#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DLGAP2	9228	genome.wustl.edu	37	8	1497660	1497660	+	Silent	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr8:1497660C>T	ENST00000421627.2	+	2	935	c.801C>T	c.(799-801)aaC>aaT	p.N267N		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	346					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.N289N(2)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		AGAGCAACAACGACGTCAAGT	0.667																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	8											45.0	51.0	49.0					8																	1497660		2136	4263	6399	1485067	SO:0001819	synonymous_variant	9228			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.801C>T	8.37:g.1497660C>T		Somatic		Capture	Illumina GAIIx	4	1485067	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	0.814	-0.750892	0.03041	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.3	-9.22	0.00675	.	.	.	.	.	T	0.65015	0.2651	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73799	-0.3869	4	.	.	.	-13.3365	18.7685	0.91882	0.0:0.1862:0.0:0.8138	.	.	.	.	M	284	.	.	T	+	2	0	DLGAP2	1485067	0.194000	0.23325	0.001000	0.08648	0.243000	0.25628	-0.319000	0.08039	-2.151000	0.00795	-1.623000	0.00790	ACG		0.667	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745		Silent
WHSC1	7468	genome.wustl.edu	37	4	1980538	1980538	+	Silent	SNP	A	A	C			TCGA-09-0369-01	TCGA-09-0369-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr4:1980538A>C	ENST00000382895.3	+	24	4431	c.4000A>C	c.(4000-4002)Aga>Cga	p.R1334R	WHSC1_ENST00000508803.1_Silent_p.R1334R|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382891.5_Silent_p.R1334R|WHSC1_ENST00000382888.3_Silent_p.R682R|WHSC1_ENST00000382892.2_Silent_p.R1334R	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1334					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.R1334R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GGCATCGGTCAGAAGCACCAA	0.642			T	IGH@	MM																																		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	1	Substitution - coding silent(1)	ovary(1)	4											32.0	33.0	32.0					4																	1980538		2203	4300	6503	1950336	SO:0001819	synonymous_variant	7468			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.4000A>C	4.37:g.1980538A>C		Somatic		Capture	Illumina GAIIx	4	1950336	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	37	CCDS33940.1	SNP	7	WashU																																																																																				0.642	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		Silent
GNA12	2768	genome.wustl.edu	37	7	2771257	2771257	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:2771257C>T	ENST00000275364.3	-	4	866	c.704G>A	c.(703-705)cGc>cAc	p.R235H	AMZ1_ENST00000489665.1_Intron|GNA12_ENST00000491117.1_5'UTR|GNA12_ENST00000396960.3_Missense_Mutation_p.R87H|GNA12_ENST00000407904.3_Missense_Mutation_p.R176H|GNA12_ENST00000407653.1_Missense_Mutation_p.R159H|GNA12_ENST00000544127.1_Missense_Mutation_p.R142H	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	235					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R235H(1)		endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		CCACTTCTGGCGCTGGGACCG	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											97.0	89.0	92.0					7																	2771257		2203	4300	6503	2737783	SO:0001583	missense	2768			L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.704G>A	7.37:g.2771257C>T	ENSP00000275364:p.Arg235His	Somatic		Capture	Illumina GAIIx	4	2737783	A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Missense_Mutation	SNP	ENST00000275364.3	37	CCDS5335.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787652	0.70337	.	.	ENSG00000146535	ENST00000275364;ENST00000407904;ENST00000407653;ENST00000396960;ENST00000544127	D;D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14;-3.14	6.17	2.48	0.30137	.	0.097705	0.64402	N	0.000002	D	0.96454	0.8843	H	0.95187	3.635	0.80722	D	1	B;D;B	0.76494	0.35;0.999;0.096	B;D;B	0.63957	0.023;0.92;0.027	D	0.95594	0.8657	10	0.87932	D	0	.	10.8296	0.46652	0.0:0.7507:0.0:0.2493	.	235;235;176	Q5PPR5;Q03113;B3KXS2	.;GNA12_HUMAN;.	H	235;176;159;87;142	ENSP00000275364:R235H;ENSP00000385935:R176H;ENSP00000386054:R159H;ENSP00000380160:R87H;ENSP00000437469:R142H	ENSP00000275364:R235H	R	-	2	0	GNA12	2737783	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	7.720000	0.84759	0.201000	0.20466	-0.136000	0.14681	CGC		0.567	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241608.1	NM_007353		Missense_Mutation
CSMD1	64478	genome.wustl.edu	37	8	2820044	2820044	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr8:2820044G>C	ENST00000520002.1	-	62	10130	c.9575C>G	c.(9574-9576)tCc>tGc	p.S3192C	CSMD1_ENST00000602557.1_Missense_Mutation_p.S3192C|CSMD1_ENST00000400186.3_Missense_Mutation_p.S3015C|CSMD1_ENST00000537824.1_Missense_Mutation_p.S3191C|CSMD1_ENST00000602723.1_Missense_Mutation_p.S3015C|CSMD1_ENST00000542608.1_Missense_Mutation_p.S3014C			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3192	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.S2920C(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GACTCTTCTGGAGGATCCCAC	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	63.0	64.0					8																	2820044		1926	4128	6054	2807451	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9575C>G	8.37:g.2820044G>C	ENSP00000430733:p.Ser3192Cys	Somatic		Capture	Illumina GAIIx	4	2807451	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535769	0.45176	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.6	5.6	0.85130	Complement control module (2);Sushi/SCR/CCP (3);	0.303473	0.27437	N	0.019367	D	0.89339	0.6687	H	0.97983	4.12	0.80722	D	1	D;D;D	0.76494	0.999;0.991;0.98	D;D;P	0.78314	0.991;0.926;0.879	D	0.92813	0.6266	10	0.72032	D	0.01	.	19.6087	0.95589	0.0:0.0:1.0:0.0	.	3192;3192;3014	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	C	3015;3192;3053;3191;3014	ENSP00000383047:S3015C;ENSP00000430733:S3192C;ENSP00000441462:S3191C;ENSP00000446243:S3014C	ENSP00000320445:S3053C	S	-	2	0	CSMD1	2807451	1.000000	0.71417	0.011000	0.14972	0.083000	0.17756	7.744000	0.85034	2.639000	0.89480	0.655000	0.94253	TCC		0.502	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		Missense_Mutation
ANO2	57101	genome.wustl.edu	37	12	5963224	5963224	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr12:5963224T>G	ENST00000356134.5	-	4	677	c.606A>C	c.(604-606)aaA>aaC	p.K202N	ANO2_ENST00000546188.1_Missense_Mutation_p.K202N|ANO2_ENST00000327087.8_Missense_Mutation_p.K202N	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	206					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.K202N(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TGGTAGGAACTTTGATCTTCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											149.0	155.0	153.0					12																	5963224		1912	4124	6036	5833485	SO:0001583	missense	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.606A>C	12.37:g.5963224T>G	ENSP00000348453:p.Lys202Asn	Somatic		Capture	Illumina GAIIx	4	5833485	C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	37		SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214394	0.79352	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.69926	-0.44;-0.44;-0.44	5.15	5.15	0.70609	.	0.044965	0.85682	D	0.000000	D	0.83510	0.5270	M	0.90082	3.085	0.53005	D	0.999966	D	0.89917	1.0	D	0.83275	0.996	D	0.85992	0.1489	10	0.56958	D	0.05	.	11.6536	0.51304	0.0:0.0:0.0:1.0	.	202	Q9NQ90-3	.	N	202;202;202;206	ENSP00000314048:K202N;ENSP00000348453:K202N;ENSP00000440981:K202N	ENSP00000314048:K202N	K	-	3	2	ANO2	5833485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.892000	0.48625	2.075000	0.62263	0.528000	0.53228	AAA		0.502	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-09-0369-01	TCGA-09-0369-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	17	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	7518996	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	Somatic		Capture	Illumina GAIIx	4	7518996	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
PZP	5858	genome.wustl.edu	37	12	9356365	9356365	+	Splice_Site	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr12:9356365G>A	ENST00000261336.2	-	2	294	c.266C>T	c.(265-267)aCt>aTt	p.T89I	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	89					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T89I(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AGCACTCACAGTGAAGGAGAC	0.512																																					Melanoma(125;1402 1695 4685 34487 38571)											1	Substitution - Missense(1)	ovary(1)	12											91.0	76.0	81.0					12																	9356365		2203	4300	6503	9247632	SO:0001630	splice_region_variant	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.267+1C>T	12.37:g.9356365G>A		Somatic		Capture	Illumina GAIIx	4	9247632	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	2.611	-0.290797	0.05568	.	.	ENSG00000126838	ENST00000261336	T	0.08634	3.07	2.08	2.08	0.27032	.	0.413883	0.15949	U	0.236816	T	0.07369	0.0186	L	0.42245	1.32	0.80722	D	1	B	0.19706	0.038	B	0.21151	0.033	T	0.18398	-1.0338	10	0.27785	T	0.31	.	7.7209	0.28731	0.0:0.0:1.0:0.0	.	89	P20742	PZP_HUMAN	I	89	ENSP00000261336:T89I	ENSP00000261336:T89I	T	-	2	0	PZP	9247632	0.025000	0.19082	0.927000	0.36925	0.114000	0.19823	-0.026000	0.12392	1.491000	0.48482	0.467000	0.42956	ACT		0.512	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	Missense_Mutation	Missense_Mutation
SLC2A9	56606	genome.wustl.edu	37	4	9909889	9909889	+	Silent	SNP	C	C	A			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr4:9909889C>A	ENST00000264784.3	-	8	1136	c.1083G>T	c.(1081-1083)ggG>ggT	p.G361G	SLC2A9_ENST00000506583.1_Silent_p.G332G|SLC2A9_ENST00000309065.3_Silent_p.G332G	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	361					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)	p.G332G(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	TCTCGATGCCCCCTGTACTCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	4											141.0	122.0	129.0					4																	9909889		2203	4300	6503	9518987	SO:0001819	synonymous_variant	56606			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.1083G>T	4.37:g.9909889C>A		Somatic		Capture	Illumina GAIIx	4	9518987	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Silent	SNP	ENST00000264784.3	37	CCDS3407.1	SNP	22	WashU																																																																																				0.483	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207055.1			Silent
MYCN	4613	genome.wustl.edu	37	2	16085897	16085897	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:16085897C>T	ENST00000281043.3	+	3	1370	c.1073C>T	c.(1072-1074)cCg>cTg	p.P358L		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	358					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P358L(2)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TCCCCACGTCCGCTCAAGAGT	0.597			A		neuroblastoma																																		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	2	Substitution - Missense(2)	ovary(1)|skin(1)	2											45.0	44.0	44.0					2																	16085897		2203	4300	6503	16003348	SO:0001583	missense	4613			BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1073C>T	2.37:g.16085897C>T	ENSP00000281043:p.Pro358Leu	Somatic		Capture	Illumina GAIIx	4	16003348	Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	37	CCDS1687.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	10.19	1.280884	0.23392	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	T	0.16743	2.32	5.15	3.29	0.37713	Transcription regulator Myc, N-terminal (1);	0.874924	0.09504	U	0.793265	T	0.11410	0.0278	L	0.38175	1.15	0.58432	D	0.999998	B	0.29627	0.252	B	0.26614	0.071	T	0.09314	-1.0680	10	0.08381	T	0.77	-13.0989	6.2865	0.21037	0.1532:0.6979:0.0:0.1489	.	358	P04198	MYCN_HUMAN	L	358;276	ENSP00000281043:P358L	ENSP00000281043:P358L	P	+	2	0	MYCN	16003348	0.492000	0.26027	0.955000	0.39395	0.560000	0.35617	2.108000	0.41854	1.282000	0.44496	0.655000	0.94253	CCG		0.597	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378		Missense_Mutation
