#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCG1	9619	hgsc.bcm.edu	37	21	43708395	43708395	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr21:43708395G>T	ENST00000361802.2	+	10	1378	c.1233G>T	c.(1231-1233)agG>agT	p.R411S	ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Missense_Mutation_p.R401S|ABCG1_ENST00000347800.2_Missense_Mutation_p.R396S|ABCG1_ENST00000398449.3_Missense_Mutation_p.R399S|ABCG1_ENST00000398437.1_Missense_Mutation_p.R557S|ABCG1_ENST00000340588.4_Missense_Mutation_p.R519S|ABCG1_ENST00000343687.3_Missense_Mutation_p.R410S	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	411					amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)	p.R411S(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	TCTTCAAGAGGACCTTCCTCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	21											86.0	71.0	76.0					21																	43708395		2203	4300	6503	42581464	SO:0001583	missense	9619			U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1233G>T	21.37:g.43708395G>T	ENSP00000354995:p.Arg411Ser	Somatic		Capture	SOLID	Phase_III	42581464	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	SNP	41	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.71|18.71	3.681890|3.681890	0.68042|0.68042	.|.	.|.	ENSG00000160179|ENSG00000160179	ENST00000489035;ENST00000469119;ENST00000482161|ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588	.|T;T;T;T;T;T;T	.|0.81163	.|-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	4.18|4.18	1.26|1.26	0.21427|0.21427	.|ABC-2 type transporter (1);	.|0.115669	.|0.53938	.|D	.|0.000044	D|D	0.89294|0.89294	0.6674|0.6674	M|M	0.90922|0.90922	3.16|3.16	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D;P;D;D;D	.|0.64830	.|0.994;0.986;0.809;0.986;0.986;0.989	.|D;D;P;D;D;D	.|0.72625	.|0.934;0.923;0.633;0.952;0.923;0.978	D|D	0.86954|0.86954	0.2087|0.2087	5|9	.|.	.|.	.|.	-17.2791|-17.2791	7.7356|7.7356	0.28812|0.28812	0.5237:0.0:0.4763:0.0|0.5237:0.0:0.4763:0.0	.|.	.|422;410;411;399;396;401	.|B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3	.|.;.;ABCG1_HUMAN;.;.;.	Y|S	147;135;135|401;396;399;411;410;557;519	.|ENSP00000381475:R401S;ENSP00000291524:R396S;ENSP00000381467:R399S;ENSP00000354995:R411S;ENSP00000339744:R410S;ENSP00000381464:R557S;ENSP00000343820:R519S	.|.	D|R	+|+	1|3	0|2	ABCG1|ABCG1	42581464|42581464	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.996000|0.996000	0.88848|0.88848	1.196000|1.196000	0.32198|0.32198	0.032000|0.032000	0.15435|0.15435	0.460000|0.460000	0.39030|0.39030	GAC|AGG		0.582	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174		Missense_Mutation
ACACB	32	hgsc.bcm.edu	37	12	109623408	109623408	+	Missense_Mutation	SNP	C	C	T	rs145713657	byFrequency	TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr12:109623408C>T	ENST00000338432.7	+	12	1962	c.1843C>T	c.(1843-1845)Cgg>Tgg	p.R615W	ACACB_ENST00000377848.3_Missense_Mutation_p.R615W|ACACB_ENST00000377854.5_Missense_Mutation_p.R615W			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	615	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.R615W(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GCCACTGCACCGGCTGAAGGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	12						C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	74.0	64.0	67.0		1843	1.8	1.0	12	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ACACB	NM_001093.3	101	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	615/2459	109623408	3,13003	2203	4300	6503	108107791	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1843C>T	12.37:g.109623408C>T	ENSP00000341044:p.Arg615Trp	Somatic		Capture	SOLID	Phase_III	108107791	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	c	19.17	3.775682	0.70107	4.54E-4	1.16E-4	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.97831	-4.56;-4.56;-4.56	5.32	1.78	0.24846	ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.98661	0.9551	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99414	1.0931	10	0.87932	D	0	.	13.6894	0.62535	0.5445:0.4555:0.0:0.0	.	615	O00763	ACACB_HUMAN	W	615	ENSP00000341044:R615W;ENSP00000367079:R615W;ENSP00000367085:R615W	ENSP00000341044:R615W	R	+	1	2	ACACB	108107791	0.999000	0.42202	1.000000	0.80357	0.899000	0.52679	0.761000	0.26489	0.658000	0.30925	0.556000	0.70494	CGG		0.562	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		Missense_Mutation
ARMCX2	9823	hgsc.bcm.edu	37	X	100912313	100912313	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chrX:100912313A>C	ENST00000328766.5	-	5	715	c.262T>G	c.(262-264)Tct>Gct	p.S88A	ARMCX2_ENST00000356824.4_Missense_Mutation_p.S88A|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Missense_Mutation_p.S88A	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	88	Ala-rich.					integral component of membrane (GO:0016021)		p.S88A(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TCCAGAGCAGAGGCTTCATCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	X											51.0	47.0	48.0					X																	100912313		2203	4300	6503	100798969	SO:0001583	missense	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.262T>G	X.37:g.100912313A>C	ENSP00000331662:p.Ser88Ala	Somatic		Capture	SOLID	Phase_III	100798969	O60267|Q5H9D9	Missense_Mutation	SNP	ENST00000328766.5	37	CCDS14490.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.30	1.598886	0.28445	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824;ENST00000413506;ENST00000433318;ENST00000440675;ENST00000458024	T;T;T;T;T	0.47528	1.36;1.36;1.36;0.84;0.84	4.54	1.86	0.25419	.	0.000000	0.35525	N	0.003156	T	0.31544	0.0800	L	0.44542	1.39	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.19549	-1.0302	10	0.09590	T	0.72	-11.0854	7.2838	0.26326	0.6467:0.0:0.0:0.3533	.	88	Q7L311	ARMX2_HUMAN	A	88	ENSP00000331662:S88A;ENSP00000328631:S88A;ENSP00000349281:S88A;ENSP00000412481:S88A;ENSP00000410151:S88A	ENSP00000331662:S88A	S	-	1	0	ARMCX2	100798969	0.012000	0.17670	0.041000	0.18516	0.041000	0.13682	0.651000	0.24873	0.640000	0.30582	0.441000	0.28932	TCT		0.622	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		Missense_Mutation
CACNG3	10368	hgsc.bcm.edu	37	16	24358116	24358116	+	Silent	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr16:24358116G>A	ENST00000005284.3	+	2	1475	c.273G>A	c.(271-273)caG>caA	p.Q91Q		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	91					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.Q91Q(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ACTACGAACAGGACACAGCCG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	16											85.0	77.0	80.0					16																	24358116		2197	4300	6497	24265617	SO:0001819	synonymous_variant	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.273G>A	16.37:g.24358116G>A		Somatic		Capture	SOLID	Phase_III	24265617		Silent	SNP	ENST00000005284.3	37	CCDS10620.1	SNP	35	Baylor																																																																																				0.567	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539		Silent
CASKIN2	57513	hgsc.bcm.edu	37	17	73501687	73501687	+	Missense_Mutation	SNP	T	T	G			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr17:73501687T>G	ENST00000321617.3	-	10	1467	c.881A>C	c.(880-882)aAc>aCc	p.N294T	CASKIN2_ENST00000581870.1_Missense_Mutation_p.N294T|CASKIN2_ENST00000433559.2_Missense_Mutation_p.N212T	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	294	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATCGTGGAGGTTCCAGAAATC	0.542																																																0			17											120.0	125.0	123.0					17																	73501687		2203	4300	6503	71013282	SO:0001583	missense	57513			AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.881A>C	17.37:g.73501687T>G	ENSP00000325355:p.Asn294Thr	Somatic		Capture	SOLID	Phase_III	71013282	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Missense_Mutation	SNP	ENST00000321617.3	37	CCDS11723.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	35	5.455001	0.96223	.	.	ENSG00000177303	ENST00000321617;ENST00000433559	T;T	0.08807	3.05;3.05	5.38	5.38	0.77491	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.49305	D	0.000143	T	0.17323	0.0416	N	0.20986	0.625	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.981;0.999	T	0.04885	-1.0920	10	0.41790	T	0.15	.	15.6702	0.77267	0.0:0.0:0.0:1.0	.	212;294	Q8WXE0-2;Q8WXE0	.;CSKI2_HUMAN	T	294;212	ENSP00000325355:N294T;ENSP00000406963:N212T	ENSP00000325355:N294T	N	-	2	0	CASKIN2	71013282	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.206000	0.72154	2.170000	0.68504	0.459000	0.35465	AAC		0.542	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447609.1	NM_020753		Missense_Mutation
