAIIx	4	32493821	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	43	WashU																																																																																				0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Silent
FEZ2	9637	genome.wustl.edu	37	2	36805938	36805938	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:36805938G>T	ENST00000405912.3	-	5	704	c.705C>A	c.(703-705)taC>taA	p.Y235*	FEZ2_ENST00000379245.4_Nonsense_Mutation_p.Y235*|FEZ2_ENST00000305852.7_Nonsense_Mutation_p.Y64*	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)	235					axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)			p.Y235*(1)		breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				GCTCCTCAGAGTACTCCTTAA	0.398																																																1	Substitution - Nonsense(1)	ovary(1)	2											90.0	89.0	89.0					2																	36805938		1925	4148	6073	36659442	SO:0001587	stop_gained	9637			U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.705C>A	2.37:g.36805938G>T	ENSP00000385112:p.Tyr235*	Somatic		Capture	Illumina GAIIx	4	36659442	Q5EBN3|Q76LN0|Q99690	Nonsense_Mutation	SNP	ENST00000405912.3	37	CCDS46257.1	SNP	36	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.574021|7.574021	0.98368|0.98368	.|.	.|.	ENSG00000171055|ENSG00000171055	ENST00000441005|ENST00000379245;ENST00000305852;ENST00000405912;ENST00000357996	.|.	.|.	.|.	6.17|6.17	2.48|2.48	0.30137|0.30137	.|.	.|0.168122	.|0.53938	.|D	.|0.000043	T|.	0.21631|.	0.0521|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37314|.	-0.9711|.	3|.	.|0.02654	.|T	.|1	8.7589|8.7589	8.5607|8.5607	0.33509|0.33509	0.4452:0.0:0.5548:0.0|0.4452:0.0:0.5548:0.0	.|.	.|.	.|.	.|.	I|X	37|235;64;235;134	.|.	.|ENSP00000305843:Y64X	L|Y	-|-	1|3	0|2	FEZ2|FEZ2	36659442|36659442	1.000000|1.000000	0.71417|0.71417	0.923000|0.923000	0.36655|0.36655	0.808000|0.808000	0.45660|0.45660	2.157000|2.157000	0.42320|0.42320	0.198000|0.198000	0.20407|0.20407	-0.768000|-0.768000	0.03414|0.03414	CTC|TAC		0.398	FEZ2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325432.1			Nonsense_Mutation
TBC1D1	23216	genome.wustl.edu	37	4	37904125	37904125	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr4:37904125C>T	ENST00000261439.4	+	2	764	c.409C>T	c.(409-411)Caa>Taa	p.Q137*	TBC1D1_ENST00000508802.1_Nonsense_Mutation_p.Q137*|TBC1D1_ENST00000402522.1_Nonsense_Mutation_p.Q137*	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	137					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)	p.Q137*(1)		NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						AGCCGATGATCAAACAAAAGT	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	4											45.0	48.0	47.0					4																	37904125		2203	4300	6503	37580520	SO:0001587	stop_gained	23216			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.409C>T	4.37:g.37904125C>T	ENSP00000261439:p.Gln137*	Somatic		Capture	Illumina GAIIx	4	37580520	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Nonsense_Mutation	SNP	ENST00000261439.4	37	CCDS33972.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	39	7.885283	0.98542	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000402522	.	.	.	5.96	5.96	0.96718	.	0.000000	0.47455	D	0.000232	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-23.6087	20.0044	0.97430	0.0:1.0:0.0:0.0	.	.	.	.	X	137	.	ENSP00000261439:Q137X	Q	+	1	0	TBC1D1	37580520	1.000000	0.71417	0.995000	0.50966	0.901000	0.52897	5.503000	0.66962	2.830000	0.97506	0.585000	0.79938	CAA		0.408	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173		Nonsense_Mutation
LRFN5	145581	genome.wustl.edu	37	14	42361150	42361150	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr14:42361150G>C	ENST00000298119.4	+	4	3272	c.2083G>C	c.(2083-2085)Gca>Cca	p.A695P	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	695						integral component of membrane (GO:0016021)		p.A695P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GTCTAAAAGAGCACATATAAA	0.443										HNSCC(30;0.082)																																						1	Substitution - Missense(1)	ovary(1)	14											46.0	45.0	45.0					14																	42361150		2203	4300	6503	41430900	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.2083G>C	14.37:g.42361150G>C	ENSP00000298119:p.Ala695Pro	Somatic		Capture	Illumina GAIIx	4	41430900	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767784	0.31320	.	.	ENSG00000165379	ENST00000298119	T	0.53423	0.62	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000029	T	0.31765	0.0807	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.08411	-1.0723	10	0.48119	T	0.1	.	17.3132	0.87215	0.0:0.0:1.0:0.0	.	695	Q96NI6	LRFN5_HUMAN	P	695	ENSP00000298119:A695P	ENSP00000298119:A695P	A	+	1	0	LRFN5	41430900	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.772000	0.55325	2.699000	0.92147	0.650000	0.86243	GCA		0.443	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		Missense_Mutation
SLC30A9	10463	genome.wustl.edu	37	4	42020141	42020141	+	Silent	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr4:42020141C>T	ENST00000264451.7	+	3	468	c.288C>T	c.(286-288)ggC>ggT	p.G96G		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	96					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G96G(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAGGTATAGGCACAGAACTCA	0.264																																																1	Substitution - coding silent(1)	ovary(1)	4											37.0	39.0	38.0					4																	42020141		2202	4294	6496	41714898	SO:0001819	synonymous_variant	10463			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.288C>T	4.37:g.42020141C>T		Somatic		Capture	Illumina GAIIx	4	41714898	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Silent	SNP	ENST00000264451.7	37	CCDS3465.1	SNP	25	WashU																																																																																				0.264	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3			Silent
CCDC36	339834	genome.wustl.edu	37	3	49294667	49294667	+	Silent	SNP	T	T	C			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr3:49294667T>C	ENST00000438782.1	+	8	1973	c.1737T>C	c.(1735-1737)aaT>aaC	p.N579N	CCDC36_ENST00000296449.5_Silent_p.N579N|CCDC36_ENST00000452691.2_Silent_p.N579N|RP11-3B7.1_ENST00000440528.3_5'Flank			Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	579								p.N569N(1)		endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|urinary_tract(3)	14				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		CAGGAAAGAATTTGCTCTATG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	3											158.0	166.0	163.0					3																	49294667		2203	4300	6503	49269671	SO:0001819	synonymous_variant	339834			AK058049	CCDS33755.2	3p21.31	2009-08-06			ENSG00000173421	ENSG00000173421			27945	protein-coding gene	gene with protein product	"""cancer/testis antigen 74"""						Standard	NM_178173		Approved	FLJ25320, CT74	uc011bck.1	Q8IYA8	OTTHUMG00000155920	ENST00000438782.1:c.1737T>C	3.37:g.49294667T>C		Somatic		Capture	Illumina GAIIx	4	49269671	C9JJL0|Q05DG9|Q96LP7	Silent	SNP	ENST00000438782.1	37	CCDS33755.2	SNP	52	WashU																																																																																				0.478	CCDC36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342332.1	NM_178173		Silent
RBM6	10180	genome.wustl.edu	37	3	50103789	50103789	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr3:50103789C>G	ENST00000266022.4	+	17	3056	c.2797C>G	c.(2797-2799)Ccc>Gcc	p.P933A	RBM6_ENST00000539992.1_Missense_Mutation_p.P275A|RBM6_ENST00000421682.1_5'Flank|RBM6_ENST00000442092.1_Missense_Mutation_p.P411A|RBM6_ENST00000422955.1_Missense_Mutation_p.P411A|RBM6_ENST00000443081.1_Missense_Mutation_p.P801A|RBM6_ENST00000441115.1_3'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	933					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P933A(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CACAGCACAGCCCCAGAAGCG	0.532																																																1	Substitution - Missense(1)	ovary(1)	3											96.0	104.0	101.0					3																	50103789		2203	4300	6503	50078793	SO:0001583	missense	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2797C>G	3.37:g.50103789C>G	ENSP00000266022:p.Pro933Ala	Somatic		Capture	Illumina GAIIx	4	50078793	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797562	0.31777	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000539992;ENST00000422955	T;T;T;T;T	0.47869	0.83;1.38;1.38;0.9;0.83	5.94	5.06	0.68205	.	0.301982	0.31519	N	0.007505	T	0.39759	0.1090	L	0.43152	1.355	0.58432	D	0.999998	B	0.25719	0.132	B	0.17098	0.017	T	0.13602	-1.0503	9	.	.	.	-2.4958	15.5433	0.76074	0.0:0.9327:0.0:0.0673	.	933	P78332	RBM6_HUMAN	A	411;933;801;275;411	ENSP00000393530:P411A;ENSP00000266022:P933A;ENSP00000396466:P801A;ENSP00000443165:P275A;ENSP00000392939:P411A	.	P	+	1	0	RBM6	50078793	0.946000	0.32159	0.992000	0.48379	0.126000	0.20510	1.831000	0.39141	2.812000	0.96745	0.655000	0.94253	CCC		0.532	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		Missense_Mutation