AP1M1	8907	genome.wustl.edu	37	19	16314300	16314300	+	Missense_Mutation	SNP	G	G	A	rs372560384		TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr19:16314300G>A	ENST00000291439.3	+	2	522	c.73G>A	c.(73-75)Gtg>Atg	p.V25M	AP1M1_ENST00000541844.1_Intron|AP1M1_ENST00000590756.1_Intron|AP1M1_ENST00000429941.2_Missense_Mutation_p.V25M|AP1M1_ENST00000444449.2_Missense_Mutation_p.V25M	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	25					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.V25M(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CCGTGGCGACGTGGACATGTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											99.0	82.0	87.0					19																	16314300		2203	4300	6503	16175300	SO:0001583	missense	8907				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.73G>A	19.37:g.16314300G>A	ENSP00000291439:p.Val25Met	Somatic		Capture	Illumina GAIIx	4	16175300	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018315	0.54576	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000429941	T;T;T	0.67171	0.33;0.33;-0.25	4.45	3.41	0.39046	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.67970	0.2950	M	0.75447	2.3	0.80722	D	1	P;P;B	0.39551	0.62;0.678;0.42	B;B;B	0.42163	0.378;0.271;0.271	T	0.70357	-0.4894	10	0.66056	D	0.02	-28.2059	10.9899	0.47543	0.0911:0.0:0.9089:0.0	.	25;25;25	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	M	25	ENSP00000388996:V25M;ENSP00000291439:V25M;ENSP00000411498:V25M	ENSP00000291439:V25M	V	+	1	0	AP1M1	16175300	1.000000	0.71417	0.961000	0.40146	0.963000	0.63663	7.633000	0.83260	0.873000	0.35799	0.561000	0.74099	GTG		0.592	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493		Missense_Mutation
CCNB1IP1	57820	genome.wustl.edu	37	14	20781754	20781754	+	Missense_Mutation	SNP	A	A	T			TCGA-09-0369-01	TCGA-09-0369-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr14:20781754A>T	ENST00000398169.3	-	6	1120	c.504T>A	c.(502-504)aaT>aaA	p.N168K	CCNB1IP1_ENST00000353689.4_Missense_Mutation_p.N168K|CCNB1IP1_ENST00000437553.2_Missense_Mutation_p.N168K|CCNB1IP1_ENST00000398163.2_Missense_Mutation_p.N168K|CCNB1IP1_ENST00000358932.4_Missense_Mutation_p.N168K|CCNB1IP1_ENST00000398160.2_Missense_Mutation_p.N168K			Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1, E3 ubiquitin protein ligase	168					blastocyst formation (GO:0001825)|chiasma assembly (GO:0051026)|protein ubiquitination (GO:0016567)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N168K(1)	HMGA2/CCNB1IP1(2)	breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		GATACTGACGATTGCGCTCCA	0.423			T	HMGA2	leiomyoma																																		Dom	yes		14	14q11.2	57820	"""cyclin B1 interacting protein 1, E3 ubiquitin protein ligase"""		M	1	Substitution - Missense(1)	ovary(1)	14											170.0	153.0	159.0					14																	20781754		2203	4300	6503	19851594	SO:0001583	missense	57820			AF216381	CCDS9547.1	14q11.2	2014-02-04	2011-01-31	2004-01-14	ENSG00000100814	ENSG00000100814			19437	protein-coding gene	gene with protein product	"""human enhancer of invasion 10"""	608249	"""chromosome 14 open reading frame 18"", ""cyclin B1 interacting protein 1"""	C14orf18		12612082, 21779533	Standard	NM_021178		Approved	HEI10	uc001vwy.4	Q9NPC3	OTTHUMG00000029509	ENST00000398169.3:c.504T>A	14.37:g.20781754A>T	ENSP00000381235:p.Asn168Lys	Somatic		Capture	Illumina GAIIx	4	19851594		Missense_Mutation	SNP	ENST00000398169.3	37	CCDS9547.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831139	0.71258	.	.	ENSG00000100814	ENST00000398160;ENST00000398169;ENST00000358932;ENST00000353689;ENST00000437553;ENST00000398163	.	.	.	5.14	2.71	0.32032	.	0.000000	0.85682	D	0.000000	T	0.48840	0.1522	L	0.42245	1.32	0.42281	D	0.992098	P	0.50528	0.936	P	0.50708	0.648	T	0.39761	-0.9598	9	0.34782	T	0.22	-24.064	7.5592	0.27841	0.7588:0.0:0.2412:0.0	.	168	Q9NPC3	CIP1_HUMAN	K	168	.	ENSP00000337396:N168K	N	-	3	2	CCNB1IP1	19851594	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.325000	0.52030	0.860000	0.35481	0.459000	0.35465	AAT		0.423	CCNB1IP1-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073538.3	NM_021178, NM_182849, NM_182851, NM_182852		Missense_Mutation
ZNF729	100287226	genome.wustl.edu	37	19	22499601	22499601	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr19:22499601G>T	ENST00000601693.1	+	4	3500	c.3382G>T	c.(3382-3384)Ggg>Tgg	p.G1128W	ZNF729_ENST00000357491.6_Missense_Mutation_p.G1100W			A6NN14	ZN729_HUMAN	zinc finger protein 729	1128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1100W(2)		breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						AATTCATACTGGGGAGAAACC	0.368																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	19																																								22291441	SO:0001583	missense					CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3382G>T	19.37:g.22499601G>T	ENSP00000469582:p.Gly1128Trp	Somatic		Capture	Illumina GAIIx	4	22291441	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	37	CCDS59368.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	.	12.64	1.997843	0.35226	.	.	ENSG00000196350	ENST00000357491	T	0.01665	4.7	0.96	0.96	0.19631	.	.	.	.	.	T	0.11367	0.0277	H	0.95816	3.725	.	.	.	.	.	.	.	.	.	T	0.08351	-1.0726	6	0.87932	D	0	.	8.758	0.34656	0.0:0.0:1.0:0.0	.	.	.	.	W	1100	ENSP00000350085:G1100W	ENSP00000350085:G1100W	G	+	1	0	ZNF729	22291441	0.514000	0.26202	0.303000	0.25071	0.269000	0.26545	2.895000	0.48648	0.409000	0.25649	0.409000	0.27619	GGG		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301		Missense_Mutation
TRA2A	29896	genome.wustl.edu	37	7	23561393	23561393	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:23561393C>G	ENST00000297071.4	-	2	319	c.103G>C	c.(103-105)Gga>Cga	p.G35R	TRA2A_ENST00000392502.4_5'UTR|TRA2A_ENST00000474586.1_5'UTR|TRA2A_ENST00000538367.1_5'UTR	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	35	Arg/Ser-rich (RS1 domain).				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G35R(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						CTACGAGATCCTGACCTGCTC	0.418																																					Pancreas(121;2137 2973 46590)											1	Substitution - Missense(1)	ovary(1)	7											114.0	109.0	110.0					7																	23561393		2203	4300	6503	23527918	SO:0001583	missense	29896			U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.103G>C	7.37:g.23561393C>G	ENSP00000297071:p.Gly35Arg	Somatic		Capture	Illumina GAIIx	4	23527918	B4DUA9	Missense_Mutation	SNP	ENST00000297071.4	37	CCDS5383.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537622	0.27475	.	.	ENSG00000164548	ENST00000297071	T	0.14022	2.54	5.95	5.07	0.68467	.	0.103264	0.64402	D	0.000003	T	0.05640	0.0148	N	0.02916	-0.46	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36114	-0.9761	10	0.15499	T	0.54	-8.6897	11.0262	0.47746	0.0:0.8592:0.0:0.1408	.	35	Q13595	TRA2A_HUMAN	R	35	ENSP00000297071:G35R	ENSP00000297071:G35R	G	-	1	0	TRA2A	23527918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.787000	0.55439	1.537000	0.49254	0.585000	0.79938	GGA		0.418	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293		Missense_Mutation
CDH10	1008	genome.wustl.edu	37	5	24488057	24488057	+	Silent	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr5:24488057C>T	ENST00000264463.4	-	12	2589	c.2082G>A	c.(2080-2082)acG>acA	p.T694T	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	694					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T694T(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		GAATAAATAACGTTTCTGGAA	0.498										HNSCC(23;0.051)																																						1	Substitution - coding silent(1)	ovary(1)	5											70.0	76.0	74.0					5																	24488057		2203	4300	6503	24523814	SO:0001819	synonymous_variant	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2082G>A	5.37:g.24488057C>T		Somatic		Capture	Illumina GAIIx	4	24523814	Q9ULB3	Silent	SNP	ENST00000264463.4	37	CCDS3892.1	SNP	19	WashU																																																																																				0.498	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		Silent
VSX1	30813	genome.wustl.edu	37	20	25062081	25062081	+	Intron	SNP	A	A	G	rs200511788		TCGA-09-0369-01	TCGA-09-0369-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr20:25062081A>G	ENST00000376709.4	-	1	688				VSX1_ENST00000429762.3_Intron|VSX1_ENST00000424574.1_Intron|VSX1_ENST00000376707.3_Intron|VSX1_ENST00000398332.1_Missense_Mutation_p.M143T|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000451258.1_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1						neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						GCGGTCTCACATCGCTGAGGG	0.642													A|||	1	0.000199681	0.0	0.0	5008	,	,		16296	0.0		0.001	False		,,,				2504	0.0															0			20						A	,	0,1752		0,0,876	59.0	58.0	58.0		,	-0.5	0.0	20		58	8,3974		0,8,1983	no	intron,intron	VSX1	NM_014588.4,NM_199425.1	,	0,8,2859	GG,GA,AA		0.2009,0.0,0.1395	,	,	25062081	8,5726	876	1991	2867	25010081	SO:0001627	intron_variant	30813			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.424+227T>C	20.37:g.25062081A>G		Somatic		Capture	Illumina GAIIx	4	25010081	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	CCDS13168.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	2.321	-0.355709	0.05138	0.0	0.002009	ENSG00000100987	ENST00000398332	T	0.63255	-0.03	2.07	-0.517	0.11947	.	.	.	.	.	T	0.51686	0.1689	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.51108	-0.8747	6	0.87932	D	0	.	1.7249	0.02919	0.4814:0.0:0.203:0.3156	.	.	.	.	T	143	ENSP00000381376:M143T	ENSP00000381376:M143T	M	-	2	0	VSX1	25010081	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.504000	0.06375	-0.166000	0.10890	0.379000	0.24179	ATG		0.642	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3			Missense_Mutation
CAD	790	genome.wustl.edu	37	2	27454914	27454914	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:27454914G>C	ENST00000403525.1	+	16	2422	c.2278G>C	c.(2278-2280)Gtg>Ctg	p.V760L	CAD_ENST00000464159.1_3'UTR|CAD_ENST00000264705.4_Missense_Mutation_p.V823L			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.V823L(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTTATTCAGTGGACCGCCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											104.0	91.0	96.0					2																	27454914		2203	4300	6503	27308418	SO:0001583	missense	790			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2278G>C	2.37:g.27454914G>C	ENSP00000384510:p.Val760Leu	Somatic		Capture	Illumina GAIIx	4	27308418	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275888	0.40294	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.96856	-4.15;-4.15	5.2	3.25	0.37280	Carbamoyl-phosphate synthetase, large subunit, oligomerisation (3);	0.267026	0.37437	N	0.002084	D	0.92919	0.7747	L	0.52823	1.66	0.45867	D	0.998725	B;B	0.16802	0.019;0.002	B;B	0.23574	0.047;0.01	D	0.88373	0.2996	10	0.36615	T	0.2	-5.6672	5.0206	0.14360	0.3547:0.0:0.6453:0.0	.	760;823	F8VPD4;P27708	.;PYR1_HUMAN	L	823;760	ENSP00000264705:V823L;ENSP00000384510:V760L	ENSP00000264705:V823L	V	+	1	0	CAD	27308418	1.000000	0.71417	0.661000	0.29709	0.571000	0.35966	5.258000	0.65479	1.420000	0.47138	0.655000	0.94253	GTG		0.532	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1			Missense_Mutation
FLT3	2322	genome.wustl.edu	37	13	28608122	28608122	+	Missense_Mutation	SNP	A	A	G			TCGA-09-0369-01	TCGA-09-0369-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr13:28608122A>G	ENST00000241453.7	-	15	1925	c.1844T>C	c.(1843-1845)gTa>gCa	p.V615A	FLT3_ENST00000537084.1_Missense_Mutation_p.V615A|FLT3_ENST00000380982.4_Missense_Mutation_p.V615A	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	615	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.V615A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGATCCTAGTACCTTCCCTGC	0.403			"""Mis, O"""		"""AML, ALL"""																																		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	1	Substitution - Missense(1)	ovary(1)	13											239.0	220.0	226.0					13																	28608122		2203	4300	6503	27506122	SO:0001583	missense	2322			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1844T>C	13.37:g.28608122A>G	ENSP00000241453:p.Val615Ala	Somatic		Capture	Illumina GAIIx	4	27506122	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	37	CCDS31953.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	15.10	2.733790	0.48939	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	D;D;D	0.89875	-2.58;-2.58;-2.58	5.93	5.93	0.95920	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000012	D	0.84656	0.5520	L	0.33753	1.03	0.47778	D	0.999513	P;B	0.35575	0.51;0.011	B;B	0.34590	0.186;0.061	D	0.85355	0.1104	10	0.62326	D	0.03	.	16.3797	0.83452	1.0:0.0:0.0:0.0	.	615;615	P36888-2;P36888	.;FLT3_HUMAN	A	615	ENSP00000241453:V615A;ENSP00000370369:V615A;ENSP00000438139:V615A	ENSP00000241453:V615A	V	-	2	0	FLT3	27506122	0.987000	0.35691	0.967000	0.41034	0.831000	0.47069	3.376000	0.52417	2.271000	0.75665	0.533000	0.62120	GTA		0.403	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2			Missense_Mutation
