#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCG4	64137	hgsc.bcm.edu	37	11	119029424	119029424	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr11:119029424C>A	ENST00000449422.2	+	11	1513	c.1325C>A	c.(1324-1326)aCt>aAt	p.T442N	ABCG4_ENST00000531739.1_Missense_Mutation_p.T442N|ABCG4_ENST00000307417.3_Missense_Mutation_p.T442N|AP002956.1_ENST00000599663.1_5'Flank	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	442	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.T442N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CTCATGCCAACTGTGCTCACC	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											96.0	85.0	89.0					11																	119029424		2200	4295	6495	118534634	SO:0001583	missense	64137			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1325C>A	11.37:g.119029424C>A	ENSP00000406874:p.Thr442Asn	Somatic		Capture	SOLID	Phase_III	118534634	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	37	CCDS8415.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962100	0.92791	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.72167	-0.63;-0.63;-0.63	5.63	5.63	0.86233	ABC-2 type transporter (1);	0.000000	0.85682	D	0.000000	D	0.87305	0.6144	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88712	0.3223	10	0.62326	D	0.03	-15.2087	19.266	0.93985	0.0:1.0:0.0:0.0	.	442	Q9H172	ABCG4_HUMAN	N	442	ENSP00000304111:T442N;ENSP00000406874:T442N;ENSP00000434318:T442N	ENSP00000304111:T442N	T	+	2	0	ABCG4	118534634	1.000000	0.71417	0.701000	0.30321	0.999000	0.98932	7.811000	0.86092	2.636000	0.89361	0.655000	0.94253	ACT		0.622	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169		Missense_Mutation
ACSS3	79611	hgsc.bcm.edu	37	12	81613841	81613841	+	Silent	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:81613841A>G	ENST00000548058.1	+	11	2410	c.1500A>G	c.(1498-1500)ggA>ggG	p.G500G	ACSS3_ENST00000548324.1_Silent_p.G182G|ACSS3_ENST00000261206.3_Silent_p.G499G			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	500						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.G500G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GGTGTTTAGGAAATATTGTGG	0.284																																																1	Substitution - coding silent(1)	ovary(1)	12											47.0	52.0	50.0					12																	81613841		2203	4300	6503	80137972	SO:0001819	synonymous_variant	79611				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1500A>G	12.37:g.81613841A>G		Somatic		Capture	SOLID	Phase_III	80137972	Q8NC66	Silent	SNP	ENST00000548058.1	37	CCDS9022.1	SNP	9	Baylor																																																																																				0.284	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560		Silent
ADAMTS17	170691	hgsc.bcm.edu	37	15	100821543	100821543	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr15:100821543C>A	ENST00000268070.4	-	4	785	c.680G>T	c.(679-681)cGg>cTg	p.R227L		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	227						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GCTGGTGAGCCGGATAGCGTT	0.632																																																0			15											37.0	35.0	36.0					15																	100821543		2203	4299	6502	98639066	SO:0001583	missense	170691			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.680G>T	15.37:g.100821543C>A	ENSP00000268070:p.Arg227Leu	Somatic		Capture	SOLID	Phase_III	98639066	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317639	0.40996	.	.	ENSG00000140470	ENST00000268070	T	0.63255	-0.03	4.89	-2.86	0.05717	.	0.662303	0.14663	N	0.305845	T	0.40791	0.1131	N	0.24115	0.695	0.28977	N	0.888856	P	0.37276	0.589	B	0.28916	0.096	T	0.12682	-1.0538	10	0.22706	T	0.39	.	15.8376	0.78811	0.0:0.9168:0.0:0.0832	.	227	Q8TE56	ATS17_HUMAN	L	227	ENSP00000268070:R227L	ENSP00000268070:R227L	R	-	2	0	ADAMTS17	98639066	0.046000	0.20272	0.147000	0.22382	0.618000	0.37518	0.232000	0.17891	-0.990000	0.03481	-0.965000	0.02619	CGG		0.632	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057		Missense_Mutation
AFAP1	60312	hgsc.bcm.edu	37	4	7840399	7840399	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr4:7840399T>A	ENST00000360265.4	-	5	812	c.578A>T	c.(577-579)cAg>cTg	p.Q193L	AFAP1_ENST00000358461.2_Missense_Mutation_p.Q193L|AFAP1_ENST00000382543.3_Missense_Mutation_p.Q193L|AFAP1_ENST00000420658.1_Missense_Mutation_p.Q193L			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	193	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						CAGTTCCATCTGAGGCTGCTG	0.463																																																0			4											175.0	161.0	166.0					4																	7840399		2203	4300	6503	7891299	SO:0001583	missense	60312			AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.578A>T	4.37:g.7840399T>A	ENSP00000353402:p.Gln193Leu	Somatic		Capture	SOLID	Phase_III	7891299	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	37	CCDS3397.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.1	4.979544	0.92982	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.10477	2.87;2.87;2.87;2.87	4.45	4.45	0.53987	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.058655	0.64402	D	0.000001	T	0.12817	0.0311	L	0.28115	0.83	0.80722	D	1	P;B	0.46457	0.878;0.005	P;B	0.49922	0.626;0.013	T	0.15292	-1.0442	10	0.26408	T	0.33	-47.5037	13.973	0.64252	0.0:0.0:0.0:1.0	.	193;193	E9PDT7;Q8N556	.;AFAP1_HUMAN	L	193	ENSP00000353402:Q193L;ENSP00000410689:Q193L;ENSP00000351245:Q193L;ENSP00000371983:Q193L	ENSP00000351245:Q193L	Q	-	2	0	AFAP1	7891299	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.247000	0.78257	1.898000	0.54952	0.524000	0.50904	CAG		0.463	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638		Missense_Mutation
ALPK2	115701	hgsc.bcm.edu	37	18	56191190	56191190	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr18:56191190G>A	ENST00000361673.3	-	7	5819	c.5606C>T	c.(5605-5607)gCt>gTt	p.A1869V		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1869	Ig-like 2.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A1230V(1)|p.A1869V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GTTAAATTCAGCAGTCACTTT	0.488																																																2	Substitution - Missense(2)	ovary(2)	18											124.0	114.0	118.0					18																	56191190		2203	4300	6503	54342170	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5606C>T	18.37:g.56191190G>A	ENSP00000354991:p.Ala1869Val	Somatic		Capture	SOLID	Phase_III	54342170	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.16	2.749982	0.49257	.	.	ENSG00000198796	ENST00000361673	T	0.69040	-0.37	5.58	5.58	0.84498	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Protein kinase-like domain (1);Immunoglobulin-like fold (1);	0.309163	0.29212	N	0.012808	T	0.80303	0.4598	M	0.68952	2.095	0.28615	N	0.908482	P	0.49862	0.929	P	0.61477	0.889	T	0.76005	-0.3117	10	0.87932	D	0	-3.8443	19.2367	0.93864	0.0:0.0:1.0:0.0	.	1869	Q86TB3	ALPK2_HUMAN	V	1869	ENSP00000354991:A1869V	ENSP00000354991:A1869V	A	-	2	0	ALPK2	54342170	1.000000	0.71417	0.681000	0.30009	0.354000	0.29330	6.004000	0.70709	2.629000	0.89072	0.650000	0.86243	GCT		0.488	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		Missense_Mutation
AMPH	273	hgsc.bcm.edu	37	7	38505071	38505071	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr7:38505071G>A	ENST00000356264.2	-	9	960	c.745C>T	c.(745-747)Ccc>Tcc	p.P249S	AMPH_ENST00000325590.5_Missense_Mutation_p.P249S|AMPH_ENST00000428293.2_Missense_Mutation_p.P249S	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	249					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.P249S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GCCTACCTGGGCGCTCCTTGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	7											59.0	49.0	52.0					7																	38505071		2203	4300	6503	38471596	SO:0001583	missense	273				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.745C>T	7.37:g.38505071G>A	ENSP00000348602:p.Pro249Ser	Somatic		Capture	SOLID	Phase_III	38471596	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508008	0.85282	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070	T;T;T	0.41758	0.99;0.99;0.99	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.63271	0.2497	M	0.66939	2.045	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.976	T	0.54788	-0.8241	10	0.30078	T	0.28	.	18.7629	0.91860	0.0:0.0:1.0:0.0	.	249;249	P49418-2;P49418	.;AMPH_HUMAN	S	249;249;249;19;249	ENSP00000317441:P249S;ENSP00000348602:P249S;ENSP00000390734:P249S	ENSP00000317441:P249S	P	-	1	0	AMPH	38471596	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.102000	0.89548	2.941000	0.99782	0.655000	0.94253	CCC		0.488	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		Missense_Mutation
APAF1	317	hgsc.bcm.edu	37	12	99061363	99061363	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:99061363G>A	ENST00000551964.1	+	10	2171	c.1435G>A	c.(1435-1437)Gac>Aac	p.D479N	APAF1_ENST00000359972.2_Missense_Mutation_p.D468N|APAF1_ENST00000339433.3_Missense_Mutation_p.D479N|APAF1_ENST00000547045.1_Missense_Mutation_p.D479N|APAF1_ENST00000357310.1_Missense_Mutation_p.D479N|APAF1_ENST00000550527.1_Missense_Mutation_p.D468N|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000549007.1_Missense_Mutation_p.D479N	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	479					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.D479N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	AGATCAGGAAGACTGTATGTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	12											133.0	123.0	126.0					12																	99061363		2203	4300	6503	97585494	SO:0001583	missense	317			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1435G>A	12.37:g.99061363G>A	ENSP00000448165:p.Asp479Asn	Somatic		Capture	SOLID	Phase_III	97585494	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037281	0.93630	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.62788	0.0;0.15;0.1;0.21;0.0;0.1;0.21	5.34	5.34	0.76211	.	0.045148	0.85682	D	0.000000	T	0.76807	0.4039	M	0.62723	1.935	0.80722	D	1	D;P;P;D	0.76494	0.999;0.926;0.624;0.997	D;P;P;D	0.79108	0.991;0.77;0.488;0.992	T	0.72734	-0.4204	10	0.27082	T	0.32	-24.2303	19.0609	0.93093	0.0:0.0:1.0:0.0	.	479;468;479;468	O14727-4;O14727-3;O14727;O14727-2	.;.;APAF_HUMAN;.	N	479;468;479;479;468;479;479	ENSP00000448165:D479N;ENSP00000353059:D468N;ENSP00000349862:D479N;ENSP00000341830:D479N;ENSP00000448449:D468N;ENSP00000449791:D479N;ENSP00000448161:D479N	ENSP00000341830:D479N	D	+	1	0	APAF1	97585494	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.984000	0.93482	2.503000	0.84419	0.467000	0.42956	GAC		0.413	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		Missense_Mutation
ARFGEF1	10565	hgsc.bcm.edu	37	8	68204116	68204116	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr8:68204116T>A	ENST00000262215.3	-	6	1271	c.882A>T	c.(880-882)gaA>gaT	p.E294D		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	294					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)	p.E294D(1)		breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTTCAGTCTGTTCATTTTCTG	0.423																																																1	Substitution - Missense(1)	ovary(1)	8											152.0	141.0	145.0					8																	68204116		2203	4300	6503	68366670	SO:0001583	missense	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.882A>T	8.37:g.68204116T>A	ENSP00000262215:p.Glu294Asp	Somatic		Capture	SOLID	Phase_III	68366670	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316001	0.40996	.	.	ENSG00000066777	ENST00000262215	T	0.20598	2.06	5.22	1.53	0.23141	Armadillo-type fold (1);	0.063176	0.64402	D	0.000007	T	0.17109	0.0411	L	0.53249	1.67	0.80722	D	1	B	0.18310	0.027	B	0.14023	0.01	T	0.10753	-1.0616	10	0.16420	T	0.52	.	9.3927	0.38383	0.0:0.3634:0.0:0.6366	.	294	Q9Y6D6	BIG1_HUMAN	D	294	ENSP00000262215:E294D	ENSP00000262215:E294D	E	-	3	2	ARFGEF1	68366670	0.121000	0.22262	0.998000	0.56505	0.996000	0.88848	-0.622000	0.05553	0.028000	0.15324	0.377000	0.23210	GAA		0.423	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		Missense_Mutation
ARR3	407	hgsc.bcm.edu	37	X	69489735	69489735	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:69489735G>C	ENST00000307959.8	+	4	133	c.82G>C	c.(82-84)Gac>Cac	p.D28H	ARR3_ENST00000374495.3_Missense_Mutation_p.D28H	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	28					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)		p.D28H(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						GGACCATGTGGACACGGTGGA	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											43.0	36.0	38.0					X																	69489735		2203	4300	6503	69406460	SO:0001583	missense	407				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.82G>C	X.37:g.69489735G>C	ENSP00000311538:p.Asp28His	Somatic		Capture	SOLID	Phase_III	69406460	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	ENST00000307959.8	37	CCDS14399.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850686	0.71719	.	.	ENSG00000120500	ENST00000374495;ENST00000374480;ENST00000307959	T;T	0.16073	2.37;2.37	4.64	4.64	0.57946	Arrestin, N-terminal (1);Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.202310	0.49916	D	0.000128	T	0.39226	0.1070	M	0.72479	2.2	0.53688	D	0.999975	D;D	0.69078	0.997;0.993	D;P	0.63877	0.919;0.898	T	0.30475	-0.9977	10	0.62326	D	0.03	.	15.6287	0.76885	0.0:0.0:1.0:0.0	.	28;28	P36575;P36575-2	ARRC_HUMAN;.	H	28	ENSP00000363619:D28H;ENSP00000311538:D28H	ENSP00000311538:D28H	D	+	1	0	ARR3	69406460	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	4.830000	0.62745	2.138000	0.66242	0.600000	0.82982	GAC		0.483	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312		Missense_Mutation
ASAP3	55616	hgsc.bcm.edu	37	1	23760008	23760008	+	Silent	SNP	C	C	A	rs143770418	byFrequency	TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:23760008C>A	ENST00000336689.3	-	21	2081	c.2037G>T	c.(2035-2037)gcG>gcT	p.A679A	ASAP3_ENST00000495646.1_Silent_p.A183A|ASAP3_ENST00000437606.2_Silent_p.A670A	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	679					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.A679A(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CAAAGGTCCCCGCCTGGGCCT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	1											97.0	108.0	104.0					1																	23760008		2203	4300	6503	23632595	SO:0001819	synonymous_variant	55616			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2037G>T	1.37:g.23760008C>A		Somatic		Capture	SOLID	Phase_III	23632595	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	ENST00000336689.3	37	CCDS235.1	SNP	23	Baylor																																																																																				0.592	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707		Silent