SCN8A	6334	genome.wustl.edu	37	12	52145297	52145297	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr12:52145297G>A	ENST00000354534.6	+	14	2468	c.2290G>A	c.(2290-2292)Gtc>Atc	p.V764I	SCN8A_ENST00000550891.1_Missense_Mutation_p.V764I|SCN8A_ENST00000545061.1_Missense_Mutation_p.V764I	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	764					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.V764I(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CATCTGCATCGTCCTGAATAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											170.0	162.0	165.0					12																	52145297		2042	4212	6254	50431564	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2290G>A	12.37:g.52145297G>A	ENSP00000346534:p.Val764Ile	Somatic		Capture	Illumina GAIIx	4	50431564	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347016	0.82022	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.96812	0.8959	M	0.66939	2.045	0.80722	D	1	P;B;D	0.61080	0.893;0.195;0.989	B;B;P	0.47744	0.436;0.035;0.556	D	0.97406	0.9999	10	0.72032	D	0.01	.	18.2096	0.89866	0.0:0.0:1.0:0.0	.	764;764;764	F8VWM7;F8VRN5;Q9UQD0	.;.;SCN8A_HUMAN	I	764;764;764;764;677	ENSP00000448415:V764I;ENSP00000346534:V764I;ENSP00000440360:V764I;ENSP00000347255:V764I	ENSP00000346534:V764I	V	+	1	0	SCN8A	50431564	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	7.860000	0.86993	2.617000	0.88574	0.650000	0.86243	GTC		0.443	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		Missense_Mutation
MLIP	90523	genome.wustl.edu	37	6	53989392	53989392	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:53989392A>G	ENST00000274897.5	+	3	454	c.341A>G	c.(340-342)aAc>aGc	p.N114S	MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000514921.1_Missense_Mutation_p.N114S|MLIP_ENST00000509997.1_Missense_Mutation_p.N62S|MLIP_ENST00000370876.2_Missense_Mutation_p.N52S|MLIP_ENST00000502396.1_Missense_Mutation_p.N125S|MLIP_ENST00000370877.2_Missense_Mutation_p.N62S|MLIP_ENST00000358276.5_Missense_Mutation_p.N108S	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	114						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)		p.N114S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						TTCGAAGCAAACAAACTTCAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	6											115.0	110.0	112.0					6																	53989392		2203	4300	6503	54097351	SO:0001583	missense	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.341A>G	6.37:g.53989392A>G	ENSP00000274897:p.Asn114Ser	Somatic		Capture	Illumina GAIIx	4	54097351	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	ENST00000274897.5	37	CCDS4954.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	12.04	1.817156	0.32145	.	.	ENSG00000146147	ENST00000505762;ENST00000274897;ENST00000514921;ENST00000370877;ENST00000509997;ENST00000370876;ENST00000503951;ENST00000502396;ENST00000358276;ENST00000514433	T;T;T;T;T;T;T;T;T	0.45668	2.28;1.96;1.94;1.96;1.53;0.89;1.97;1.55;1.96	5.48	3.06	0.35304	.	0.890469	0.09990	N	0.729800	T	0.12475	0.0303	L	0.38531	1.155	0.09310	N	1	B;P;P;B;B	0.41131	0.004;0.629;0.739;0.016;0.05	B;B;B;B;B	0.36464	0.007;0.16;0.225;0.02;0.031	T	0.09907	-1.0653	10	0.30854	T	0.27	0.1516	4.9526	0.14023	0.7174:0.1885:0.0941:0.0	.	125;125;52;114;114	Q5VWP3-3;B7ZA42;Q5VWP3-2;Q5VWP3;D6RE05	.;.;.;MLIP_HUMAN;.	S	91;114;114;62;62;52;73;125;108;115	ENSP00000274897:N114S;ENSP00000425142:N114S;ENSP00000359914:N62S;ENSP00000427584:N62S;ENSP00000359913:N52S;ENSP00000426830:N73S;ENSP00000426290:N125S;ENSP00000351019:N108S;ENSP00000421444:N115S	ENSP00000274897:N114S	N	+	2	0	MLIP	54097351	0.001000	0.12720	0.017000	0.16124	0.824000	0.46624	0.481000	0.22260	0.868000	0.35678	0.533000	0.62120	AAC		0.448	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569		Missense_Mutation
BICC1	80114	genome.wustl.edu	37	10	60549098	60549098	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr10:60549098C>A	ENST00000373886.3	+	7	681	c.677C>A	c.(676-678)cCc>cAc	p.P226H		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	226					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.P226H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CCTAATTCCCCCTCTATTCAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											145.0	137.0	139.0					10																	60549098		2203	4300	6503	60219104	SO:0001583	missense	80114			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.677C>A	10.37:g.60549098C>A	ENSP00000362993:p.Pro226His	Somatic		Capture	Illumina GAIIx	4	60219104		Missense_Mutation	SNP	ENST00000373886.3	37	CCDS31206.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081892	0.55861	.	.	ENSG00000122870	ENST00000373886	T	0.35605	1.3	5.66	5.66	0.87406	.	0.047390	0.85682	D	0.000000	T	0.41143	0.1146	M	0.67397	2.05	0.80722	D	1	B	0.15930	0.015	B	0.17433	0.018	T	0.26883	-1.0090	10	0.62326	D	0.03	-14.3127	16.0833	0.81020	0.1343:0.8657:0.0:0.0	.	226	Q9H694	BICC1_HUMAN	H	226	ENSP00000362993:P226H	ENSP00000362993:P226H	P	+	2	0	BICC1	60219104	1.000000	0.71417	0.976000	0.42696	0.834000	0.47266	5.848000	0.69458	2.665000	0.90641	0.655000	0.94253	CCC		0.408	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044		Missense_Mutation
PACS1	55690	genome.wustl.edu	37	11	66002792	66002792	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr11:66002792C>G	ENST00000320580.4	+	18	2158	c.2125C>G	c.(2125-2127)Cgg>Ggg	p.R709G	PACS1_ENST00000529757.1_Missense_Mutation_p.R245G	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	709					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R709G(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						CGTGGCAGGGCGGGTGATGCA	0.567																																																1	Substitution - Missense(1)	ovary(1)	11											69.0	64.0	66.0					11																	66002792		2200	4295	6495	65759368	SO:0001583	missense	55690			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.2125C>G	11.37:g.66002792C>G	ENSP00000316454:p.Arg709Gly	Somatic		Capture	Illumina GAIIx	4	65759368	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456218	0.84317	.	.	ENSG00000175115	ENST00000320580;ENST00000529757	T;T	0.56444	0.46;0.46	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.75236	0.3822	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79361	-0.1835	10	0.87932	D	0	-24.4704	17.2071	0.86921	0.0:1.0:0.0:0.0	.	709	Q6VY07	PACS1_HUMAN	G	709;245	ENSP00000316454:R709G;ENSP00000432858:R245G	ENSP00000316454:R709G	R	+	1	2	PACS1	65759368	0.998000	0.40836	0.993000	0.49108	0.985000	0.73830	3.769000	0.55303	2.599000	0.87857	0.561000	0.74099	CGG		0.567	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026		Missense_Mutation
IL12RB2	3595	genome.wustl.edu	37	1	67787504	67787504	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:67787504T>G	ENST00000262345.1	+	3	936	c.296T>G	c.(295-297)tTt>tGt	p.F99C	IL12RB2_ENST00000541374.1_Missense_Mutation_p.F99C|IL12RB2_ENST00000371000.1_Missense_Mutation_p.F99C|IL12RB2_ENST00000544434.1_Missense_Mutation_p.F99C	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	99					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.F99C(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ACAACCTTGTTTGTCTGCAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											168.0	161.0	163.0					1																	67787504		2203	4300	6503	67560092	SO:0001583	missense	3595			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.296T>G	1.37:g.67787504T>G	ENSP00000262345:p.Phe99Cys	Somatic		Capture	Illumina GAIIx	4	67560092	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403371	0.42613	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.95	5.95	0.96441	Immunoglobulin C2-set-like, ligand-binding (1);	0.144837	0.64402	D	0.000005	T	0.77864	0.4194	L	0.36672	1.1	0.45914	D	0.998751	D;D;D;D	0.89917	0.998;1.0;0.999;1.0	P;D;D;D	0.76575	0.905;0.988;0.946;0.977	T	0.80672	-0.1278	10	0.52906	T	0.07	-28.3087	12.8126	0.57647	0.0:0.0:0.0:1.0	.	99;99;99;99	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	C	99	ENSP00000262345:F99C;ENSP00000360039:F99C;ENSP00000445276:F99C;ENSP00000442443:F99C	ENSP00000262345:F99C	F	+	2	0	IL12RB2	67560092	0.996000	0.38824	0.961000	0.40146	0.005000	0.04900	3.848000	0.55903	2.274000	0.75844	0.528000	0.53228	TTT		0.393	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559		Missense_Mutation
MYBL1	4603	genome.wustl.edu	37	8	67492549	67492549	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr8:67492549A>G	ENST00000522677.3	-	9	1330	c.920T>C	c.(919-921)aTg>aCg	p.M307T	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Missense_Mutation_p.M307T	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	307	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M307T(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			AGTATTAGACATGTTATCATC	0.383																																																1	Substitution - Missense(1)	ovary(1)	8											67.0	64.0	65.0					8																	67492549		1878	4110	5988	67655103	SO:0001583	missense	4603			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.920T>C	8.37:g.67492549A>G	ENSP00000429633:p.Met307Thr	Somatic		Capture	Illumina GAIIx	4	67655103	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	37	CCDS47867.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724869	0.30593	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	T;T	0.16743	2.8;2.32	5.34	5.34	0.76211	.	0.166422	0.56097	D	0.000032	T	0.16642	0.0400	L	0.50333	1.59	0.41698	D	0.98938	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.06807	-1.0806	10	0.09843	T	0.71	-4.7883	15.3103	0.74026	1.0:0.0:0.0:0.0	.	307;306;307	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	T	307	ENSP00000429633:M307T;ENSP00000428011:M307T	ENSP00000429633:M307T	M	-	2	0	MYBL1	67655103	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.924000	0.63418	2.007000	0.58848	0.533000	0.62120	ATG		0.383	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274		Missense_Mutation