ITGAX	3687	genome.wustl.edu	37	16	31373161	31373161	+	Silent	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr16:31373161G>A	ENST00000268296.4	+	10	1138	c.1017G>A	c.(1015-1017)acG>acA	p.T339T	ITGAX_ENST00000562522.1_Silent_p.T339T	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	339	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.T339T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCCCAGGTACGGAGACCACAA	0.577																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	16											134.0	114.0	121.0					16																	31373161		2197	4300	6497	31280662	SO:0001819	synonymous_variant	3687			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1017G>A	16.37:g.31373161G>A		Somatic		Capture	Illumina GAIIx	4	31280662	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1	SNP	39	WashU																																																																																				0.577	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887		Silent
PDZD2	23037	genome.wustl.edu	37	5	32048781	32048781	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr5:32048781T>G	ENST00000438447.1	+	8	2044	c.1656T>G	c.(1654-1656)agT>agG	p.S552R	PDZD2_ENST00000282493.3_Missense_Mutation_p.S552R			O15018	PDZD2_HUMAN	PDZ domain containing 2	552					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.S552R(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						ACTCTTCCAGTGCCTCACAGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											56.0	63.0	61.0					5																	32048781		2203	4300	6503	32084538	SO:0001583	missense	23037			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.1656T>G	5.37:g.32048781T>G	ENSP00000402033:p.Ser552Arg	Somatic		Capture	Illumina GAIIx	4	32084538	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	14.26	2.482296	0.44147	.	.	ENSG00000133401	ENST00000438447;ENST00000282493	T;T	0.06142	3.34;3.34	5.41	-10.7	0.00240	.	0.822435	0.10293	N	0.692048	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	B;B	0.25809	0.135;0.001	B;B	0.25140	0.058;0.002	T	0.42310	-0.9459	10	0.62326	D	0.03	.	2.7062	0.05163	0.1969:0.1753:0.4405:0.1873	.	378;552	B4E3P2;O15018	.;PDZD2_HUMAN	R	552	ENSP00000402033:S552R;ENSP00000282493:S552R	ENSP00000282493:S552R	S	+	3	2	PDZD2	32084538	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.265000	0.08644	-1.872000	0.01136	-0.438000	0.05819	AGT		0.582	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1			Missense_Mutation
NME8	51314	genome.wustl.edu	37	7	37907476	37907476	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:37907476G>T	ENST00000199447.4	+	11	1166	c.794G>T	c.(793-795)gGa>gTa	p.G265V	NME8_ENST00000440017.1_Missense_Mutation_p.G265V|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	265					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.G265V(1)									GTTACACCTGGAATGATGAAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	7											82.0	67.0	72.0					7																	37907476		2203	4300	6503	37874001	SO:0001583	missense	51314			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.794G>T	7.37:g.37907476G>T	ENSP00000199447:p.Gly265Val	Somatic		Capture	Illumina GAIIx	4	37874001	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	2.841	-0.240549	0.05944	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.35421	1.31;1.31	4.21	-2.24	0.06909	.	4.923680	0.00567	N	0.000295	T	0.16385	0.0394	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.08868	-1.0701	10	0.12430	T	0.62	5.2241	3.295	0.06963	0.2272:0.2303:0.4453:0.0972	.	265	Q8N427	TXND3_HUMAN	V	265	ENSP00000199447:G265V;ENSP00000397063:G265V	ENSP00000199447:G265V	G	+	2	0	TXNDC3	37874001	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.326000	0.00252	-0.455000	0.07054	-0.253000	0.11424	GGA		0.458	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616		Missense_Mutation
AOC2	314	genome.wustl.edu	37	17	41001637	41001637	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr17:41001637C>T	ENST00000253799.3	+	3	1921	c.1894C>T	c.(1894-1896)Cag>Tag	p.Q632*	AOC2_ENST00000452774.2_Nonsense_Mutation_p.Q605*|AOC3_ENST00000308423.2_5'Flank	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	632					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.Q632*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGTGGTGACCCAGAGAAAGGA	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	17											127.0	107.0	114.0					17																	41001637		2203	4300	6503	38255163	SO:0001587	stop_gained	314			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1894C>T	17.37:g.41001637C>T	ENSP00000253799:p.Gln632*	Somatic		Capture	Illumina GAIIx	4	38255163	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Nonsense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909906	0.92107	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	.	.	.	4.76	3.79	0.43588	.	0.372152	0.29806	N	0.011150	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4189	13.0905	0.59164	0.442:0.558:0.0:0.0	.	.	.	.	X	632;605	.	ENSP00000253799:Q632X	Q	+	1	0	AOC2	38255163	0.001000	0.12720	1.000000	0.80357	0.732000	0.41865	0.803000	0.27083	1.213000	0.43380	0.561000	0.74099	CAG		0.483	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158		Nonsense_Mutation
GCHFR	2644	genome.wustl.edu	37	15	41059450	41059450	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr15:41059450C>T	ENST00000260447.4	+	3	319	c.158C>T	c.(157-159)cCc>cTc	p.P53L	DNAJC17_ENST00000558727.1_5'Flank|C15orf62_ENST00000344320.6_5'Flank|GCHFR_ENST00000558467.1_Missense_Mutation_p.P36L|GCHFR_ENST00000559445.1_Missense_Mutation_p.P42L|GCHFR_ENST00000558670.1_3'UTR|GCHFR_ENST00000559932.1_Missense_Mutation_p.P36L	NM_005258.2	NP_005249.1	P30047	GFRP_HUMAN	GTP cyclohydrolase I feedback regulator	53					negative regulation of biosynthetic process (GO:0009890)|negative regulation of GTP cyclohydrolase I activity (GO:0043105)|neurotransmitter metabolic process (GO:0042133)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|protein heterooligomerization (GO:0051291)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome (GO:0042470)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	amino acid binding (GO:0016597)|enzyme inhibitor activity (GO:0004857)	p.P53L(1)		endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)	6		all_cancers(109;3.3e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.58e-05)|COAD - Colon adenocarcinoma(120;0.149)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GATGACCCTCCCCGCATAGTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											111.0	103.0	106.0					15																	41059450		2203	4300	6503	38846742	SO:0001583	missense	2644			U78190	CCDS10064.1	15q15	2004-01-19	2004-05-20		ENSG00000137880	ENSG00000137880			4194	protein-coding gene	gene with protein product		602437	"""GTP cyclohydrolase I feedback regulatory protein"""			8702680, 1286669	Standard	NM_005258		Approved	GFRP, HsT16933	uc001zmr.1	P30047	OTTHUMG00000130069	ENST00000260447.4:c.158C>T	15.37:g.41059450C>T	ENSP00000260447:p.Pro53Leu	Somatic		Capture	Illumina GAIIx	4	38846742	B2R4L6|B7ZLM8|Q2M1Q2|Q99749	Missense_Mutation	SNP	ENST00000260447.4	37	CCDS10064.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.484271	0.96307	.	.	ENSG00000137880	ENST00000260447	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.83686	0.5308	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84949	0.0870	8	0.87932	D	0	-4.6292	19.6421	0.95762	0.0:1.0:0.0:0.0	.	42;53	B7ZLM8;P30047	.;GFRP_HUMAN	L	53	.	ENSP00000260447:P53L	P	+	2	0	GCHFR	38846742	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.313000	0.78978	2.815000	0.96918	0.561000	0.74099	CCC		0.592	GCHFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252360.2	NM_005258		Missense_Mutation
LRRK2	120892	genome.wustl.edu	37	12	40688693	40688693	+	Missense_Mutation	SNP	T	T	C			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr12:40688693T>C	ENST00000298910.7	+	22	2913	c.2855T>C	c.(2854-2856)aTa>aCa	p.I952T	LRRK2_ENST00000343742.2_Missense_Mutation_p.I952T	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	952					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.I952T(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAAAGAAAAATATTATCTTCA	0.294																																																2	Substitution - Missense(2)	ovary(2)	12											42.0	47.0	46.0					12																	40688693		2203	4283	6486	38974960	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2855T>C	12.37:g.40688693T>C	ENSP00000298910:p.Ile952Thr	Somatic		Capture	Illumina GAIIx	4	38974960	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	9.906	1.208150	0.22205	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.72167	2.2;-0.63	5.52	3.06	0.35304	.	0.426159	0.25558	N	0.029843	T	0.48447	0.1500	N	0.19112	0.55	0.09310	N	0.999995	B;B	0.23735	0.09;0.013	B;B	0.18871	0.023;0.005	T	0.25293	-1.0136	10	0.23891	T	0.37	.	5.1185	0.14849	0.2808:0.075:0.0:0.6442	.	952;952	E9PC85;Q5S007	.;LRRK2_HUMAN	T	952	ENSP00000341930:I952T;ENSP00000298910:I952T	ENSP00000298910:I952T	I	+	2	0	LRRK2	38974960	0.915000	0.31059	0.459000	0.27081	0.880000	0.50808	1.606000	0.36826	0.337000	0.23665	0.482000	0.46254	ATA		0.294	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		Missense_Mutation
ACBD4	79777	genome.wustl.edu	37	17	43213977	43213977	+	Nonsense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr17:43213977C>T	ENST00000376955.4	+	3	496	c.199C>T	c.(199-201)Cga>Tga	p.R67*	ACBD4_ENST00000321854.8_Nonsense_Mutation_p.R67*|ACBD4_ENST00000398322.3_Nonsense_Mutation_p.R67*|ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000591859.1_Nonsense_Mutation_p.R67*|ACBD4_ENST00000592162.1_Nonsense_Mutation_p.R67*|ACBD4_ENST00000586346.1_Nonsense_Mutation_p.R67*|ACBD4_ENST00000431281.1_Nonsense_Mutation_p.R67*	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	67	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.						fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)	p.R67*(1)		kidney(1)|lung(3)|ovary(1)	5						CCCCATTGGACGATATAAGTG	0.622																																																1	Substitution - Nonsense(1)	ovary(1)	17											41.0	47.0	45.0					17																	43213977		1873	4110	5983	40569503	SO:0001587	stop_gained	79777			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.199C>T	17.37:g.43213977C>T	ENSP00000366154:p.Arg67*	Somatic		Capture	Illumina GAIIx	4	40569503	D3DX64|Q8IUT1|Q9H8Q4	Nonsense_Mutation	SNP	ENST00000376955.4	37	CCDS45711.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	40	7.932850	0.98568	.	.	ENSG00000181513	ENST00000431281;ENST00000321854;ENST00000398322;ENST00000376955	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1007	0.48172	0.1843:0.8157:0.0:0.0	.	.	.	.	X	67	.	ENSP00000314440:R67X	R	+	1	2	ACBD4	40569503	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.017000	0.40981	2.677000	0.91161	0.561000	0.74099	CGA		0.622	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722		Nonsense_Mutation
PSENEN	55851	genome.wustl.edu	37	19	36237686	36237686	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr19:36237686C>T	ENST00000587708.2	+	4	927	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	U2AF1L4_ENST00000378975.3_5'Flank|AC002398.9_ENST00000591613.2_Intron|AD000671.6_ENST00000589807.1_5'Flank|U2AF1L4_ENST00000292879.5_5'Flank|PSENEN_ENST00000591949.1_3'UTR|AC002398.11_ENST00000591091.1_RNA|U2AF1L4_ENST00000588100.1_5'Flank|PSENEN_ENST00000222266.2_Missense_Mutation_p.R82W|AC002398.11_ENST00000585365.1_RNA|U2AF1L4_ENST00000412391.2_5'Flank|LIN37_ENST00000301159.9_5'Flank			Q9NZ42	PEN2_HUMAN	presenilin enhancer gamma secretase subunit	82					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R82W(1)		central_nervous_system(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCAGATCTACCGGCCCCGCTG	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											69.0	72.0	71.0					19																	36237686		2203	4300	6503	40929526	SO:0001583	missense	55851			AF220053	CCDS12474.1	19q13.12	2014-09-17	2013-09-12			ENSG00000205155			30100	protein-coding gene	gene with protein product		607632	"""presenilin enhancer 2 homolog (C. elegans)"""			12110170, 12660785	Standard	NM_172341		Approved	PEN2	uc002obi.1	Q9NZ42		ENST00000587708.2:c.244C>T	19.37:g.36237686C>T	ENSP00000468411:p.Arg82Trp	Somatic		Capture	Illumina GAIIx	4	40929526	B2R5L9	Missense_Mutation	SNP	ENST00000587708.2	37	CCDS12474.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115520	0.77323	.	.	ENSG00000205155	ENST00000222266	D	0.81739	-1.53	5.86	2.58	0.30949	.	0.000000	0.85682	D	0.000000	D	0.87672	0.6236	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85887	0.1426	10	0.87932	D	0	-15.535	7.7582	0.28936	0.1413:0.7176:0.0:0.1411	.	82	Q9NZ42	PEN2_HUMAN	W	82	ENSP00000222266:R82W	ENSP00000222266:R82W	R	+	1	2	PSENEN	40929526	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.576000	0.46033	0.368000	0.24481	-1.047000	0.02352	CGG		0.587	PSENEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459101.2	NM_172341		Missense_Mutation