ATAD2	29028	hgsc.bcm.edu	37	8	124340475	124340475	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr8:124340475A>T	ENST00000287394.5	-	25	3930	c.3823T>A	c.(3823-3825)Tct>Act	p.S1275T	ATAD2_ENST00000521903.1_Missense_Mutation_p.S593T	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1275					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S1275T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGAGAGCTAGAAGCATCTCCA	0.294																																																1	Substitution - Missense(1)	ovary(1)	8											73.0	69.0	70.0					8																	124340475		2203	4299	6502	124409656	SO:0001583	missense	29028			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3823T>A	8.37:g.124340475A>T	ENSP00000287394:p.Ser1275Thr	Somatic		Capture	SOLID	Phase_III	124409656	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	4.286	0.052304	0.08291	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;T	0.91843	-2.92;1.5	5.08	-0.599	0.11645	.	1.760250	0.02605	N	0.101461	D	0.86981	0.6064	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.70615	-0.4823	10	0.25751	T	0.34	-4.1646	5.3878	0.16227	0.4622:0.2727:0.0:0.2652	.	1275	Q6PL18	ATAD2_HUMAN	T	1275;593	ENSP00000287394:S1275T;ENSP00000429213:S593T	ENSP00000287394:S1275T	S	-	1	0	ATAD2	124409656	0.000000	0.05858	0.006000	0.13384	0.057000	0.15508	0.265000	0.18515	0.301000	0.22738	0.528000	0.53228	TCT		0.294	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109		Missense_Mutation
BNC1	646	hgsc.bcm.edu	37	15	83932832	83932832	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr15:83932832C>T	ENST00000345382.2	-	4	1256	c.1171G>A	c.(1171-1173)Ggg>Agg	p.G391R	BNC1_ENST00000569704.1_Missense_Mutation_p.G384R|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	391					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G391W(1)|p.G391R(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						ATGTTACACCCTTCGATGGTG	0.507																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	15											150.0	135.0	140.0					15																	83932832		2203	4300	6503	81723836	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1171G>A	15.37:g.83932832C>T	ENSP00000307041:p.Gly391Arg	Somatic		Capture	SOLID	Phase_III	81723836	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668427	0.88348	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.62788	-0.0	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.81673	0.4872	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.83138	-0.0110	10	0.87932	D	0	-34.7995	19.9598	0.97242	0.0:1.0:0.0:0.0	.	384;391	F5GY04;Q01954	.;BNC1_HUMAN	R	391;384	ENSP00000307041:G391R	ENSP00000307041:G391R	G	-	1	0	BNC1	81723836	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.755000	0.85180	2.716000	0.92895	0.655000	0.94253	GGG		0.507	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		Missense_Mutation
SLC52A3	113278	hgsc.bcm.edu	37	20	744283	744283	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr20:744283T>C	ENST00000217254.7	-	3	1173	c.932A>G	c.(931-933)aAc>aGc	p.N311S	SLC52A3_ENST00000381944.3_Missense_Mutation_p.N311S|SLC52A3_ENST00000473664.1_Intron	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	311					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)	p.N311S(1)									GGTGAGCGCGTTGACGAAGGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	20											129.0	106.0	114.0					20																	744283		2203	4300	6503	692283	SO:0001583	missense	113278			AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.932A>G	20.37:g.744283T>C	ENSP00000217254:p.Asn311Ser	Somatic		Capture	SOLID	Phase_III	692283	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	37	CCDS13007.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.17	2.753796	0.49362	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	T;T	0.74421	-0.84;-0.84	5.07	5.07	0.68467	.	0.085679	0.85682	D	0.000000	T	0.78691	0.4323	L	0.53617	1.68	0.80722	D	1	D;D	0.63880	0.98;0.993	P;P	0.61940	0.753;0.896	T	0.76217	-0.3040	10	0.29301	T	0.29	-23.7881	9.0922	0.36619	0.0:0.0871:0.0:0.9129	.	311;311	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	S	311	ENSP00000217254:N311S;ENSP00000371370:N311S	ENSP00000217254:N311S	N	-	2	0	C20orf54	692283	1.000000	0.71417	0.885000	0.34714	0.088000	0.18126	5.071000	0.64382	1.912000	0.55364	0.459000	0.35465	AAC		0.637	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409		Missense_Mutation
C9orf3	84909	hgsc.bcm.edu	37	9	97522493	97522493	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr9:97522493T>C	ENST00000375315.2	+	1	428	c.428T>C	c.(427-429)tTg>tCg	p.L143S	C9orf3_ENST00000277198.2_Missense_Mutation_p.L143S|C9orf3_ENST00000297979.5_Missense_Mutation_p.L143S	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	143					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L143S(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		GAGGATTTTTTGCTAGTGTTG	0.448																																																1	Substitution - Missense(1)	ovary(1)	9											216.0	215.0	215.0					9																	97522493		2203	4300	6503	96562314	SO:0001583	missense	84909			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.428T>C	9.37:g.97522493T>C	ENSP00000364464:p.Leu143Ser	Somatic		Capture	SOLID	Phase_III	96562314	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	ENST00000375315.2	37	CCDS55328.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.060	0.994249	0.19043	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000427193	T;T;T;T	0.24723	2.62;2.6;2.8;1.84	4.78	3.61	0.41365	.	0.384199	0.24403	N	0.038836	T	0.22282	0.0537	M	0.62723	1.935	0.80722	D	1	B;P;B;B	0.34864	0.206;0.473;0.225;0.256	B;B;B;B	0.30943	0.052;0.122;0.032;0.067	T	0.03184	-1.1063	10	0.35671	T	0.21	-4.5386	7.2199	0.25981	0.0:0.0769:0.1478:0.7754	.	143;143;143;143	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	S	143;143;143;17	ENSP00000277198:L143S;ENSP00000297979:L143S;ENSP00000364464:L143S;ENSP00000387736:L17S	ENSP00000277198:L143S	L	+	2	0	C9orf3	96562314	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.403000	0.52615	0.919000	0.36945	0.460000	0.39030	TTG		0.448	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032823		Missense_Mutation
CADM3	57863	hgsc.bcm.edu	37	1	159163723	159163723	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:159163723C>T	ENST00000368125.4	+	5	741	c.584C>T	c.(583-585)aCa>aTa	p.T195I	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.T229I	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	195	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.T229I(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					AGCTCGGTGACATTCCAGGTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	96.0	102.0					1																	159163723		2203	4300	6503	157430347	SO:0001583	missense	57863			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.584C>T	1.37:g.159163723C>T	ENSP00000357107:p.Thr195Ile	Somatic		Capture	SOLID	Phase_III	157430347	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	37	CCDS44251.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191177	0.38707	.	.	ENSG00000162706	ENST00000368124;ENST00000368125	T;T	0.76448	-1.02;-1.02	5.0	1.86	0.25419	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.414834	0.25148	N	0.032777	T	0.47078	0.1426	N	0.26042	0.785	0.09310	N	0.999995	P;P	0.46220	0.589;0.874	B;P	0.45712	0.405;0.491	T	0.38499	-0.9658	10	0.26408	T	0.33	.	5.8103	0.18462	0.4645:0.4407:0.0:0.0948	.	195;229	Q8N126;Q8N126-2	CADM3_HUMAN;.	I	229;195	ENSP00000357106:T229I;ENSP00000357107:T195I	ENSP00000357106:T229I	T	+	2	0	CADM3	157430347	0.948000	0.32251	0.868000	0.34077	0.983000	0.72400	2.202000	0.42743	0.694000	0.31654	0.561000	0.74099	ACA		0.512	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189		Missense_Mutation
CASR	846	hgsc.bcm.edu	37	3	122003922	122003922	+	Missense_Mutation	SNP	C	C	T	rs193921082		TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:122003922C>T	ENST00000490131.1	+	7	3493	c.3121C>T	c.(3121-3123)Cgg>Tgg	p.R1041W	CASR_ENST00000498619.1_Missense_Mutation_p.R1051W|CASR_ENST00000296154.5_Missense_Mutation_p.R1041W	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	1041					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R1041W(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGGAGACCAGCGGCCAGAGGT	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											70.0	72.0	72.0					3																	122003922		2203	4300	6503	123486612	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.3121C>T	3.37:g.122003922C>T	ENSP00000418685:p.Arg1041Trp	Somatic		Capture	SOLID	Phase_III	123486612	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.865	-0.029157	0.07589	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89415	-2.51;-2.51;-2.51	5.27	5.27	0.74061	.	1.033920	0.07611	N	0.925384	T	0.80003	0.4544	N	0.19112	0.55	0.09310	N	1	P;P	0.44260	0.74;0.83	B;B	0.29942	0.109;0.075	T	0.71909	-0.4450	10	0.72032	D	0.01	.	11.9868	0.53153	0.1844:0.8156:0.0:0.0	.	1051;1041	E7ENE0;P41180	.;CASR_HUMAN	W	1041;1051;1041	ENSP00000418685:R1041W;ENSP00000420194:R1051W;ENSP00000296154:R1041W	ENSP00000296154:R1041W	R	+	1	2	CASR	123486612	0.766000	0.28496	0.050000	0.19076	0.011000	0.07611	2.488000	0.45276	2.632000	0.89209	0.561000	0.74099	CGG		0.567	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388		Missense_Mutation
CDKL1	8814	hgsc.bcm.edu	37	14	50805740	50805740	+	Silent	SNP	G	G	A	rs184318768		TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:50805740G>A	ENST00000216378.2	-	7	1310	c.666C>T	c.(664-666)ctC>ctT	p.L222L	CDKL1_ENST00000395834.1_Silent_p.L222L|CDKL1_ENST00000356146.1_5'UTR	NM_001282236.1	NP_001269165.1	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)	p.L222L(1)		endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					GCCTAGGAATGAGATCCCCTT	0.423													G|||	1	0.000199681	0.0008	0.0	5008	,	,		24685	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	14											157.0	152.0	154.0					14																	50805740		2203	4300	6503	49875490	SO:0001819	synonymous_variant	8814			AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000216378.2:c.666C>T	14.37:g.50805740G>A		Somatic		Capture	SOLID	Phase_III	49875490	Q2M3A4|Q6QUA0|Q8WXQ5	Silent	SNP	ENST00000216378.2	37		SNP	45	Baylor	2|2	9.157509157509158E-4|9.157509157509158E-4	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	9.390|9.390	1.075170|1.075170	0.20227|0.20227	.|.	.|.	ENSG00000100490|ENSG00000100490	ENST00000534267|ENST00000525911	.|.	.|.	.|.	5.23|5.23	5.23|5.23	0.72850|0.72850	.|.	.|.	.|.	.|.	.|.	T|T	0.62307|0.62307	0.2417|0.2417	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.58634|0.58634	-0.7602|-0.7602	4|4	.|.	.|.	.|.	.|.	11.3005|11.3005	0.49302|0.49302	0.1441:0.0:0.8559:0.0|0.1441:0.0:0.8559:0.0	.|.	.|.	.|.	.|.	Y|L	36|3	.|.	.|.	H|S	-|-	1|2	0|0	CDKL1|CDKL1	49875490|49875490	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.508000|0.508000	0.22692|0.22692	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	CAT|TCA		0.423	CDKL1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382103.1			Silent
COL4A6	1288	hgsc.bcm.edu	37	X	107406237	107406237	+	Silent	SNP	T	T	C	rs149076650	byFrequency	TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:107406237T>C	ENST00000372216.4	-	41	4204	c.4104A>G	c.(4102-4104)caA>caG	p.Q1368Q	COL4A6_ENST00000334504.7_Silent_p.Q1367Q|COL4A6_ENST00000394872.2_Silent_p.Q1368Q|COL4A6_ENST00000538570.1_Silent_p.Q1310Q|COL4A6_ENST00000545689.1_Silent_p.Q1343Q	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1368	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.Q1367Q(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CAGTTGGTGTTTGTCCAGGAT	0.622									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - coding silent(1)	ovary(1)	X						T	,	0,3835		0,0,0,1632,571	98.0	92.0	94.0		4104,4101	-1.3	0.7	X	dbSNP_134	94	2,6726		0,1,1,2427,1871	no	coding-synonymous,coding-synonymous	COL4A6	NM_001847.2,NM_033641.2	,	0,1,1,4059,2442	CC,CT,C,TT,T		0.0297,0.0,0.0189	,	1368/1692,1367/1691	107406237	2,10561	2203	4300	6503	107292893	SO:0001819	synonymous_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4104A>G	X.37:g.107406237T>C		Somatic		Capture	SOLID	Phase_III	107292893	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1	SNP	64	Baylor																																																																																				0.622	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			Silent
CTSE	1510	hgsc.bcm.edu	37	1	206328779	206328779	+	Silent	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:206328779A>T	ENST00000358184.2	+	7	964	c.846A>T	c.(844-846)acA>acT	p.T282T	CTSE_ENST00000432969.2_Intron|CTSE_ENST00000361052.3_Silent_p.T287T|CTSE_ENST00000360218.2_Intron	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	287					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.T282T(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TTGTGGACACAGGGACTTCCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	1											81.0	75.0	77.0					1																	206328779		2203	4300	6503	204495402	SO:0001819	synonymous_variant	1510			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.846A>T	1.37:g.206328779A>T		Somatic		Capture	SOLID	Phase_III	204495402	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	CCDS1462.1	SNP	7	Baylor																																																																																				0.617	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910		Silent
DKK2	27123	hgsc.bcm.edu	37	4	107845851	107845851	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr4:107845851C>G	ENST00000285311.3	-	3	1085	c.380G>C	c.(379-381)tGt>tCt	p.C127S	DKK2_ENST00000510463.1_Missense_Mutation_p.C81S|DKK2_ENST00000513208.1_Missense_Mutation_p.C27S	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	127	DKK-type Cys-1.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.C127S(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		AACTGGGATACAGATGCCTGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	4											189.0	182.0	184.0					4																	107845851		2203	4300	6503	108065300	SO:0001583	missense	27123			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.380G>C	4.37:g.107845851C>G	ENSP00000285311:p.Cys127Ser	Somatic		Capture	SOLID	Phase_III	108065300	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	CCDS3675.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430178	0.62844	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.58060	0.36;0.71;0.5	5.66	5.66	0.87406	Dickkopf, N-terminal cysteine-rich (1);	0.000000	0.85682	D	0.000000	T	0.75280	0.3828	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.87578	0.998;0.987	T	0.77469	-0.2576	10	0.87932	D	0	-10.5984	19.7302	0.96179	0.0:1.0:0.0:0.0	.	127;127	Q9H3R7;Q9UBU2	.;DKK2_HUMAN	S	127;27;81	ENSP00000285311:C127S;ENSP00000421255:C27S;ENSP00000423797:C81S	ENSP00000285311:C127S	C	-	2	0	DKK2	108065300	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	6.544000	0.73878	2.669000	0.90835	0.585000	0.79938	TGT		0.408	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4			Missense_Mutation