DTX2	113878	genome.wustl.edu	37	7	76111908	76111908	+	Missense_Mutation	SNP	G	G	T	rs146593354		TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:76111908G>T	ENST00000324432.5	+	5	862	c.352G>T	c.(352-354)Gat>Tat	p.D118Y	DTX2_ENST00000446820.2_Missense_Mutation_p.D118Y|DTX2_ENST00000430490.2_Missense_Mutation_p.D118Y|DTX2_ENST00000307569.8_Missense_Mutation_p.D118Y|DTX2_ENST00000472426.1_3'UTR|DTX2_ENST00000413936.2_Missense_Mutation_p.D118Y|DTX2_ENST00000446600.1_Missense_Mutation_p.D27Y	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	118	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.D118Y(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GCTGAGCGACGATGGCTCCTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											52.0	51.0	51.0					7																	76111908		2203	4300	6503	75949844	SO:0001583	missense	113878				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.352G>T	7.37:g.76111908G>T	ENSP00000322885:p.Asp118Tyr	Somatic		Capture	Illumina GAIIx	4	75949844	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	ENST00000324432.5	37	CCDS5587.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	.	16.19	3.053588	0.55218	.	.	ENSG00000091073	ENST00000324432;ENST00000307569;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000423646;ENST00000430490;ENST00000446820	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.41	5.41	0.78517	WWE domain (2);WWE domain, subgroup (1);	0.054241	0.64402	D	0.000001	T	0.55784	0.1942	L	0.40543	1.245	0.45946	D	0.998773	D;D;D	0.63046	0.992;0.992;0.978	P;P;D	0.65010	0.805;0.886;0.931	T	0.55347	-0.8155	10	0.54805	T	0.06	-18.442	18.1599	0.89705	0.0:0.0:1.0:0.0	.	27;118;118	F5GX89;Q86UW9-2;Q86UW9	.;.;DTX2_HUMAN	Y	118;118;27;27;118;118;118;118	ENSP00000322885:D118Y;ENSP00000305242:D118Y;ENSP00000397648:D27Y;ENSP00000390218:D118Y;ENSP00000415838:D118Y;ENSP00000411986:D118Y;ENSP00000392545:D118Y	ENSP00000305242:D118Y	D	+	1	0	AC005522.1	75949844	1.000000	0.71417	0.954000	0.39281	0.247000	0.25773	6.399000	0.73248	2.552000	0.86080	0.561000	0.74099	GAT		0.617	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			Missense_Mutation
BNC1	646	genome.wustl.edu	37	15	83935704	83935704	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr15:83935704G>A	ENST00000345382.2	-	3	404	c.319C>T	c.(319-321)Cgc>Tgc	p.R107C	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.R100C	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	107					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R107C(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						ATTTTTAGGCGAACGGGGATG	0.512																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	15											107.0	99.0	102.0					15																	83935704		2203	4300	6503	81726708	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.319C>T	15.37:g.83935704G>A	ENSP00000307041:p.Arg107Cys	Somatic		Capture	Illumina GAIIx	4	81726708	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.136508	0.94517	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	D	0.86956	-2.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.93556	0.7943	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93593	0.6923	10	0.87932	D	0	-34.9268	19.614	0.95622	0.0:0.0:1.0:0.0	.	100;107	F5GY04;Q01954	.;BNC1_HUMAN	C	107;100	ENSP00000307041:R107C	ENSP00000307041:R107C	R	-	1	0	BNC1	81726708	1.000000	0.71417	0.997000	0.53966	0.919000	0.55068	9.554000	0.98121	2.873000	0.98535	0.561000	0.74099	CGC		0.512	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		Missense_Mutation
NECAB2	54550	genome.wustl.edu	37	16	84035457	84035457	+	Silent	SNP	G	G	A	rs149100547	byFrequency	TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr16:84035457G>A	ENST00000305202.4	+	12	1085	c.1068G>A	c.(1066-1068)gcG>gcA	p.A356A	NECAB2_ENST00000565691.1_Silent_p.A273A	NM_019065.2	NP_061938.2	Q7Z6G3	NECA2_HUMAN	N-terminal EF-hand calcium binding protein 2	356	ABM.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)	p.A356A(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19						TGTGTAAGGCGTTCCGGCACG	0.632													g|||	6	0.00119808	0.003	0.0	5008	,	,		17211	0.0		0.0	False		,,,				2504	0.002															1	Substitution - coding silent(1)	ovary(1)	16						A		11,4389	17.9+/-39.9	0,11,2189	63.0	53.0	56.0		1068	-10.2	0.0	16	dbSNP_134	56	0,8600		0,0,4300	no	coding-synonymous	NECAB2	NM_019065.2		0,11,6489	AA,AG,GG		0.0,0.25,0.0846		356/387	84035457	11,12989	2200	4300	6500	82592958	SO:0001819	synonymous_variant	54550			AY299331	CCDS10940.1	16q23.3-q24.1	2013-01-10	2007-12-06	2007-12-06	ENSG00000103154	ENSG00000103154		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	23746	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 2"""	EFCBP2		12044471	Standard	NM_019065		Approved		uc002fhd.3	Q7Z6G3	OTTHUMG00000137636	ENST00000305202.4:c.1068G>A	16.37:g.84035457G>A		Somatic		Capture	Illumina GAIIx	4	82592958	A2RRG3|O75547|Q6ZSK0	Silent	SNP	ENST00000305202.4	37	CCDS10940.1	SNP	40	WashU																																																																																				0.632	NECAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269077.2	NM_019065		Silent
ENTPD1	953	genome.wustl.edu	37	10	97624620	97624620	+	Splice_Site	SNP	T	T	C			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr10:97624620T>C	ENST00000371205.4	+	9	1609		c.e9+2		RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000371207.3_Splice_Site|ENTPD1_ENST00000543964.1_Splice_Site|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1_ENST00000453258.2_Splice_Site|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000539125.1_Splice_Site|ENTPD1_ENST00000371203.5_Splice_Site|RP11-248J23.7_ENST00000491114.1_Splice_Site			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)	p.?(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		ATTGGCAAGGTAATTTGGGGG	0.512																																																1	Unknown(1)	ovary(1)	10											71.0	62.0	65.0					10																	97624620		2203	4300	6503	97614610	SO:0001630	splice_region_variant	953			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.1326+2T>C	10.37:g.97624620T>C		Somatic		Capture	Illumina GAIIx	4	97614610	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Splice_Site_SNP	SNP	ENST00000371205.4	37	CCDS7444.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583506	0.65992	.	.	ENSG00000138185	ENST00000453258;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1881	0.59693	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ENTPD1	97614610	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.976000	0.76135	2.212000	0.71576	0.533000	0.62120	.		0.512	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	Intron	Splice_Site_SNP
VPS13B	157680	genome.wustl.edu	37	8	100128073	100128073	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr8:100128073A>G	ENST00000358544.2	+	7	1019	c.908A>G	c.(907-909)cAt>cGt	p.H303R	VPS13B_ENST00000355155.1_Missense_Mutation_p.H303R|VPS13B_ENST00000357162.2_Missense_Mutation_p.H303R|VPS13B_ENST00000395996.1_Missense_Mutation_p.H303R|VPS13B_ENST00000441350.2_Missense_Mutation_p.H303R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	303					protein transport (GO:0015031)			p.H303R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTTACTTGTCATAATAAAGAT	0.299																																					Colon(161;2205 2542 7338 31318)											1	Substitution - Missense(1)	ovary(1)	8											67.0	69.0	68.0					8																	100128073		2203	4296	6499	100197249	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.908A>G	8.37:g.100128073A>G	ENSP00000351346:p.His303Arg	Somatic		Capture	Illumina GAIIx	4	100197249	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	10.25	1.299077	0.23650	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	T;T;T;T;D	0.82433	-1.03;-0.32;-0.32;-0.03;-1.61	5.65	3.25	0.37280	.	0.339565	0.27451	N	0.019317	T	0.64114	0.2569	N	0.22421	0.69	0.29101	N	0.881461	P;B;B;B;B	0.34757	0.467;0.112;0.256;0.095;0.078	B;B;B;B;B	0.31547	0.132;0.015;0.086;0.023;0.033	T	0.54323	-0.8311	10	0.18710	T	0.47	.	3.2179	0.06705	0.6424:0.1406:0.0737:0.1433	.	303;303;303;303;303	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	R	303	ENSP00000347281:H303R;ENSP00000349685:H303R;ENSP00000351346:H303R;ENSP00000379318:H303R;ENSP00000398472:H303R	ENSP00000347281:H303R	H	+	2	0	VPS13B	100197249	0.980000	0.34600	0.997000	0.53966	0.775000	0.43874	2.275000	0.43399	0.940000	0.37473	0.533000	0.62120	CAT		0.299	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		Missense_Mutation
SASS6	163786	genome.wustl.edu	37	1	100573197	100573197	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:100573197G>A	ENST00000287482.5	-	10	1273	c.1133C>T	c.(1132-1134)gCa>gTa	p.A378V	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.A211V	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	378					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)		p.A378V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CAGAAGTTCTGCAGATAATGA	0.254																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	44.0	42.0					1																	100573197		2197	4281	6478	100345785	SO:0001583	missense	163786			AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1133C>T	1.37:g.100573197G>A	ENSP00000287482:p.Ala378Val	Somatic		Capture	Illumina GAIIx	4	100345785	D3DT55|Q8N3K0	Missense_Mutation	SNP	ENST00000287482.5	37	CCDS764.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635890	0.67130	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.78481	-1.18;-1.18	5.64	5.64	0.86602	.	0.150547	0.64402	D	0.000020	T	0.70500	0.3231	L	0.59436	1.845	0.43036	D	0.994616	P	0.47762	0.9	B	0.42522	0.39	T	0.70974	-0.4726	10	0.33141	T	0.24	-8.1079	19.6985	0.96043	0.0:0.0:1.0:0.0	.	378	Q6UVJ0	SAS6_HUMAN	V	378;351;211	ENSP00000287482:A378V;ENSP00000440169:A211V	ENSP00000287482:A378V	A	-	2	0	SASS6	100345785	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.620000	0.67736	2.650000	0.89964	0.585000	0.79938	GCA		0.254	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292		Missense_Mutation