CES5A	221223	hgsc.bcm.edu	37	16	55880571	55880571	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr16:55880571G>A	ENST00000290567.9	-	13	1641	c.1520C>T	c.(1519-1521)tCt>tTt	p.S507F	CES5A_ENST00000521992.1_Missense_Mutation_p.S536F|CES5A_ENST00000518005.1_Missense_Mutation_p.S401F|CES5A_ENST00000319165.9_Missense_Mutation_p.S457F|CES5A_ENST00000520435.1_Missense_Mutation_p.S477F|CES5A_ENST00000541580.1_5'UTR	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	507						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.S536Y(1)|p.S457Y(1)|p.S457F(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TGGCCACAGAGACAGGTCGTT	0.547																																																3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	16											172.0	174.0	173.0					16																	55880571		2198	4300	6498	54438072	SO:0001583	missense	221223			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1520C>T	16.37:g.55880571G>A	ENSP00000290567:p.Ser507Phe	Somatic		Capture	SOLID	Phase_III	54438072	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	.	10.47	1.358338	0.24598	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	T;T;T;T;T	0.07688	3.17;3.17;3.17;3.17;3.17	5.51	4.34	0.51931	Carboxylesterase, type B (1);	0.161766	0.29660	N	0.011523	T	0.04452	0.0122	N	0.12746	0.255	0.23192	N	0.998141	B;B	0.33073	0.0;0.396	B;B	0.31245	0.002;0.126	T	0.29181	-1.0020	10	0.66056	D	0.02	.	5.7829	0.18316	0.2254:0.0:0.7746:0.0	.	507;457	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	F	536;457;401;507;477;287	ENSP00000428864:S536F;ENSP00000324271:S457F;ENSP00000428571:S401F;ENSP00000290567:S507F;ENSP00000428887:S477F	ENSP00000290567:S507F	S	-	2	0	CES5A	54438072	0.977000	0.34250	0.847000	0.33407	0.073000	0.16967	2.197000	0.42696	2.741000	0.93983	0.655000	0.94253	TCT		0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024		Missense_Mutation
CHML	1122	hgsc.bcm.edu	37	1	241797187	241797187	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr1:241797187G>A	ENST00000366553.1	-	1	2045	c.1882C>T	c.(1882-1884)Cct>Tct	p.P628S	OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	628					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.P628S(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TTGGTTCCAGGAGCCTCTGGC	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											148.0	155.0	152.0					1																	241797187		2203	4299	6502	239863810	SO:0001583	missense	1122			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1882C>T	1.37:g.241797187G>A	ENSP00000355511:p.Pro628Ser	Somatic		Capture	SOLID	Phase_III	239863810	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.280	-0.986950	0.02180	.	.	ENSG00000203668	ENST00000366553	D	0.87729	-2.29	4.55	-2.9	0.05648	.	1.182510	0.06378	N	0.714704	T	0.66799	0.2826	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.11329	0.006	T	0.59408	-0.7460	9	0.02654	T	1	0.241	6.4577	0.21938	0.5583:0.0:0.3099:0.1318	.	628	P26374	RAE2_HUMAN	S	628	ENSP00000355511:P628S	ENSP00000355511:P628S	P	-	1	0	CHML	239863810	0.001000	0.12720	0.016000	0.15963	0.125000	0.20455	-0.591000	0.05753	-0.566000	0.06054	-0.122000	0.15005	CCT		0.418	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821		Missense_Mutation
COL6A3	1293	hgsc.bcm.edu	37	2	238266004	238266004	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:238266004C>T	ENST00000295550.4	-	23	7020	c.6568G>A	c.(6568-6570)Gga>Aga	p.G2190R	COL6A3_ENST00000409809.1_Missense_Mutation_p.G1984R|COL6A3_ENST00000353578.4_Missense_Mutation_p.G1984R|COL6A3_ENST00000346358.4_Missense_Mutation_p.G1990R|COL6A3_ENST00000347401.3_Missense_Mutation_p.G1989R|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1583R	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2190	Collagen-like 3.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G2190R(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCTCCAGGTCCTCCAGGTACT	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											251.0	246.0	248.0					2																	238266004		2203	4300	6503	237930743	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6568G>A	2.37:g.238266004C>T	ENSP00000295550:p.Gly2190Arg	Somatic		Capture	SOLID	Phase_III	237930743	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.732	1.162444	0.21538	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15;-5.15	5.04	-1.51	0.08664	.	1.051440	0.07491	N	0.905552	D	0.93680	0.7981	N	0.16656	0.425	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	D	0.87923	0.2705	10	0.18276	T	0.48	.	2.2573	0.04058	0.1379:0.4244:0.1391:0.2987	.	1583;1984;2190	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	R	2190;1989;1984;1583;1984;1990	ENSP00000295550:G2190R;ENSP00000315609:G1989R;ENSP00000315873:G1984R;ENSP00000418285:G1583R;ENSP00000386844:G1984R;ENSP00000295546:G1990R	ENSP00000295550:G2190R	G	-	1	0	COL6A3	237930743	0.000000	0.05858	0.002000	0.10522	0.937000	0.57800	-1.011000	0.03652	-0.283000	0.09115	-0.423000	0.05987	GGA		0.502	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Missense_Mutation
CRP	1401	hgsc.bcm.edu	37	1	159683683	159683683	+	Missense_Mutation	SNP	C	C	T	rs146258487	byFrequency	TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr1:159683683C>T	ENST00000255030.5	-	2	410	c.307G>A	c.(307-309)Gag>Aag	p.E103K	CRP_ENST00000368110.1_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000368111.1_Intron|CRP_ENST00000343919.2_Intron|CRP_ENST00000473196.1_5'Flank|CRP_ENST00000437342.1_5'UTR	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	103	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)	p.E103K(1)		breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	TCAGGAACCTCGAATAATATT	0.463													C|||	5	0.000998403	0.0038	0.0	5008	,	,		19332	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						C	LYS/GLU	4,4402	8.1+/-20.4	0,4,2199	110.0	109.0	109.0		307	-9.5	0.0	1	dbSNP_134	109	0,8600		0,0,4300	yes	missense	CRP	NM_000567.2	56	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	103/225	159683683	4,13002	2203	4300	6503	157950307	SO:0001583	missense	1401			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.307G>A	1.37:g.159683683C>T	ENSP00000255030:p.Glu103Lys	Somatic		Capture	SOLID	Phase_III	157950307	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Missense_Mutation	SNP	ENST00000255030.5	37	CCDS30911.1	SNP	31	Baylor	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	1.205	-0.631264	0.03584	9.08E-4	0.0	ENSG00000132693	ENST00000255030	T	0.58210	0.35	4.73	-9.47	0.00594	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	1.320080	0.04710	N	0.417432	T	0.02688	0.0081	N	0.00483	-1.445	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.03025	-1.1081	10	0.02654	T	1	1.5928	3.2907	0.06948	0.083:0.2218:0.232:0.4631	.	103	P02741	CRP_HUMAN	K	103	ENSP00000255030:E103K	ENSP00000255030:E103K	E	-	1	0	CRP	157950307	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.307000	0.08167	-1.960000	0.01017	-1.608000	0.00805	GAG		0.463	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085553.1	NM_000567		Missense_Mutation
DCTN1	1639	hgsc.bcm.edu	37	2	74596555	74596555	+	Silent	SNP	G	G	T			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:74596555G>T	ENST00000361874.3	-	14	1773	c.1456C>A	c.(1456-1458)Cgg>Agg	p.R486R	DCTN1_ENST00000394003.3_Silent_p.R479R|DCTN1_ENST00000407639.2_Silent_p.R352R|DCTN1_ENST00000409438.1_Silent_p.R352R|DCTN1_ENST00000409567.3_Silent_p.R466R|DCTN1_ENST00000409240.1_Silent_p.R449R|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409868.1_Silent_p.R469R	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	486					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.R486R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						AGCTGCTCCCGCAGCTCCAGT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	2											87.0	89.0	88.0					2																	74596555		2203	4300	6503	74450063	SO:0001819	synonymous_variant	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1456C>A	2.37:g.74596555G>T		Somatic		Capture	SOLID	Phase_III	74450063	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Silent	SNP	ENST00000361874.3	37	CCDS1939.1	SNP	38	Baylor																																																																																				0.572	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082		Silent
DDIT3	1649	hgsc.bcm.edu	37	12	57910759	57910759	+	Missense_Mutation	SNP	C	C	T	rs536093041		TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr12:57910759C>T	ENST00000346473.3	-	4	522	c.343G>A	c.(343-345)Gct>Act	p.A115T	DDIT3_ENST00000547303.1_Missense_Mutation_p.A115T|MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000551116.1_Missense_Mutation_p.A138T|RN7SL312P_ENST00000582079.1_RNA|DDIT3_ENST00000552740.1_Missense_Mutation_p.A138T	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	115	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.		A -> V (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A115T(1)	EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						TGCTTTCCAGCCCGGGCTGGG	0.542			T	FUS	liposarcoma																																GBM(112;1383 1547 7626 23045 28770)		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	1	Substitution - Missense(1)	ovary(1)	12											140.0	149.0	146.0					12																	57910759		2203	4300	6503	56197026	SO:0001583	missense	1649			BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.343G>A	12.37:g.57910759C>T	ENSP00000340671:p.Ala115Thr	Somatic		Capture	SOLID	Phase_III	56197026	F8VS99	Missense_Mutation	SNP	ENST00000346473.3	37	CCDS8943.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.56	2.573052	0.45902	.	.	ENSG00000175197	ENST00000547303;ENST00000551116;ENST00000346473;ENST00000552740;ENST00000547526	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.75	3.92	0.45320	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.255981	0.37809	N	0.001921	T	0.23965	0.0580	N	0.08118	0	0.27274	N	0.958282	B;B	0.13145	0.007;0.001	B;B	0.14578	0.011;0.002	T	0.18681	-1.0329	10	0.59425	D	0.04	-0.0817	11.2751	0.49161	0.0:0.8022:0.1274:0.0704	.	138;115	F8VS99;P35638	.;DDIT3_HUMAN	T	115;138;115;138;138	ENSP00000447188:A115T;ENSP00000448665:A138T;ENSP00000340671:A115T;ENSP00000447803:A138T	ENSP00000340671:A115T	A	-	1	0	DDIT3	56197026	0.943000	0.32029	1.000000	0.80357	0.780000	0.44128	0.720000	0.25896	0.894000	0.36317	0.655000	0.94253	GCT		0.542	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083		Missense_Mutation