DOK6	220164	hgsc.bcm.edu	37	18	67508519	67508519	+	Frame_Shift_Del	DEL	C	C	-			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr18:67508519delC	ENST00000382713.5	+	8	1086	c.896delC	c.(895-897)acafs	p.T299fs		NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	299										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CGTGCACAGACATTTCCCAGC	0.507																																																0			18											146.0	143.0	144.0					18																	67508519		2203	4300	6503	65659499	SO:0001589	frameshift_variant	220164			AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.896delC	18.37:g.67508519delC	ENSP00000372160:p.Thr299fs	Somatic		Capture	SOLID	Phase_III	65659499	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Frame_Shift_Del	DEL	ENST00000382713.5	37	CCDS32841.1	DEL	17	Baylor																																																																																				0.507	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721		Frame_Shift_Del
DRD1	1812	hgsc.bcm.edu	37	5	174868790	174868790	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:174868790A>G	ENST00000393752.2	-	2	2305	c.1313T>C	c.(1312-1314)aTc>aCc	p.I438T		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	438				I -> M (in Ref. 2; CAA41734). {ECO:0000305}.	activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.I438T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GTTTTGTGTGATGGGTTGGAT	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											194.0	187.0	189.0					5																	174868790		2203	4300	6503	174801396	SO:0001583	missense	1812			X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.1313T>C	5.37:g.174868790A>G	ENSP00000377353:p.Ile438Thr	Somatic		Capture	SOLID	Phase_III	174801396	B2RA44|Q4QRJ0	Missense_Mutation	SNP	ENST00000393752.2	37	CCDS4393.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	5.916	0.353119	0.11182	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.69926	-0.44	5.41	4.26	0.50523	.	0.238793	0.40908	N	0.000992	T	0.52008	0.1708	N	0.25890	0.77	0.39040	D	0.960109	B	0.02656	0.0	B	0.04013	0.001	T	0.49881	-0.8892	10	0.46703	T	0.11	.	10.6852	0.45839	0.9248:0.0:0.0752:0.0	.	438	P21728	DRD1_HUMAN	T	438	ENSP00000377353:I438T	ENSP00000327652:I438T	I	-	2	0	DRD1	174801396	1.000000	0.71417	0.599000	0.28851	0.123000	0.20343	6.151000	0.71806	1.007000	0.39238	0.459000	0.35465	ATC		0.522	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	NM_000794		Missense_Mutation
ERBB2	2064	hgsc.bcm.edu	37	17	37881617	37881617	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr17:37881617G>A	ENST00000269571.5	+	22	2846	c.2687G>A	c.(2686-2688)cGc>cAc	p.R896H	ERBB2_ENST00000406381.2_Missense_Mutation_p.R866H|ERBB2_ENST00000445658.2_Missense_Mutation_p.R620H|ERBB2_ENST00000584601.1_Missense_Mutation_p.R866H|ERBB2_ENST00000584450.1_Missense_Mutation_p.R896H|ERBB2_ENST00000540147.1_Missense_Mutation_p.R866H|ERBB2_ENST00000541774.1_Missense_Mutation_p.R881H|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	896	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.R896H(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TCCATTCTCCGCCGGCGGTTC	0.607		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	1	Substitution - Missense(1)	ovary(1)	17											65.0	65.0	65.0					17																	37881617		2203	4300	6503	35135143	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2687G>A	17.37:g.37881617G>A	ENSP00000269571:p.Arg896His	Somatic		Capture	SOLID	Phase_III	35135143	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534053	0.45073	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	5.62	3.53	0.40419	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.29684	0.0741	N	0.03983	-0.305	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.23726	-1.0180	9	0.02654	T	1	.	6.9134	0.24347	0.1528:0.1449:0.7022:0.0	.	620;881;896	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	H	866;881;620;896;866	ENSP00000385185:R866H;ENSP00000446466:R881H;ENSP00000404047:R620H;ENSP00000269571:R896H;ENSP00000443562:R866H	ENSP00000269571:R896H	R	+	2	0	ERBB2	35135143	0.947000	0.32204	0.996000	0.52242	0.951000	0.60555	2.095000	0.41729	1.382000	0.46385	0.563000	0.77884	CGC		0.607	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2			Missense_Mutation
ERBB2IP	55914	hgsc.bcm.edu	37	5	65342358	65342358	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:65342358G>A	ENST00000284037.5	+	18	2169	c.1780G>A	c.(1780-1782)Gtt>Att	p.V594I	ERBB2IP_ENST00000506030.1_Missense_Mutation_p.V594I|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.V594I|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.V590I|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.V594I|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.V594I|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.V594I|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.V594I|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.V594I|ERBB2IP_ENST00000416865.2_Intron	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	594					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)	p.V594I(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CCATGATGATGTTTTTGAGGT	0.333																																																1	Substitution - Missense(1)	ovary(1)	5											119.0	127.0	124.0					5																	65342358		2203	4300	6503	65378114	SO:0001583	missense	55914				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.1780G>A	5.37:g.65342358G>A	ENSP00000284037:p.Val594Ile	Somatic		Capture	SOLID	Phase_III	65378114	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272596	0.40194	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.05081	3.5;3.5;3.5;3.5;3.5;3.5;3.5;3.5;3.5	5.68	1.77	0.24775	.	0.347112	0.29551	N	0.011840	T	0.02012	0.0063	N	0.08118	0	0.22479	N	0.999065	B;B;B;B;B;B;B	0.23806	0.0;0.001;0.001;0.0;0.0;0.002;0.091	B;B;B;B;B;B;B	0.23716	0.005;0.004;0.004;0.002;0.001;0.003;0.048	T	0.45116	-0.9283	10	0.02654	T	1	.	0.6276	0.00789	0.2586:0.1834:0.37:0.188	.	594;594;594;590;594;594;594	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	I	594;594;594;594;594;594;590;594;594	ENSP00000284037:V594I;ENSP00000370330:V594I;ENSP00000370326:V594I;ENSP00000370323:V594I;ENSP00000370322:V594I;ENSP00000370325:V594I;ENSP00000422766:V590I;ENSP00000426632:V594I;ENSP00000422015:V594I	ENSP00000284037:V594I	V	+	1	0	ERBB2IP	65378114	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.345000	0.44018	1.408000	0.46895	0.655000	0.94253	GTT		0.333	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695		Missense_Mutation
FAM71B	153745	hgsc.bcm.edu	37	5	156590505	156590505	+	Silent	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:156590505A>T	ENST00000302938.4	-	2	866	c.771T>A	c.(769-771)gcT>gcA	p.A257A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	257	Ala-rich.					nucleus (GO:0005634)		p.A257A(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTCCTTCAGCAGCCCCTGGAG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	5											93.0	79.0	84.0					5																	156590505		2203	4300	6503	156523083	SO:0001819	synonymous_variant	153745				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.771T>A	5.37:g.156590505A>T		Somatic		Capture	SOLID	Phase_III	156523083	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	37	CCDS4335.1	SNP	7	Baylor																																																																																				0.592	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899		Silent
FOXG1	2290	hgsc.bcm.edu	37	14	29237865	29237865	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:29237865G>C	ENST00000313071.4	+	1	1579	c.1380G>C	c.(1378-1380)ttG>ttC	p.L460F	FOXG1_ENST00000382535.3_Missense_Mutation_p.L460F	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	460					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L460F(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GACCCTCTTTGCCAAGTTTTA	0.557																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	14											81.0	81.0	81.0					14																	29237865		2203	4300	6503	28307616	SO:0001583	missense	2290				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1380G>C	14.37:g.29237865G>C	ENSP00000339004:p.Leu460Phe	Somatic		Capture	SOLID	Phase_III	28307616	A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	CCDS9636.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861165	0.51482	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.94280	-3.39;-3.39	4.14	4.14	0.48551	.	0.000000	0.64402	U	0.000010	D	0.93943	0.8061	L	0.27053	0.805	0.49915	D	0.999833	D	0.71674	0.998	D	0.78314	0.991	D	0.94827	0.7992	10	0.56958	D	0.05	.	16.7792	0.85559	0.0:0.0:1.0:0.0	.	460	P55316	FOXG1_HUMAN	F	460	ENSP00000371975:L460F;ENSP00000339004:L460F	ENSP00000339004:L460F	L	+	3	2	FOXG1	28307616	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.438000	0.52871	2.006000	0.58801	0.491000	0.48974	TTG		0.557	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3			Missense_Mutation
FCF1	51077	hgsc.bcm.edu	37	14	75200825	75200825	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:75200825G>T	ENST00000341162.4	+	7	554	c.500G>T	c.(499-501)aGa>aTa	p.R167I	FCF1_ENST00000534938.2_Missense_Mutation_p.R155I|FCF1_ENST00000553615.1_Missense_Mutation_p.R152I	NM_015962.4	NP_057046.1	Q9Y324	FCF1_HUMAN	FCF1 rRNA-processing protein	167					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.R167I(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.0037)		CTGAAAAGAAGAATCCGTAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	14											119.0	94.0	102.0					14																	75200825		2203	4300	6503	74270578	SO:0001583	missense	51077			AF132969	CCDS9832.1	14q24.2	2013-05-03	2013-05-03	2007-01-30	ENSG00000119616	ENSG00000119616			20220	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 111"", ""FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)"""	C14orf111		16762320	Standard	XR_245690		Approved	CGI-35, Bka, UTP24	uc001xqh.3	Q9Y324		ENST00000341162.4:c.500G>T	14.37:g.75200825G>T	ENSP00000344393:p.Arg167Ile	Somatic		Capture	SOLID	Phase_III	74270578	Q86TW8|Q8TBL8	Missense_Mutation	SNP	ENST00000341162.4	37	CCDS9832.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	35	5.434793	0.96150	.	.	ENSG00000119616	ENST00000341162;ENST00000534938;ENST00000553615	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.90202	0.6937	H	0.97315	3.98	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.80764	0.994;0.974	D	0.93475	0.6822	9	0.87932	D	0	.	18.8512	0.92230	0.0:0.0:1.0:0.0	.	167;152	Q9Y324;G3V5S9	FCF1_HUMAN;.	I	167;155;152	.	ENSP00000344393:R167I	R	+	2	0	FCF1	74270578	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.349000	0.97066	2.621000	0.88768	0.655000	0.94253	AGA		0.403	FCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413622.1	NM_015962		Missense_Mutation
FOXN4	121643	hgsc.bcm.edu	37	12	109717702	109717702	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:109717702A>T	ENST00000299162.5	-	10	1432	c.1328T>A	c.(1327-1329)tTc>tAc	p.F443Y	FOXN4_ENST00000355216.1_Missense_Mutation_p.F263Y	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	443					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F263Y(1)		large_intestine(5)|lung(9)|ovary(2)	16						GTCCAAGCTGAATCCCTCATC	0.577																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	75.0	82.0					12																	109717702		2203	4300	6503	108202085	SO:0001583	missense	121643			AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1328T>A	12.37:g.109717702A>T	ENSP00000299162:p.Phe443Tyr	Somatic		Capture	SOLID	Phase_III	108202085	Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	CCDS9126.2	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740806	0.89573	.	.	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.95377	-3.69;-3.37	4.72	4.72	0.59763	.	0.118734	0.64402	D	0.000018	D	0.97028	0.9029	M	0.72894	2.215	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.70227	0.968;0.959	D	0.97440	1.0021	10	0.66056	D	0.02	-14.1483	13.7208	0.62725	1.0:0.0:0.0:0.0	.	443;443	A6H901;Q96NZ1	.;FOXN4_HUMAN	Y	263;443	ENSP00000347354:F263Y;ENSP00000299162:F443Y	ENSP00000299162:F443Y	F	-	2	0	FOXN4	108202085	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.858000	0.92256	1.901000	0.55032	0.402000	0.26972	TTC		0.577	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735		Missense_Mutation
FOXP2	93986	hgsc.bcm.edu	37	7	114304392	114304392	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr7:114304392G>A	ENST00000393494.2	+	16	2183	c.1904G>A	c.(1903-1905)aGt>aAt	p.S635N	FOXP2_ENST00000393498.2_Missense_Mutation_p.S614N|FOXP2_ENST00000403559.4_Missense_Mutation_p.S652N|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000393489.3_Missense_Mutation_p.S543N|FOXP2_ENST00000350908.4_Missense_Mutation_p.S635N|FOXP2_ENST00000393491.3_Missense_Mutation_p.S450N|FOXP2_ENST00000408937.3_Missense_Mutation_p.S660N			O15409	FOXP2_HUMAN	forkhead box P2	635					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S660N(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AATGCATCCAGTGGCCTACTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											91.0	82.0	85.0					7																	114304392		2203	4300	6503	114091628	SO:0001583	missense	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1904G>A	7.37:g.114304392G>A	ENSP00000377132:p.Ser635Asn	Somatic		Capture	SOLID	Phase_III	114091628	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	37	CCDS5760.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538030	0.27475	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.91295	-2.55;-2.54;-2.56;-2.55;-2.61;-2.82	5.57	5.57	0.84162	.	0.407107	0.31370	N	0.007773	D	0.83959	0.5367	N	0.19112	0.55	0.80722	D	1	B;B;B;B;B	0.19817	0.039;0.003;0.024;0.039;0.016	B;B;B;B;B	0.19148	0.007;0.003;0.024;0.007;0.006	T	0.79288	-0.1865	10	0.37606	T	0.19	.	15.0717	0.72042	0.0:0.1414:0.8586:0.0	.	634;652;450;635;660	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	N	635;660;652;635;612;543;450	ENSP00000377132:S635N;ENSP00000386200:S660N;ENSP00000385069:S652N;ENSP00000265436:S635N;ENSP00000377129:S543N;ENSP00000377130:S450N	ENSP00000265436:S635N	S	+	2	0	FOXP2	114091628	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.491000	0.60326	2.614000	0.88457	0.655000	0.94253	AGT		0.473	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491		Missense_Mutation