NALCN	259232	genome.wustl.edu	37	13	102030996	102030996	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr13:102030996A>C	ENST00000251127.6	-	4	381	c.300T>G	c.(298-300)agT>agG	p.S100R	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.S100R|NALCN_ENST00000376200.5_Missense_Mutation_p.S100R	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	100					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.S100R(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCACATAGGAACTATCCCCCT	0.294																																																1	Substitution - Missense(1)	ovary(1)	13											89.0	92.0	91.0					13																	102030996		2203	4299	6502	100828997	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.300T>G	13.37:g.102030996A>C	ENSP00000251127:p.Ser100Arg	Somatic		Capture	Illumina GAIIx	4	100828997	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	5.526	0.281925	0.10458	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.98264	-4.83;-4.83;-4.83	5.57	4.18	0.49190	Ion transport (1);	0.294916	0.43416	D	0.000567	D	0.90065	0.6897	N	0.01250	-0.93	0.39722	D	0.971481	B;B	0.13594	0.008;0.001	B;B	0.17979	0.02;0.004	D	0.83699	0.0181	10	0.13853	T	0.58	.	7.1975	0.25862	0.7134:0.0:0.2866:0.0	.	100;100	F2Z323;Q8IZF0	.;NALCN_HUMAN	R	100	ENSP00000251127:S100R;ENSP00000365367:S100R;ENSP00000365373:S100R	ENSP00000251127:S100R	S	-	3	2	NALCN	100828997	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	4.183000	0.58317	0.751000	0.32900	0.482000	0.46254	AGT		0.294	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		Missense_Mutation
ITGBL1	9358	genome.wustl.edu	37	13	102220075	102220075	+	Silent	SNP	G	G	A	rs369818869		TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr13:102220075G>A	ENST00000376180.3	+	3	561	c.342G>A	c.(340-342)aaG>aaA	p.K114K	ITGBL1_ENST00000376162.3_Silent_p.K21K|ITGBL1_ENST00000545560.2_5'UTR	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	114	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)		p.K114K(1)		breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACTGTGGCAAGTGCAAGTGTG	0.423																																																1	Substitution - coding silent(1)	ovary(1)	13						G		1,4405	2.1+/-5.4	0,1,2202	232.0	202.0	212.0		342	3.7	1.0	13		212	0,8600		0,0,4300	no	coding-synonymous	ITGBL1	NM_004791.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		114/495	102220075	1,13005	2203	4300	6503	101018076	SO:0001819	synonymous_variant	9358			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.342G>A	13.37:g.102220075G>A		Somatic		Capture	Illumina GAIIx	4	101018076	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	ENST00000376180.3	37	CCDS9499.1	SNP	36	WashU																																																																																				0.423	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791		Silent
SLC5A7	60482	genome.wustl.edu	37	2	108622654	108622654	+	Silent	SNP	A	A	C			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:108622654A>C	ENST00000264047.2	+	7	1167	c.891A>C	c.(889-891)tcA>tcC	p.S297S	SLC5A7_ENST00000409059.1_Silent_p.S297S|SLC5A7_ENST00000540517.1_Silent_p.S192S	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	297					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)	p.S297S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TTGGAGCATCAACAGGTAAAT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	2											97.0	92.0	94.0					2																	108622654		2203	4300	6503	107989086	SO:0001819	synonymous_variant	60482			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.891A>C	2.37:g.108622654A>C		Somatic		Capture	Illumina GAIIx	4	107989086	Q53TF2	Silent	SNP	ENST00000264047.2	37	CCDS2074.1	SNP	5	WashU																																																																																				0.542	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1			Silent
KIAA1919	91749	genome.wustl.edu	37	6	111587906	111587906	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:111587906C>A	ENST00000368847.4	+	4	1494	c.1141C>A	c.(1141-1143)Cct>Act	p.P381T		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	381					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.P381T(1)		large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AGGAAAATACCCTGATTTGCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											118.0	122.0	121.0					6																	111587906		2203	4300	6503	111694599	SO:0001583	missense	91749			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1141C>A	6.37:g.111587906C>A	ENSP00000357840:p.Pro381Thr	Somatic		Capture	Illumina GAIIx	4	111694599	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	37	CCDS5090.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676135	0.47886	.	.	ENSG00000173214	ENST00000368847	T	0.80738	-1.41	5.92	5.05	0.67936	Major facilitator superfamily domain, general substrate transporter (1);	0.260868	0.43919	D	0.000513	T	0.81361	0.4806	M	0.62723	1.935	0.40986	D	0.984813	D	0.54772	0.968	P	0.54664	0.758	T	0.81450	-0.0927	10	0.48119	T	0.1	-9.4291	14.5218	0.67856	0.0:0.9302:0.0:0.0698	.	381	Q5TF39	NAGT1_HUMAN	T	381	ENSP00000357840:P381T	ENSP00000357840:P381T	P	+	1	0	KIAA1919	111694599	0.098000	0.21812	0.394000	0.26270	0.125000	0.20455	2.655000	0.46707	2.806000	0.96561	0.551000	0.68910	CCT		0.413	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369		Missense_Mutation
SVEP1	79987	genome.wustl.edu	37	9	113312349	113312349	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr9:113312349T>A	ENST00000401783.2	-	2	903	c.567A>T	c.(565-567)aaA>aaT	p.K189N	SVEP1_ENST00000374461.1_Missense_Mutation_p.K166N|SVEP1_ENST00000302728.8_Missense_Mutation_p.K189N|SVEP1_ENST00000467821.1_5'Flank|SVEP1_ENST00000374469.1_Missense_Mutation_p.K166N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	189	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.K189N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAAATACAACTTTTGTTGAGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	9											194.0	193.0	193.0					9																	113312349		1889	4114	6003	112352170	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.567A>T	9.37:g.113312349T>A	ENSP00000384917:p.Lys189Asn	Somatic		Capture	Illumina GAIIx	4	112352170	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.92	3.505903	0.64410	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.5	4.34	0.51931	von Willebrand factor, type A (3);	0.046806	0.85682	D	0.000000	D	0.92593	0.7647	M	0.84326	2.69	0.36633	D	0.876382	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.979;0.964	D	0.94282	0.7521	10	0.87932	D	0	.	9.299	0.37833	0.0:0.1922:0.0:0.8078	.	189;189;189	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	N	189;166;189;166	ENSP00000384917:K189N;ENSP00000363593:K166N;ENSP00000304118:K189N;ENSP00000363585:K166N	ENSP00000304118:K189N	K	-	3	2	SVEP1	112352170	1.000000	0.71417	0.997000	0.53966	0.682000	0.39822	1.298000	0.33412	2.209000	0.71365	0.460000	0.39030	AAA		0.418	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
MOV10	4343	genome.wustl.edu	37	1	113239067	113239067	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:113239067C>T	ENST00000413052.2	+	13	2282	c.1892C>T	c.(1891-1893)tCg>tTg	p.S631L	MOV10_ENST00000357443.2_Missense_Mutation_p.S631L|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Missense_Mutation_p.S575L|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000369645.1_Missense_Mutation_p.S631L	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	631					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.S631L(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		AGGTTGGTCTCGGCCCAGTTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											114.0	105.0	108.0					1																	113239067		2203	4300	6503	113040590	SO:0001583	missense	4343			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1892C>T	1.37:g.113239067C>T	ENSP00000399797:p.Ser631Leu	Somatic		Capture	Illumina GAIIx	4	113040590	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	ENST00000413052.2	37	CCDS853.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	19.77	3.890196	0.72524	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000369644;ENST00000357443;ENST00000369648	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.18	4.26	0.50523	.	0.187386	0.48767	D	0.000166	T	0.53174	0.1780	L	0.39633	1.23	0.80722	D	1	P	0.43231	0.801	B	0.41571	0.36	T	0.61950	-0.6957	10	0.06494	T	0.89	-6.3065	14.7902	0.69837	0.1456:0.8544:0.0:0.0	.	631	Q9HCE1	MOV10_HUMAN	L	631;631;575;631;569	ENSP00000399797:S631L;ENSP00000358659:S631L;ENSP00000358658:S575L;ENSP00000350028:S631L	ENSP00000350028:S631L	S	+	2	0	MOV10	113040590	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	7.211000	0.77933	1.378000	0.46305	0.655000	0.94253	TCG		0.567	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963		Missense_Mutation