DDR1	780	hgsc.bcm.edu	37	6	30856768	30856768	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr6:30856768A>G	ENST00000324771.8	+	5	717	c.169A>G	c.(169-171)Act>Gct	p.T57A	DDR1_ENST00000376567.2_Missense_Mutation_p.T57A|DDR1_ENST00000452441.1_Missense_Mutation_p.T57A|DDR1_ENST00000418800.2_Missense_Mutation_p.T57A|DDR1_ENST00000376569.3_Missense_Mutation_p.T57A|DDR1_ENST00000454612.2_Missense_Mutation_p.T57A|DDR1_ENST00000513240.1_Missense_Mutation_p.T57A|MIR4640_ENST00000581824.1_RNA|DDR1_ENST00000508312.1_Missense_Mutation_p.T75A|DDR1_ENST00000376575.3_Missense_Mutation_p.T57A|DDR1_ENST00000376568.3_Missense_Mutation_p.T57A|DDR1_ENST00000376570.4_Missense_Mutation_p.T57A|DDR1_ENST00000446312.1_Missense_Mutation_p.T57A|DDR1_ENST00000361741.4_5'Flank			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	57	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T57A(1)		central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	GTCAGATTCCACTGCCGCCCG	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											57.0	44.0	48.0					6																	30856768		1509	2708	4217	30964747	SO:0001583	missense	780			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.169A>G	6.37:g.30856768A>G	ENSP00000318217:p.Thr57Ala	Somatic		Capture	SOLID	Phase_III	30964747	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.78	3.696397	0.68386	.	.	ENSG00000204580	ENST00000505066;ENST00000460944;ENST00000324771;ENST00000505534;ENST00000508317;ENST00000418800;ENST00000509639;ENST00000412274;ENST00000507901;ENST00000454612;ENST00000507046;ENST00000437124;ENST00000396342;ENST00000504651;ENST00000512694;ENST00000515233;ENST00000515881;ENST00000376569;ENST00000511510;ENST00000376575;ENST00000376570;ENST00000446312;ENST00000504927;ENST00000428153;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000512336;ENST00000421124;ENST00000512725;ENST00000504679;ENST00000503495;ENST00000376567;ENST00000513240	D;D;D;D;D;D;D;T;D;D;T;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98914	-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-0.77;-5.23;-5.23;0.76;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23;-5.23	5.08	5.08	0.68730	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98576	0.9524	M	0.62016	1.91	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.996;0.995;0.999;0.996	D;D;D;D;D	0.87578	0.95;0.97;0.995;0.998;0.99	D	0.99860	1.1082	10	0.66056	D	0.02	.	12.7879	0.57516	1.0:0.0:0.0:0.0	.	57;83;75;57;57	Q08345-4;B7Z3A2;B7Z2K0;Q08345-5;Q08345	.;.;.;.;DDR1_HUMAN	A	57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;75;57;57;57;57;83;57;57	ENSP00000421189:T57A;ENSP00000426420:T57A;ENSP00000318217:T57A;ENSP00000420833:T57A;ENSP00000427369:T57A;ENSP00000407699:T57A;ENSP00000422331:T57A;ENSP00000392413:T57A;ENSP00000424703:T57A;ENSP00000406091:T57A;ENSP00000425713:T57A;ENSP00000394273:T57A;ENSP00000379631:T57A;ENSP00000424758:T57A;ENSP00000426229:T57A;ENSP00000422467:T57A;ENSP00000423492:T57A;ENSP00000365753:T57A;ENSP00000425113:T57A;ENSP00000365759:T57A;ENSP00000365754:T57A;ENSP00000405998:T57A;ENSP00000427597:T57A;ENSP00000390593:T57A;ENSP00000365752:T57A;ENSP00000405039:T57A;ENSP00000422442:T75A;ENSP00000421719:T57A;ENSP00000409682:T57A;ENSP00000422108:T57A;ENSP00000423906:T57A;ENSP00000423749:T83A;ENSP00000365751:T57A;ENSP00000427552:T57A	ENSP00000318217:T57A	T	+	1	0	DDR1	30964747	1.000000	0.71417	0.992000	0.48379	0.513000	0.34164	9.285000	0.95894	1.900000	0.55004	0.254000	0.18369	ACT		0.617	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994		Missense_Mutation
EIF3B	8662	hgsc.bcm.edu	37	7	2415052	2415052	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr7:2415052A>G	ENST00000360876.4	+	14	1974	c.1918A>G	c.(1918-1920)Act>Gct	p.T640A	EIF3B_ENST00000397011.2_Missense_Mutation_p.T640A	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GTTTGTGGACACTTCGGACTG	0.567																																																0			7											242.0	171.0	195.0					7																	2415052		2203	4300	6503	2381578	SO:0001583	missense	8662			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1918A>G	7.37:g.2415052A>G	ENSP00000354125:p.Thr640Ala	Somatic		Capture	SOLID	Phase_III	2381578		Missense_Mutation	SNP	ENST00000360876.4	37	CCDS5332.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.03	1.518847	0.27211	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.05513	3.43;3.43	5.46	5.46	0.80206	Translation initiation factor 2A, beta propellor-like domain (1);Six-bladed beta-propeller, TolB-like (1);	0.087099	0.85682	D	0.000000	T	0.12008	0.0292	M	0.66939	2.045	0.54753	D	0.999986	B	0.31752	0.338	B	0.36464	0.225	T	0.03259	-1.1055	10	0.36615	T	0.2	-26.1017	15.2079	0.73195	1.0:0.0:0.0:0.0	.	640	P55884	EIF3B_HUMAN	A	640;640;640;564	ENSP00000354125:T640A;ENSP00000380206:T640A	ENSP00000316638:T640A	T	+	1	0	EIF3B	2381578	1.000000	0.71417	0.959000	0.39883	0.663000	0.39108	5.975000	0.70475	2.078000	0.62432	0.533000	0.62120	ACT		0.567	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			Missense_Mutation
PLK1	5347	hgsc.bcm.edu	37	16	23703610	23703610	+	IGR	SNP	A	A	T			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr16:23703610A>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000256797.4_Missense_Mutation_p.Y763N|ERN2_ENST00000457008.2_Missense_Mutation_p.Y663N	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.Y763N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GAAAGCACGTAGTAGAACACG	0.567																																					Colon(12;240 564 27038 33155)											1	Substitution - Missense(1)	ovary(1)	16											75.0	73.0	74.0					16																	23703610		2197	4300	6497	23611111	SO:0001628	intergenic_variant	10595				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23703610A>T		Somatic		Capture	SOLID	Phase_III	23611111	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	SNP	15	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655775	0.88056	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.50001	0.76;0.76	5.65	5.65	0.86999	.	0.137817	0.50627	D	0.000113	T	0.64940	0.2644	L	0.60012	1.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67883	-0.5555	10	0.87932	D	0	.	13.8429	0.63451	1.0:0.0:0.0:0.0	.	663;715	E7ETG2;A5YM65	.;.	N	763;663	ENSP00000256797:Y763N;ENSP00000413812:Y663N	ENSP00000256797:Y763N	Y	-	1	0	ERN2	23611111	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	8.905000	0.92613	2.146000	0.66826	0.533000	0.62120	TAC		0.567	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030		Missense_Mutation
FABP4	2167	hgsc.bcm.edu	37	8	82391144	82391144	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr8:82391144C>T	ENST00000256104.4	-	4	450	c.355G>A	c.(355-357)Gtc>Atc	p.V119I	FABP4_ENST00000518669.1_5'UTR|RP11-157I4.4_ENST00000524085.2_RNA	NM_001442.2	NP_001433.1	P15090	FABP4_HUMAN	fatty acid binding protein 4, adipocyte	119					brown fat cell differentiation (GO:0050873)|cellular response to lithium ion (GO:0071285)|cholesterol homeostasis (GO:0042632)|cytokine production (GO:0001816)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of inflammatory response (GO:0050729)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|nucleus (GO:0005634)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)	p.V119I(1)		breast(2)|central_nervous_system(1)|large_intestine(1)|ovary(1)|skin(1)	6			Epithelial(68;0.213)			CCTTTCATGACGCATTCCTAG	0.393																																					NSCLC(35;550 1252 19644 48360)											1	Substitution - Missense(1)	ovary(1)	8											168.0	139.0	149.0					8																	82391144		2203	4300	6503	82553699	SO:0001583	missense	2167			J02874	CCDS6230.1	8q21.13	2013-03-01			ENSG00000170323	ENSG00000170323		"""Fatty acid binding protein family"""	3559	protein-coding gene	gene with protein product		600434				2481498	Standard	NM_001442		Approved	A-FABP, aP2	uc003ycd.2	P15090	OTTHUMG00000164602	ENST00000256104.4:c.355G>A	8.37:g.82391144C>T	ENSP00000256104:p.Val119Ile	Somatic		Capture	SOLID	Phase_III	82553699	Q6IBA1	Missense_Mutation	SNP	ENST00000256104.4	37	CCDS6230.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.130	0.579711	0.13686	.	.	ENSG00000170323	ENST00000256104	T	0.07908	3.15	4.93	-9.86	0.00473	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.948010	0.08883	N	0.879700	T	0.04182	0.0116	N	0.12663	0.25	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42548	-0.9445	10	0.35671	T	0.21	.	13.9321	0.64003	0.0:0.6698:0.1083:0.2219	.	119	P15090	FABP4_HUMAN	I	119	ENSP00000256104:V119I	ENSP00000256104:V119I	V	-	1	0	FABP4	82553699	0.000000	0.05858	0.113000	0.21522	0.302000	0.27658	-1.956000	0.01522	-2.104000	0.00843	-1.152000	0.01820	GTC		0.393	FABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379368.1	NM_001442		Missense_Mutation