PSMC5	5705	hgsc.bcm.edu	37	17	61903952	61903952	+	5'Flank	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr17:61903952C>A	ENST00000310144.6	+	0	0				PSMC5_ENST00000581882.1_5'Flank|FTSJ3_ENST00000427159.2_Missense_Mutation_p.D50Y|FTSJ3_ENST00000580295.1_5'Flank|PSMC5_ENST00000580864.1_5'Flank|PSMC5_ENST00000375812.4_5'Flank	NM_002805.5	NP_002796.4	P62195	PRS8_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of inclusion body assembly (GO:0090261)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|nuclear proteasome complex (GO:0031595)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|thyrotropin-releasing hormone receptor binding (GO:0031531)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.D50Y(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	20						GCACACAGGTCCAGCAAGGCT	0.567																																																1	Substitution - Missense(1)	ovary(1)	17											51.0	50.0	50.0					17																	61903952		2203	4300	6503	59257684	SO:0001631	upstream_gene_variant	117246			L38810	CCDS11645.1, CCDS56043.1	17q23.3	2010-04-21			ENSG00000087191	ENSG00000087191		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9552	protein-coding gene	gene with protein product		601681				9473509, 9048938	Standard	NM_002805		Approved	SUG1, p45/SUG, TBP10, p45, S8, TRIP1, SUG-1	uc002jcb.3	P62195			17.37:g.61903952C>A	Exception_encountered	Somatic		Capture	SOLID	Phase_III	59257684	A8K3Z3|A8K763|O35051|O43208|P47210|P52915|P52916	Missense_Mutation	SNP	ENST00000310144.6	37	CCDS11645.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959442	0.53400	.	.	ENSG00000108592	ENST00000427159	D	0.82167	-1.58	5.51	4.54	0.55810	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.85682	D	0.000000	D	0.95268	0.8465	H	0.99712	4.72	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97115	0.9807	10	0.87932	D	0	-21.2227	14.2006	0.65703	0.0:0.8496:0.1504:0.0	.	50	Q8IY81	RRMJ3_HUMAN	Y	50	ENSP00000396673:D50Y	ENSP00000396673:D50Y	D	-	1	0	FTSJ3	59257684	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.808000	0.75206	1.552000	0.49463	0.561000	0.74099	GAC		0.567	PSMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444404.1	NM_002805		Missense_Mutation
GLI1	2735	hgsc.bcm.edu	37	12	57858598	57858598	+	Silent	SNP	G	G	A	rs371273350		TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:57858598G>A	ENST00000228682.2	+	4	427	c.336G>A	c.(334-336)tcG>tcA	p.S112S	GLI1_ENST00000543426.1_5'UTR|GLI1_ENST00000546141.1_Silent_p.S71S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	112					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.S112S(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			TCATCAACTCGCGATGCACAT	0.602																																					Pancreas(157;841 1936 10503 41495 50368)											1	Substitution - coding silent(1)	ovary(1)	12											133.0	111.0	119.0					12																	57858598		2203	4300	6503	56144865	SO:0001819	synonymous_variant	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.336G>A	12.37:g.57858598G>A		Somatic		Capture	SOLID	Phase_III	56144865	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	ENST00000228682.2	37	CCDS8940.1	SNP	38	Baylor																																																																																				0.602	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		Silent
GRIK4	2900	hgsc.bcm.edu	37	11	120702670	120702670	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr11:120702670C>T	ENST00000527524.2	+	7	908	c.621C>T	c.(619-621)atC>atT	p.I207I	GRIK4_ENST00000438375.2_Silent_p.I207I	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	207					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.I207I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TCAAGGAGATCCGGGACGACA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	11											120.0	107.0	112.0					11																	120702670		2203	4299	6502	120207880	SO:0001819	synonymous_variant	2900			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.621C>T	11.37:g.120702670C>T		Somatic		Capture	SOLID	Phase_III	120207880	A8K9L1	Silent	SNP	ENST00000527524.2	37	CCDS8433.1	SNP	30	Baylor																																																																																				0.627	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619		Silent
GUCY2C	2984	hgsc.bcm.edu	37	12	14794039	14794039	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:14794039G>A	ENST00000261170.3	-	18	2181	c.2045C>T	c.(2044-2046)aCt>aTt	p.T682I		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	682	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.T682I(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACAGCTCAAAGTGTAGAAGGT	0.512																																																1	Substitution - Missense(1)	ovary(1)	12											147.0	104.0	119.0					12																	14794039		2203	4300	6503	14685306	SO:0001583	missense	2984				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2045C>T	12.37:g.14794039G>A	ENSP00000261170:p.Thr682Ile	Somatic		Capture	SOLID	Phase_III	14685306	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122467	0.56613	.	.	ENSG00000070019	ENST00000261170	T	0.62639	0.01	5.34	5.34	0.76211	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69450	0.3112	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63756	-0.6565	10	0.18710	T	0.47	.	19.0276	0.92939	0.0:0.0:1.0:0.0	.	682	P25092	GUC2C_HUMAN	I	682	ENSP00000261170:T682I	ENSP00000261170:T682I	T	-	2	0	GUCY2C	14685306	1.000000	0.71417	0.936000	0.37596	0.447000	0.32167	5.533000	0.67160	2.495000	0.84180	0.655000	0.94253	ACT		0.512	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1			Missense_Mutation
HACE1	57531	hgsc.bcm.edu	37	6	105244592	105244592	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:105244592G>T	ENST00000262903.4	-	9	1030	c.754C>A	c.(754-756)Cac>Aac	p.H252N	HACE1_ENST00000369125.2_Missense_Mutation_p.H252N	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	252					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.H252N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		AGCCTCGGGTGATATTGAATT	0.333																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	78.0	78.0					6																	105244592		2202	4298	6500	105351285	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.754C>A	6.37:g.105244592G>T	ENSP00000262903:p.His252Asn	Somatic		Capture	SOLID	Phase_III	105351285	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.82	3.484269	0.63962	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.63580	-0.05;-0.05	5.4	5.4	0.78164	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	N	0.24115	0.695	0.80722	D	1	P;P	0.45126	0.851;0.851	P;P	0.58391	0.838;0.775	T	0.48779	-0.9005	10	0.06236	T	0.91	.	19.1639	0.93546	0.0:0.0:1.0:0.0	.	252;252	E9PGP0;Q8IYU2	.;HACE1_HUMAN	N	252	ENSP00000262903:H252N;ENSP00000358121:H252N	ENSP00000262903:H252N	H	-	1	0	HACE1	105351285	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.958000	0.93099	2.517000	0.84864	0.585000	0.79938	CAC		0.333	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		Missense_Mutation
HCFC2	29915	hgsc.bcm.edu	37	12	104473358	104473358	+	Silent	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:104473358T>C	ENST00000229330.4	+	4	713	c.609T>C	c.(607-609)tcT>tcC	p.S203S		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	203					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)	p.S203S(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						AAAAAGATTCTGGAAGTCCTA	0.448																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)											1	Substitution - coding silent(1)	ovary(1)	12											152.0	159.0	156.0					12																	104473358		2203	4300	6503	102997488	SO:0001819	synonymous_variant	29915			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.609T>C	12.37:g.104473358T>C		Somatic		Capture	SOLID	Phase_III	102997488	B2R8Q5|C0H5X3	Silent	SNP	ENST00000229330.4	37	CCDS9097.1	SNP	55	Baylor																																																																																				0.448	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320		Silent
IGF2R	3482	hgsc.bcm.edu	37	6	160517553	160517553	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:160517553C>T	ENST00000356956.1	+	45	6886	c.6738C>T	c.(6736-6738)ttC>ttT	p.F2246F	IGF2R_ENST00000475584.1_3'UTR|RP11-288H12.3_ENST00000569097.1_RNA	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2246					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.F2246F(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CCATCTTCTTCCACTGTGACC	0.552																																																1	Substitution - coding silent(1)	ovary(1)	6											257.0	202.0	220.0					6																	160517553		2203	4300	6503	160437543	SO:0001819	synonymous_variant	3482			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6738C>T	6.37:g.160517553C>T		Somatic		Capture	SOLID	Phase_III	160437543	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1	SNP	30	Baylor																																																																																				0.552	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		Silent
IL17RC	84818	hgsc.bcm.edu	37	3	9962623	9962623	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:9962623G>A	ENST00000295981.3	+	7	1023	c.805G>A	c.(805-807)Gaa>Aaa	p.E269K	RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000413608.1_Missense_Mutation_p.E198K|IL17RC_ENST00000416074.2_Intron|IL17RC_ENST00000383812.4_Intron|IL17RC_ENST00000498214.1_Intron|IL17RC_ENST00000455057.1_Intron|IL17RC_ENST00000403601.3_Missense_Mutation_p.E198K	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	269					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)	p.E269K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CAGGGGGCTCGAAGTCTGGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											28.0	30.0	29.0					3																	9962623		2203	4300	6503	9937623	SO:0001583	missense	84818			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.805G>A	3.37:g.9962623G>A	ENSP00000295981:p.Glu269Lys	Somatic		Capture	SOLID	Phase_III	9937623	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	37	CCDS2590.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046233	0.75846	.	.	ENSG00000163702	ENST00000295981;ENST00000436503;ENST00000403601;ENST00000413608	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	5.59	2.72	0.32119	.	0.269330	0.26293	N	0.025201	T	0.11836	0.0288	L	0.44542	1.39	0.46028	D	0.998823	B;P;P;B;P	0.48764	0.052;0.915;0.915;0.213;0.83	B;B;B;B;B	0.35655	0.016;0.207;0.207;0.022;0.187	T	0.04811	-1.0925	10	0.66056	D	0.02	-3.0627	7.7861	0.29093	0.0867:0.2784:0.6349:0.0	.	198;198;198;269;198	A8BWD5;E9PHJ6;A8BWC9;Q8NAC3;Q8NAC3-2	.;.;.;I17RC_HUMAN;.	K	269;173;198;198	ENSP00000295981:E269K;ENSP00000401128:E173K;ENSP00000384969:E198K;ENSP00000396064:E198K	ENSP00000295981:E269K	E	+	1	0	IL17RC	9937623	0.971000	0.33674	0.348000	0.25681	0.994000	0.84299	1.705000	0.37867	0.271000	0.22005	0.557000	0.71058	GAA		0.627	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732		Missense_Mutation
IL6R	3570	hgsc.bcm.edu	37	1	154437778	154437778	+	Silent	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:154437778G>A	ENST00000368485.3	+	10	1766	c.1329G>A	c.(1327-1329)tcG>tcA	p.S443S	IL6R_ENST00000344086.4_3'UTR|IL6R_ENST00000507256.1_3'UTR	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	443					acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)	p.S443S(1)	IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	ACAATACCTCGAGCCACAACC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											60.0	63.0	62.0					1																	154437778		2203	4300	6503	152704402	SO:0001819	synonymous_variant	3570			X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.1329G>A	1.37:g.154437778G>A		Somatic		Capture	SOLID	Phase_III	152704402	A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Silent	SNP	ENST00000368485.3	37	CCDS1067.1	SNP	37	Baylor																																																																																				0.622	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565		Silent
ITSN1	6453	hgsc.bcm.edu	37	21	35254666	35254666	+	Silent	SNP	C	C	G			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr21:35254666C>G	ENST00000381318.3	+	35	4749	c.4461C>G	c.(4459-4461)ctC>ctG	p.L1487L	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Silent_p.L1426L|ITSN1_ENST00000399367.3_Silent_p.L1482L|ITSN1_ENST00000381285.4_Silent_p.L1487L|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1487	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1487L(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						ACGACTTCCTCCTGCTGACTC	0.478																																																1	Substitution - coding silent(1)	ovary(1)	21											72.0	68.0	69.0					21																	35254666		2203	4300	6503	34176536	SO:0001819	synonymous_variant	6453			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.4461C>G	21.37:g.35254666C>G		Somatic		Capture	SOLID	Phase_III	34176536	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Silent	SNP	ENST00000381318.3	37	CCDS33545.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.964	0.971366	0.18736	.	.	ENSG00000205726	ENST00000381284	.	.	.	5.8	-0.665	0.11403	.	.	.	.	.	T	0.54240	0.1846	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46582	-0.9181	4	.	.	.	.	8.2616	0.31788	0.0:0.3797:0.4342:0.1862	.	.	.	.	A	167	.	.	P	+	1	0	ITSN1	34176536	0.998000	0.40836	0.995000	0.50966	0.998000	0.95712	0.359000	0.20233	-0.145000	0.11294	0.655000	0.94253	CCT		0.478	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024		Silent
KAL1	3730	hgsc.bcm.edu	37	X	8591675	8591675	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:8591675T>C	ENST00000262648.3	-	3	441	c.292A>G	c.(292-294)Aaa>Gaa	p.K98E		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	98					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.K98E(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						CACTGGTGTTTCCTCAGGTCC	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											133.0	96.0	108.0					X																	8591675		2203	4300	6503	8551675	SO:0001583	missense	3730				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.292A>G	X.37:g.8591675T>C	ENSP00000262648:p.Lys98Glu	Somatic		Capture	SOLID	Phase_III	8551675	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	CCDS14130.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	7.751	0.703344	0.15172	.	.	ENSG00000011201	ENST00000262648	T	0.74737	-0.87	4.55	4.55	0.56014	.	0.239554	0.43416	N	0.000570	T	0.56848	0.2013	N	0.17082	0.46	0.25441	N	0.988094	B	0.06786	0.001	B	0.10450	0.005	T	0.47182	-0.9137	10	0.34782	T	0.22	.	9.5211	0.39135	0.0:0.0:0.0:1.0	.	98	P23352	KALM_HUMAN	E	98	ENSP00000262648:K98E	ENSP00000262648:K98E	K	-	1	0	KAL1	8551675	1.000000	0.71417	0.404000	0.26397	0.881000	0.50899	2.946000	0.49050	1.506000	0.48736	0.486000	0.48141	AAA		0.438	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216		Missense_Mutation