SZT2	23334	genome.wustl.edu	37	1	43896652	43896652	+	Missense_Mutation	SNP	G	G	A	rs537199503		TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:43896652G>A	ENST00000562955.1	+	32	4636	c.4636G>A	c.(4636-4638)Gtt>Att	p.V1546I	SZT2_ENST00000372442.1_Missense_Mutation_p.V704I	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1603					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.V704I(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GGGCCCCCCAGTTGGAGGCCG	0.582																																																2	Substitution - Missense(2)	ovary(2)	1											57.0	55.0	56.0					1																	43896652		2203	4300	6503	43669239	SO:0001583	missense	23334			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4636G>A	1.37:g.43896652G>A	ENSP00000457168:p.Val1546Ile	Somatic		Capture	Illumina GAIIx	4	43669239	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	5.677	0.309465	0.10733	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.79	-9.05	0.00730	.	1.311170	0.04727	N	0.420390	T	0.22475	0.0542	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13602	-1.0503	9	0.24483	T	0.36	.	7.4221	0.27077	0.1504:0.2454:0.5117:0.0924	.	1546	Q5T011-5	.	I	704	.	ENSP00000361519:V704I	V	+	1	0	SZT2	43669239	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.145000	0.03194	-1.116000	0.02969	-2.048000	0.00412	GTT		0.582	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		Missense_Mutation
CELSR3	1951	genome.wustl.edu	37	3	48697823	48697823	+	Missense_Mutation	SNP	C	C	T	rs145148789		TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr3:48697823C>T	ENST00000164024.4	-	1	2525	c.2245G>A	c.(2245-2247)Gtt>Att	p.V749I	CELSR3_ENST00000544264.1_Missense_Mutation_p.V749I	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	749	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.V749I(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TTGTCATTAACGTCCAGCACA	0.557																																																1	Substitution - Missense(1)	ovary(1)	3						C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	101.0	91.0	95.0		2245	5.8	1.0	3	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	missense	CELSR3	NM_001407.2	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging	749/3313	48697823	3,13003	2203	4300	6503	48672827	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2245G>A	3.37:g.48697823C>T	ENSP00000164024:p.Val749Ile	Somatic		Capture	Illumina GAIIx	4	48672827	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879079	0.72294	4.54E-4	1.16E-4	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.01258	5.09;5.09	5.82	5.82	0.92795	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.06690	0.0171	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.923	T	0.41680	-0.9495	9	0.41790	T	0.15	.	20.0852	0.97797	0.0:1.0:0.0:0.0	.	749;819	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	I	749	ENSP00000164024:V749I;ENSP00000445694:V749I	ENSP00000164024:V749I	V	-	1	0	CELSR3	48672827	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	6.080000	0.71299	2.756000	0.94617	0.561000	0.74099	GTT		0.557	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Missense_Mutation
SLC1A7	6512	genome.wustl.edu	37	1	53554599	53554599	+	Missense_Mutation	SNP	T	T	A			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:53554599T>A	ENST00000371494.4	-	10	1541	c.1414A>T	c.(1414-1416)Atc>Ttc	p.I472F	SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	472					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.I472F(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		TGGGCCATGATCCCCGCTGCC	0.617																																					NSCLC(128;80 1811 21245 38490 51715)											1	Substitution - Missense(1)	ovary(1)	1											101.0	83.0	89.0					1																	53554599		2203	4300	6503	53327187	SO:0001583	missense	6512			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1414A>T	1.37:g.53554599T>A	ENSP00000360549:p.Ile472Phe	Somatic		Capture	Illumina GAIIx	4	53327187	Q5VVZ0|Q969Z8|Q9BW45	Missense_Mutation	SNP	ENST00000371494.4	37	CCDS574.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	32	5.184440	0.94885	.	.	ENSG00000162383	ENST00000371494	T	0.63580	-0.05	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.81559	0.4848	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	0.989;1.0	D;D	0.87578	0.973;0.998	D	0.84495	0.0613	10	0.87932	D	0	-43.8407	15.7575	0.78046	0.0:0.0:0.0:1.0	.	472;125	O00341;B3KSM4	EAA5_HUMAN;.	F	472	ENSP00000360549:I472F	ENSP00000360549:I472F	I	-	1	0	SLC1A7	53327187	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.005000	0.88553	2.317000	0.78254	0.459000	0.35465	ATC		0.617	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671		Missense_Mutation
OR10A7	121364	genome.wustl.edu	37	12	55615503	55615503	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr12:55615503C>T	ENST00000326258.1	+	1	695	c.695C>T	c.(694-696)aCt>aTt	p.T232I		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T232I(1)		endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						TCCTCTGCCACTGGCCGCCAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	101.0	109.0					12																	55615503		2203	4300	6503	53901770	SO:0001583	missense	121364			BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.695C>T	12.37:g.55615503C>T	ENSP00000326718:p.Thr232Ile	Somatic		Capture	Illumina GAIIx	4	53901770	Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	37	CCDS31815.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	c	2.929	-0.221446	0.06061	.	.	ENSG00000179919	ENST00000326258	T	0.00115	8.71	4.08	2.18	0.27775	GPCR, rhodopsin-like superfamily (1);	0.636530	0.13159	N	0.409188	T	0.00178	0.0005	L	0.48642	1.525	0.09310	N	1	B	0.21905	0.062	B	0.34242	0.178	T	0.17198	-1.0377	10	0.54805	T	0.06	.	8.4626	0.32936	0.4155:0.4467:0.1378:0.0	.	232	Q8NGE5	O10A7_HUMAN	I	232	ENSP00000326718:T232I	ENSP00000326718:T232I	T	+	2	0	OR10A7	53901770	0.000000	0.05858	0.019000	0.16419	0.079000	0.17450	-0.157000	0.10085	0.467000	0.27218	0.637000	0.83480	ACT		0.488	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1			Missense_Mutation
ZNF274	10782	genome.wustl.edu	37	19	58723004	58723004	+	Nonsense_Mutation	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr19:58723004G>T	ENST00000326804.4	+	8	1387	c.928G>T	c.(928-930)Gag>Tag	p.E310*	ZNF274_ENST00000424679.2_Nonsense_Mutation_p.E205*|ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Nonsense_Mutation_p.E278*	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	311	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		ACAGAGGACCGAGTACCGCGA	0.612																																																0			19											107.0	123.0	117.0					19																	58723004		2198	4299	6497	63414816	SO:0001587	stop_gained	10782			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.928G>T	19.37:g.58723004G>T	ENSP00000321209:p.Glu310*	Somatic		Capture	Illumina GAIIx	4	63414816	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Nonsense_Mutation	SNP	ENST00000326804.4	37		SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	38	6.921304	0.97936	.	.	ENSG00000171606	ENST00000326804;ENST00000345813;ENST00000424679	.	.	.	5.17	2.98	0.34508	.	0.000000	0.36002	N	0.002845	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-11.3271	7.7533	0.28909	0.0:0.1782:0.6372:0.1846	.	.	.	.	X	310;278;205	.	ENSP00000321209:E310X	E	+	1	0	ZNF274	63414816	0.559000	0.26562	0.960000	0.40013	0.556000	0.35491	0.967000	0.29344	2.688000	0.91661	0.563000	0.77884	GAG		0.612	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_133502		Nonsense_Mutation
SNX15	29907	genome.wustl.edu	37	11	64799920	64799920	+	Silent	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr11:64799920G>T	ENST00000377244.3	+	3	283	c.153G>T	c.(151-153)cgG>cgT	p.R51R	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Silent_p.R51R	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	51	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)	p.R51R(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						TCTGGAAGCGGTACAGCGACT	0.652																																					Esophageal Squamous(56;269 1304 3324 8253)											1	Substitution - coding silent(1)	ovary(1)	11											82.0	73.0	76.0					11																	64799920		2201	4297	6498	64556496	SO:0001819	synonymous_variant	29907			AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.153G>T	11.37:g.64799920G>T		Somatic		Capture	Illumina GAIIx	4	64556496	E5KQS6|Q9NRS5	Silent	SNP	ENST00000377244.3	37	CCDS8089.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	14.32	2.499266	0.44455	.	.	ENSG00000110025	ENST00000525648	.	.	.	5.48	-0.145	0.13436	.	.	.	.	.	T	0.56441	0.1985	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56908	-0.7901	5	0.87932	D	0	-2.8199	3.7697	0.08636	0.1479:0.3458:0.3886:0.1177	.	.	.	.	V	10	.	ENSP00000436023:G10V	G	+	2	0	SNX15	64556496	0.995000	0.38212	1.000000	0.80357	0.778000	0.44026	0.250000	0.18235	0.253000	0.21552	0.655000	0.94253	GGT		0.652	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3			Silent
ATP6V1D	51382	genome.wustl.edu	37	14	67805358	67805358	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr14:67805358C>T	ENST00000216442.7	-	9	1274	c.724G>A	c.(724-726)Gag>Aag	p.E242K	ATP6V1D_ENST00000554236.1_3'UTR|Y_RNA_ENST00000362885.1_RNA|ATP6V1D_ENST00000555431.1_Missense_Mutation_p.E187K|ATP6V1D_ENST00000555474.1_Missense_Mutation_p.E143K|ATP6V1D_ENST00000553974.1_5'Flank	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	242					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.E242K(1)		lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		AGAAGATCCTCGTCCTTCTCT	0.418																																																1	Substitution - Missense(1)	ovary(1)	14											170.0	178.0	176.0					14																	67805358		2203	4300	6503	66875111	SO:0001583	missense	51382			AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.724G>A	14.37:g.67805358C>T	ENSP00000216442:p.Glu242Lys	Somatic		Capture	Illumina GAIIx	4	66875111	B2RE33|Q9Y688	Missense_Mutation	SNP	ENST00000216442.7	37	CCDS9780.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	19.61	3.858971	0.71834	.	.	ENSG00000100554	ENST00000555474;ENST00000216442;ENST00000555431	.	.	.	5.83	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.38374	0.1038	N	0.19112	0.55	0.80722	D	1	P	0.41232	0.743	B	0.39258	0.295	T	0.41787	-0.9489	9	0.62326	D	0.03	-26.7602	12.8657	0.57937	0.0:0.8662:0.0:0.1338	.	242	Q9Y5K8	VATD_HUMAN	K	143;242;187	.	ENSP00000216442:E242K	E	-	1	0	ATP6V1D	66875111	1.000000	0.71417	0.906000	0.35671	0.477000	0.33069	7.047000	0.76599	1.477000	0.48234	-0.136000	0.14681	GAG		0.418	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994		Missense_Mutation
CSN3	1448	genome.wustl.edu	37	4	71114806	71114806	+	Missense_Mutation	SNP	C	C	A			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr4:71114806C>A	ENST00000304954.3	+	4	265	c.179C>A	c.(178-180)aCc>aAc	p.T60N		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	195					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)		p.T60N(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						TATTATGGAACCAATTTGTAC	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											122.0	118.0	119.0					4																	71114806		2203	4300	6503	71149395	SO:0001583	missense	1448			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.179C>A	4.37:g.71114806C>A	ENSP00000304822:p.Thr60Asn	Somatic		Capture	Illumina GAIIx	4	71149395	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393516	0.42410	.	.	ENSG00000171209	ENST00000304954	T	0.22945	1.93	4.38	2.58	0.30949	.	0.636024	0.14837	N	0.295482	T	0.14874	0.0359	N	0.22421	0.69	0.09310	N	1	B	0.31485	0.325	B	0.30251	0.113	T	0.18116	-1.0347	10	0.66056	D	0.02	-24.7422	4.5418	0.12061	0.2181:0.6651:0.0:0.1168	.	60	P07498	CASK_HUMAN	N	60	ENSP00000304822:T60N	ENSP00000304822:T60N	T	+	2	0	CSN3	71149395	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.555000	0.05999	0.744000	0.32741	0.557000	0.71058	ACC		0.388	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212		Missense_Mutation
ADAMTS14	140766	genome.wustl.edu	37	10	72492028	72492028	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr10:72492028G>A	ENST00000373207.1	+	7	1121	c.1121G>A	c.(1120-1122)gGc>gAc	p.G374D	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G377D	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	374	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G377D(1)		NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CCCGTCACTGGCATGTGTCAC	0.597																																																1	Substitution - Missense(1)	ovary(1)	10											107.0	81.0	90.0					10																	72492028		2203	4300	6503	72162034	SO:0001583	missense	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1121G>A	10.37:g.72492028G>A	ENSP00000362303:p.Gly374Asp	Somatic		Capture	Illumina GAIIx	4	72162034	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856799	0.91433	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	D;D	0.88818	-2.43;-2.43	4.68	4.68	0.58851	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.96116	0.8734	H	0.94925	3.6	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97172	0.9845	10	0.87932	D	0	.	17.7715	0.88494	0.0:0.0:1.0:0.0	.	374;377	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	D	377;374	ENSP00000362304:G377D;ENSP00000362303:G374D	ENSP00000362303:G374D	G	+	2	0	ADAMTS14	72162034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.606000	0.88127	0.655000	0.94253	GGC		0.597	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		Missense_Mutation