CHAMP1	283489	genome.wustl.edu	37	13	115089582	115089582	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1542-01	TCGA-04-1542-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr13:115089582G>C	ENST00000361283.1	+	3	574	c.265G>C	c.(265-267)Gac>Cac	p.D89H		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	89					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.D89H(1)									TGCATCCCCAGACAAATGGAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	13											74.0	71.0	72.0					13																	115089582		2203	4300	6503	114107684	SO:0001583	missense	283489			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.265G>C	13.37:g.115089582G>C	ENSP00000354730:p.Asp89His	Somatic		Capture	Illumina GAIIx	4	114107684	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	37	CCDS9545.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607360	0.66558	.	.	ENSG00000198824	ENST00000361283	T	0.01335	5.0	5.96	5.96	0.96718	.	0.320888	0.26324	N	0.025037	T	0.02304	0.0071	N	0.24115	0.695	0.42507	D	0.992956	P	0.45212	0.853	P	0.45856	0.495	T	0.73424	-0.3987	9	.	.	.	-1.9711	20.3928	0.98949	0.0:0.0:1.0:0.0	.	89	Q96JM3	ZN828_HUMAN	H	89	ENSP00000354730:D89H	.	D	+	1	0	ZNF828	114107684	1.000000	0.71417	0.846000	0.33378	0.903000	0.53119	6.134000	0.71689	2.813000	0.96785	0.655000	0.94253	GAC		0.393	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436		Missense_Mutation
BCL9L	283149	genome.wustl.edu	37	11	118772414	118772414	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr11:118772414G>A	ENST00000334801.3	-	6	3002	c.2038C>T	c.(2038-2040)Cgg>Tgg	p.R680W	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	680					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.R680W(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		AGCTGGTGCCGCAGCAGCTCC	0.652																																																1	Substitution - Missense(1)	ovary(1)	11											36.0	36.0	36.0					11																	118772414		2200	4294	6494	118277624	SO:0001583	missense	283149			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2038C>T	11.37:g.118772414G>A	ENSP00000335320:p.Arg680Trp	Somatic		Capture	Illumina GAIIx	4	118277624	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	15.06	2.719857	0.48728	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	T	0.66815	-0.23	4.67	2.64	0.31445	.	0.000000	0.40640	N	0.001044	T	0.74756	0.3758	L	0.47716	1.5	0.48185	D	0.999604	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.989	T	0.75303	-0.3365	10	0.72032	D	0.01	-21.2041	12.896	0.58099	0.0:0.0:0.6744:0.3256	.	675;680	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	W	680;643;680;680	ENSP00000335320:R680W	ENSP00000335320:R680W	R	-	1	2	BCL9L	118277624	0.996000	0.38824	1.000000	0.80357	0.779000	0.44077	0.923000	0.28757	0.464000	0.27142	0.313000	0.20887	CGG		0.652	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557		Missense_Mutation
ZC3HAV1	56829	genome.wustl.edu	37	7	138768734	138768734	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:138768734G>T	ENST00000242351.5	-	3	805	c.489C>A	c.(487-489)aaC>aaA	p.N163K	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.N163K|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.N163K	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	163	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.N163K(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GTGGCTGCTGGTTACAAATCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											111.0	106.0	108.0					7																	138768734		2203	4300	6503	138419274	SO:0001583	missense	56829			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.489C>A	7.37:g.138768734G>T	ENSP00000242351:p.Asn163Lys	Somatic		Capture	Illumina GAIIx	4	138419274	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	5.367	0.253034	0.10185	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.50277	0.75;0.75;0.75	4.5	0.525	0.17072	.	1.249470	0.05360	N	0.533559	T	0.33644	0.0870	N	0.26042	0.785	0.09310	N	1	B;B	0.27416	0.178;0.007	B;B	0.28011	0.085;0.01	T	0.29181	-1.0020	10	0.40728	T	0.16	.	4.674	0.12703	0.205:0.3736:0.4214:0.0	.	163;163	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	K	163	ENSP00000242351:N163K;ENSP00000418385:N163K;ENSP00000419855:N163K	ENSP00000242351:N163K	N	-	3	2	ZC3HAV1	138419274	0.000000	0.05858	0.047000	0.18901	0.020000	0.10135	-0.443000	0.06862	0.219000	0.20840	-0.140000	0.14226	AAC		0.488	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119		Missense_Mutation
CNTNAP2	26047	genome.wustl.edu	37	7	147844669	147844669	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:147844669C>A	ENST00000361727.3	+	17	3157	c.2641C>A	c.(2641-2643)Cag>Aag	p.Q881K	CNTNAP2_ENST00000538075.1_5'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	881	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.Q881K(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAACGATGACCAGTGGCACCG	0.567										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	ovary(1)	7											128.0	119.0	122.0					7																	147844669		2203	4300	6503	147475602	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2641C>A	7.37:g.147844669C>A	ENSP00000354778:p.Gln881Lys	Somatic		Capture	Illumina GAIIx	4	147475602	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919165	0.73098	.	.	ENSG00000174469	ENST00000361727	T	0.78126	-1.15	5.34	5.34	0.76211	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.75019	0.3793	L	0.49778	1.585	0.80722	D	1	B	0.25048	0.117	B	0.28011	0.085	T	0.71090	-0.4693	10	0.36615	T	0.2	.	17.6488	0.88157	0.0:1.0:0.0:0.0	.	881	Q9UHC6	CNTP2_HUMAN	K	881	ENSP00000354778:Q881K	ENSP00000354778:Q881K	Q	+	1	0	CNTNAP2	147475602	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.988000	0.70579	2.507000	0.84556	0.561000	0.74099	CAG		0.567	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			Missense_Mutation
TMLHE	55217	genome.wustl.edu	37	X	154754255	154754255	+	Missense_Mutation	SNP	C	C	T	rs201374974		TCGA-04-1542-01	TCGA-04-1542-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chrX:154754255C>T	ENST00000334398.3	-	3	365	c.220G>A	c.(220-222)Gtc>Atc	p.V74I	TMLHE_ENST00000369439.4_Missense_Mutation_p.V74I|TMLHE-AS1_ENST00000452506.1_RNA	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	74					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)	p.V74I(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	CGAAGCCAGACGTAATCAAAG	0.428													C|||	2	0.000529801	0.0	0.0029	3775	,	,		13295	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	X						C	ILE/VAL,ILE/VAL	0,3834		0,0,1632,570	155.0	135.0	142.0		220,220	3.8	1.0	X		142	1,6727		0,1,2427,1872	yes	missense,missense	TMLHE	NM_001184797.1,NM_018196.3	29,29	0,1,4059,2442	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging	74/377,74/422	154754255	1,10561	2202	4300	6502	154407449	SO:0001583	missense	55217			AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.220G>A	X.37:g.154754255C>T	ENSP00000335261:p.Val74Ile	Somatic		Capture	Illumina GAIIx	4	154407449	A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Missense_Mutation	SNP	ENST00000334398.3	37	CCDS14768.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591100	0.66219	0.0	1.49E-4	ENSG00000185973	ENST00000334398;ENST00000369439	D;T	0.82081	-1.57;-0.99	3.81	3.81	0.43845	Domain of unknown function, DUF971 (1);	0.000000	0.85682	D	0.000000	D	0.82898	0.5137	L	0.33137	0.985	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	T	0.78130	-0.2324	10	0.05620	T	0.96	-10.9097	12.9807	0.58562	0.0:1.0:0.0:0.0	.	74;74;74	Q9NVH6-2;A8K6M9;Q9NVH6	.;.;TMLH_HUMAN	I	74	ENSP00000335261:V74I;ENSP00000358447:V74I	ENSP00000335261:V74I	V	-	1	0	TMLHE	154407449	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.454000	0.73493	1.834000	0.53371	0.513000	0.50165	GTC		0.428	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058817.1	NM_018196		Missense_Mutation
SLITRK3	22865	genome.wustl.edu	37	3	164906265	164906265	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr3:164906265G>A	ENST00000475390.1	-	2	2797	c.2354C>T	c.(2353-2355)cCg>cTg	p.P785L	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P785L			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	785					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.P785L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						ACCCATTCCCGGTGGTTGTGT	0.552										HNSCC(40;0.11)																																						1	Substitution - Missense(1)	ovary(1)	3											87.0	93.0	91.0					3																	164906265		2203	4300	6503	166388959	SO:0001583	missense	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2354C>T	3.37:g.164906265G>A	ENSP00000420091:p.Pro785Leu	Somatic		Capture	Illumina GAIIx	4	166388959	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275349	0.23307	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.54279	0.58;0.58	5.44	5.44	0.79542	.	0.215496	0.23543	N	0.047051	T	0.29783	0.0744	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09552	-1.0669	10	0.21540	T	0.41	-0.9216	10.0662	0.42306	0.0882:0.0:0.9118:0.0	.	785	O94933	SLIK3_HUMAN	L	785	ENSP00000420091:P785L;ENSP00000241274:P785L	ENSP00000241274:P785L	P	-	2	0	SLITRK3	166388959	0.618000	0.27051	0.046000	0.18839	0.531000	0.34715	1.995000	0.40767	2.832000	0.97577	0.655000	0.94253	CCG		0.552	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		Missense_Mutation