KDM3B	51780	hgsc.bcm.edu	37	5	137708418	137708418	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:137708418A>G	ENST00000314358.5	+	2	448	c.248A>G	c.(247-249)cAt>cGt	p.H83R		NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	83					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.H83R(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GTAAAAGTTCATGCTGAGGAA	0.473																																																1	Substitution - Missense(1)	ovary(1)	5											112.0	107.0	108.0					5																	137708418		2203	4300	6503	137736317	SO:0001583	missense	51780			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.248A>G	5.37:g.137708418A>G	ENSP00000326563:p.His83Arg	Somatic		Capture	SOLID	Phase_III	137736317	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	21.6	4.178355	0.78564	.	.	ENSG00000120733	ENST00000314358	T	0.62232	0.04	5.11	5.11	0.69529	.	0.111741	0.64402	D	0.000008	T	0.71779	0.3380	L	0.43152	1.355	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.74515	-0.3640	10	0.66056	D	0.02	5.3653	15.0503	0.71862	1.0:0.0:0.0:0.0	.	83	Q7LBC6	KDM3B_HUMAN	R	83	ENSP00000326563:H83R	ENSP00000326563:H83R	H	+	2	0	KDM3B	137736317	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.541000	0.73865	2.142000	0.66516	0.460000	0.39030	CAT		0.473	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604		Missense_Mutation
TTI1	9675	hgsc.bcm.edu	37	20	36641604	36641604	+	Missense_Mutation	SNP	C	C	G			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr20:36641604C>G	ENST00000373448.2	-	3	853	c.615G>C	c.(613-615)ttG>ttC	p.L205F	TTI1_ENST00000449821.1_Missense_Mutation_p.L205F|TTI1_ENST00000373447.3_Missense_Mutation_p.L205F|TTI1_ENST00000487362.1_Intron	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	205					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.L205F(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AAGAGGCAAACAAATCCCCCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	20											74.0	76.0	75.0					20																	36641604		2203	4300	6503	36075018	SO:0001583	missense	9675			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.615G>C	20.37:g.36641604C>G	ENSP00000362547:p.Leu205Phe	Somatic		Capture	SOLID	Phase_III	36075018	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.58	1.980536	0.34942	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.15718	2.4;2.4;2.4	5.45	3.54	0.40534	Armadillo-like helical (1);Armadillo-type fold (1);	0.188176	0.48767	D	0.000174	T	0.36441	0.0967	M	0.72118	2.19	0.42105	D	0.991357	D	0.71674	0.998	D	0.65443	0.935	T	0.11690	-1.0577	10	0.52906	T	0.07	-20.1706	11.3495	0.49579	0.0:0.8546:0.0:0.1454	.	205	O43156	TTI1_HUMAN	F	205	ENSP00000362547:L205F;ENSP00000362546:L205F;ENSP00000407270:L205F	ENSP00000362546:L205F	L	-	3	2	TTI1	36075018	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	1.380000	0.34351	0.875000	0.35847	-0.142000	0.14014	TTG		0.428	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		Missense_Mutation
KIAA1324L	222223	hgsc.bcm.edu	37	7	86556192	86556192	+	Missense_Mutation	SNP	C	C	T	rs367624349		TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr7:86556192C>T	ENST00000450689.2	-	9	1315	c.1130G>A	c.(1129-1131)cGg>cAg	p.R377Q	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.R377Q|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.R210Q|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.R137Q	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	377						integral component of membrane (GO:0016021)		p.R137Q(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GAGATCCTCCCGGCAGATTTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	7						C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	106.0	106.0	106.0		1130,629	4.3	1.0	7		106	0,8600		0,0,4300	no	missense,missense	KIAA1324L	NM_001142749.2,NM_152748.3	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	377/1030,210/863	86556192	1,13005	2203	4300	6503	86394128	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1130G>A	7.37:g.86556192C>T	ENSP00000413445:p.Arg377Gln	Somatic		Capture	SOLID	Phase_III	86394128	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340523	0.24339	2.27E-4	0.0	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	5.23	4.34	0.51931	Growth factor, receptor (1);	0.131235	0.51477	D	0.000097	T	0.11495	0.0280	L	0.41492	1.28	0.46096	D	0.998861	B;B;B	0.18741	0.03;0.001;0.003	B;B;B	0.10450	0.005;0.002;0.002	T	0.08973	-1.0696	10	0.13108	T	0.6	.	13.8273	0.63359	0.0:0.9217:0.0:0.0783	.	377;137;210	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	Q	377;137;377;210	ENSP00000413445:R377Q;ENSP00000297222:R137Q;ENSP00000397377:R377Q;ENSP00000402390:R210Q	ENSP00000297222:R137Q	R	-	2	0	KIAA1324L	86394128	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	2.219000	0.42899	2.596000	0.87737	0.563000	0.77884	CGG		0.378	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		Missense_Mutation
KIT	3815	hgsc.bcm.edu	37	4	55561702	55561702	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr4:55561702C>T	ENST00000288135.5	+	2	189	c.92C>T	c.(91-93)cCa>cTa	p.P31L		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	31	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P31L(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTGTGAGTCCAGGGGAACCG	0.478		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	ovary(1)	4											70.0	64.0	66.0					4																	55561702		2203	4300	6503	55256459	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.92C>T	4.37:g.55561702C>T	ENSP00000288135:p.Pro31Leu	Somatic		Capture	SOLID	Phase_III	55256459	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027098	0.54683	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.76968	-1.05;-1.06	5.36	5.36	0.76844	Immunoglobulin-like fold (1);	0.136869	0.34507	N	0.003910	T	0.81640	0.4865	L	0.50333	1.59	0.58432	D	0.999993	D;D	0.89917	0.998;1.0	D;D	0.85130	0.969;0.997	T	0.75252	-0.3383	10	0.09590	T	0.72	.	11.5015	0.50441	0.1787:0.8213:0.0:0.0	.	31;31	P10721-2;P10721	.;KIT_HUMAN	L	31	ENSP00000288135:P31L;ENSP00000390987:P31L	ENSP00000288135:P31L	P	+	2	0	KIT	55256459	0.998000	0.40836	0.984000	0.44739	0.435000	0.31806	3.347000	0.52200	2.788000	0.95919	0.650000	0.86243	CCA		0.478	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Missense_Mutation
KTN1	3895	hgsc.bcm.edu	37	14	56104028	56104028	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:56104028G>A	ENST00000395314.3	+	11	1730	c.1662G>A	c.(1660-1662)atG>atA	p.M554I	KTN1_ENST00000413890.2_Missense_Mutation_p.M554I|KTN1_ENST00000395311.1_Missense_Mutation_p.M554I|KTN1_ENST00000416613.1_Missense_Mutation_p.M554I|KTN1_ENST00000438792.2_Missense_Mutation_p.M554I|KTN1_ENST00000395308.1_Missense_Mutation_p.M554I|KTN1_ENST00000395309.3_Missense_Mutation_p.M554I	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	554					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.M554I(1)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TGCAGTTAATGGAATCAGAGC	0.348			T	RET	papillary thryoid																																		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	1	Substitution - Missense(1)	ovary(1)	14											100.0	104.0	103.0					14																	56104028		2203	4300	6503	55173781	SO:0001583	missense	3895				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.1662G>A	14.37:g.56104028G>A	ENSP00000378725:p.Met554Ile	Somatic		Capture	SOLID	Phase_III	55173781	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291454	0.40494	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000554567;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	T;T;T;T;T;T;T	0.33216	1.42;1.43;1.46;1.43;1.42;1.42;1.43	5.29	3.41	0.39046	.	0.208982	0.33496	N	0.004852	T	0.38799	0.1054	L	0.31926	0.97	0.34357	D	0.690508	B;D;B;B	0.59767	0.063;0.986;0.036;0.012	B;D;B;B	0.71656	0.023;0.974;0.044;0.023	T	0.47886	-0.9082	10	0.38643	T	0.18	-12.5324	9.0377	0.36298	0.0701:0.0:0.6666:0.2633	.	554;554;554;554	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	I	554;554;4;554;554;554;554;554	ENSP00000394992:M554I;ENSP00000378720:M554I;ENSP00000391964:M554I;ENSP00000378725:M554I;ENSP00000378719:M554I;ENSP00000378722:M554I;ENSP00000388807:M554I	ENSP00000378719:M554I	M	+	3	0	KTN1	55173781	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.967000	0.56802	0.678000	0.31325	0.563000	0.77884	ATG		0.348	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2			Missense_Mutation
LAMB4	22798	hgsc.bcm.edu	37	7	107696175	107696175	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr7:107696175G>T	ENST00000388781.3	-	25	3740	c.3657C>A	c.(3655-3657)gaC>gaA	p.D1219E	LAMB4_ENST00000205386.4_Missense_Mutation_p.D1219E|LAMB4_ENST00000388780.3_Missense_Mutation_p.D1219E	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1219	Domain II.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.D1219E(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TCCCTCTGAGGTCTTTGAAGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	7											79.0	80.0	80.0					7																	107696175		2203	4300	6503	107483411	SO:0001583	missense	22798			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3657C>A	7.37:g.107696175G>T	ENSP00000373433:p.Asp1219Glu	Somatic		Capture	SOLID	Phase_III	107483411	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	1.864	-0.461818	0.04508	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.33438	1.41;1.41;1.98;1.59	4.8	2.97	0.34412	.	0.621077	0.13418	N	0.389391	T	0.13243	0.0321	N	0.14661	0.345	0.40373	D	0.979367	B;B	0.14805	0.001;0.011	B;B	0.15870	0.003;0.014	T	0.17228	-1.0376	10	0.02654	T	1	.	4.9888	0.14203	0.2345:0.0:0.6184:0.147	.	1219;1219	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	E	1219;1219;245;1219	ENSP00000205386:D1219E;ENSP00000373433:D1219E;ENSP00000416562:D245E;ENSP00000373432:D1219E	ENSP00000205386:D1219E	D	-	3	2	LAMB4	107483411	1.000000	0.71417	0.952000	0.39060	0.988000	0.76386	1.261000	0.32980	0.614000	0.30107	0.655000	0.94253	GAC		0.433	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857		Missense_Mutation
LHFPL4	375323	hgsc.bcm.edu	37	3	9547725	9547725	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:9547725A>T	ENST00000287585.6	-	3	854	c.569T>A	c.(568-570)cTc>cAc	p.L190H		NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	203						integral component of membrane (GO:0016021)		p.L190H(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					GAGGAAGGAGAGGATGAGGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	3											149.0	116.0	127.0					3																	9547725		2203	4300	6503	9522725	SO:0001583	missense	375323			AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.569T>A	3.37:g.9547725A>T	ENSP00000287585:p.Leu190His	Somatic		Capture	SOLID	Phase_III	9522725	A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000287585.6	37	CCDS33691.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.9	4.786061	0.90282	.	.	ENSG00000156959	ENST00000287585	T	0.81163	-1.46	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000011	D	0.91590	0.7343	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93401	0.6760	10	0.87932	D	0	-22.9845	15.4563	0.75318	1.0:0.0:0.0:0.0	.	190	Q7Z7J7	LHPL4_HUMAN	H	190	ENSP00000287585:L190H	ENSP00000287585:L190H	L	-	2	0	LHFPL4	9522725	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.141000	0.66446	0.533000	0.62120	CTC		0.622	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	NM_198560		Missense_Mutation
LRP1	4035	hgsc.bcm.edu	37	12	57602963	57602963	+	Silent	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:57602963G>T	ENST00000243077.3	+	79	12709	c.12243G>T	c.(12241-12243)gtG>gtT	p.V4081V		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4081					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.V4081V(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACCCCATTGTGGCTGCTGACA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	12											51.0	46.0	48.0					12																	57602963		2203	4300	6503	55889230	SO:0001819	synonymous_variant	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12243G>T	12.37:g.57602963G>T		Somatic		Capture	SOLID	Phase_III	55889230	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	47	Baylor																																																																																				0.607	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Silent
LRP1B	53353	hgsc.bcm.edu	37	2	141259421	141259421	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr2:141259421A>T	ENST00000389484.3	-	55	9656	c.8685T>A	c.(8683-8685)ttT>ttA	p.F2895L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2895	LDL-receptor class A 20. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.F2895L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCACATAAAAAATGAACTGT	0.373										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											45.0	44.0	44.0					2																	141259421		2203	4299	6502	140975891	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8685T>A	2.37:g.141259421A>T	ENSP00000374135:p.Phe2895Leu	Somatic		Capture	SOLID	Phase_III	140975891	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.42	2.529648	0.44969	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95377	-3.69	5.95	4.81	0.61882	.	0.000000	0.85682	U	0.000000	D	0.88822	0.6541	N	0.12569	0.235	0.44092	D	0.996853	P	0.38280	0.625	B	0.40741	0.339	D	0.86316	0.1689	10	0.10902	T	0.67	.	10.3952	0.44196	0.872:0.0:0.128:0.0	.	2895	Q9NZR2	LRP1B_HUMAN	L	2895;2833	ENSP00000374135:F2895L	ENSP00000374135:F2895L	F	-	3	2	LRP1B	140975891	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.567000	0.53813	2.276000	0.75962	0.528000	0.53228	TTT		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