FAM111A	63901	hgsc.bcm.edu	37	11	58920846	58920846	+	Missense_Mutation	SNP	C	C	G	rs184251651		TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr11:58920846C>G	ENST00000528737.1	+	5	4523	c.1705C>G	c.(1705-1707)Cgt>Ggt	p.R569G	FAM111A_ENST00000533703.1_Missense_Mutation_p.R569G|FAM111A_ENST00000361723.3_Missense_Mutation_p.R569G|FAM111A_ENST00000531147.1_Missense_Mutation_p.R569G|FAM111A_ENST00000420244.1_Missense_Mutation_p.R569G			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	569	Interaction with SV40 large T antigen.		R -> H (in KCS2). {ECO:0000269|PubMed:23684011, ECO:0000269|PubMed:23996431, ECO:0000269|PubMed:24635597}.		defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R569G(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AAATGAGACTCGTAGTATCAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	11											139.0	137.0	137.0					11																	58920846		2201	4295	6496	58677422	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1705C>G	11.37:g.58920846C>G	ENSP00000434435:p.Arg569Gly	Somatic		Capture	SOLID	Phase_III	58677422	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	ENST00000528737.1	37	CCDS7973.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.496	0.651729	0.14516	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.87	-9.43	0.00607	Peptidase cysteine/serine, trypsin-like (1);	1.656350	0.02840	N	0.127821	T	0.25232	0.0613	L	0.29908	0.895	0.09310	N	1	B	0.23937	0.094	B	0.15484	0.013	T	0.05903	-1.0857	10	0.26408	T	0.33	-15.5963	8.3329	0.32197	0.0929:0.5489:0.1892:0.1691	.	569	Q96PZ2	F111A_HUMAN	G	569	ENSP00000434435:R569G;ENSP00000406683:R569G;ENSP00000355264:R569G;ENSP00000433154:R569G;ENSP00000431631:R569G	ENSP00000355264:R569G	R	+	1	0	FAM111A	58677422	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.107000	0.10873	-1.660000	0.01486	-1.724000	0.00704	CGT		0.413	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074		Missense_Mutation
FAM47B	170062	hgsc.bcm.edu	37	X	34962096	34962096	+	Nonsense_Mutation	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chrX:34962096G>A	ENST00000329357.5	+	1	1184	c.1148G>A	c.(1147-1149)tGg>tAg	p.W383*		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	383								p.W383*(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TACCATTTTTGGGAATCCTGT	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	X											45.0	43.0	43.0					X																	34962096		2202	4300	6502	34872017	SO:0001587	stop_gained	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1148G>A	X.37:g.34962096G>A	ENSP00000328307:p.Trp383*	Somatic		Capture	SOLID	Phase_III	34872017	Q5JQN5|Q6PIG3	Nonsense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848768	0.32699	.	.	ENSG00000189132	ENST00000329357	.	.	.	0.401	-0.634	0.11516	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	.	.	.	.	.	.	.	X	383	.	ENSP00000328307:W383X	W	+	2	0	FAM47B	34872017	0.030000	0.19436	0.001000	0.08648	0.001000	0.01503	-0.309000	0.08145	-0.478000	0.06823	-0.472000	0.04984	TGG		0.552	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		Nonsense_Mutation
FASTKD3	79072	hgsc.bcm.edu	37	5	7867785	7867785	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr5:7867785A>C	ENST00000264669.5	-	2	548	c.412T>G	c.(412-414)Tgt>Ggt	p.C138G	MTRR_ENST00000440940.2_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000264668.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	138					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.C138G(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TCCACTTCACAAATTCGTTGT	0.423																																																1	Substitution - Missense(1)	ovary(1)	5											59.0	55.0	57.0					5																	7867785		2203	4300	6503	7920785	SO:0001583	missense	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.412T>G	5.37:g.7867785A>C	ENSP00000264669:p.Cys138Gly	Somatic		Capture	SOLID	Phase_III	7920785	Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	CCDS3873.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.53	1.964676	0.34659	.	.	ENSG00000124279	ENST00000264669;ENST00000504695;ENST00000507572	T;T;T	0.20738	2.05;2.05;2.05	4.43	4.43	0.53597	.	0.368727	0.31612	N	0.007341	T	0.20700	0.0498	M	0.64997	1.995	0.36648	D	0.877234	B	0.27823	0.19	B	0.25140	0.058	T	0.11842	-1.0571	10	0.26408	T	0.33	-6.0999	10.0944	0.42466	0.8316:0.1684:0.0:0.0	.	138	Q14CZ7	FAKD3_HUMAN	G	138;138;121	ENSP00000264669:C138G;ENSP00000426008:C138G;ENSP00000422443:C121G	ENSP00000264669:C138G	C	-	1	0	FASTKD3	7920785	0.994000	0.37717	0.230000	0.23976	0.853000	0.48598	3.348000	0.52209	1.867000	0.54127	0.533000	0.62120	TGT		0.423	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091		Missense_Mutation
FBXO47	494188	hgsc.bcm.edu	37	17	37101218	37101218	+	Missense_Mutation	SNP	T	T	A	rs112930651		TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr17:37101218T>A	ENST00000378079.2	-	7	987	c.788A>T	c.(787-789)cAa>cTa	p.Q263L		NM_001008777.2	NP_001008777.2	Q5MNV8	FBX47_HUMAN	F-box protein 47	263								p.Q263L(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	20						CTCACCATCTTGAGGAGATAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	17											124.0	117.0	119.0					17																	37101218		2203	4300	6503	34354744	SO:0001583	missense	494188				CCDS32639.1	17q12	2014-08-12			ENSG00000204952	ENSG00000204952		"""F-boxes /  ""other"""""	31969	protein-coding gene	gene with protein product		609498				15723337	Standard	NM_001008777		Approved		uc002hrc.2	Q5MNV8	OTTHUMG00000178945	ENST00000378079.2:c.788A>T	17.37:g.37101218T>A	ENSP00000367319:p.Gln263Leu	Somatic		Capture	SOLID	Phase_III	34354744	B2RTZ4	Missense_Mutation	SNP	ENST00000378079.2	37	CCDS32639.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.74	1.435454	0.25813	.	.	ENSG00000204952	ENST00000378079	T	0.44083	0.93	5.47	4.39	0.52855	.	0.643940	0.16875	N	0.195954	T	0.18383	0.0441	N	0.08118	0	0.25090	N	0.990868	B	0.02656	0.0	B	0.01281	0.0	T	0.05484	-1.0882	10	0.27785	T	0.31	0.1487	2.0912	0.03657	0.1591:0.0866:0.166:0.5883	.	263	Q5MNV8	FBX47_HUMAN	L	263	ENSP00000367319:Q263L	ENSP00000367319:Q263L	Q	-	2	0	FBXO47	34354744	0.900000	0.30661	0.985000	0.45067	0.945000	0.59286	1.383000	0.34385	2.073000	0.62155	0.477000	0.44152	CAA		0.363	FBXO47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444073.1	NM_001008777		Missense_Mutation
GPR112	139378	hgsc.bcm.edu	37	X	135390976	135390976	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chrX:135390976A>C	ENST00000394143.1	+	4	331	c.40A>C	c.(40-42)Att>Ctt	p.I14L	GPR112_ENST00000412101.1_Missense_Mutation_p.I14L|GPR112_ENST00000370652.1_Missense_Mutation_p.I14L|GPR112_ENST00000394141.1_Missense_Mutation_p.I14L|GPR112_ENST00000287534.4_5'UTR	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	14					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I14L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTATGGATTGATTCTCATGTC	0.299																																																1	Substitution - Missense(1)	ovary(1)	X											183.0	168.0	173.0					X																	135390976		2203	4300	6503	135218642	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.40A>C	X.37:g.135390976A>C	ENSP00000377699:p.Ile14Leu	Somatic		Capture	SOLID	Phase_III	135218642	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.77	2.038140	0.35989	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.38077	1.18;1.18;1.16;1.16	5.58	3.04	0.35103	.	.	.	.	.	T	0.19846	0.0477	N	0.19112	0.55	0.80722	D	1	P;P	0.46784	0.884;0.603	B;B	0.35470	0.203;0.1	T	0.02333	-1.1175	9	0.72032	D	0.01	.	9.0899	0.36603	0.6446:0.3553:0.0:0.0	.	14;14	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	L	14	ENSP00000377699:I14L;ENSP00000359686:I14L;ENSP00000416526:I14L;ENSP00000377697:I14L	ENSP00000359686:I14L	I	+	1	0	GPR112	135218642	1.000000	0.71417	0.132000	0.22025	0.845000	0.48019	1.205000	0.32308	0.275000	0.22094	0.441000	0.28932	ATT		0.299	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			Missense_Mutation
GRM8	2918	hgsc.bcm.edu	37	7	126173408	126173408	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr7:126173408T>C	ENST00000339582.2	-	9	2836	c.2028A>G	c.(2026-2028)atA>atG	p.I676M	GRM8_ENST00000358373.3_Missense_Mutation_p.I676M|GRM8_ENST00000444921.2_Missense_Mutation_p.I676M|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	676					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.I676M(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CCTGCTCAAATATTCGGTGGA	0.502										HNSCC(24;0.065)																																						1	Substitution - Missense(1)	ovary(1)	7											92.0	85.0	87.0					7																	126173408		2203	4300	6503	125960644	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2028A>G	7.37:g.126173408T>C	ENSP00000344173:p.Ile676Met	Somatic		Capture	SOLID	Phase_III	125960644	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	CCDS5794.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.51	3.144298	0.57044	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.90563	-2.69;-2.69;-2.69	5.82	5.82	0.92795	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96396	0.8824	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	D	0.97265	0.9907	10	0.87932	D	0	.	15.3625	0.74492	0.0:0.0:0.0:1.0	.	676;676	O00222-2;O00222	.;GRM8_HUMAN	M	676	ENSP00000344173:I676M;ENSP00000409790:I676M;ENSP00000351142:I676M	ENSP00000344173:I676M	I	-	3	3	GRM8	125960644	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.500000	0.53318	2.234000	0.73211	0.533000	0.62120	ATA		0.502	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			Missense_Mutation