PDE11A	50940	genome.wustl.edu	37	2	178879078	178879078	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:178879078G>A	ENST00000286063.6	-	2	1339	c.1022C>T	c.(1021-1023)gCg>gTg	p.A341V	AC011998.1_ENST00000457053.1_RNA|PDE11A_ENST00000358450.4_Missense_Mutation_p.A91V	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	341	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.A341V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CTTATTTATCGCTTGGGCCAC	0.373									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							1	Substitution - Missense(1)	ovary(1)	2											155.0	143.0	147.0					2																	178879078		2203	4300	6503	178587324	SO:0001583	missense	50940	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1022C>T	2.37:g.178879078G>A	ENSP00000286063:p.Ala341Val	Somatic		Capture	Illumina GAIIx	4	178587324	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662056	0.29515	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000431253	T;T	0.65549	-0.16;-0.16	5.36	5.36	0.76844	GAF (2);	0.047751	0.85682	D	0.000000	T	0.42177	0.1191	N	0.02775	-0.495	0.80722	D	1	D;P	0.55800	0.973;0.854	P;B	0.47705	0.555;0.324	T	0.48043	-0.9069	10	0.02654	T	1	.	18.4349	0.90642	0.0:0.0:1.0:0.0	.	91;341	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	V	341;91;16	ENSP00000286063:A341V;ENSP00000351232:A91V	ENSP00000286063:A341V	A	-	2	0	PDE11A	178587324	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	9.813000	0.99286	2.663000	0.90544	0.467000	0.42956	GCG		0.373	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2			Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179395650	179395650	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:179395650G>A	ENST00000591111.1	-	308	100993	c.100769C>T	c.(100768-100770)cCa>cTa	p.P33590L	TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P35231L|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P26291L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P26166L|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P26358L|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P32663L			Q8WZ42	TITIN_HUMAN	titin	33590					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P26166L(1)|p.P32661L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTCTTGGTGGTGATGTCAC	0.473																																																2	Substitution - Missense(2)	ovary(2)	2											148.0	146.0	146.0					2																	179395650		1890	4101	5991	179103896	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100769C>T	2.37:g.179395650G>A	ENSP00000465570:p.Pro33590Leu	Somatic		Capture	Illumina GAIIx	4	179103896	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144510	0.77888	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70045	-0.45;-0.08;-0.1;-0.12	4.99	4.99	0.66335	Ribonuclease H-like (1);	.	.	.	.	T	0.70552	0.3237	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.63880	0.986;0.986;0.986;0.993	P;P;P;P	0.56216	0.593;0.593;0.593;0.794	T	0.75102	-0.3436	9	0.87932	D	0	.	18.2867	0.90117	0.0:0.0:1.0:0.0	.	26166;26291;26358;33590	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	32663;26166;26358;26291;26163	ENSP00000343764:P32663L;ENSP00000434586:P26166L;ENSP00000340554:P26358L;ENSP00000352154:P26291L	ENSP00000340554:P26358L	P	-	2	0	TTN	179103896	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.061000	0.71148	2.321000	0.78463	0.455000	0.32223	CCA		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179615844	179615844	+	Intron	SNP	C	C	T	rs200816462		TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:179615844C>T	ENST00000591111.1	-	45	10585				TTN_ENST00000360870.5_Silent_p.K3761K|TTN_ENST00000589042.1_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K3761K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATGATCTACCTTATAACTTT	0.363																																																1	Substitution - coding silent(1)	ovary(1)	2											83.0	84.0	84.0					2																	179615844		2201	4295	6496	179324089	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2006G>A	2.37:g.179615844C>T		Somatic		Capture	Illumina GAIIx	4	179324089	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37		SNP	24	WashU																																																																																				0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Silent
COL3A1	1281	genome.wustl.edu	37	2	189856241	189856241	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:189856241G>A	ENST00000304636.3	+	12	1051	c.881G>A	c.(880-882)gGa>gAa	p.G294E	COL3A1_ENST00000317840.5_Missense_Mutation_p.G294E	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	294	Triple-helical region.			NGA -> DGS (in Ref. 11; AA sequence). {ECO:0000305}.	aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.G294E(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGCGAAAATGGAGCTCCTGGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	69.0	68.0					2																	189856241		2203	4300	6503	189564486	SO:0001583	missense	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.881G>A	2.37:g.189856241G>A	ENSP00000304408:p.Gly294Glu	Somatic		Capture	Illumina GAIIx	4	189564486	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049310	0.75846	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99619	-6.28;-6.28	5.93	5.93	0.95920	.	0.000000	0.46758	D	0.000276	D	0.99802	0.9915	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97321	0.9944	10	0.72032	D	0.01	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	294	P02461	CO3A1_HUMAN	E	294	ENSP00000304408:G294E;ENSP00000315243:G294E	ENSP00000304408:G294E	G	+	2	0	COL3A1	189564486	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.135000	0.94478	2.814000	0.96858	0.591000	0.81541	GGA		0.313	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090		Missense_Mutation
LHX9	56956	genome.wustl.edu	37	1	197887071	197887071	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:197887071A>G	ENST00000367387.4	+	1	543	c.118A>G	c.(118-120)Aga>Gga	p.R40G	LHX9_ENST00000367391.1_Missense_Mutation_p.R31G|LHX9_ENST00000606127.1_3'UTR|LHX9_ENST00000561173.1_Missense_Mutation_p.R46G|LHX9_ENST00000367390.3_Missense_Mutation_p.R31G|LHX9_ENST00000337020.2_Missense_Mutation_p.R40G	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	40					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R40G(1)		endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						GATGGAGCGCAGATCCAAGAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	89.0	89.0					1																	197887071		2203	4300	6503	196153694	SO:0001583	missense	56956			AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.118A>G	1.37:g.197887071A>G	ENSP00000356357:p.Arg40Gly	Somatic		Capture	Illumina GAIIx	4	196153694	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	17.63	3.438126	0.62955	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000367388;ENST00000337020;ENST00000367387	T;D;T;D	0.89617	0.39;-2.54;0.34;-2.54	5.06	2.64	0.31445	.	0.000000	0.85682	D	0.000000	D	0.92251	0.7542	L	0.59436	1.845	0.54753	D	0.999983	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.987;0.999	D	0.91296	0.5063	10	0.72032	D	0.01	.	12.1768	0.54190	0.5592:0.4408:0.0:0.0	.	40;31;31	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	G	31;31;83;40;40	ENSP00000356361:R31G;ENSP00000356360:R31G;ENSP00000337969:R40G;ENSP00000356357:R40G	ENSP00000337969:R40G	R	+	1	2	LHX9	196153694	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.018000	0.30002	0.312000	0.23038	-0.313000	0.08912	AGA		0.667	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204		Missense_Mutation
ESRRG	2104	genome.wustl.edu	37	1	216850648	216850648	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:216850648G>A	ENST00000408911.3	-	2	395	c.242C>T	c.(241-243)tCg>tTg	p.S81L	ESRRG_ENST00000493748.1_Missense_Mutation_p.S58L|ESRRG_ENST00000361395.2_Missense_Mutation_p.S58L|ESRRG_ENST00000360012.3_Missense_Mutation_p.S58L|ESRRG_ENST00000366940.2_Missense_Mutation_p.S58L|ESRRG_ENST00000366937.1_Missense_Mutation_p.S86L|ESRRG_ENST00000359162.2_Missense_Mutation_p.S58L|ESRRG_ENST00000366938.2_Missense_Mutation_p.S58L|ESRRG_ENST00000361525.3_Missense_Mutation_p.S58L|ESRRG_ENST00000391890.3_Missense_Mutation_p.S58L|ESRRG_ENST00000493603.1_Missense_Mutation_p.S58L|ESRRG_ENST00000487276.1_Missense_Mutation_p.S58L|ESRRG_ENST00000463665.1_Missense_Mutation_p.S58L	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	81					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S81L(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GAGAGGTGGCGAGTCAAGTCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	147.0	155.0					1																	216850648		2203	4300	6503	214917271	SO:0001583	missense	2104			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.242C>T	1.37:g.216850648G>A	ENSP00000386171:p.Ser81Leu	Somatic		Capture	Illumina GAIIx	4	214917271	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.934263	0.97122	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275;ENST00000469486	D;D;D;D;D;D;D;D;D;D;D;D;D;D;T	0.95447	-3.25;-3.25;-3.26;-3.28;-3.25;-3.25;-3.25;-3.25;-3.25;-3.28;-3.71;-3.25;-3.25;-3.08;-0.06	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	M	0.62723	1.935	0.80722	D	1	D;D;D	0.69078	0.965;0.997;0.994	P;D;P	0.69479	0.506;0.964;0.885	D	0.96583	0.9432	10	0.51188	T	0.08	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	58;86;81	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	L	58;58;86;81;58;58;58;58;58;58;58;58;58;58;58;58	ENSP00000355225:S58L;ENSP00000355907:S58L;ENSP00000355904:S86L;ENSP00000386171:S81L;ENSP00000352077:S58L;ENSP00000354584:S58L;ENSP00000355905:S58L;ENSP00000353108:S58L;ENSP00000419594:S58L;ENSP00000375761:S58L;ENSP00000418629:S58L;ENSP00000419155:S58L;ENSP00000417374:S58L;ENSP00000419514:S58L;ENSP00000417900:S58L	ENSP00000346386:S58L	S	-	2	0	ESRRG	214917271	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	TCG		0.562	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595		Missense_Mutation