GTF2IRD1	9569	genome.wustl.edu	37	7	73944096	73944096	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:73944096G>A	ENST00000265755.3	+	9	1516	c.1123G>A	c.(1123-1125)Gtg>Atg	p.V375M	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.V407M|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.V375M|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.V375M	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	375					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V375M(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CATGGTCCCCGTGCCCTACCG	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											68.0	57.0	61.0					7																	73944096		2203	4300	6503	73582032	SO:0001583	missense	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1123G>A	7.37:g.73944096G>A	ENSP00000265755:p.Val375Met	Somatic		Capture	Illumina GAIIx	4	73582032	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	g	26.1	4.704554	0.88924	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.74107	0.3673	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;0.998	D;P;D;D	0.91635	0.999;0.904;0.985;0.944	T	0.77183	-0.2681	10	0.59425	D	0.04	-30.5453	16.4644	0.84074	0.0:0.0:1.0:0.0	.	407;375;375;375	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	M	375;407;375;375	ENSP00000265755:V375M;ENSP00000397566:V407M;ENSP00000408477:V375M;ENSP00000418383:V375M	ENSP00000265755:V375M	V	+	1	0	GTF2IRD1	73582032	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	9.080000	0.94040	2.214000	0.71695	0.457000	0.33378	GTG		0.612	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		Missense_Mutation
MYF5	4617	genome.wustl.edu	37	12	81112214	81112214	+	Splice_Site	SNP	T	T	G			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr12:81112214T>G	ENST00000228644.3	+	2	729		c.e2+2			NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5						camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						TATCAAATGGTAAGAATTGAT	0.398																																																1	Unknown(1)	ovary(1)	12											152.0	144.0	146.0					12																	81112214		2203	4300	6503	79636345	SO:0001630	splice_region_variant	4617				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.577+2T>G	12.37:g.81112214T>G		Somatic		Capture	Illumina GAIIx	4	79636345	Q6ISR9	Splice_Site_SNP	SNP	ENST00000228644.3	37	CCDS9020.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	18.57	3.653275	0.67472	.	.	ENSG00000111049	ENST00000228644	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5272	0.75919	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYF5	79636345	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.462000	0.73526	2.311000	0.77944	0.533000	0.62120	.		0.398	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	Intron	Splice_Site_SNP
CERS3	204219	genome.wustl.edu	37	15	101013152	101013152	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr15:101013152C>T	ENST00000394113.1	-	11	1405	c.715G>A	c.(715-717)Gat>Aat	p.D239N	CERS3_ENST00000538112.2_Missense_Mutation_p.D239N|CERS3_ENST00000284382.4_Missense_Mutation_p.D239N|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	239	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.D239N(1)									TCAGCCACATCGTGTACAATC	0.438																																																1	Substitution - Missense(1)	ovary(1)	15											114.0	100.0	105.0					15																	101013152		2203	4300	6503	98830675	SO:0001583	missense	204219				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.715G>A	15.37:g.101013152C>T	ENSP00000377672:p.Asp239Asn	Somatic		Capture	Illumina GAIIx	4	98830675	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	34	5.322713	0.95708	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.87650	-2.28;-2.28	5.92	5.92	0.95590	TRAM/LAG1/CLN8 homology domain (3);	0.045398	0.85682	D	0.000000	D	0.94215	0.8143	M	0.84156	2.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94330	0.7561	10	0.87932	D	0	-26.0758	19.0795	0.93177	0.0:1.0:0.0:0.0	.	239	Q8IU89	CERS3_HUMAN	N	239;250;239	ENSP00000284382:D239N;ENSP00000437640:D239N	ENSP00000284382:D239N	D	-	1	0	CERS3	98830675	1.000000	0.71417	0.580000	0.28601	0.855000	0.48748	6.620000	0.74224	2.795000	0.96236	0.655000	0.94253	GAT		0.438	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842		Missense_Mutation
IL18RAP	8807	genome.wustl.edu	37	2	103057835	103057835	+	Missense_Mutation	SNP	T	T	A	rs200911053		TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:103057835T>A	ENST00000264260.2	+	7	1383	c.794T>A	c.(793-795)cTt>cAt	p.L265H	IL18RAP_ENST00000409369.1_Missense_Mutation_p.L123H|AC007278.3_ENST00000450893.1_RNA	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	265	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L265H(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GAAGTAGAACTTGGTAAGCTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											120.0	100.0	107.0					2																	103057835		2203	4300	6503	102424267	SO:0001583	missense	8807			AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.794T>A	2.37:g.103057835T>A	ENSP00000264260:p.Leu265His	Somatic		Capture	Illumina GAIIx	4	102424267	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	37	CCDS2061.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.09	3.299466	0.60195	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.15603	2.41;2.41	5.07	5.07	0.68467	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110761	0.40640	N	0.001046	T	0.42585	0.1209	M	0.80746	2.51	0.44282	D	0.997147	D	0.89917	1.0	D	0.97110	1.0	T	0.42666	-0.9438	10	0.87932	D	0	.	11.2084	0.48784	0.0:0.0:0.0:1.0	.	265	O95256	I18RA_HUMAN	H	265;123	ENSP00000264260:L265H;ENSP00000387201:L123H	ENSP00000264260:L265H	L	+	2	0	IL18RAP	102424267	1.000000	0.71417	0.999000	0.59377	0.449000	0.32228	3.794000	0.55492	1.917000	0.55516	0.402000	0.26972	CTT		0.443	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853		Missense_Mutation
AIM1	202	genome.wustl.edu	37	6	106968144	106968144	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr6:106968144C>T	ENST00000369066.3	+	2	2324	c.1837C>T	c.(1837-1839)Ctc>Ttc	p.L613F		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.L613F(1)		breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		CACAGCAGAGCTCGCGGCAAA	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											72.0	75.0	74.0					6																	106968144		2203	4300	6503	107074837	SO:0001583	missense	202			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1837C>T	6.37:g.106968144C>T	ENSP00000358062:p.Leu613Phe	Somatic		Capture	Illumina GAIIx	4	107074837	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968434	0.34754	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.71461	-0.57	5.44	4.55	0.56014	.	1.270490	0.05510	N	0.560086	T	0.43122	0.1233	N	0.22421	0.69	0.29576	N	0.849566	B	0.24483	0.104	B	0.20955	0.032	T	0.38023	-0.9680	10	0.56958	D	0.05	.	11.914	0.52755	0.0:0.8254:0.1746:0.0	.	613	Q9Y4K1	AIM1_HUMAN	F	1021;613	ENSP00000358062:L613F	ENSP00000285105:L1021F	L	+	1	0	AIM1	107074837	0.344000	0.24827	0.014000	0.15608	0.001000	0.01503	2.032000	0.41127	1.492000	0.48499	0.655000	0.94253	CTC		0.512	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1			Missense_Mutation
LAMB4	22798	genome.wustl.edu	37	7	107678032	107678032	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:107678032C>G	ENST00000388781.3	-	30	4563	c.4480G>C	c.(4480-4482)Gtg>Ctg	p.V1494L	LAMB4_ENST00000388780.3_Missense_Mutation_p.V1494L|LAMB4_ENST00000205386.4_Missense_Mutation_p.V1494L|LAMB4_ENST00000483484.1_5'Flank|AC005048.1_ENST00000401266.1_RNA	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1494	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.V1494L(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TCTGGAGGCACGTTTTCCTCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	7											158.0	146.0	150.0					7																	107678032		2203	4300	6503	107465268	SO:0001583	missense	22798			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4480G>C	7.37:g.107678032C>G	ENSP00000373433:p.Val1494Leu	Somatic		Capture	Illumina GAIIx	4	107465268	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125711	0.56721	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.31247	1.5;1.5;1.91;1.52	4.85	0.915	0.19366	.	0.000000	0.43416	D	0.000565	T	0.25901	0.0631	L	0.38175	1.15	0.31362	N	0.681273	P;D	0.58620	0.874;0.983	P;P	0.49451	0.611;0.59	T	0.27571	-1.0070	10	0.72032	D	0.01	.	4.6157	0.12424	0.1524:0.5946:0.0:0.2529	.	1494;1494	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	L	1494;1494;520;1494	ENSP00000205386:V1494L;ENSP00000373433:V1494L;ENSP00000416562:V520L;ENSP00000373432:V1494L	ENSP00000205386:V1494L	V	-	1	0	LAMB4	107465268	0.019000	0.18553	0.338000	0.25549	0.959000	0.62525	0.304000	0.19228	0.054000	0.16065	0.655000	0.94253	GTG		0.393	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		Missense_Mutation
HENMT1	113802	genome.wustl.edu	37	1	109197423	109197423	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:109197423T>G	ENST00000370032.5	-	5	733	c.313A>C	c.(313-315)Aat>Cat	p.N105H	HENMT1_ENST00000493676.1_5'UTR|HENMT1_ENST00000402983.1_Missense_Mutation_p.N105H|HENMT1_ENST00000370031.1_Missense_Mutation_p.N105H	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	105					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.N105H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						ATGGTCAAATTCAGATCCCGA	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	80.0	83.0					1																	109197423		2203	4300	6503	108998946	SO:0001583	missense	113802				CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.313A>C	1.37:g.109197423T>G	ENSP00000359049:p.Asn105His	Somatic		Capture	Illumina GAIIx	4	108998946	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Missense_Mutation	SNP	ENST00000370032.5	37	CCDS787.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	11.71	1.721023	0.30503	.	.	ENSG00000162639	ENST00000402983;ENST00000370031;ENST00000370032;ENST00000420055	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.1	-2.07	0.07276	.	1.354520	0.04564	N	0.392021	T	0.18635	0.0447	L	0.27053	0.805	0.09310	N	1	D	0.53151	0.958	P	0.48334	0.574	T	0.05954	-1.0854	10	0.49607	T	0.09	-13.4666	2.3324	0.04239	0.2024:0.1619:0.1015:0.5342	.	105	Q5T8I9	HENMT_HUMAN	H	105	ENSP00000385655:N105H;ENSP00000359048:N105H;ENSP00000359049:N105H;ENSP00000403953:N105H	ENSP00000359048:N105H	N	-	1	0	HENMT1	108998946	0.185000	0.23213	0.001000	0.08648	0.004000	0.04260	0.514000	0.22786	-0.134000	0.11516	-0.248000	0.11899	AAT		0.363	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030592.1	NM_144584		Missense_Mutation
RFX6	222546	genome.wustl.edu	37	6	117232163	117232163	+	Silent	SNP	C	C	T	rs372387409		TCGA-09-0369-01	TCGA-09-0369-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr6:117232163C>T	ENST00000332958.2	+	7	754	c.738C>T	c.(736-738)agC>agT	p.S246S	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	246					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AATTCCCCAGCGCTCAACACC	0.358																																																0			6						C		0,4406		0,0,2203	106.0	106.0	106.0		738	-1.3	1.0	6		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RFX6	NM_173560.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		246/929	117232163	1,13005	2203	4300	6503	117338856	SO:0001819	synonymous_variant	222546			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.738C>T	6.37:g.117232163C>T		Somatic		Capture	Illumina GAIIx	4	117338856	Q5T6B3	Silent	SNP	ENST00000332958.2	37	CCDS5113.1	SNP	27	WashU																																																																																				0.358	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		Silent