KANK1	23189	hgsc.bcm.edu	37	9	738303	738303	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr9:738303C>A	ENST00000382303.1	+	12	4004	c.3352C>A	c.(3352-3354)Ctc>Atc	p.L1118I	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.L960I|KANK1_ENST00000382297.2_Missense_Mutation_p.L1118I	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1118					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)	p.L960I(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TCTGAACACCCTCCAGCACGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	9											76.0	57.0	64.0					9																	738303		2203	4300	6503	728303	SO:0001583	missense	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3352C>A	9.37:g.738303C>A	ENSP00000371740:p.Leu1118Ile	Somatic		Capture	SOLID	Phase_III	728303	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	CCDS34976.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.855	0.945496	0.18356	.	.	ENSG00000107104	ENST00000382303;ENST00000397976;ENST00000382297;ENST00000382293;ENST00000382289;ENST00000382286	T;T;T	0.37235	1.21;1.21;1.28	5.73	4.73	0.59995	.	0.138628	0.32314	N	0.006273	T	0.11922	0.0290	N	0.01686	-0.76	0.37092	D	0.899502	B;B;B	0.11235	0.001;0.004;0.002	B;B;B	0.17433	0.018;0.006;0.004	T	0.26710	-1.0095	10	0.06236	T	0.91	13.4839	8.3508	0.32301	0.2706:0.6118:0.1177:0.0	.	164;30;1118	F5H7I5;Q5W0W2;Q14678	.;.;KANK1_HUMAN	I	1118;164;1118;960;96;30	ENSP00000371740:L1118I;ENSP00000371734:L1118I;ENSP00000371730:L960I	ENSP00000371723:L30I	L	+	1	0	KANK1	728303	0.992000	0.36948	1.000000	0.80357	0.988000	0.76386	2.217000	0.42880	2.868000	0.98415	0.557000	0.71058	CTC		0.493	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158		Missense_Mutation
MAN1A1	4121	hgsc.bcm.edu	37	6	119526032	119526032	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr6:119526032G>C	ENST00000368468.3	-	7	1449	c.1008C>G	c.(1006-1008)aaC>aaG	p.N336K		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	336					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N336K(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		CCCAGGGCCAGTTCCTTCCAA	0.448																																					Ovarian(136;8 1825 12608 33541 47587)											1	Substitution - Missense(1)	ovary(1)	6											68.0	67.0	67.0					6																	119526032		2203	4300	6503	119567731	SO:0001583	missense	4121			AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1008C>G	6.37:g.119526032G>C	ENSP00000357453:p.Asn336Lys	Somatic		Capture	SOLID	Phase_III	119567731	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	37	CCDS5122.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580503	0.65992	.	.	ENSG00000111885	ENST00000368468	T	0.72942	-0.7	5.37	3.25	0.37280	.	0.000000	0.85682	D	0.000000	T	0.71728	0.3374	M	0.64676	1.99	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71388	-0.4608	10	0.38643	T	0.18	-8.4707	9.0116	0.36144	0.3045:0.0:0.6955:0.0	.	336	P33908	MA1A1_HUMAN	K	336	ENSP00000357453:N336K	ENSP00000357453:N336K	N	-	3	2	MAN1A1	119567731	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.614000	0.36911	1.257000	0.44085	0.591000	0.81541	AAC		0.448	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907		Missense_Mutation
MTSS1	9788	hgsc.bcm.edu	37	8	125580673	125580673	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr8:125580673T>C	ENST00000518547.1	-	7	1038	c.565A>G	c.(565-567)Att>Gtt	p.I189V	MTSS1_ENST00000378017.3_Missense_Mutation_p.I189V|MTSS1_ENST00000354184.4_5'UTR|NDUFB9_ENST00000522532.1_3'UTR|MTSS1_ENST00000395508.2_5'Flank|MTSS1_ENST00000325064.5_Missense_Mutation_p.I193V|MTSS1_ENST00000524090.1_Missense_Mutation_p.I79V|MTSS1_ENST00000431961.2_5'UTR	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	189	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.I189V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CGTTCTTCAATCAAAGCCTTC	0.448																																					Esophageal Squamous(160;622 1893 3862 8546 12509)											1	Substitution - Missense(1)	ovary(1)	8											110.0	95.0	100.0					8																	125580673		2203	4300	6503	125649854	SO:0001583	missense	9788			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.565A>G	8.37:g.125580673T>C	ENSP00000429064:p.Ile189Val	Somatic		Capture	SOLID	Phase_III	125649854	J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	37	CCDS6353.1	SNP	50	Baylor	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	6.598|6.598|6.598	0.478798|0.478798|0.478798	0.12521|0.12521|0.12521	.|.|.	.|.|.	ENSG00000170873|ENSG00000170873|ENSG00000170873	ENST00000523179|ENST00000378017;ENST00000518547;ENST00000325064;ENST00000524090|ENST00000522162	.|T;T;T;T|.	.|0.32988|.	.|1.52;1.54;1.5;1.43|.	5.55|5.55|5.55	5.55|5.55|5.55	0.83447|0.83447|0.83447	.|IRSp53/MIM homology domain (IMD) (3);|.	.|0.072630|.	.|0.64402|.	.|D|.	.|0.000002|.	T|T|.	0.51702|0.51702|.	0.1690|0.1690|.	N|N|N	0.20445|0.20445|0.20445	0.575|0.575|0.575	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B;B;B;B|.	.|0.33171|.	.|0.4;0.16;0.027;0.022|.	.|B;B;B;B|.	.|0.36244|.	.|0.191;0.22;0.024;0.022|.	T|T|.	0.48736|0.48736|.	-0.9009|-0.9009|.	5|10|.	.|0.22109|.	.|T|.	.|0.4|.	-18.4336|-18.4336|-18.4336	15.9844|15.9844|15.9844	0.80138|0.80138|0.80138	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|79;189;189;189|.	.|E7EWW5;A5YM41;O43312;O43312-4|.	.|.;.;MTSS1_HUMAN;.|.	G|V|W	36|189;189;193;79|183	.|ENSP00000367256:I189V;ENSP00000429064:I189V;ENSP00000322804:I193V;ENSP00000428319:I79V|.	.|ENSP00000322804:I193V|.	D|I|X	-|-|-	2|1|3	0|0|0	MTSS1|MTSS1|MTSS1	125649854|125649854|125649854	0.994000|0.994000|0.994000	0.37717|0.37717|0.37717	0.705000|0.705000|0.705000	0.30386|0.30386|0.30386	0.799000|0.799000|0.799000	0.45148|0.45148|0.45148	1.523000|1.523000|1.523000	0.35932|0.35932|0.35932	2.233000|2.233000|2.233000	0.73108|0.73108|0.73108	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAT|ATT|TGA		0.448	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751		Missense_Mutation
KAT6B	23522	hgsc.bcm.edu	37	10	76781908	76781908	+	Silent	SNP	A	A	G	rs72074375|rs144154275|rs371512199|rs79644703|rs559824889|rs71929101	byFrequency	TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr10:76781908A>G	ENST00000287239.4	+	16	3780	c.3291A>G	c.(3289-3291)gaA>gaG	p.E1097E	KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372711.1_Silent_p.E914E|RP11-77G23.2_ENST00000413431.1_RNA|RP11-77G23.5_ENST00000436608.1_RNA|KAT6B_ENST00000372725.1_Silent_p.E805E|KAT6B_ENST00000372714.1_Silent_p.E805E|KAT6B_ENST00000372724.1_Silent_p.E805E	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1097	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1097E(4)|p.E1097delE(1)									aagaagaggaagaagaagaag	0.443											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				5	Substitution - coding silent(4)|Deletion - In frame(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)	10											19.0	38.0	32.0					10																	76781908		2198	4300	6498	76451914	SO:0001819	synonymous_variant	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3291A>G	10.37:g.76781908A>G		Somatic	1170	Capture	SOLID	Phase_III	76451914	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1	SNP	3	Baylor																																																																																				0.443	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		Silent
NBAS	51594	hgsc.bcm.edu	37	2	15359049	15359049	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:15359049G>A	ENST00000281513.5	-	48	6305	c.6280C>T	c.(6280-6282)Cct>Tct	p.P2094S	NBAS_ENST00000441750.1_Missense_Mutation_p.P1974S	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2094					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GCACAGAAAGGCCGCAGCCAC	0.552																																																0			2											37.0	41.0	40.0					2																	15359049		2203	4300	6503	15276500	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6280C>T	2.37:g.15359049G>A	ENSP00000281513:p.Pro2094Ser	Somatic		Capture	SOLID	Phase_III	15276500	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.6	4.930876	0.92389	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.30448	1.53;1.53	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.51466	0.1676	M	0.65498	2.005	0.80722	D	1	D;P	0.62365	0.991;0.676	P;B	0.58130	0.833;0.197	T	0.53294	-0.8459	10	0.87932	D	0	.	18.5325	0.90997	0.0:0.0:1.0:0.0	.	1974;2094	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	S	1974;2094	ENSP00000413201:P1974S;ENSP00000281513:P2094S	ENSP00000281513:P2094S	P	-	1	0	NBAS	15276500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.735000	0.91549	2.609000	0.88269	0.591000	0.81541	CCT		0.552	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909		Missense_Mutation