MAGEB6	158809	hgsc.bcm.edu	37	X	26212648	26212648	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:26212648T>A	ENST00000379034.1	+	2	834	c.685T>A	c.(685-687)Tac>Aac	p.Y229N		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	229	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.Y229N(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						CCGCAGAGAGTACAAGCCCTA	0.488																																																1	Substitution - Missense(1)	ovary(1)	X											82.0	67.0	72.0					X																	26212648		2202	4300	6502	26122569	SO:0001583	missense	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.685T>A	X.37:g.26212648T>A	ENSP00000368320:p.Tyr229Asn	Somatic		Capture	SOLID	Phase_III	26122569	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	CCDS14217.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.80	2.046578	0.36085	.	.	ENSG00000176746	ENST00000379034	T	0.04917	3.53	3.1	1.94	0.25998	.	0.000000	0.64402	U	0.000002	T	0.21307	0.0513	M	0.85041	2.73	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04427	-1.0952	10	0.72032	D	0.01	.	4.3283	0.11051	0.0:0.1599:0.0:0.8401	.	229	Q8N7X4	MAGB6_HUMAN	N	229	ENSP00000368320:Y229N	ENSP00000368320:Y229N	Y	+	1	0	MAGEB6	26122569	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.112000	0.15479	0.450000	0.26774	0.481000	0.45027	TAC		0.488	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		Missense_Mutation
MAP3K5	4217	hgsc.bcm.edu	37	6	136932441	136932441	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:136932441G>A	ENST00000359015.4	-	18	2860	c.2500C>T	c.(2500-2502)Ccc>Tcc	p.P834S	MAP3K5_ENST00000355845.4_Missense_Mutation_p.P81S	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	834	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.P834S(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TCAGTACAGGGGTTTATGCCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											135.0	128.0	131.0					6																	136932441		2203	4300	6503	136974134	SO:0001583	missense	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2500C>T	6.37:g.136932441G>A	ENSP00000351908:p.Pro834Ser	Somatic		Capture	SOLID	Phase_III	136974134	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	CCDS5179.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.147660	0.94603	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	T;T	0.62941	-0.01;-0.01	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.097108	0.64402	D	0.000001	T	0.50222	0.1603	N	0.02345	-0.59	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.959;0.999	T	0.65792	-0.6082	10	0.37606	T	0.19	.	19.3266	0.94264	0.0:0.0:1.0:0.0	.	914;834	Q59GL6;Q99683	.;M3K5_HUMAN	S	834;81;914	ENSP00000351908:P834S;ENSP00000348104:P81S	ENSP00000348104:P81S	P	-	1	0	MAP3K5	136974134	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.447000	0.97595	2.642000	0.89623	0.555000	0.69702	CCC		0.383	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			Missense_Mutation
MARK4	57787	hgsc.bcm.edu	37	19	45783945	45783945	+	Missense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr19:45783945G>A	ENST00000262891.4	+	12	1560	c.1229G>A	c.(1228-1230)cGg>cAg	p.R410Q	MARK4_ENST00000300843.4_Missense_Mutation_p.R410Q	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	410					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.R410Q(1)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AAAGGGCAGCGGAGTTCCTCT	0.662																																																1	Substitution - Missense(1)	ovary(1)	19											97.0	78.0	85.0					19																	45783945		2203	4300	6503	50475785	SO:0001583	missense	57787			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1229G>A	19.37:g.45783945G>A	ENSP00000262891:p.Arg410Gln	Somatic		Capture	SOLID	Phase_III	50475785	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	34	5.376741	0.95945	.	.	ENSG00000007047	ENST00000262891;ENST00000300843	T;T	0.35421	1.31;1.31	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	T	0.62877	0.2464	M	0.78049	2.395	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.998	P;D;D	0.75484	0.769;0.978;0.986	T	0.62656	-0.6808	10	0.52906	T	0.07	.	17.7884	0.88545	0.0:0.0:1.0:0.0	.	276;410;410	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	Q	410	ENSP00000262891:R410Q;ENSP00000300843:R410Q	ENSP00000262891:R410Q	R	+	2	0	MARK4	50475785	1.000000	0.71417	0.993000	0.49108	0.939000	0.58152	6.619000	0.74219	2.804000	0.96469	0.462000	0.41574	CGG		0.662	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		Missense_Mutation
MDC1	9656	hgsc.bcm.edu	37	6	30671316	30671316	+	Splice_Site	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:30671316T>C	ENST00000376406.3	-	11	6210		c.e11-2		MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Splice_Site	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1						DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.?(1)		breast(2)|kidney(1)|ovary(1)	4						CACGACATCCTGAGATTGAGA	0.522								Other conserved DNA damage response genes																																								1	Unknown(1)	ovary(1)	6											167.0	191.0	182.0					6																	30671316		1511	2709	4220	30779295	SO:0001630	splice_region_variant	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5563-2A>G	6.37:g.30671316T>C		Somatic		Capture	SOLID	Phase_III	30779295	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Splice_Site_SNP	SNP	ENST00000376406.3	37	CCDS34384.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.87	2.365231	0.41902	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	.	.	.	5.45	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7998	0.34901	0.0:0.0:0.2443:0.7557	.	.	.	.	.	-1	.	.	.	-	.	.	MDC1	30779295	0.973000	0.33851	0.746000	0.31095	0.295000	0.27426	3.359000	0.52292	2.205000	0.71048	0.454000	0.30748	.		0.522	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	Intron	Splice_Site_SNP
MLEC	9761	hgsc.bcm.edu	37	12	121134227	121134227	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:121134227G>C	ENST00000228506.3	+	5	1186	c.758G>C	c.(757-759)cGg>cCg	p.R253P	MLEC_ENST00000535413.1_3'UTR|RP11-173P15.3_ENST00000535720.1_RNA|MLEC_ENST00000412616.2_Missense_Mutation_p.G175R|RP11-173P15.3_ENST00000541383.1_RNA	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	253					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.R253P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						AATAAGAACCGGGTGCAGTCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											145.0	142.0	143.0					12																	121134227		2203	4300	6503	119618610	SO:0001583	missense	9761			BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.758G>C	12.37:g.121134227G>C	ENSP00000228506:p.Arg253Pro	Somatic		Capture	SOLID	Phase_III	119618610		Missense_Mutation	SNP	ENST00000228506.3	37	CCDS9206.1	SNP	39	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.65|11.65	1.703347|1.703347	0.30232|0.30232	.|.	.|.	ENSG00000110917|ENSG00000110917	ENST00000412616|ENST00000228506;ENST00000535656	.|.	.|.	.|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	.|0.180865	.|0.48286	.|D	.|0.000198	T|T	0.46756|0.46756	0.1409|0.1409	L|L	0.52823|0.52823	1.66|1.66	0.28106|0.28106	N|N	0.931191|0.931191	.|B	.|0.31290	.|0.318	.|B	.|0.28139	.|0.086	T|T	0.52087|0.52087	-0.8622|-0.8622	6|9	0.87932|0.66056	D|D	0|0.02	.|.	18.6593|18.6593	0.91467|0.91467	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|253	.|Q14165	.|MLEC_HUMAN	R|P	175|253;130	.|.	ENSP00000440746:G175R|ENSP00000228506:R253P	G|R	+|+	1|2	0|0	MLEC|MLEC	119618610|119618610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.037000|6.037000	0.70956|0.70956	2.492000|2.492000	0.84095|0.84095	0.563000|0.563000	0.77884|0.77884	GGG|CGG		0.507	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730		Missense_Mutation
MST1R	4486	hgsc.bcm.edu	37	3	49934992	49934992	+	Silent	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:49934992C>A	ENST00000296474.3	-	6	2034	c.2007G>T	c.(2005-2007)cgG>cgT	p.R669R	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Silent_p.R669R	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	669	IPT/TIG 1.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.R669R(1)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TGCCGTCTACCCGGAAGTGCT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	3											104.0	83.0	90.0					3																	49934992		2203	4300	6503	49909996	SO:0001819	synonymous_variant	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2007G>T	3.37:g.49934992C>A		Somatic		Capture	SOLID	Phase_III	49909996	B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	37	CCDS2807.1	SNP	22	Baylor																																																																																				0.612	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1			Silent
MTMR8	55613	hgsc.bcm.edu	37	X	63574684	63574684	+	Silent	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:63574684G>T	ENST00000374852.3	-	4	508	c.441C>A	c.(439-441)acC>acA	p.T147T	MTMR8_ENST00000453546.1_Silent_p.T147T	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	147	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.T147T(1)|p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						CATCTGTTATGGTCCAGTTTC	0.383																																																2	Whole gene deletion(1)|Substitution - coding silent(1)	ovary(2)	X											158.0	126.0	137.0					X																	63574684		2203	4300	6503	63491409	SO:0001819	synonymous_variant	55613			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.441C>A	X.37:g.63574684G>T		Somatic		Capture	SOLID	Phase_III	63491409	Q5JT99|Q9NXP6	Silent	SNP	ENST00000374852.3	37	CCDS14379.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.532	0.283084	0.10458	.	.	ENSG00000102043	ENST00000442913	.	.	.	2.67	-0.0836	0.13693	.	.	.	.	.	T	0.39253	0.1071	.	.	.	0.37707	D	0.924424	.	.	.	.	.	.	T	0.30621	-0.9972	4	.	.	.	.	0.6212	0.00778	0.3589:0.1685:0.3002:0.1724	.	.	.	.	N	64	.	.	H	-	1	0	MTMR8	63491409	0.973000	0.33851	0.970000	0.41538	0.879000	0.50718	0.044000	0.13992	-0.151000	0.11176	-1.167000	0.01749	CAT		0.383	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677		Silent
MYBL2	4605	hgsc.bcm.edu	37	20	42343841	42343841	+	Missense_Mutation	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr20:42343841T>C	ENST00000217026.4	+	13	2019	c.1892T>C	c.(1891-1893)cTc>cCc	p.L631P	MYBL2_ENST00000396863.4_Missense_Mutation_p.L607P	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	631					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L631P(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AACAGCTTGCTCAACCAGGGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											173.0	179.0	177.0					20																	42343841		2203	4300	6503	41777255	SO:0001583	missense	4605				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1892T>C	20.37:g.42343841T>C	ENSP00000217026:p.Leu631Pro	Somatic		Capture	SOLID	Phase_III	41777255	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657822	0.67586	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.18174	2.23;2.24	4.44	4.44	0.53790	.	0.171732	0.38005	N	0.001853	T	0.32071	0.0817	L	0.59436	1.845	0.80722	D	1	P;D	0.63046	0.669;0.992	B;P	0.60789	0.239;0.879	T	0.02588	-1.1137	10	0.48119	T	0.1	-21.8446	11.5436	0.50679	0.0:0.0:0.0:1.0	.	607;631	F8W6N6;P10244	.;MYBB_HUMAN	P	607;631	ENSP00000380072:L607P;ENSP00000217026:L631P	ENSP00000217026:L631P	L	+	2	0	MYBL2	41777255	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.273000	0.65564	1.775000	0.52247	0.402000	0.26972	CTC		0.562	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466		Missense_Mutation
NPR1	4881	hgsc.bcm.edu	37	1	153658297	153658297	+	Missense_Mutation	SNP	G	G	A	rs61757359	byFrequency	TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:153658297G>A	ENST00000368680.3	+	9	2093	c.1621G>A	c.(1621-1623)Ggc>Agc	p.G541S		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.G541S(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CTCCAATTACGGCTCCCTGCT	0.552													G|||	4	0.000798722	0.0008	0.0	5008	,	,		17974	0.0		0.003	False		,,,				2504	0.0				Pancreas(141;1349 1870 15144 15830 40702)											1	Substitution - Missense(1)	ovary(1)	1						G	SER/GLY	6,4400	11.4+/-27.6	0,6,2197	75.0	62.0	67.0		1621	4.2	1.0	1	dbSNP_129	67	33,8567	22.8+/-68.1	0,33,4267	yes	missense	NPR1	NM_000906.3	56	0,39,6464	AA,AG,GG		0.3837,0.1362,0.2999	benign	541/1062	153658297	39,12967	2203	4300	6503	151924921	SO:0001583	missense	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1621G>A	1.37:g.153658297G>A	ENSP00000357669:p.Gly541Ser	Somatic		Capture	SOLID	Phase_III	151924921	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	CCDS1051.1	SNP	39	Baylor	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	17.33	3.362741	0.61403	0.001362	0.003837	ENSG00000169418	ENST00000368680;ENST00000428723	T	0.41400	1.0	4.15	4.15	0.48705	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.10035	0.0246	N	0.17674	0.51	0.80722	D	1	B;P	0.43607	0.091;0.812	B;B	0.26693	0.025;0.072	T	0.08932	-1.0698	10	0.13853	T	0.58	.	14.3021	0.66359	0.0:0.0:1.0:0.0	rs61757359	46;541	B7Z4Y7;P16066	.;ANPRA_HUMAN	S	541;46	ENSP00000357669:G541S	ENSP00000357669:G541S	G	+	1	0	NPR1	151924921	1.000000	0.71417	0.994000	0.49952	0.917000	0.54804	9.429000	0.97481	2.322000	0.78497	0.555000	0.69702	GGC		0.552	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906		Missense_Mutation
NTM	50863	hgsc.bcm.edu	37	11	132016343	132016343	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr11:132016343C>A	ENST00000374786.1	+	2	814	c.335C>A	c.(334-336)cCt>cAt	p.P112H	NTM_ENST00000374784.1_Missense_Mutation_p.P112H|NTM_ENST00000374791.3_Missense_Mutation_p.P112H|NTM_ENST00000539799.1_Missense_Mutation_p.P112H|NTM_ENST00000427481.2_Missense_Mutation_p.P103H|NTM_ENST00000425719.2_Missense_Mutation_p.P112H	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	112	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P112H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GACGAGGGCCCTTACACCTGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											167.0	115.0	133.0					11																	132016343		2201	4297	6498	131521553	SO:0001583	missense	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.335C>A	11.37:g.132016343C>A	ENSP00000363918:p.Pro112His	Somatic		Capture	SOLID	Phase_III	131521553	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351594	0.61183	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000550167;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.58	5.58	0.84498	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.051205	0.85682	D	0.000000	T	0.78329	0.4266	M	0.72894	2.215	0.58432	D	0.999992	D;P;D;P;D;D	0.64830	0.994;0.935;0.984;0.935;0.97;0.993	D;D;P;P;P;P	0.67382	0.951;0.928;0.831;0.903;0.784;0.881	T	0.73357	-0.4008	10	0.15499	T	0.54	-17.1243	15.909	0.79456	0.1357:0.8643:0.0:0.0	.	112;103;112;112;112;112	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	H	112;112;103;103;112;112;112	ENSP00000363923:P112H;ENSP00000437668:P112H;ENSP00000448104:P103H;ENSP00000416320:P103H;ENSP00000363918:P112H;ENSP00000396722:P112H;ENSP00000363916:P112H	ENSP00000363916:P112H	P	+	2	0	NTM	131521553	1.000000	0.71417	0.951000	0.38953	0.944000	0.59088	7.805000	0.86005	2.631000	0.89168	0.655000	0.94253	CCT		0.577	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522		Missense_Mutation