FEZF1	389549	genome.wustl.edu	37	7	121943817	121943817	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:121943817C>G	ENST00000442488.2	-	1	742	c.675G>C	c.(673-675)caG>caC	p.Q225H	FEZF1-AS1_ENST00000437317.1_RNA|FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000427185.2_Missense_Mutation_p.Q175H|FEZF1_ENST00000331178.4_Missense_Mutation_p.Q225H	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	225					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.Q225H(1)		breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						AATGCTGCAGCTGAGCCTGGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	7											75.0	82.0	80.0					7																	121943817		2203	4300	6503	121731053	SO:0001583	missense	389549			AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.675G>C	7.37:g.121943817C>G	ENSP00000411145:p.Gln225His	Somatic		Capture	Illumina GAIIx	4	121731053	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	ENST00000442488.2	37	CCDS34741.2	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000429	0.35320	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	T;T;T	0.07908	3.15;3.31;3.19	5.24	3.43	0.39272	.	0.108661	0.64402	D	0.000004	T	0.04998	0.0134	N	0.14661	0.345	0.37315	D	0.909306	B;B	0.21225	0.014;0.053	B;B	0.20955	0.007;0.032	T	0.38929	-0.9638	10	0.34782	T	0.22	-23.6628	8.15	0.31134	0.0:0.725:0.1304:0.1446	.	225;175	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	H	225;225;175	ENSP00000411145:Q225H;ENSP00000332777:Q225H;ENSP00000392727:Q175H	ENSP00000332777:Q225H	Q	-	3	2	FEZF1	121731053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.756000	0.47549	0.697000	0.31718	0.555000	0.69702	CAG		0.507	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613		Missense_Mutation
GJA1	2697	genome.wustl.edu	37	6	121768858	121768858	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr6:121768858G>C	ENST00000282561.3	+	2	1022	c.865G>C	c.(865-867)Gtt>Ctt	p.V289L		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	289					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.V289L(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GTACAAGCTGGTTACTGGCGA	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											68.0	70.0	69.0					6																	121768858		2203	4300	6503	121810557	SO:0001583	missense	2697			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.865G>C	6.37:g.121768858G>C	ENSP00000282561:p.Val289Leu	Somatic		Capture	Illumina GAIIx	4	121810557	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	5.964	0.361846	0.11296	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.81821	-1.54	5.18	4.31	0.51392	.	0.224369	0.36303	N	0.002674	T	0.48295	0.1492	N	0.19112	0.55	0.41875	D	0.990291	B	0.09022	0.002	B	0.10450	0.005	T	0.48293	-0.9048	10	0.08381	T	0.77	.	13.6859	0.62515	0.0739:0.0:0.9261:0.0	.	289	P17302	CXA1_HUMAN	L	273;289	ENSP00000282561:V289L	ENSP00000282561:V289L	V	+	1	0	GJA1	121810557	1.000000	0.71417	0.989000	0.46669	0.470000	0.32858	7.383000	0.79741	1.415000	0.47037	0.585000	0.79938	GTT		0.483	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165		Missense_Mutation
LAMC3	10319	genome.wustl.edu	37	9	133942439	133942439	+	Missense_Mutation	SNP	G	G	A	rs529385350		TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr9:133942439G>A	ENST00000361069.4	+	14	2573	c.2440G>A	c.(2440-2442)Ggg>Agg	p.G814R	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	814	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.G814R(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCAGTGTAGCGGGAACGTGGA	0.642																																																1	Substitution - Missense(1)	ovary(1)	9											65.0	56.0	59.0					9																	133942439		2203	4300	6503	132932260	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2440G>A	9.37:g.133942439G>A	ENSP00000354360:p.Gly814Arg	Somatic		Capture	Illumina GAIIx	4	132932260	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684891	0.47991	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.66995	-0.24	4.8	3.89	0.44902	EGF-like, laminin (3);	0.299825	0.35903	N	0.002908	T	0.76478	0.3993	H	0.95816	3.725	0.52501	D	0.999959	P	0.37525	0.598	B	0.41135	0.348	T	0.78881	-0.2029	10	0.54805	T	0.06	.	9.275	0.37694	0.168:0.0:0.832:0.0	.	814	Q9Y6N6	LAMC3_HUMAN	R	814	ENSP00000354360:G814R	ENSP00000347156:G814R	G	+	1	0	LAMC3	132932260	1.000000	0.71417	0.694000	0.30210	0.378000	0.30076	4.898000	0.63238	1.128000	0.42052	0.650000	0.86243	GGG		0.642	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059		Missense_Mutation
TRAF2	7186	genome.wustl.edu	37	9	139814809	139814809	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr9:139814809C>T	ENST00000247668.2	+	8	854	c.802C>T	c.(802-804)Ctc>Ttc	p.L268F	TRAF2_ENST00000536468.1_Missense_Mutation_p.L268F|TRAF2_ENST00000359662.3_Missense_Mutation_p.L320F	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	268				Missing (in Ref. 2; BAB70792). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L268F(1)		breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		GGGGTCAGAGCTCCTGCAGAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											67.0	67.0	67.0					9																	139814809		2202	4300	6502	138934630	SO:0001583	missense	7186			U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.802C>T	9.37:g.139814809C>T	ENSP00000247668:p.Leu268Phe	Somatic		Capture	Illumina GAIIx	4	138934630	A8K107|B4DPJ7|Q7Z337|Q96NT2	Missense_Mutation	SNP	ENST00000247668.2	37	CCDS7013.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276784	0.23307	.	.	ENSG00000127191	ENST00000536468;ENST00000432785;ENST00000247668;ENST00000359662	T;T;T	0.39056	1.37;1.37;1.1	4.37	4.37	0.52481	.	0.257811	0.33327	N	0.005040	T	0.52693	0.1750	M	0.79926	2.475	0.30121	N	0.805673	P;P;B	0.36048	0.534;0.534;0.399	P;P;B	0.44732	0.459;0.459;0.27	T	0.59484	-0.7446	10	0.52906	T	0.07	-36.1552	11.3326	0.49485	0.1816:0.8184:0.0:0.0	.	257;243;268	Q12933-3;Q12933-4;Q12933	.;.;TRAF2_HUMAN	F	268;267;268;320	ENSP00000446414:L268F;ENSP00000247668:L268F;ENSP00000352685:L320F	ENSP00000247668:L268F	L	+	1	0	TRAF2	138934630	1.000000	0.71417	0.117000	0.21633	0.191000	0.23601	1.366000	0.34193	2.246000	0.74042	0.462000	0.41574	CTC		0.632	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138		Missense_Mutation
MRAS	22808	genome.wustl.edu	37	3	138117370	138117370	+	Missense_Mutation	SNP	T	T	G			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr3:138117370T>G	ENST00000289104.4	+	4	1054	c.407T>G	c.(406-408)aTc>aGc	p.I136S	MRAS_ENST00000464896.1_Missense_Mutation_p.I60S|MRAS_ENST00000474559.1_Missense_Mutation_p.I136S|MRAS_ENST00000423968.2_Missense_Mutation_p.I136S	NM_001085049.2|NM_001252090.1|NM_001252091.1|NM_012219.4	NP_001078518.1|NP_001239019.1|NP_001239020.1|NP_036351.3	O14807	RASM_HUMAN	muscle RAS oncogene homolog	136					actin cytoskeleton organization (GO:0030036)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|Ras protein signal transduction (GO:0007265)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)	p.I136S(1)		kidney(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	14						TTGAGGAAGATCACCAGGGAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											164.0	144.0	150.0					3																	138117370		2203	4300	6503	139600060	SO:0001583	missense	22808			AF022080	CCDS3100.1, CCDS58855.1	3q22.3	2014-05-09			ENSG00000158186	ENSG00000158186			7227	protein-coding gene	gene with protein product		608435				9400994, 10446149	Standard	NM_012219		Approved	M-RAs, R-RAS3, RRAS3	uc003esi.4	O14807	OTTHUMG00000159888	ENST00000289104.4:c.407T>G	3.37:g.138117370T>G	ENSP00000289104:p.Ile136Ser	Somatic		Capture	Illumina GAIIx	4	139600060	B4DIK0|Q86WX8	Missense_Mutation	SNP	ENST00000289104.4	37	CCDS3100.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560734	0.65538	.	.	ENSG00000158186	ENST00000289104;ENST00000423968;ENST00000494949;ENST00000464896;ENST00000474559	T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43	4.71	4.71	0.59529	Small GTP-binding protein domain (1);	0.150607	0.64402	D	0.000012	T	0.80303	0.4598	M	0.78344	2.41	0.51767	D	0.999939	B	0.32653	0.379	B	0.32624	0.149	T	0.81996	-0.0676	10	0.87932	D	0	.	12.135	0.53966	0.0:0.0:0.0:1.0	.	136	O14807	RASM_HUMAN	S	136;136;60;60;136	ENSP00000289104:I136S;ENSP00000389682:I136S;ENSP00000417685:I60S;ENSP00000419582:I60S;ENSP00000418356:I136S	ENSP00000289104:I136S	I	+	2	0	MRAS	139600060	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.770000	0.85390	1.745000	0.51790	0.459000	0.35465	ATC		0.502	MRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357990.1			Missense_Mutation
PCDHB11	56125	genome.wustl.edu	37	5	140580437	140580437	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr5:140580437G>A	ENST00000354757.3	+	1	1090	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	PCDHB11_ENST00000536699.1_5'UTR	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	364	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V364M(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCAGAGACCGTGGTTATGGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	5											112.0	111.0	111.0					5																	140580437		2203	4300	6503	140560621	SO:0001583	missense	56125			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1090G>A	5.37:g.140580437G>A	ENSP00000346802:p.Val364Met	Somatic		Capture	Illumina GAIIx	4	140560621	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894510	0.52121	.	.	ENSG00000197479	ENST00000354757;ENST00000536825	T	0.52295	0.67	2.52	0.519	0.17035	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.62307	0.2417	M	0.85197	2.74	0.35148	D	0.769504	D	0.56968	0.978	P	0.57720	0.826	T	0.69355	-0.5167	9	0.66056	D	0.02	.	8.2233	0.31554	0.2185:0.0:0.7815:0.0	.	364	Q9Y5F2	PCDBB_HUMAN	M	364;54	ENSP00000346802:V364M	ENSP00000346802:V364M	V	+	1	0	PCDHB11	140560621	0.010000	0.17322	0.001000	0.08648	0.438000	0.31896	1.630000	0.37081	-0.027000	0.13873	0.306000	0.20318	GTG		0.408	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		Missense_Mutation
CLGN	1047	genome.wustl.edu	37	4	141321660	141321660	+	Missense_Mutation	SNP	G	G	C			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr4:141321660G>C	ENST00000325617.5	-	7	985	c.545C>G	c.(544-546)cCa>cGa	p.P182R	CLGN_ENST00000414773.1_Missense_Mutation_p.P182R|CLGN_ENST00000537281.1_Missense_Mutation_p.P182R	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	182					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)	p.P182R(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					ACATTTATCTGGTCCAAACAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											78.0	82.0	81.0					4																	141321660		2203	4298	6501	141541110	SO:0001583	missense	1047			D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.545C>G	4.37:g.141321660G>C	ENSP00000326699:p.Pro182Arg	Somatic		Capture	Illumina GAIIx	4	141541110	B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	ENST00000325617.5	37	CCDS3751.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736952	0.89482	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000545667	T;T;T	0.62498	0.02;0.02;0.02	5.36	5.36	0.76844	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Calreticulin/calnexin, conserved site (1);	0.047867	0.85682	D	0.000000	D	0.86539	0.5957	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90504	0.4476	10	0.87932	D	0	-12.8213	19.4559	0.94889	0.0:0.0:1.0:0.0	.	182	O14967	CLGN_HUMAN	R	182;182;182;99	ENSP00000326699:P182R;ENSP00000392782:P182R;ENSP00000439381:P182R	ENSP00000326699:P182R	P	-	2	0	CLGN	141541110	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.669000	0.90835	0.591000	0.81541	CCA		0.333	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2	NM_004362		Missense_Mutation
FLNA	2316	genome.wustl.edu	37	X	153577752	153577752	+	Silent	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chrX:153577752G>A	ENST00000369850.3	-	47	7970	c.7734C>T	c.(7732-7734)ttC>ttT	p.F2578F	FLNA_ENST00000369856.3_Silent_p.F711F|FLNA_ENST00000498491.1_5'UTR|FLNA_ENST00000344736.4_Silent_p.F2538F|FLNA_ENST00000360319.4_Silent_p.F2570F|FLNA_ENST00000422373.1_Silent_p.F2570F	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2578	Self-association site, tail.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGTCTACTGTGAAGCTGCTCT	0.652																																																0			X											52.0	55.0	54.0					X																	153577752		1961	4116	6077	153230946	SO:0001819	synonymous_variant	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.7734C>T	X.37:g.153577752G>A		Somatic		Capture	Illumina GAIIx	4	153230946	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	CCDS48194.1	SNP	45	WashU																																																																																				0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			Silent