NR4A2	4929	hgsc.bcm.edu	37	2	157184460	157184460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:157184460delT	ENST00000339562.4	-	5	1423	c.1061delA	c.(1060-1062)gagfs	p.E354fs	NR4A2_ENST00000426264.1_Frame_Shift_Del_p.E291fs|NR4A2_ENST00000409572.1_Frame_Shift_Del_p.E354fs|NR4A2_ENST00000539077.1_Frame_Shift_Del_p.E365fs|NR4A2_ENST00000409108.2_Frame_Shift_Del_p.E354fs|NR4A2_ENST00000429376.1_Frame_Shift_Del_p.E291fs	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	354	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E354fs*9(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						GGGAGAGGGCTCCTGTGGGCT	0.597																																																1	Deletion - Frameshift(1)	ovary(1)	2											28.0	28.0	28.0					2																	157184460		2203	4298	6501	156892706	SO:0001589	frameshift_variant	4929			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1061delA	2.37:g.157184460delT	ENSP00000344479:p.Glu354fs	Somatic		Capture	SOLID	Phase_III	156892706	Q16311|Q53RZ2|Q6NXU0	Frame_Shift_Del	DEL	ENST00000339562.4	37	CCDS2201.1	DEL	54	Baylor																																																																																				0.597	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2			Frame_Shift_Del
NCKAP1	10787	hgsc.bcm.edu	37	2	183848087	183848087	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:183848087C>A	ENST00000361354.4	-	11	1400	c.1028G>T	c.(1027-1029)cGc>cTc	p.R343L	NCKAP1_ENST00000360982.2_Missense_Mutation_p.R349L	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	343					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)	p.R349L(1)		breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TAAAAACTTGCGTCTTTCTCT	0.343																																																1	Substitution - Missense(1)	ovary(1)	2											107.0	103.0	105.0					2																	183848087		2203	4300	6503	183556332	SO:0001583	missense	10787			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1028G>T	2.37:g.183848087C>A	ENSP00000355348:p.Arg343Leu	Somatic		Capture	SOLID	Phase_III	183556332	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.360365	0.95877	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.57273	0.41;0.41	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	M	0.87758	2.905	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.70487	0.969;0.947	T	0.81722	-0.0803	10	0.87932	D	0	-6.3069	18.7206	0.91691	0.0:1.0:0.0:0.0	.	343;349	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	L	343;349	ENSP00000355348:R343L;ENSP00000354251:R349L	ENSP00000354251:R349L	R	-	2	0	NCKAP1	183556332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.417000	0.82017	0.555000	0.69702	CGC		0.343	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842		Missense_Mutation
NRG1	3084	hgsc.bcm.edu	37	8	32505843	32505843	+	Intron	SNP	C	C	A	rs145849314	byFrequency	TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr8:32505843C>A	ENST00000405005.3	+	5	502				NRG1_ENST00000523079.1_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000520502.2_Missense_Mutation_p.P203T|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000519301.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GGTGAGAACGCCCAAGTCAGC	0.488																																																0			8											85.0	72.0	77.0					8																	32505843		2203	4300	6503	32625385	SO:0001627	intron_variant	3084			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.502+31440C>A	8.37:g.32505843C>A		Somatic		Capture	SOLID	Phase_III	32625385	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000405005.3	37	CCDS6085.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566691	0.45694	.	.	ENSG00000157168	ENST00000520502;ENST00000523041	T	0.13196	2.61	5.77	5.77	0.91146	.	.	.	.	.	T	0.25754	0.0627	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.01729	-1.1286	9	0.54805	T	0.06	.	18.5428	0.91035	0.0:1.0:0.0:0.0	.	203;203	Q53F54;Q02297-10	.;.	T	203;163	ENSP00000433289:P203T	ENSP00000433289:P203T	P	+	1	0	NRG1	32625385	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.561000	0.45905	2.885000	0.99019	0.655000	0.94253	CCC		0.488	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1			Missense_Mutation
PBRM1	55193	hgsc.bcm.edu	37	3	52685780	52685780	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr3:52685780T>C	ENST00000296302.7	-	6	693	c.692A>G	c.(691-693)aAg>aGg	p.K231R	PBRM1_ENST00000409057.1_Missense_Mutation_p.K231R|PBRM1_ENST00000356770.4_Missense_Mutation_p.K231R|PBRM1_ENST00000409114.3_Missense_Mutation_p.K231R|PBRM1_ENST00000337303.4_Missense_Mutation_p.K231R|PBRM1_ENST00000409767.1_Missense_Mutation_p.K231R|PBRM1_ENST00000394830.3_Missense_Mutation_p.K231R|PBRM1_ENST00000410007.1_Missense_Mutation_p.K231R			Q86U86	PB1_HUMAN	polybromo 1	231	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.K231R(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGCAATGGTCTTGAGATCTAT	0.358			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																		Rec	yes		3	3p21	55193	polybromo 1		E	1	Substitution - Missense(1)	ovary(1)	3											144.0	137.0	140.0					3																	52685780		2203	4300	6503	52660820	SO:0001583	missense	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.692A>G	3.37:g.52685780T>C	ENSP00000296302:p.Lys231Arg	Somatic		Capture	SOLID	Phase_III	52660820	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417069	0.62511	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36	5.45	5.45	0.79879	Bromodomain (6);Bromodomain, conserved site (1);	0.049971	0.85682	D	0.000000	T	0.47021	0.1423	L	0.27944	0.81	0.51482	D	0.999926	B;B;D;B;B;B;B;B;D	0.67145	0.01;0.018;0.99;0.04;0.0;0.004;0.007;0.0;0.996	B;B;D;B;B;B;B;B;D	0.79108	0.032;0.041;0.989;0.047;0.001;0.026;0.044;0.003;0.992	T	0.41787	-0.9489	10	0.39692	T	0.17	-7.33	15.515	0.75815	0.0:0.0:0.0:1.0	.	231;231;231;231;231;231;231;231;231	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	R	231;231;231;231;231;231;231;231;231;175	ENSP00000349213:K231R;ENSP00000378307:K231R;ENSP00000296302:K231R;ENSP00000338302:K231R;ENSP00000386593:K231R;ENSP00000386529:K231R;ENSP00000386643:K231R;ENSP00000386601:K231R;ENSP00000387775:K231R;ENSP00000397662:K175R	ENSP00000296302:K231R	K	-	2	0	PBRM1	52660820	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.768000	0.47645	2.056000	0.61249	0.533000	0.62120	AAG		0.358	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165		Missense_Mutation
PDE6C	5146	hgsc.bcm.edu	37	10	95400690	95400690	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr10:95400690A>C	ENST00000371447.3	+	14	1889	c.1751A>C	c.(1750-1752)aAg>aCg	p.K584T		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	584					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.K584T(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	GGAAGATTAAAGAAGTACTAC	0.353																																																1	Substitution - Missense(1)	ovary(1)	10											99.0	90.0	93.0					10																	95400690		2203	4300	6503	95390680	SO:0001583	missense	5146			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1751A>C	10.37:g.95400690A>C	ENSP00000360502:p.Lys584Thr	Somatic		Capture	SOLID	Phase_III	95390680	A6NCR6|Q5VY29	Missense_Mutation	SNP	ENST00000371447.3	37	CCDS7429.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.67	3.187486	0.57909	.	.	ENSG00000095464	ENST00000371447	D	0.81579	-1.51	5.2	5.2	0.72013	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	1.148130	0.06245	N	0.691061	D	0.87943	0.6305	L	0.52759	1.655	0.53005	D	0.999966	D	0.69078	0.997	D	0.65140	0.932	T	0.79579	-0.1745	10	0.62326	D	0.03	.	15.2292	0.73374	1.0:0.0:0.0:0.0	.	584	P51160	PDE6C_HUMAN	T	584	ENSP00000360502:K584T	ENSP00000360502:K584T	K	+	2	0	PDE6C	95390680	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	5.410000	0.66381	2.187000	0.69744	0.460000	0.39030	AAG		0.353	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204		Missense_Mutation
SCN3A	6328	hgsc.bcm.edu	37	2	165947488	165947488	+	Silent	SNP	G	G	A			TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:165947488G>A	ENST00000360093.3	-	28	5666	c.5175C>T	c.(5173-5175)gaC>gaT	p.D1725D	SCN3A_ENST00000283254.7_Silent_p.D1725D|SCN3A_ENST00000465043.1_5'Flank|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Silent_p.D1676D|SCN3A_ENST00000540861.1_Silent_p.D208D	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1725					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.D1725D(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGGGTCACAGTCGGGTGGTG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	2											159.0	158.0	159.0					2																	165947488		2203	4300	6503	165655734	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5175C>T	2.37:g.165947488G>A		Somatic		Capture	SOLID	Phase_III	165655734	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37		SNP	36	Baylor																																																																																				0.463	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		Silent