OAS1	4938	hgsc.bcm.edu	37	12	113354443	113354443	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:113354443G>C	ENST00000202917.5	+	4	1047	c.784G>C	c.(784-786)Gtc>Ctc	p.V262L	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000551241.1_Missense_Mutation_p.V262L|OAS1_ENST00000452357.2_Missense_Mutation_p.V262L|OAS1_ENST00000445409.2_Missense_Mutation_p.V262L	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	262					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.V262L(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						CTTGGAATTAGTCATAAACTA	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											119.0	109.0	112.0					12																	113354443		2203	4300	6503	111838826	SO:0001583	missense	4938			X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.784G>C	12.37:g.113354443G>C	ENSP00000202917:p.Val262Leu	Somatic		Capture	SOLID	Phase_III	111838826	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	ENST00000202917.5	37	CCDS41838.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.270	0.813114	0.16537	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000551241;ENST00000377508;ENST00000550689;ENST00000553152	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	4.84	0.516	0.17019	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.627114	0.14073	N	0.343255	T	0.32645	0.0836	L	0.49778	1.585	0.21325	N	0.999723	P;B;P;B;B	0.35174	0.488;0.038;0.488;0.433;0.211	B;B;B;B;B	0.37989	0.262;0.021;0.262;0.171;0.105	T	0.17289	-1.0374	10	0.36615	T	0.2	-32.8645	3.7319	0.08496	0.3255:0.1867:0.4877:0.0	.	262;262;262;262;262	E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;OAS1_HUMAN;.;.	L	262;262;262;262;262;258;8	ENSP00000202917:V262L;ENSP00000388001:V262L;ENSP00000415721:V262L;ENSP00000448790:V262L;ENSP00000448348:V258L;ENSP00000449053:V8L	ENSP00000202917:V262L	V	+	1	0	OAS1	111838826	0.079000	0.21365	0.003000	0.11579	0.333000	0.28666	0.545000	0.23268	0.231000	0.21079	0.467000	0.42956	GTC		0.463	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405896.2			Missense_Mutation
OXCT1	5019	hgsc.bcm.edu	37	5	41862746	41862746	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:41862746C>A	ENST00000196371.5	-	2	345	c.185G>T	c.(184-186)gGt>gTt	p.G62V		NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	62					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.G62V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	GTACTCACCACCAACCAAAAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											135.0	115.0	122.0					5																	41862746		2203	4300	6503	41898503	SO:0001583	missense	5019			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.185G>T	5.37:g.41862746C>A	ENSP00000196371:p.Gly62Val	Somatic		Capture	SOLID	Phase_III	41898503	B2R5V2|B7Z528	Missense_Mutation	SNP	ENST00000196371.5	37	CCDS3937.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100231	0.76983	.	.	ENSG00000083720	ENST00000196371	D	0.95137	-3.62	5.38	5.38	0.77491	3-oxoacid CoA-transferase, subunit A (1);	0.000000	0.85682	D	0.000000	D	0.98403	0.9469	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99737	1.1014	10	0.87932	D	0	-13.3807	17.8949	0.88885	0.0:1.0:0.0:0.0	.	62	P55809	SCOT1_HUMAN	V	62	ENSP00000196371:G62V	ENSP00000196371:G62V	G	-	2	0	OXCT1	41898503	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	6.661000	0.74422	2.513000	0.84729	0.591000	0.81541	GGT		0.373	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436		Missense_Mutation
PAQR5	54852	hgsc.bcm.edu	37	15	69677130	69677130	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr15:69677130C>T	ENST00000340965.3	+	5	962	c.294C>T	c.(292-294)tcC>tcT	p.S98S	PAQR5_ENST00000561027.1_3'UTR|PAQR5_ENST00000561153.1_Silent_p.S98S|PAQR5_ENST00000395407.2_Silent_p.S98S	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	98					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)	p.S98S(1)		endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						CACTTGTGTCCAGCTGTGCGC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	15											254.0	179.0	204.0					15																	69677130		2200	4298	6498	67464184	SO:0001819	synonymous_variant	54852				CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.294C>T	15.37:g.69677130C>T		Somatic		Capture	SOLID	Phase_III	67464184	Q8IXU2	Silent	SNP	ENST00000340965.3	37	CCDS10232.1	SNP	21	Baylor																																																																																				0.522	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705		Silent
PATZ1	23598	hgsc.bcm.edu	37	22	31740525	31740525	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr22:31740525A>C	ENST00000266269.5	-	1	1693	c.1064T>G	c.(1063-1065)gTg>gGg	p.V355G	PATZ1_ENST00000215919.3_Missense_Mutation_p.V355G|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Missense_Mutation_p.V355G|PATZ1_ENST00000351933.4_Missense_Mutation_p.V355G	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	355					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						CTCACAAGCCACCTGCTTCCT	0.592																																																0			22											76.0	75.0	75.0					22																	31740525		2203	4300	6503	30070525	SO:0001583	missense	23598			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1064T>G	22.37:g.31740525A>C	ENSP00000266269:p.Val355Gly	Somatic		Capture	SOLID	Phase_III	30070525	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	ENST00000266269.5	37	CCDS13894.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.34	3.601774	0.66445	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	4.78	4.78	0.61160	Zinc finger, C2H2-like (1);AT hook, DNA-binding motif (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41236	0.1150	N	0.24115	0.695	0.80722	D	1	D;D;D;D	0.89917	0.99;0.981;1.0;0.981	P;D;D;D	0.83275	0.818;0.978;0.996;0.978	T	0.41928	-0.9481	10	0.87932	D	0	-17.7358	13.5015	0.61459	1.0:0.0:0.0:0.0	.	355;355;355;355	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	G	355	ENSP00000266269:V355G;ENSP00000384173:V355G;ENSP00000337520:V355G;ENSP00000215919:V355G	ENSP00000215919:V355G	V	-	2	0	PATZ1	30070525	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.797000	0.69087	1.795000	0.52594	0.459000	0.35465	GTG		0.592	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	NM_032052		Missense_Mutation
PDE4DIP	9659	hgsc.bcm.edu	37	1	144906483	144906483	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:144906483C>A	ENST00000369354.3	-	18	2563	c.2374G>T	c.(2374-2376)Gtg>Ttg	p.V792L	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.V929L|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.V792L|PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.V858L|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.V955L|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.V929L|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.V579L|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.V792L|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.V955L|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.V792L			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	792					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.V792L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCAGCCTGCACCTGCAGCTCT	0.408			T	PDGFRB	MPD																																		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	1	Substitution - Missense(1)	ovary(1)	1											104.0	105.0	104.0					1																	144906483		2203	4296	6499	143617840	SO:0001583	missense	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2374G>T	1.37:g.144906483C>A	ENSP00000358360:p.Val792Leu	Somatic		Capture	SOLID	Phase_III	143617840	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322145	0.81580	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.12147	4.75;4.83;4.83;4.81;4.81;3.86;3.85;2.74;2.73;2.71	6.07	6.07	0.98685	.	.	.	.	.	T	0.10680	0.0261	L	0.27053	0.805	0.80722	D	1	P;P;P;D;D	0.58970	0.792;0.942;0.927;0.984;0.982	B;P;P;P;P	0.54346	0.342;0.697;0.608;0.713;0.749	T	0.20009	-1.0288	9	0.14656	T	0.56	.	18.3129	0.90207	0.0:1.0:0.0:0.0	.	955;792;955;858;792	E9PL24;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;MYOME_HUMAN	L	858;792;792;955;929;929;792;792;955;955;579	ENSP00000327209:V858L;ENSP00000358360:V792L;ENSP00000358363:V792L;ENSP00000435654:V929L;ENSP00000358366:V929L;ENSP00000358357:V792L;ENSP00000358355:V792L;ENSP00000316434:V955L;ENSP00000433392:V955L;ENSP00000436791:V579L	ENSP00000327209:V858L	V	-	1	0	PDE4DIP	143617840	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.803000	0.55560	2.928000	0.99379	0.638000	0.83543	GTG		0.408	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		Missense_Mutation
PDE8B	8622	hgsc.bcm.edu	37	5	76621405	76621405	+	Silent	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:76621405C>A	ENST00000264917.5	+	3	486	c.441C>A	c.(439-441)ggC>ggA	p.G147G	PDE8B_ENST00000333194.4_Silent_p.G147G|PDE8B_ENST00000340978.3_Silent_p.G147G|PDE8B_ENST00000342343.4_Silent_p.G127G|PDE8B_ENST00000346042.3_Silent_p.G147G	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	147				G -> R (in Ref. 7; CAD38584). {ECO:0000305}.	cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.G147G(1)	GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	AGAGCGATGGCTTCTGGTGGG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	5											141.0	145.0	144.0					5																	76621405		2203	4300	6503	76657161	SO:0001819	synonymous_variant	8622			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.441C>A	5.37:g.76621405C>A		Somatic		Capture	SOLID	Phase_III	76657161	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Silent	SNP	ENST00000264917.5	37	CCDS4037.1	SNP	28	Baylor																																																																																				0.408	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719		Silent
PEX5	5830	hgsc.bcm.edu	37	12	7361751	7361751	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:7361751C>T	ENST00000455147.2	+	15	2125	c.1545C>T	c.(1543-1545)ctC>ctT	p.L515L	PEX5_ENST00000266563.5_Silent_p.L478L|PEX5_ENST00000420616.2_Silent_p.L515L|PEX5_ENST00000266564.3_Silent_p.L507L|PEX5_ENST00000434354.2_Silent_p.L530L|PEX5_ENST00000412720.2_Silent_p.L536L	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	515					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)	p.L507L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CAGCTGCCCTCAGCGTTCGTC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	12											93.0	80.0	85.0					12																	7361751		2203	4300	6503	7253018	SO:0001819	synonymous_variant	5830			U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.1545C>T	12.37:g.7361751C>T		Somatic		Capture	SOLID	Phase_III	7253018	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Silent	SNP	ENST00000455147.2	37	CCDS44823.1	SNP	29	Baylor																																																																																				0.537	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319		Silent
PLCB1	23236	hgsc.bcm.edu	37	20	8698361	8698361	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr20:8698361A>G	ENST00000338037.6	+	14	1406	c.1379A>G	c.(1378-1380)tAt>tGt	p.Y460C	PLCB1_ENST00000378637.2_Missense_Mutation_p.Y460C|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.Y460C	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	460	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.Y460C(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GATTTAATGTATAAAATTTTG	0.393																																																1	Substitution - Missense(1)	ovary(1)	20											78.0	85.0	83.0					20																	8698361		2203	4300	6503	8646361	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1379A>G	20.37:g.8698361A>G	ENSP00000338185:p.Tyr460Cys	Somatic		Capture	SOLID	Phase_III	8646361	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.32	2.500174	0.44455	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.53206	0.63;0.63;0.63	5.85	5.85	0.93711	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.157589	0.64402	D	0.000018	T	0.56426	0.1984	L	0.49640	1.575	0.42098	D	0.991322	D;D	0.61697	0.976;0.99	P;P	0.58970	0.84;0.849	T	0.56420	-0.7982	10	0.40728	T	0.16	.	11.3034	0.49320	0.9296:0.0:0.0704:0.0	.	460;460	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	C	460;460;460;380;380	ENSP00000367908:Y460C;ENSP00000338185:Y460C;ENSP00000367904:Y460C	ENSP00000338185:Y460C	Y	+	2	0	PLCB1	8646361	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.392000	0.59659	2.234000	0.73211	0.533000	0.62120	TAT		0.393	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3			Missense_Mutation
POLM	27434	hgsc.bcm.edu	37	7	44118404	44118404	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr7:44118404G>C	ENST00000242248.5	-	5	750	c.649C>G	c.(649-651)Ctg>Gtg	p.L217V	POLM_ENST00000395831.3_Missense_Mutation_p.L217V|POLM_ENST00000335195.6_Missense_Mutation_p.L217V|POLM_ENST00000492971.1_5'Flank	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	217					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.L217V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						CCATGCTCCAGCAGCTCCTGG	0.617								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	7											109.0	81.0	90.0					7																	44118404		2203	4300	6503	44084929	SO:0001583	missense	27434			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.649C>G	7.37:g.44118404G>C	ENSP00000242248:p.Leu217Val	Somatic		Capture	SOLID	Phase_III	44084929	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	CCDS34625.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710548	0.48517	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831	T;T;T	0.48836	0.8;0.8;0.8	5.91	4.09	0.47781	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.63260	0.2496	M	0.68317	2.08	0.45995	D	0.998808	D;D;D;D;D;D	0.89917	1.0;0.991;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.997;0.972;0.997;0.997;0.996;0.996	T	0.65643	-0.6118	10	0.72032	D	0.01	-29.8198	9.3118	0.37910	0.1689:0.0:0.8311:0.0	.	184;217;217;217;217;217	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	V	217	ENSP00000335141:L217V;ENSP00000242248:L217V;ENSP00000379174:L217V	ENSP00000242248:L217V	L	-	1	2	POLM	44084929	0.998000	0.40836	1.000000	0.80357	0.958000	0.62258	0.632000	0.24583	1.509000	0.48786	0.650000	0.86243	CTG		0.617	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284		Missense_Mutation