CD1C	911	genome.wustl.edu	37	1	158262529	158262529	+	Missense_Mutation	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:158262529G>T	ENST00000368170.3	+	4	1033	c.754G>T	c.(754-756)Ggt>Tgt	p.G252C		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	252	Ig-like.				antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)	p.G252C(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					CACTAAACATGGTGATATTCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											148.0	145.0	146.0					1																	158262529		2203	4300	6503	156529153	SO:0001583	missense	911			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.754G>T	1.37:g.158262529G>T	ENSP00000357152:p.Gly252Cys	Somatic		Capture	Illumina GAIIx	4	156529153	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	SNP	47	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	13.15|13.15	2.151646|2.151646	0.38021|0.38021	.|.	.|.	ENSG00000158481|ENSG00000158481	ENST00000368169;ENST00000368170;ENST00000454192|ENST00000443761	T|.	0.03004|.	4.08|.	3.62|3.62	2.7|2.7	0.31948|0.31948	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);|.	0.601763|.	0.13907|.	N|.	0.354518|.	T|T	0.68016|0.68016	0.2955|0.2955	H|H	0.98111|0.98111	4.15|4.15	0.09310|0.09310	N|N	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.62728|0.62728	-0.6793|-0.6793	10|5	0.87932|.	D|.	0|.	.|.	7.0798|7.0798	0.25225|0.25225	0.1273:0.0:0.8727:0.0|0.1273:0.0:0.8727:0.0	.|.	252;252|.	E9PGC9;P29017|.	.;CD1C_HUMAN|.	C|L	252;252;55|186	ENSP00000357152:G252C|.	ENSP00000357151:G252C|.	G|W	+|+	1|2	0|0	CD1C|CD1C	156529153|156529153	0.001000|0.001000	0.12720|0.12720	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	0.643000|0.643000	0.24750|0.24750	0.871000|0.871000	0.35750|0.35750	0.650000|0.650000	0.86243|0.86243	GGT|TGG		0.527	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765		Missense_Mutation
SCN9A	6335	genome.wustl.edu	37	2	167108389	167108389	+	Missense_Mutation	SNP	T	T	A			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:167108389T>A	ENST00000409435.1	-	17	3357	c.3358A>T	c.(3358-3360)Aac>Tac	p.N1120Y	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.N1121Y|SCN9A_ENST00000409672.1_Missense_Mutation_p.N1109Y|SCN9A_ENST00000375387.4_Missense_Mutation_p.N1121Y			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1120					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.N1109Y(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTGACCGGTTTAATCTCTAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											70.0	64.0	66.0					2																	167108389		1875	4096	5971	166816635	SO:0001583	missense	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3358A>T	2.37:g.167108389T>A	ENSP00000386330:p.Asn1120Tyr	Somatic		Capture	Illumina GAIIx	4	166816635	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	13.71	2.317358	0.40996	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.82	4.61	0.57282	.	0.222293	0.21708	U	0.070305	D	0.86456	0.5937	M	0.81942	2.565	0.27840	N	0.941133	P	0.43412	0.806	P	0.46389	0.515	T	0.83322	-0.0017	10	0.72032	D	0.01	.	14.0375	0.64654	0.0:0.0:0.1338:0.8662	.	1109	E7EUN6	.	Y	1109;1121;1121;1120	ENSP00000386306:N1109Y;ENSP00000364536:N1121Y;ENSP00000304748:N1121Y;ENSP00000386330:N1120Y	ENSP00000304748:N1121Y	N	-	1	0	SCN9A	166816635	0.796000	0.28864	0.926000	0.36857	0.531000	0.34715	1.653000	0.37323	2.221000	0.72209	0.528000	0.53228	AAC		0.428	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		Missense_Mutation
LRP2	4036	genome.wustl.edu	37	2	170129508	170129508	+	Missense_Mutation	SNP	T	T	A			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:170129508T>A	ENST00000263816.3	-	15	2330	c.2045A>T	c.(2044-2046)aAt>aTt	p.N682I	LRP2_ENST00000443831.1_Missense_Mutation_p.N613I	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	682	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.N682I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAAACCATCATTATCTGTTCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											192.0	179.0	183.0					2																	170129508		2203	4300	6503	169837754	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.2045A>T	2.37:g.170129508T>A	ENSP00000263816:p.Asn682Ile	Somatic		Capture	Illumina GAIIx	4	169837754	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	28.2	4.901071	0.92035	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.94723	-2.65;-3.5	5.5	5.5	0.81552	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.97120	0.9059	M	0.80982	2.52	0.31710	N	0.639659	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.97165	0.9840	10	0.49607	T	0.09	.	15.8976	0.79346	0.0:0.0:0.0:1.0	.	613;682	E9PC35;P98164	.;LRP2_HUMAN	I	682;613	ENSP00000263816:N682I;ENSP00000409813:N613I	ENSP00000263816:N682I	N	-	2	0	LRP2	169837754	1.000000	0.71417	0.966000	0.40874	0.983000	0.72400	6.202000	0.72131	2.212000	0.71576	0.528000	0.53228	AAT		0.478	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179495021	179495021	+	Missense_Mutation	SNP	C	C	A			TCGA-09-0369-01	TCGA-09-0369-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:179495021C>A	ENST00000591111.1	-	189	39529	c.39305G>T	c.(39304-39306)gGg>gTg	p.G13102V	TTN_ENST00000359218.5_Missense_Mutation_p.G5803V|TTN_ENST00000342992.6_Missense_Mutation_p.G12175V|TTN_ENST00000460472.2_Missense_Mutation_p.G5678V|TTN_ENST00000342175.6_Missense_Mutation_p.G5870V|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G14743V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13102					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G5678V(1)|p.G12175V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAATCCACCCCACCCGTCTG	0.403																																																2	Substitution - Missense(2)	ovary(2)	2											81.0	86.0	84.0					2																	179495021		1859	4085	5944	179203266	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39305G>T	2.37:g.179495021C>A	ENSP00000465570:p.Gly13102Val	Somatic		Capture	Illumina GAIIx	4	179203266	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	10.42	1.346394	0.24426	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	6.04	4.23	0.50019	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.24812	0.0602	L	0.34521	1.04	0.58432	D	0.999998	B;B;B;B	0.11235	0.004;0.004;0.004;0.004	B;B;B;B	0.10450	0.005;0.005;0.005;0.005	T	0.03863	-1.0997	9	0.87932	D	0	.	11.3144	0.49383	0.1275:0.8072:0.0:0.0653	.	5678;5803;5870;13102	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	12175;5678;5870;5803;5678	ENSP00000343764:G12175V;ENSP00000434586:G5678V;ENSP00000340554:G5870V;ENSP00000352154:G5803V	ENSP00000340554:G5870V	G	-	2	0	TTN	179203266	0.810000	0.29049	0.903000	0.35520	0.651000	0.38670	1.939000	0.40213	0.858000	0.35431	-0.251000	0.11542	GGG		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
ETNK2	55224	genome.wustl.edu	37	1	204115852	204115852	+	Missense_Mutation	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:204115852C>T	ENST00000367202.4	-	3	709	c.559G>A	c.(559-561)Gcc>Acc	p.A187T	ETNK2_ENST00000367201.3_Missense_Mutation_p.A187T|ETNK2_ENST00000367199.2_Intron|ETNK2_ENST00000367198.2_Missense_Mutation_p.A9T	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	187					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)	p.A187T(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGCCGTTGGCGTGGATAGTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											155.0	132.0	139.0					1																	204115852		2203	4300	6503	202382475	SO:0001583	missense	55224			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.559G>A	1.37:g.204115852C>T	ENSP00000356170:p.Ala187Thr	Somatic		Capture	Illumina GAIIx	4	202382475	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	ENST00000367202.4	37	CCDS1442.2	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820409	0.50633	.	.	ENSG00000143845	ENST00000367201;ENST00000367202;ENST00000455266;ENST00000367198;ENST00000422699;ENST00000452983	T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26	5.34	3.46	0.39613	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.288050	0.38959	N	0.001506	T	0.39809	0.1092	L	0.35854	1.095	0.36205	D	0.850983	B;B	0.27971	0.015;0.196	B;B	0.17098	0.014;0.017	T	0.34775	-0.9815	10	0.13470	T	0.59	-13.5273	8.6803	0.34205	0.0:0.7599:0.0:0.2401	.	187;187	Q9NVF9;Q9NVF9-2	EKI2_HUMAN;.	T	187;187;53;9;53;44	ENSP00000356169:A187T;ENSP00000356170:A187T;ENSP00000356166:A9T;ENSP00000405497:A53T;ENSP00000398091:A44T	ENSP00000356166:A9T	A	-	1	0	ETNK2	202382475	0.999000	0.42202	0.973000	0.42090	0.998000	0.95712	2.541000	0.45735	0.809000	0.34255	0.655000	0.94253	GCC		0.502	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087893.1	NM_018208		Missense_Mutation
TRAF3IP3	80342	genome.wustl.edu	37	1	209948835	209948835	+	Splice_Site	SNP	G	G	T			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr1:209948835G>T	ENST00000367024.1	+	10	1431		c.e10+1		TRAF3IP3_ENST00000477431.1_Splice_Site|TRAF3IP3_ENST00000400959.3_Splice_Site|TRAF3IP3_ENST00000367023.1_Splice_Site|TRAF3IP3_ENST00000367026.3_Splice_Site|TRAF3IP3_ENST00000367025.3_Splice_Site|TRAF3IP3_ENST00000010338.4_Splice_Site			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3							integral component of membrane (GO:0016021)		p.?(1)		breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GAGCACACAGGTATGGGGATG	0.552																																																1	Unknown(1)	ovary(1)	1											89.0	94.0	92.0					1																	209948835		2203	4300	6503	208015458	SO:0001630	splice_region_variant	80342				CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.915+1G>T	1.37:g.209948835G>T		Somatic		Capture	Illumina GAIIx	4	208015458	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Splice_Site_SNP	SNP	ENST00000367024.1	37	CCDS1490.2	SNP	44	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.50|13.50	2.256316|2.256316	0.39896|0.39896	.|.	.|.	ENSG00000009790|ENSG00000009790	ENST00000400959;ENST00000367025;ENST00000367026;ENST00000367024;ENST00000010338;ENST00000367023;ENST00000487271;ENST00000477431|ENST00000458110	.|.	.|.	.|.	5.04|5.04	4.13|4.13	0.48395|0.48395	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63271	.|0.2497	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61242	.|-0.7102	.|4	.|.	.|.	.|.	.|.	12.2935|12.2935	0.54831|0.54831	0.0831:0.0:0.9168:0.0|0.0831:0.0:0.9168:0.0	.|.	.|.	.|.	.|.	.|L	-1|289	.|.	.|.	.|V	+|+	.|1	.|0	TRAF3IP3|TRAF3IP3	208015458|208015458	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.619000|0.619000	0.37552|0.37552	6.032000|6.032000	0.70918|0.70918	1.124000|1.124000	0.41980|0.41980	0.563000|0.563000	0.77884|0.77884	.|GTA		0.552	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		Intron	Splice_Site_SNP
ILKAP	80895	genome.wustl.edu	37	2	239092348	239092348	+	Silent	SNP	C	C	T	rs150186666		TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr2:239092348C>T	ENST00000254654.3	-	8	835	c.660G>A	c.(658-660)acG>acA	p.T220T		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	220	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.T220T(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		CCAGAACACACGTGGCAGTGG	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		20211	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2											62.0	57.0	59.0					2																	239092348		2203	4300	6503	238757087	SO:0001819	synonymous_variant	80895			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.660G>A	2.37:g.239092348C>T		Somatic		Capture	Illumina GAIIx	4	238757087	B3KM39	Silent	SNP	ENST00000254654.3	37	CCDS2526.1	SNP	19	WashU																																																																																				0.488	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768		Silent
E2F5	1875	genome.wustl.edu	37	8	86125997	86125997	+	Missense_Mutation	SNP	T	T	A			TCGA-09-0369-01	TCGA-09-0369-10	T	T	A	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr8:86125997T>A	ENST00000416274.2	+	8	975	c.941T>A	c.(940-942)cTc>cAc	p.L314H	E2F5_ENST00000418930.2_Missense_Mutation_p.L313H|E2F5_ENST00000517476.1_Missense_Mutation_p.L153H|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000521429.1_Missense_Mutation_p.L141H|E2F5_ENST00000256117.5_Missense_Mutation_p.L315H	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	314	Transactivation. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L314H(1)		NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						GTGTTTCCTCTCTTAAGGCTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	8											128.0	115.0	119.0					8																	86125997		1830	4091	5921	86313249	SO:0001583	missense	1875			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.941T>A	8.37:g.86125997T>A	ENSP00000398124:p.Leu314His	Somatic		Capture	Illumina GAIIx	Phase_III	86313249	E9PBN9|Q16601|Q92756	Missense_Mutation	SNP	ENST00000416274.2	37	CCDS47885.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628508	0.67015	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274;ENST00000517476;ENST00000521429;ENST00000518234	D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	5.43	4.26	0.50523	.	0.134314	0.48286	D	0.000191	D	0.90549	0.7038	M	0.72894	2.215	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.977;0.995;0.98	D	0.91180	0.4975	10	0.72032	D	0.01	-11.3872	11.5324	0.50618	0.0:0.0717:0.0:0.9283	.	141;313;314	E5RHD4;Q15329-2;Q15329	.;.;E2F5_HUMAN	H	313;315;314;153;141;150	ENSP00000414312:L313H;ENSP00000256117:L315H;ENSP00000398124:L314H;ENSP00000429120:L153H;ENSP00000428606:L141H;ENSP00000429669:L150H	ENSP00000256117:L315H	L	+	2	0	E2F5	86313249	1.000000	0.71417	0.904000	0.35570	0.984000	0.73092	2.760000	0.47581	2.063000	0.61619	0.533000	0.62120	CTC		0.333	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951		Missense_Mutation