SEC23A	10484	hgsc.bcm.edu	37	14	39514455	39514455	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr14:39514455C>T	ENST00000307712.6	-	16	2328	c.1811G>A	c.(1810-1812)cGt>cAt	p.R604H	SEC23A_ENST00000545328.2_Missense_Mutation_p.R575H|SEC23A_ENST00000536508.1_Missense_Mutation_p.R502H|SEC23A_ENST00000537403.1_Missense_Mutation_p.R402H	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	604					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.R604H(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		AAAATGGTGACGATAATATGA	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											87.0	82.0	83.0					14																	39514455		2203	4300	6503	38584206	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1811G>A	14.37:g.39514455C>T	ENSP00000306881:p.Arg604His	Somatic		Capture	SOLID	Phase_III	38584206	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	37	CCDS9668.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	35	5.443261	0.96187	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73	5.49	5.49	0.81192	Sec23/Sec24, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.96383	0.8820	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.96183	0.9132	10	0.54805	T	0.06	-16.3883	19.7347	0.96198	0.0:1.0:0.0:0.0	.	575;502;604	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	H	402;604;502;575	ENSP00000444193:R402H;ENSP00000306881:R604H;ENSP00000437715:R502H;ENSP00000445393:R575H	ENSP00000306881:R604H	R	-	2	0	SEC23A	38584206	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.760000	0.85248	2.746000	0.94184	0.655000	0.94253	CGT		0.368	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2			Missense_Mutation
SEC61A1	29927	hgsc.bcm.edu	37	3	127785876	127785876	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr3:127785876C>T	ENST00000243253.3	+	9	1041	c.857C>T	c.(856-858)aCg>aTg	p.T286M	SEC61A1_ENST00000464451.1_Missense_Mutation_p.T292M|SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_Intron|SEC61A1_ENST00000424880.2_Missense_Mutation_p.T166M	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	286					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						CTCTTCTATACGTCCAACATC	0.542																																																0			3											243.0	185.0	205.0					3																	127785876		2203	4300	6503	129268566	SO:0001583	missense	29927			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.857C>T	3.37:g.127785876C>T	ENSP00000243253:p.Thr286Met	Somatic		Capture	SOLID	Phase_III	129268566	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	ENST00000243253.3	37	CCDS3046.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.8	4.770503	0.90108	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.32	5.32	0.75619	SecY subunit domain (2);	0.000000	0.85682	D	0.000000	D	0.86506	0.5949	M	0.92459	3.31	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.89742	0.3934	9	0.87932	D	0	.	19.0048	0.92846	0.0:1.0:0.0:0.0	.	286	P61619	S61A1_HUMAN	M	292;286;166	.	ENSP00000243253:T286M	T	+	2	0	SEC61A1	129268566	1.000000	0.71417	0.999000	0.59377	0.839000	0.47603	7.818000	0.86416	2.480000	0.83734	0.655000	0.94253	ACG		0.542	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336		Missense_Mutation
TLL2	7093	hgsc.bcm.edu	37	10	98133368	98133368	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr10:98133368C>T	ENST00000357947.3	-	19	2872	c.2647G>A	c.(2647-2649)Gca>Aca	p.A883T		NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	883	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CTGTGCACTGCCTGGAAGCCT	0.557																																																0			10											72.0	70.0	71.0					10																	98133368		2203	4300	6503	98123358	SO:0001583	missense	7093			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.2647G>A	10.37:g.98133368C>T	ENSP00000350630:p.Ala883Thr	Somatic		Capture	SOLID	Phase_III	98123358	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.362501	0.95877	.	.	ENSG00000095587	ENST00000357947	T	0.41065	1.01	4.84	4.84	0.62591	CUB (5);	0.000000	0.45361	D	0.000372	T	0.79986	0.4541	H	0.99156	4.45	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.88489	0.3074	10	0.72032	D	0.01	.	17.4726	0.87650	0.0:1.0:0.0:0.0	.	883	Q9Y6L7	TLL2_HUMAN	T	883	ENSP00000350630:A883T	ENSP00000350630:A883T	A	-	1	0	TLL2	98123358	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.829000	0.69316	2.672000	0.90937	0.555000	0.69702	GCA		0.557	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1			Missense_Mutation
TNFAIP3	7128	hgsc.bcm.edu	37	6	138195993	138195993	+	Missense_Mutation	SNP	T	T	G			TCGA-09-1661-01	TCGA-09-1661-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr6:138195993T>G	ENST00000237289.4	+	3	373	c.307T>G	c.(307-309)Tgc>Ggc	p.C103G		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	103	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.C103G(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TGACGGCAATTGCCTCATGCA	0.498			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(25)|ovary(1)	6											91.0	72.0	79.0					6																	138195993		2203	4300	6503	138237686	SO:0001583	missense	7128			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.307T>G	6.37:g.138195993T>G	ENSP00000237289:p.Cys103Gly	Somatic		Capture	SOLID	Phase_III	138237686	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	25.3	4.624178	0.87560	.	.	ENSG00000118503	ENST00000420009;ENST00000237289;ENST00000535574;ENST00000535332;ENST00000539356;ENST00000544646;ENST00000536070	T;T	0.77877	-1.13;-1.13	5.97	5.97	0.96955	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	D	0.87716	0.6247	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89978	0.4098	10	0.87932	D	0	-1.3152	15.0072	0.71522	0.0:0.0:0.0:1.0	.	103	P21580	TNAP3_HUMAN	G	103	ENSP00000401562:C103G;ENSP00000237289:C103G	ENSP00000237289:C103G	C	+	1	0	TNFAIP3	138237686	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.157000	0.77461	2.274000	0.75844	0.533000	0.62120	TGC		0.498	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			Missense_Mutation
TOM1	10043	hgsc.bcm.edu	37	22	35717995	35717995	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr22:35717995A>C	ENST00000449058.2	+	3	306	c.181A>C	c.(181-183)Aat>Cat	p.N61H	TOM1_ENST00000447733.1_Missense_Mutation_p.N28H|TOM1_ENST00000382034.5_5'UTR|TOM1_ENST00000425375.1_Missense_Mutation_p.N61H|TOM1_ENST00000436462.2_Intron|TOM1_ENST00000411850.1_Missense_Mutation_p.N61H	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	61	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.N61H(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						AATCGTGGGGAATAAGAACTT	0.527																																																1	Substitution - Missense(1)	ovary(1)	22											128.0	109.0	116.0					22																	35717995		2203	4300	6503	34047995	SO:0001583	missense	10043			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.181A>C	22.37:g.35717995A>C	ENSP00000394466:p.Asn61His	Somatic		Capture	SOLID	Phase_III	34047995	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389309	0.82902	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000450839;ENST00000451197;ENST00000443206	T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01	5.03	5.03	0.67393	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.51914	1.62	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;1.0	T	0.07366	-1.0776	10	0.30078	T	0.28	-13.3426	14.7793	0.69754	1.0:0.0:0.0:0.0	.	61;61;61;61	O60784-3;B4DKQ5;O60784-2;O60784	.;.;.;TOM1_HUMAN	H	28;61;61;61;61;61;61;28	ENSP00000398876:N28H;ENSP00000393714:N61H;ENSP00000394466:N61H;ENSP00000413697:N61H;ENSP00000394924:N61H;ENSP00000389789:N28H	ENSP00000338422:N61H	N	+	1	0	TOM1	34047995	1.000000	0.71417	0.533000	0.28001	0.859000	0.49053	9.204000	0.95041	1.895000	0.54865	0.459000	0.35465	AAT		0.527	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr17:7578290C>T	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	17	GRCh37	CD043957|CS011574|CS083991	TP53	D|S							82.0	74.0	76.0					17																	7578290		2203	4300	6503	7519015	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>A	17.37:g.7578290C>T		Somatic		Capture	SOLID	Phase_III	7519015	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007143	0.19199	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
TRIM73	375593	hgsc.bcm.edu	37	7	75033005	75033005	+	Missense_Mutation	SNP	A	A	C	rs200694955		TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr7:75033005A>C	ENST00000437796.1	+	2	496	c.477A>C	c.(475-477)aaA>aaC	p.K159N	TRIM73_ENST00000430211.1_Missense_Mutation_p.K159N|TRIM73_ENST00000323819.3_Missense_Mutation_p.K159N|TRIM73_ENST00000450434.1_Missense_Mutation_p.K28N|TRIM73_ENST00000447409.2_Missense_Mutation_p.K159N			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	159						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.K159N(1)		endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						AACTGGTGAAAAACCGGACCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											1.0	1.0	1.0					7																	75033005		3	4	7	74870941	SO:0001583	missense	375593			AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.477A>C	7.37:g.75033005A>C	ENSP00000417040:p.Lys159Asn	Somatic		Capture	SOLID	Phase_III	74870941	Q8N0S3	Missense_Mutation	SNP	ENST00000437796.1	37	CCDS34665.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.094	-1.161943	0.01673	.	.	ENSG00000178809	ENST00000450434;ENST00000323819;ENST00000430211;ENST00000447409;ENST00000437796	T;T;T;T	0.70399	-0.47;-0.45;-0.48;-0.47	2.64	1.74	0.24563	.	0.000000	0.64402	N	0.000003	T	0.35393	0.0930	N	0.01576	-0.805	0.20074	N	0.999939	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22626	-1.0211	10	0.18276	T	0.48	.	5.7557	0.18172	0.1935:0.692:0.0:0.1145	.	159;159	Q86UV6;Q86UV7	TRI74_HUMAN;TRI73_HUMAN	N	28;159;159;159;159	ENSP00000318615:K159N;ENSP00000410121:K159N;ENSP00000407135:K159N;ENSP00000417040:K159N	ENSP00000318615:K159N	K	+	3	2	TRIM73	74870941	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	2.160000	0.42348	0.203000	0.20529	-0.506000	0.04501	AAA		0.587	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1			Missense_Mutation