NYAP2	57624	genome.wustl.edu	37	2	226273703	226273703	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1542-01	TCGA-04-1542-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr2:226273703T>C	ENST00000272907.6	+	2	520	c.107T>C	c.(106-108)aTt>aCt	p.I36T	NYAP2_ENST00000409269.2_Missense_Mutation_p.I36T	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	36					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.I36T(1)									GGCTTGGTTATTCAGAATGCG	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											135.0	121.0	125.0					2																	226273703		1892	4119	6011	225981947	SO:0001583	missense	57624			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.107T>C	2.37:g.226273703T>C	ENSP00000272907:p.Ile36Thr	Somatic		Capture	Illumina GAIIx	4	225981947	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	16.95	3.262967	0.59431	.	.	ENSG00000144460	ENST00000272907;ENST00000409269	T	0.46819	0.86	5.92	5.92	0.95590	.	0.219310	0.36374	N	0.002636	T	0.45915	0.1366	L	0.45698	1.435	0.38927	D	0.957866	P;B	0.37731	0.607;0.42	B;B	0.37650	0.255;0.09	T	0.51826	-0.8656	10	0.59425	D	0.04	-20.4203	16.3594	0.83251	0.0:0.0:0.0:1.0	.	36;36	Q9P242-2;Q9P242	.;K1486_HUMAN	T	36	ENSP00000272907:I36T	ENSP00000272907:I36T	I	+	2	0	KIAA1486	225981947	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.437000	0.52863	2.266000	0.75297	0.455000	0.32223	ATT		0.418	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864		Missense_Mutation
NLRP3	114548	genome.wustl.edu	37	1	247587724	247587724	+	Missense_Mutation	SNP	C	C	G	rs180177500		TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr1:247587724C>G	ENST00000336119.3	+	3	1725	c.979C>G	c.(979-981)Cgg>Ggg	p.R327G	NLRP3_ENST00000391828.3_Missense_Mutation_p.R327G|NLRP3_ENST00000366497.2_Missense_Mutation_p.R327G|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Missense_Mutation_p.R327G|NLRP3_ENST00000366496.2_Missense_Mutation_p.R327G|NLRP3_ENST00000391827.2_Missense_Mutation_p.R327G	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	327	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.R327G(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GAAGGCCGAGCGGGGAGACAT	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	60.0	60.0					1																	247587724		2203	4300	6503	245654347	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.979C>G	1.37:g.247587724C>G	ENSP00000337383:p.Arg327Gly	Somatic		Capture	Illumina GAIIx	4	245654347	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548478	0.27652	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	4.04	-1.86	0.07760	NACHT nucleoside triphosphatase (1);	0.309232	0.23247	N	0.050290	T	0.75583	0.3869	L	0.38175	1.15	0.09310	N	1	B;B;P;B;P	0.50272	0.312;0.439;0.933;0.373;0.457	B;B;P;B;P	0.49708	0.199;0.412;0.62;0.261;0.499	T	0.72200	-0.4362	10	0.72032	D	0.01	.	12.4489	0.55667	0.7157:0.2843:0.0:0.0	.	327;327;327;327;327	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	G	327	ENSP00000375704:R327G;ENSP00000355453:R327G;ENSP00000337383:R327G;ENSP00000294752:R327G;ENSP00000355452:R327G;ENSP00000375703:R327G	ENSP00000337383:R327G	R	+	1	2	NLRP3	245654347	0.001000	0.12720	0.002000	0.10522	0.827000	0.46813	0.291000	0.18994	-0.309000	0.08779	0.563000	0.77884	CGG		0.582	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		Missense_Mutation
TCERG1L	256536	genome.wustl.edu	37	10	132932675	132932675	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr10:132932675C>G	ENST00000368642.4	-	8	1311	c.1226G>C	c.(1225-1227)aGg>aCg	p.R409T		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	409								p.R368T(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TTGGTCTTCCCTGTTGTCTTC	0.488																																																1	Substitution - Missense(1)	ovary(1)	10											125.0	98.0	107.0					10																	132932675		2203	4298	6501	132822665	SO:0001583	missense	256536			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1226G>C	10.37:g.132932675C>G	ENSP00000357631:p.Arg409Thr	Somatic		Capture	Illumina GAIIx	4	132822665	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	37	CCDS7662.2	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	2.710	-0.268956	0.05716	.	.	ENSG00000176769	ENST00000368642	T	0.22945	1.93	3.66	0.541	0.17168	.	0.945998	0.08791	N	0.893227	T	0.15522	0.0374	N	0.24115	0.695	0.09310	N	1	B	0.20164	0.042	B	0.16289	0.015	T	0.35450	-0.9788	10	0.15066	T	0.55	1.7859	9.2223	0.37384	0.5758:0.4242:0.0:0.0	.	409	Q5VWI1	TCRGL_HUMAN	T	409	ENSP00000357631:R409T	ENSP00000357631:R409T	R	-	2	0	TCERG1L	132822665	0.007000	0.16637	0.000000	0.03702	0.006000	0.05464	0.240000	0.18042	0.112000	0.17975	-0.293000	0.09583	AGG		0.488	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937		Missense_Mutation
DAGLA	747	genome.wustl.edu	37	11	61508800	61508800	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr11:61508800A>C	ENST00000257215.5	+	19	2266	c.2150A>C	c.(2149-2151)gAc>gCc	p.D717A		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	717					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.D717A(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCGACTGCAGACCACCGCAAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											42.0	37.0	38.0					11																	61508800		2202	4299	6501	61265376	SO:0001583	missense	747			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2150A>C	11.37:g.61508800A>C	ENSP00000257215:p.Asp717Ala	Somatic		Capture	Illumina GAIIx	4	61265376	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	CCDS31578.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	10.78	1.448002	0.26074	.	.	ENSG00000134780	ENST00000257215	T	0.25085	1.82	3.88	2.71	0.32032	.	0.533161	0.20766	N	0.086067	T	0.13500	0.0327	N	0.22421	0.69	0.29569	N	0.850063	B	0.13594	0.008	B	0.09377	0.004	T	0.24012	-1.0172	10	0.15066	T	0.55	-7.5637	6.6088	0.22739	0.7877:0.0:0.2123:0.0	.	717	Q9Y4D2	DGLA_HUMAN	A	717	ENSP00000257215:D717A	ENSP00000257215:D717A	D	+	2	0	DAGLA	61265376	1.000000	0.71417	0.075000	0.20258	0.709000	0.40893	4.787000	0.62432	0.619000	0.30197	0.374000	0.22700	GAC		0.632	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133		Missense_Mutation
ATP5EP2	432369	genome.wustl.edu	37	13	28519532	28519532	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr13:28519532G>T	ENST00000381026.3	+	1	190	c.136G>T	c.(136-138)Gtg>Ttg	p.V46L				Q5VTU8	AT5EL_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit pseudogene 2	46					ATP synthesis coupled proton transport (GO:0015986)	mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.V46L(1)		ovary(1)	1						CGTAAAAATTGTGAAAGTAAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	13																																								27417532	SO:0001583	missense				EC567419		13q12	2008-10-21			ENSG00000180389	ENSG00000180389			34026	pseudogene	pseudogene							Standard	NR_002162		Approved		uc001uru.3	Q5VTU8	OTTHUMG00000016642	ENST00000381026.3:c.136G>T	13.37:g.28519532G>T	ENSP00000370414:p.Val46Leu	Somatic		Capture	Illumina GAIIx	4	27417532		Missense_Mutation	SNP	ENST00000381026.3	37		SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826469	0.32329	.	.	ENSG00000180389	ENST00000381026	T	0.76968	-1.06	3.32	2.45	0.29901	.	0.000000	0.64402	D	0.000002	T	0.75539	0.3863	.	.	.	0.34276	D	0.68162	.	.	.	.	.	.	T	0.78054	-0.2354	7	0.45353	T	0.12	-19.8106	6.675	0.23090	0.1371:0.0:0.8629:0.0	.	.	.	.	L	46	ENSP00000370414:V46L	ENSP00000370414:V46L	V	+	1	0	ATP5EP2	27417532	1.000000	0.71417	0.784000	0.31847	0.146000	0.21551	1.256000	0.32921	0.764000	0.33197	0.573000	0.79308	GTG		0.398	ATP5EP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000044314.1	NR_002162		Missense_Mutation
NOD2	64127	genome.wustl.edu	37	16	50745533	50745533	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr16:50745533C>T	ENST00000300589.2	+	4	1816	c.1711C>T	c.(1711-1713)Cag>Tag	p.Q571*	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	571	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)	p.Q571*(1)		cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CCAGCAGCTCCAGGCAGCACA	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	16											42.0	35.0	38.0					16																	50745533		2198	4300	6498	49303034	SO:0001587	stop_gained	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.1711C>T	16.37:g.50745533C>T	ENSP00000300589:p.Gln571*	Somatic		Capture	Illumina GAIIx	4	49303034	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Nonsense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.444849	0.96187	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	.	.	.	5.16	4.2	0.49525	.	0.224222	0.31784	N	0.007073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	10.118	0.42603	0.0:0.9032:0.0:0.0968	.	.	.	.	X	544;571	.	ENSP00000300589:Q571X	Q	+	1	0	NOD2	49303034	0.195000	0.23338	0.999000	0.59377	0.646000	0.38490	0.599000	0.24089	2.403000	0.81681	0.561000	0.74099	CAG		0.627	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162		Nonsense_Mutation