AMER1	139285	genome.wustl.edu	37	X	63410536	63410536	+	Silent	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chrX:63410536G>A	ENST00000330258.3	-	2	2903	c.2631C>T	c.(2629-2631)ggC>ggT	p.G877G	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	877					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									GAGGGTGCAGGCCAGGCAGTC	0.572																																																67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	X											43.0	45.0	44.0					X																	63410536		2111	4205	6316	63327261	SO:0001819	synonymous_variant	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2631C>T	X.37:g.63410536G>A		Somatic		Capture	Illumina GAIIx	Phase_III	63327261	A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	CCDS14377.2	SNP	42	WashU																																																																																				0.572	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		Silent
ATG2A	23130	genome.wustl.edu	37	11	64679721	64679721	+	Splice_Site	SNP	T	T	A			TCGA-09-0369-01	TCGA-09-0369-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr11:64679721T>A	ENST00000377264.3	-	8	1035	c.923A>T	c.(922-924)gAc>gTc	p.D308V	ATG2A_ENST00000421419.2_Splice_Site_p.D308V	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	308					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)		p.D308V(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCCCTCGTGGTCTGCAGGGGA	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											48.0	53.0	51.0					11																	64679721		2201	4297	6498	64436297	SO:0001630	splice_region_variant	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.923-1A>T	11.37:g.64679721T>A		Somatic		Capture	Illumina GAIIx	PhaseIII	64436297	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	SNP	58	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.13|12.13	1.845916|1.845916	0.32606|0.32606	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377264;ENST00000227459|ENST00000418259	T;T|.	0.08370|.	3.1;3.1|.	3.97|3.97	2.79|2.79	0.32731|0.32731	.|.	0.460130|.	0.22687|.	N|.	0.056868|.	T|T	0.51041|0.51041	0.1651|0.1651	L|L	0.39898|0.39898	1.24|1.24	0.45946|0.45946	D|D	0.998777|0.998777	B|.	0.27498|.	0.18|.	B|.	0.19391|.	0.025|.	T|T	0.36915|0.36915	-0.9728|-0.9728	10|5	0.59425|.	D|.	0.04|.	.|.	7.346|7.346	0.26664|0.26664	0.0:0.0:0.224:0.776|0.0:0.0:0.224:0.776	.|.	308|.	Q2TAZ0|.	ATG2A_HUMAN|.	V|S	308|109	ENSP00000410522:D308V;ENSP00000366475:D308V|.	ENSP00000227459:D308V|.	D|R	-|-	2|3	0|2	ATG2A|ATG2A	64436297|64436297	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.028000|0.028000	0.11728|0.11728	2.777000|2.777000	0.47717|0.47717	0.665000|0.665000	0.31066|0.31066	0.459000|0.459000	0.35465|0.35465	GAC|AGA		0.667	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	Missense_Mutation	Missense_Mutation
MFGE8	4240	genome.wustl.edu	37	15	89450599	89450599	+	Missense_Mutation	SNP	C	C	G			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr15:89450599C>G	ENST00000566497.1	-	3	275	c.214G>C	c.(214-216)Gag>Cag	p.E72Q	MFGE8_ENST00000268151.7_Missense_Mutation_p.E72Q|MFGE8_ENST00000542878.1_Missense_Mutation_p.E28Q|MFGE8_ENST00000559997.1_5'UTR|MFGE8_ENST00000268150.8_Missense_Mutation_p.E72Q|MFGE8_ENST00000539437.1_Missense_Mutation_p.E64Q			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	72	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)	p.E72Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CCCAGTGGCTCGACACATTCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											95.0	71.0	79.0					15																	89450599		2200	4299	6499	87251603	SO:0001583	missense	4240			U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.214G>C	15.37:g.89450599C>G	ENSP00000456281:p.Glu72Gln	Somatic		Capture	Illumina GAIIx	PhaseIII	87251603	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	ENST00000566497.1	37	CCDS10347.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	9.179	1.023036	0.19433	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437;ENST00000542878	D;D;D;D	0.97303	-4.33;-4.33;-4.33;-1.64	5.32	1.55	0.23275	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.903251	0.09933	N	0.736947	D	0.92021	0.7472	N	0.17379	0.485	0.09310	N	1	P;P;P;P;P;P	0.39665	0.521;0.682;0.521;0.501;0.653;0.521	B;B;B;B;B;B	0.43623	0.244;0.359;0.244;0.425;0.425;0.244	D	0.85534	0.1211	10	0.14252	T	0.57	-5.2285	4.4457	0.11597	0.1452:0.2604:0.0:0.5944	.	64;28;28;64;72;72	B3KTQ2;F5GZN3;B4E396;F5H7N9;Q08431-3;Q08431	.;.;.;.;.;MFGM_HUMAN	Q	72;72;64;28	ENSP00000268150:E72Q;ENSP00000268151:E72Q;ENSP00000442386:E64Q;ENSP00000444332:E28Q	ENSP00000268150:E72Q	E	-	1	0	MFGE8	87251603	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.231000	0.17872	0.268000	0.21939	0.462000	0.41574	GAG		0.592	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000432804.1	NM_005928		Missense_Mutation
GPR62	118442	genome.wustl.edu	37	3	51990611	51990611	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr3:51990611G>A	ENST00000322241.4	+	1	1282	c.943G>A	c.(943-945)Gcc>Acc	p.A315T		NM_080865.3	NP_543141.3	Q9BZJ7	GPR62_HUMAN	G protein-coupled receptor 62	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.A315T(1)		endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACCTGTGCGGGCCTGCACTCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	3											11.0	13.0	13.0					3																	51990611		2166	4240	6406	51965651	SO:0001583	missense	118442			AF317653	CCDS2838.1	3p21.1	2012-08-21			ENSG00000180929	ENSG00000180929		"""GPCR / Class A : Orphans"""	13301	protein-coding gene	gene with protein product		606917				11165367	Standard	NM_080865		Approved		uc003dca.4	Q9BZJ7	OTTHUMG00000157367	ENST00000322241.4:c.943G>A	3.37:g.51990611G>A	ENSP00000319250:p.Ala315Thr	Somatic		Capture	Illumina GAIIx	PhaseIII	51965651	F1DAM4|Q5KU27	Missense_Mutation	SNP	ENST00000322241.4	37	CCDS2838.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457745	0.43634	.	.	ENSG00000180929	ENST00000322241	T	0.03035	4.07	4.03	-4.15	0.03881	.	1.013190	0.07966	N	0.983182	T	0.02047	0.0064	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49273	-0.8957	10	0.10111	T	0.7	-8.9647	2.1897	0.03895	0.5007:0.1343:0.2288:0.1361	.	315	Q9BZJ7	GPR62_HUMAN	T	315	ENSP00000319250:A315T	ENSP00000319250:A315T	A	+	1	0	GPR62	51965651	0.000000	0.05858	0.022000	0.16811	0.464000	0.32679	-1.288000	0.02783	-0.624000	0.05611	0.561000	0.74099	GCC		0.701	GPR62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348611.1			Missense_Mutation
PCDHA2	56146	genome.wustl.edu	37	5	140176419	140176419	+	Missense_Mutation	SNP	G	G	A			TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr5:140176419G>A	ENST00000526136.1	+	1	1870	c.1870G>A	c.(1870-1872)Gtg>Atg	p.V624M	PCDHA2_ENST00000520672.2_Missense_Mutation_p.V624M|PCDHA2_ENST00000378132.1_Missense_Mutation_p.V624M|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V624M(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGTTCCGCGTGGGGCTATA	0.642																																																1	Substitution - Missense(1)	ovary(1)	5											107.0	103.0	104.0					5																	140176419		2203	4300	6503	140156603	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1870G>A	5.37:g.140176419G>A	ENSP00000431748:p.Val624Met	Somatic		Capture	Illumina GAIIx	PhaseIII	140156603	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	g	9.918	1.211258	0.22289	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.59502	0.26;0.26;0.26	3.91	3.01	0.34805	Cadherin (4);Cadherin-like (1);	0.277827	0.19309	U	0.117456	T	0.72590	0.3479	M	0.80746	2.51	0.25662	N	0.985997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.98;0.989;0.98	T	0.60984	-0.7154	10	0.87932	D	0	.	7.9432	0.29971	0.1881:0.0:0.8119:0.0	.	624;624;624	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	M	624	ENSP00000430584:V624M;ENSP00000367372:V624M;ENSP00000431748:V624M	ENSP00000367372:V624M	V	+	1	0	PCDHA2	140156603	0.038000	0.19896	1.000000	0.80357	0.157000	0.22087	0.214000	0.17541	1.917000	0.55516	0.549000	0.68633	GTG		0.642	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		Missense_Mutation
PHKG1	5260	genome.wustl.edu	37	7	56147289	56147289	+	IGR	SNP	C	C	T			TCGA-09-0369-01	TCGA-09-0369-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr7:56147289C>T	ENST00000297373.2	-	0	1431				SUMF2_ENST00000275607.9_Missense_Mutation_p.P209L|SUMF2_ENST00000342190.6_Missense_Mutation_p.R268C|SUMF2_ENST00000437307.2_Missense_Mutation_p.P228L|SUMF2_ENST00000395435.2_Missense_Mutation_p.P232L|SUMF2_ENST00000395436.2_Missense_Mutation_p.P301L|SUMF2_ENST00000413756.1_Silent_p.A336A|SUMF2_ENST00000434526.2_Missense_Mutation_p.P316L	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)	p.P297L(1)		endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCAGGCCGGCCGCCAGGGGAG	0.587											OREG0018082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(184;580 2064 5329 24177 35303)											1	Substitution - Missense(1)	ovary(1)	7											84.0	88.0	87.0					7																	56147289		2203	4300	6503	56114783	SO:0001628	intergenic_variant	25870			X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869		7.37:g.56147289C>T		Somatic	1013	Capture	Illumina GAIIx	PhaseIII	56114783	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	ENST00000297373.2	37	CCDS5525.1	SNP	23	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.952|6.952	0.545499|0.545499	0.13312|0.13312	.|.	.|.	ENSG00000129103|ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000395435;ENST00000437307|ENST00000342190	D;D;D;D;D|D	0.97665|0.91631	-3.53;-3.55;-4.48;-2.91;-3.05|-2.88	4.47|4.47	-2.39|-2.39	0.06602|0.06602	.|.	.|0.954894	.|0.08770	.|N	.|0.896477	T|T	0.82222|0.82222	0.4990|0.4990	N|N	0.05383|0.05383	-0.06|-0.06	0.09310|0.09310	N|N	1|1	B;B;B;B|B;B	0.16396|0.09022	0.009;0.007;0.017;0.004|0.0;0.002	B;B;B;B|B;B	0.09377|0.04013	0.004;0.002;0.003;0.001|0.0;0.001	T|T	0.65590|0.65590	-0.6131|-0.6131	9|10	0.39692|0.56958	T|D	0.17|0.05	-21.1102|-21.1102	11.2584|11.2584	0.49067|0.49067	0.0:0.5238:0.0:0.4762|0.0:0.5238:0.0:0.4762	.|.	213;301;319;297|231;268	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7|Q8NBJ7-4;F8WA42	.;.;.;SUMF2_HUMAN|.;.	L|C	301;316;209;232;228|268	ENSP00000378824:P301L;ENSP00000400922:P316L;ENSP00000275607:P209L;ENSP00000378823:P232L;ENSP00000415989:P228L|ENSP00000341938:R268C	ENSP00000275607:P209L|ENSP00000341938:R268C	P|R	+|+	2|1	0|0	SUMF2|SUMF2	56114783|56114783	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.228000|-0.228000	0.09114|0.09114	-1.019000|-1.019000	0.03358|0.03358	-1.598000|-1.598000	0.00824|0.00824	CCG|CGC		0.587	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251587.1	NM_006213		Missense_Mutation
VAV2	7410	genome.wustl.edu	37	9	136726544	136726544	+	Missense_Mutation	SNP	G	G	A	rs199806132	byFrequency	TCGA-09-0369-01	TCGA-09-0369-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-09-0369-01	TCGA-09-0369-10	g.chr9:136726544G>A	ENST00000371850.3	-	3	363	c.332C>T	c.(331-333)gCg>gTg	p.A111V	VAV2_ENST00000486113.1_5'UTR|VAV2_ENST00000371851.1_Missense_Mutation_p.A111V|VAV2_ENST00000406606.3_Missense_Mutation_p.A111V	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	111	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A111V(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		CCTCGACACCGCGGAGATGAC	0.577													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17459	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											66.0	62.0	63.0					9																	136726544		2203	4300	6503	135716365	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.332C>T	9.37:g.136726544G>A	ENSP00000360916:p.Ala111Val	Somatic		Capture	Illumina GAIIx	PhaseIII	135716365	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	CCDS48053.1	SNP	38	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.65	1.700816	0.30142	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.43688	0.94;0.94;0.94	4.82	3.91	0.45181	Calponin homology domain (5);	0.000000	0.64402	D	0.000002	T	0.31638	0.0803	L	0.27053	0.805	0.20074	N	0.999932	P;P	0.48764	0.915;0.891	B;B	0.43508	0.222;0.422	T	0.11966	-1.0566	10	0.52906	T	0.07	.	10.6621	0.45708	0.0:0.0:0.8081:0.1919	.	111;111	P52735;P52735-3	VAV2_HUMAN;.	V	111	ENSP00000360916:A111V;ENSP00000360917:A111V;ENSP00000385362:A111V	ENSP00000317258:A111V	A	-	2	0	VAV2	135716365	0.973000	0.33851	0.231000	0.23993	0.206000	0.24218	5.681000	0.68175	1.136000	0.42199	0.655000	0.94253	GCG		0.577	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			Missense_Mutation