TSHZ2	128553	hgsc.bcm.edu	37	20	51873045	51873045	+	Silent	SNP	G	G	A	rs538141535		TCGA-09-1661-01	TCGA-09-1661-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr20:51873045G>A	ENST00000371497.5	+	2	3935	c.3048G>A	c.(3046-3048)acG>acA	p.T1016T	TSHZ2_ENST00000329613.6_Silent_p.T1013T|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Silent_p.T1013T	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	1016					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T1016T(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TAAGCAAAACGCACAGCAAGT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22050	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	20											132.0	119.0	123.0					20																	51873045		2203	4300	6503	51306452	SO:0001819	synonymous_variant	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.3048G>A	20.37:g.51873045G>A		Somatic		Capture	SOLID	Phase_III	51306452	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	CCDS33490.1	SNP	38	Baylor																																																																																				0.468	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		Silent
TSHZ3	57616	hgsc.bcm.edu	37	19	31770182	31770182	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr19:31770182C>T	ENST00000240587.4	-	2	844	c.517G>A	c.(517-519)Gct>Act	p.A173T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	173					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A173T(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					AGCGTCTTAGCCATGGCGCTC	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											41.0	41.0	41.0					19																	31770182		2203	4300	6503	36462022	SO:0001583	missense	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.517G>A	19.37:g.31770182C>T	ENSP00000240587:p.Ala173Thr	Somatic		Capture	SOLID	Phase_III	36462022	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599156	0.87055	.	.	ENSG00000121297	ENST00000240587	T	0.15603	2.41	5.44	5.44	0.79542	.	0.000000	0.64402	U	0.000001	T	0.39545	0.1082	L	0.55990	1.75	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	T	0.04373	-1.0956	10	0.49607	T	0.09	-21.9219	19.2705	0.94008	0.0:1.0:0.0:0.0	.	173	Q63HK5	TSH3_HUMAN	T	173	ENSP00000240587:A173T	ENSP00000240587:A173T	A	-	1	0	TSHZ3	36462022	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.468000	0.80943	2.543000	0.85770	0.655000	0.94253	GCT		0.642	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856		Missense_Mutation
WNT2	7472	hgsc.bcm.edu	37	7	116960728	116960728	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr7:116960728C>T	ENST00000265441.3	-	2	502	c.203G>A	c.(202-204)gGc>gAc	p.G68D	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	68					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.G68D(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CTCGGCCACGCCCTGGCTAAT	0.607																																																1	Substitution - Missense(1)	ovary(1)	7											72.0	57.0	62.0					7																	116960728		2203	4300	6503	116747964	SO:0001583	missense	7472			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.203G>A	7.37:g.116960728C>T	ENSP00000265441:p.Gly68Asp	Somatic		Capture	SOLID	Phase_III	116747964	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	CCDS5771.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073445	0.76415	.	.	ENSG00000105989	ENST00000265441;ENST00000491214	D;D	0.83591	-1.74;-1.74	5.28	5.28	0.74379	.	0.049046	0.85682	D	0.000000	D	0.95037	0.8393	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96911	0.9667	10	0.87932	D	0	.	18.2752	0.90080	0.0:1.0:0.0:0.0	.	68	P09544	WNT2_HUMAN	D	68	ENSP00000265441:G68D;ENSP00000419466:G68D	ENSP00000265441:G68D	G	-	2	0	WNT2	116747964	1.000000	0.71417	0.999000	0.59377	0.268000	0.26511	7.419000	0.80179	2.604000	0.88044	0.655000	0.94253	GGC		0.607	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391		Missense_Mutation
YIPF2	78992	hgsc.bcm.edu	37	19	11034080	11034080	+	Frame_Shift_Del	DEL	A	A	-			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr19:11034080delA	ENST00000586748.1	-	9	1010	c.838delT	c.(838-840)tacfs	p.Y280fs	YIPF2_ENST00000253031.2_Frame_Shift_Del_p.Y280fs|YIPF2_ENST00000590329.1_Frame_Shift_Del_p.Y241fs			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	280						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)		p.Y280fs*>37(1)		cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						TGGAAGAAGTACAACTGCACA	0.647																																																1	Deletion - Frameshift(1)	ovary(1)	19											121.0	123.0	122.0					19																	11034080		2203	4300	6503	10895080	SO:0001589	frameshift_variant	78992			BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.838delT	19.37:g.11034080delA	ENSP00000466055:p.Tyr280fs	Somatic		Capture	SOLID	Phase_III	10895080		Frame_Shift_Del	DEL	ENST00000586748.1	37	CCDS12251.1	DEL	14	Baylor																																																																																				0.647	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453045.1	NM_024029		Frame_Shift_Del
ZNF691	51058	hgsc.bcm.edu	37	1	43317461	43317461	+	Missense_Mutation	SNP	C	C	G	rs567618547		TCGA-09-1661-01	TCGA-09-1661-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr1:43317461C>G	ENST00000372506.1	+	4	1172	c.832C>G	c.(832-834)Cag>Gag	p.Q278E	ZNF691_ENST00000372507.1_Missense_Mutation_p.Q278E|ZNF691_ENST00000372508.3_Missense_Mutation_p.Q278E|ZNF691_ENST00000372502.1_Missense_Mutation_p.Q300E|ZNF691_ENST00000397044.3_Missense_Mutation_p.Q309E|ZNF691_ENST00000372504.1_Missense_Mutation_p.Q300E	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	141						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q278E(1)		large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTTGGGCGAACAGGCTGGGAA	0.537																																																1	Substitution - Missense(1)	ovary(1)	1											29.0	33.0	31.0					1																	43317461		2202	4300	6502	43090048	SO:0001583	missense	51058				CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.832C>G	1.37:g.43317461C>G	ENSP00000361584:p.Gln278Glu	Somatic		Capture	SOLID	Phase_III	43090048	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	37	CCDS476.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985841	0.74589	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372502	T;T;T;T;T;T	0.08458	3.12;3.12;3.12;3.09;3.09;3.09	5.06	4.06	0.47325	.	.	.	.	.	T	0.05227	0.0139	N	0.03194	-0.395	0.27688	N	0.94622	P	0.38504	0.634	B	0.41236	0.351	T	0.22103	-1.0226	9	0.87932	D	0	0.5834	10.0627	0.42284	0.2003:0.7997:0.0:0.0	.	309	B4DJR7	.	E	278;278;278;309;300;300	ENSP00000361586:Q278E;ENSP00000361585:Q278E;ENSP00000361584:Q278E;ENSP00000380237:Q309E;ENSP00000361582:Q300E;ENSP00000361580:Q300E	ENSP00000361580:Q300E	Q	+	1	0	ZNF691	43090048	0.675000	0.27558	0.945000	0.38365	0.841000	0.47740	0.107000	0.15375	2.736000	0.93811	0.557000	0.71058	CAG		0.537	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911		Missense_Mutation
ZNF804A	91752	hgsc.bcm.edu	37	2	185731113	185731113	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1661-01	TCGA-09-1661-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1661-01	TCGA-09-1661-10	g.chr2:185731113A>T	ENST00000302277.6	+	2	723	c.129A>T	c.(127-129)gaA>gaT	p.E43D		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	43							metal ion binding (GO:0046872)	p.E43D(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CTGAGAAGGAAAATACCATAG	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											61.0	60.0	60.0					2																	185731113		2203	4300	6503	185439358	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.129A>T	2.37:g.185731113A>T	ENSP00000303252:p.Glu43Asp	Somatic		Capture	SOLID	Phase_III	185439358	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	19.43	3.826135	0.71143	.	.	ENSG00000170396	ENST00000302277	T	0.10382	2.88	5.68	2.49	0.30216	.	0.135350	0.34200	N	0.004164	T	0.11324	0.0276	N	0.24115	0.695	0.35790	D	0.822328	P	0.52316	0.952	P	0.51895	0.683	T	0.17167	-1.0378	10	0.87932	D	0	-10.2156	7.9518	0.30019	0.5338:0.0:0.4662:0.0	.	43	Q7Z570	Z804A_HUMAN	D	43	ENSP00000303252:E43D	ENSP00000303252:E43D	E	+	3	2	ZNF804A	185439358	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	0.762000	0.26503	0.251000	0.21505	-0.326000	0.08463	GAA		0.363	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Missense_Mutation