MBD1	4152	genome.wustl.edu	37	18	47800169	47800169	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr18:47800169C>T	ENST00000591416.1	-	12	1642	c.1211G>A	c.(1210-1212)cGt>cAt	p.R404H	MBD1_ENST00000424334.2_Missense_Mutation_p.R455H|MBD1_ENST00000587605.1_Missense_Mutation_p.R348H|MBD1_ENST00000269468.5_Missense_Mutation_p.R404H|MBD1_ENST00000436910.1_Missense_Mutation_p.R381H|MBD1_ENST00000349085.2_Missense_Mutation_p.R348H|MBD1_ENST00000382948.5_Missense_Mutation_p.R404H|MBD1_ENST00000398493.1_Missense_Mutation_p.R348H|MBD1_ENST00000398495.2_Missense_Mutation_p.R373H|MBD1_ENST00000588937.1_Missense_Mutation_p.R381H|MBD1_ENST00000590208.1_Missense_Mutation_p.R404H|MBD1_ENST00000585672.1_Missense_Mutation_p.R354H|MBD1_ENST00000591535.1_Missense_Mutation_p.R381H|MBD1_ENST00000457839.2_Missense_Mutation_p.R429H|MBD1_ENST00000339998.6_Missense_Mutation_p.R404H|MBD1_ENST00000353909.3_Missense_Mutation_p.R355H|MBD1_ENST00000269471.5_Missense_Mutation_p.R381H|MBD1_ENST00000585595.1_Missense_Mutation_p.R429H|MBD1_ENST00000347968.3_Missense_Mutation_p.R348H|MBD1_ENST00000398488.1_Missense_Mutation_p.R348H			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	404					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R404H(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CTTTCGACGACGGTAAGGTGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	18											100.0	94.0	96.0					18																	47800169		2203	4300	6503	46054167	SO:0001583	missense	4152			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1211G>A	18.37:g.47800169C>T	ENSP00000467017:p.Arg404His	Somatic		Capture	Illumina GAIIx	4	46054167	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	ENST00000591416.1	37	CCDS11943.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	7.062	0.566507	0.13560	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D	0.95690	-3.73;-3.76;-3.7;-3.73;-3.78;-3.74;-3.74;-3.74;-3.75;-3.74;-3.78;-3.7	4.26	-1.02	0.10135	.	0.929598	0.09055	N	0.855241	D	0.87783	0.6264	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B	0.11235	0.002;0.002;0.004;0.001;0.003;0.002;0.001;0.001;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.001;0.002;0.002;0.002;0.001;0.001;0.001;0.001;0.001	T	0.75156	-0.3417	10	0.38643	T	0.18	1.4119	9.7153	0.40270	0.0:0.5421:0.2031:0.2548	.	348;455;381;404;404;381;355;348;404;348;429;348	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	H	404;355;348;404;348;381;381;455;404;404;429;348;348	ENSP00000372407:R404H;ENSP00000269469:R355H;ENSP00000342531:R348H;ENSP00000269468:R404H;ENSP00000285102:R348H;ENSP00000409561:R381H;ENSP00000269471:R381H;ENSP00000408846:R455H;ENSP00000339546:R404H;ENSP00000405268:R429H;ENSP00000381506:R348H;ENSP00000381502:R348H	ENSP00000269468:R404H	R	-	2	0	MBD1	46054167	0.060000	0.20803	0.007000	0.13788	0.869000	0.49853	0.119000	0.15626	-0.494000	0.06669	-1.164000	0.01763	CGT		0.612	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846		Missense_Mutation
SHOX2	6474	genome.wustl.edu	37	3	157820642	157820642	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr3:157820642G>A	ENST00000425436.3	-	2	405	c.380C>T	c.(379-381)gCg>gTg	p.A127V	SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000389589.4_Missense_Mutation_p.A151V|SHOX2_ENST00000441443.2_5'UTR|SHOX2_ENST00000490689.2_5'UTR|SHOX2_ENST00000483851.2_Missense_Mutation_p.A127V	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	127					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A151V(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CATCCCTTTCGCATCCTCTTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											152.0	128.0	136.0					3																	157820642		2203	4300	6503	159303336	SO:0001583	missense	6474			AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.380C>T	3.37:g.157820642G>A	ENSP00000398704:p.Ala127Val	Somatic		Capture	Illumina GAIIx	4	159303336	O60465|O60467|O60903	Missense_Mutation	SNP	ENST00000425436.3	37	CCDS43164.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225816	0.39300	.	.	ENSG00000168779;ENSG00000168779;ENSG00000258518	ENST00000425436;ENST00000389589;ENST00000483851	T;D;D	0.93763	1.56;-3.28;-3.28	5.47	5.47	0.80525	Homeodomain-related (1);	0.378221	0.25419	N	0.030810	T	0.77519	0.4142	N	0.01168	-0.975	0.80722	D	1	B;B;B	0.34181	0.44;0.102;0.004	B;B;B	0.25759	0.063;0.012;0.004	T	0.80072	-0.1535	10	0.11182	T	0.66	.	12.6431	0.56720	0.0758:0.0:0.9242:0.0	.	127;151;127	O60902-2;O60902-3;O60902	.;.;SHOX2_HUMAN	V	151;127;127	ENSP00000398704:A151V;ENSP00000374240:A127V;ENSP00000419362:A127V	ENSP00000374240:A127V	A	-	2	0	SHOX2;AC112502.1	159303336	0.999000	0.42202	0.999000	0.59377	0.998000	0.95712	2.823000	0.48081	2.567000	0.86603	0.643000	0.83706	GCG		0.567	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2			Missense_Mutation
DRD1	1812	genome.wustl.edu	37	5	174869877	174869877	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr5:174869877G>T	ENST00000393752.2	-	2	1218	c.226C>A	c.(226-228)Ctg>Atg	p.L76M		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	76					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.L76M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGCATGACCAGGACGGCCACC	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											83.0	69.0	74.0					5																	174869877		2203	4300	6503	174802483	SO:0001583	missense	1812			X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.226C>A	5.37:g.174869877G>T	ENSP00000377353:p.Leu76Met	Somatic		Capture	Illumina GAIIx	4	174802483	B2RA44|Q4QRJ0	Missense_Mutation	SNP	ENST00000393752.2	37	CCDS4393.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307824	0.23821	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.74947	-0.89	5.55	-4.88	0.03113	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	M	0.91249	3.19	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.85436	0.1152	10	0.46703	T	0.11	.	13.4862	0.61366	0.4844:0.0:0.5156:0.0	.	76	P21728	DRD1_HUMAN	M	76	ENSP00000377353:L76M	ENSP00000327652:L76M	L	-	1	2	DRD1	174802483	0.957000	0.32711	0.398000	0.26321	0.103000	0.19146	0.842000	0.27627	-0.821000	0.04312	-1.053000	0.02334	CTG		0.562	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	NM_000794		Missense_Mutation
DLL1	28514	genome.wustl.edu	37	6	170597385	170597385	+	Silent	SNP	A	A	G			TCGA-04-1542-01	TCGA-04-1542-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr6:170597385A>G	ENST00000366756.3	-	4	945	c.612T>C	c.(610-612)tgT>tgC	p.C204C	FAM120B_ENST00000540480.1_5'Flank	NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	204	DSL. {ECO:0000255|PROSITE- ProRule:PRU00377}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.C204C(1)		NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		CACGCTCCCCACAGGTGAAGT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	6											73.0	62.0	65.0					6																	170597385		2203	4300	6503	170439310	SO:0001819	synonymous_variant	28514			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.612T>C	6.37:g.170597385A>G		Somatic		Capture	Illumina GAIIx	4	170439310	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Silent	SNP	ENST00000366756.3	37	CCDS5313.1	SNP	6	WashU																																																																																				0.607	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1			Silent
PDIA4	9601	genome.wustl.edu	37	7	148701101	148701101	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1542-01	TCGA-04-1542-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr7:148701101G>C	ENST00000286091.4	-	10	1955	c.1723C>G	c.(1723-1725)Caa>Gaa	p.Q575E		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	575	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.Q575E(1)		large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			AGGCCCTTTTGGCCCTTGTAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											114.0	112.0	113.0					7																	148701101		2203	4300	6503	148332034	SO:0001583	missense	9601			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1723C>G	7.37:g.148701101G>C	ENSP00000286091:p.Gln575Glu	Somatic		Capture	Illumina GAIIx	4	148332034	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	4.567	0.105291	0.08731	.	.	ENSG00000155660	ENST00000286091	T	0.15256	2.44	5.81	5.81	0.92471	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.326309	0.35320	N	0.003283	T	0.04724	0.0128	N	0.00510	-1.415	0.30536	N	0.766912	B	0.02656	0.0	B	0.01281	0.0	T	0.11792	-1.0573	10	0.02654	T	1	.	15.4157	0.74966	0.0:0.2437:0.7563:0.0	.	575	P13667	PDIA4_HUMAN	E	575	ENSP00000286091:Q575E	ENSP00000286091:Q575E	Q	-	1	0	PDIA4	148332034	1.000000	0.71417	0.971000	0.41717	0.963000	0.63663	3.617000	0.54181	2.751000	0.94390	0.555000	0.69702	CAA		0.612	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911		Missense_Mutation
ASNA1	439	genome.wustl.edu	37	19	12856529	12856529	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1542-01	TCGA-04-1542-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-04-1542-01	TCGA-04-1542-10	g.chr19:12856529C>T	ENST00000591090.1	+	5	667	c.565C>T	c.(565-567)Cgg>Tgg	p.R189W	ASNA1_ENST00000357332.3_Missense_Mutation_p.R189W					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)									p.R189W(1)		endometrium(1)|lung(6)|ovary(3)	10						GGGCCTGGGCCGGCTTATGCA	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											46.0	48.0	48.0					19																	12856529		2203	4300	6503	12717529	SO:0001583	missense	439			U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.565C>T	19.37:g.12856529C>T	ENSP00000466379:p.Arg189Trp	Somatic		Capture	Illumina GAIIx	PhaseIII	12717529		Missense_Mutation	SNP	ENST00000591090.1	37	CCDS32920.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497765	0.85069	.	.	ENSG00000198356	ENST00000357332	T	0.50277	0.75	5.26	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.46268	0.1384	L	0.27053	0.805	0.80722	D	1	D;B	0.71674	0.998;0.09	P;B	0.53185	0.72;0.042	T	0.50693	-0.8798	10	0.87932	D	0	-17.4318	13.2457	0.60022	0.0:0.9198:0.0:0.0802	.	171;189	E7EVN0;O43681	.;ASNA_HUMAN	W	189	ENSP00000349887:R189W	ENSP00000349887:R189W	R	+	1	2	ASNA1	12717529	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.674000	0.46867	2.455000	0.83008	0.655000	0.94253	CGG		0.642	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450921.1	NM_004317		Missense_Mutation