PPP2R3A	5523	hgsc.bcm.edu	37	3	135745847	135745847	+	Missense_Mutation	SNP	T	T	A			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:135745847T>A	ENST00000264977.3	+	3	2786	c.2169T>A	c.(2167-2169)agT>agA	p.S723R	PPP2R3A_ENST00000490467.1_5'UTR|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.S102R|PPP2R3A_ENST00000492624.2_5'UTR	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	723					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)	p.S723R(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATACCTGTAGTAATCATGAAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											69.0	65.0	67.0					3																	135745847		2203	4300	6503	137228537	SO:0001583	missense	5523			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2169T>A	3.37:g.135745847T>A	ENSP00000264977:p.Ser723Arg	Somatic		Capture	SOLID	Phase_III	137228537	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.10	1.257421	0.22965	.	.	ENSG00000073711	ENST00000264977;ENST00000334546	T;T	0.18174	2.23;2.23	5.58	1.51	0.23008	.	0.373870	0.30068	N	0.010500	T	0.11665	0.0284	L	0.34521	1.04	0.80722	D	1	B;B	0.33212	0.402;0.19	B;B	0.35114	0.196;0.084	T	0.14117	-1.0484	10	0.34782	T	0.22	.	6.391	0.21587	0.142:0.1512:0.0:0.7068	.	102;723	Q06190-2;Q06190	.;P2R3A_HUMAN	R	723;102	ENSP00000264977:S723R;ENSP00000334748:S102R	ENSP00000264977:S723R	S	+	3	2	PPP2R3A	137228537	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.822000	0.39052	0.377000	0.24735	0.477000	0.44152	AGT		0.403	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718		Missense_Mutation
RB1	5925	hgsc.bcm.edu	37	13	48937023	48937023	+	Missense_Mutation	SNP	C	C	T	rs587778827		TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr13:48937023C>T	ENST00000267163.4	+	8	929	c.791C>T	c.(790-792)gCa>gTa	p.A264V		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	264					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)|p.A264V(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GCACGGATAGCAAAACAACTA	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	22	Whole gene deletion(15)|Unknown(6)|Substitution - Missense(1)	bone(11)|breast(5)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)	13											104.0	111.0	108.0					13																	48937023		2203	4300	6503	47835024	SO:0001583	missense	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.791C>T	13.37:g.48937023C>T	ENSP00000267163:p.Ala264Val	Somatic		Capture	SOLID	Phase_III	47835024	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648906	0.47362	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.91996	-2.95	6.17	4.45	0.53987	.	0.477918	0.23498	N	0.047522	D	0.84942	0.5584	N	0.25647	0.755	0.30677	N	0.752736	B	0.19935	0.04	B	0.13407	0.009	T	0.75926	-0.3145	10	0.17369	T	0.5	.	11.7093	0.51616	0.0:0.8571:0.0:0.1429	.	264	P06400	RB_HUMAN	V	243;264	ENSP00000267163:A264V	ENSP00000267163:A264V	A	+	2	0	RB1	47835024	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.837000	0.39201	0.941000	0.37499	0.655000	0.94253	GCA		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			Missense_Mutation
RCBTB2	1102	hgsc.bcm.edu	37	13	49086005	49086005	+	Silent	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr13:49086005G>A	ENST00000344532.3	-	9	1107	c.684C>T	c.(682-684)gtC>gtT	p.V228V	RCBTB2_ENST00000544492.1_Missense_Mutation_p.S2F|RCBTB2_ENST00000430805.2_Silent_p.V233V|RCBTB2_ENST00000481144.1_5'Flank|RCBTB2_ENST00000544904.1_Silent_p.V204V	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	228					positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.V228V(1)		breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TGTAACCCCAGACATAGACCT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	13											82.0	77.0	79.0					13																	49086005		2203	4300	6503	47984006	SO:0001819	synonymous_variant	1102			AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.684C>T	13.37:g.49086005G>A		Somatic		Capture	SOLID	Phase_III	47984006	B2RDW8	Silent	SNP	ENST00000344532.3	37	CCDS9411.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038983	0.55003	.	.	ENSG00000136161	ENST00000544492	T	0.76968	-1.06	5.98	5.15	0.70609	.	.	.	.	.	T	0.69958	0.3169	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.67507	-0.5653	8	0.72032	D	0.01	.	10.0896	0.42439	0.0687:0.2488:0.6825:0.0	.	2	B4E372	.	F	2	ENSP00000443862:S2F	ENSP00000443862:S2F	S	-	2	0	RCBTB2	47984006	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.824000	0.39072	1.556000	0.49512	0.591000	0.81541	TCT		0.532	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268		Silent
REL	5966	hgsc.bcm.edu	37	2	61144022	61144022	+	Silent	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr2:61144022A>G	ENST00000295025.8	+	5	725	c.405A>G	c.(403-405)aaA>aaG	p.K135K	REL_ENST00000394479.3_Silent_p.K135K	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	135	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K135K(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			TCCCTGAAAAACAGCTGAATG	0.373			A		Hodgkin Lymphoma																																		Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	1	Substitution - coding silent(1)	ovary(1)	2											138.0	129.0	132.0					2																	61144022		2203	4300	6503	60997526	SO:0001819	synonymous_variant	5966			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.405A>G	2.37:g.61144022A>G		Somatic		Capture	SOLID	Phase_III	60997526	Q17RU2|Q2PNZ7|Q6LDY0	Silent	SNP	ENST00000295025.8	37	CCDS1864.1	SNP	2	Baylor																																																																																				0.373	REL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251576.3	NM_002908		Silent
ROS1	6098	hgsc.bcm.edu	37	6	117724350	117724350	+	Nonsense_Mutation	SNP	G	G	A			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:117724350G>A	ENST00000368508.3	-	6	727	c.529C>T	c.(529-531)Cag>Tag	p.Q177*	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Nonsense_Mutation_p.Q186*	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	177	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Q177*(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GAGTAGAGCTGCAGCTGCGCT	0.488			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - Nonsense(1)	ovary(1)	6											96.0	92.0	93.0					6																	117724350		2203	4300	6503	117831043	SO:0001587	stop_gained	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.529C>T	6.37:g.117724350G>A	ENSP00000357494:p.Gln177*	Somatic		Capture	SOLID	Phase_III	117831043	Q15368|Q5TDB5	Nonsense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	36	5.673088	0.96754	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	5.21	5.21	0.72293	.	0.199309	0.35525	N	0.003147	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	16.2838	0.82709	0.0:0.0:1.0:0.0	.	.	.	.	X	177;186	.	ENSP00000357493:Q186X	Q	-	1	0	ROS1	117831043	1.000000	0.71417	0.975000	0.42487	0.296000	0.27459	6.468000	0.73551	2.600000	0.87896	0.655000	0.94253	CAG		0.488	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1			Nonsense_Mutation
GPCPD1	56261	hgsc.bcm.edu	37	20	5556594	5556594	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr20:5556594C>T	ENST00000379019.4	-	9	948	c.736G>A	c.(736-738)Gat>Aat	p.D246N	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	246					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)	p.D246N(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						GGAAGGGCATCACCCTGAACT	0.393																																																1	Substitution - Missense(1)	ovary(1)	20											81.0	71.0	75.0					20																	5556594		2203	4300	6503	5504594	SO:0001583	missense	56261				CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.736G>A	20.37:g.5556594C>T	ENSP00000368305:p.Asp246Asn	Somatic		Capture	SOLID	Phase_III	5504594	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919451	0.73098	.	.	ENSG00000125772	ENST00000379019	T	0.49139	0.79	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	L	0.29908	0.895	0.80722	D	1	P	0.37636	0.603	B	0.34489	0.184	T	0.17653	-1.0362	10	0.33141	T	0.24	-22.9868	19.3281	0.94270	0.0:1.0:0.0:0.0	.	246	Q9NPB8	GPCP1_HUMAN	N	246	ENSP00000368305:D246N	ENSP00000368305:D246N	D	-	1	0	GPCPD1	5504594	1.000000	0.71417	0.978000	0.43139	0.878000	0.50629	7.776000	0.85560	2.629000	0.89072	0.650000	0.86243	GAT		0.393	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593		Missense_Mutation
SLC17A6	57084	hgsc.bcm.edu	37	11	22380986	22380986	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr11:22380986C>T	ENST00000263160.3	+	4	923	c.486C>T	c.(484-486)acC>acT	p.T162T	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	162					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.T162T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TACTTCTTACCTCTACCCTAA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	11											126.0	116.0	119.0					11																	22380986		2203	4300	6503	22337562	SO:0001819	synonymous_variant	57084			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.486C>T	11.37:g.22380986C>T		Somatic		Capture	SOLID	Phase_III	22337562	A6NKS2	Silent	SNP	ENST00000263160.3	37	CCDS7856.1	SNP	24	Baylor																																																																																				0.373	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346		Silent
SLC6A3	6531	hgsc.bcm.edu	37	5	1401057	1401057	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:1401057C>T	ENST00000270349.9	-	14	1939	c.1812G>A	c.(1810-1812)gtG>gtA	p.V604V	SLC6A3_ENST00000453492.2_Silent_p.V604V	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	604					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.V604V(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CCCCTCTGTCCACCAGCTCAC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	5											103.0	79.0	87.0					5																	1401057		2203	4300	6503	1454057	SO:0001819	synonymous_variant	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1812G>A	5.37:g.1401057C>T		Somatic		Capture	SOLID	Phase_III	1454057	A2RUN4|Q14996	Silent	SNP	ENST00000270349.9	37	CCDS3863.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.482	-0.105631	0.06924	.	.	ENSG00000142319	ENST00000512002	.	.	.	4.22	1.95	0.26073	.	.	.	.	.	T	0.51702	0.1690	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43686	-0.9376	4	.	.	.	.	4.8526	0.13543	0.0:0.6659:0.0:0.3341	.	.	.	.	R	65	.	.	G	-	1	0	SLC6A3	1454057	1.000000	0.71417	0.831000	0.32960	0.397000	0.30659	0.913000	0.28611	0.899000	0.36444	0.313000	0.20887	GGA		0.597	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044		Silent
SMOC2	64094	hgsc.bcm.edu	37	6	168927045	168927045	+	Silent	SNP	C	C	G			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:168927045C>G	ENST00000356284.2	+	3	496	c.276C>G	c.(274-276)gcC>gcG	p.A92A	SMOC2_ENST00000354536.5_Silent_p.A92A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	92	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.A92A(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GGTGTGTGGCCGAAAGGAAGT	0.498																																																1	Substitution - coding silent(1)	ovary(1)	6											129.0	104.0	112.0					6																	168927045		2203	4300	6503	168669894	SO:0001819	synonymous_variant	64094			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.276C>G	6.37:g.168927045C>G		Somatic		Capture	SOLID	Phase_III	168669894	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1	SNP	23	Baylor																																																																																				0.498	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			Silent
SNTG1	54212	hgsc.bcm.edu	37	8	51449315	51449315	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr8:51449315C>T	ENST00000522124.1	+	11	1288	c.627C>T	c.(625-627)atC>atT	p.I209I	SNTG1_ENST00000517473.1_Silent_p.I209I|SNTG1_ENST00000518864.1_Silent_p.I209I|SNTG1_ENST00000276467.5_Silent_p.I209I	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	209					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.I209I(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCAGACTGATCCCTCTACTTC	0.473																																																1	Substitution - coding silent(1)	ovary(1)	8											219.0	194.0	203.0					8																	51449315		2203	4300	6503	51611868	SO:0001819	synonymous_variant	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.627C>T	8.37:g.51449315C>T		Somatic		Capture	SOLID	Phase_III	51611868	Q2M3Q0|Q9NY98	Silent	SNP	ENST00000522124.1	37	CCDS6147.1	SNP	30	Baylor																																																																																				0.473	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			Silent
SNX27	81609	hgsc.bcm.edu	37	1	151630785	151630785	+	Missense_Mutation	SNP	C	C	G	rs377735811		TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:151630785C>G	ENST00000458013.2	+	3	738	c.618C>G	c.(616-618)aaC>aaG	p.N206K	SNX27_ENST00000368838.1_Missense_Mutation_p.N113K|SNX27_ENST00000368843.3_Missense_Mutation_p.N206K			Q96L92	SNX27_HUMAN	sorting nexin family member 27	206	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)	p.N206K(1)		central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACACCAGAACCTGAAGAGAG	0.463																																					Colon(46;291 966 40145 41237 41888)											1	Substitution - Missense(1)	ovary(1)	1											164.0	159.0	161.0					1																	151630785		2203	4300	6503	149897409	SO:0001583	missense	81609			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.618C>G	1.37:g.151630785C>G	ENSP00000400333:p.Asn206Lys	Somatic		Capture	SOLID	Phase_III	149897409	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	ENST00000458013.2	37		SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088232	0.36855	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.36878	1.23;1.23;1.23	5.54	5.54	0.83059	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	N	0.10782	0.045	0.80722	D	1	B;B	0.24092	0.097;0.079	B;B	0.27715	0.082;0.03	T	0.09552	-1.0669	10	0.21540	T	0.41	.	18.0602	0.89374	0.0:1.0:0.0:0.0	.	206;206	Q96L92;Q96L92-3	SNX27_HUMAN;.	K	206;206;113	ENSP00000400333:N206K;ENSP00000357836:N206K;ENSP00000357831:N113K	ENSP00000357831:N113K	N	+	3	2	SNX27	149897409	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.792000	0.55476	2.618000	0.88619	0.650000	0.86243	AAC		0.463	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918		Missense_Mutation
NPR2	4882	hgsc.bcm.edu	37	9	35811022	35811022	+	IGR	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr9:35811022G>T	ENST00000342694.2	+	0	3686				SPAG8_ENST00000484764.1_Missense_Mutation_p.S297R|SPAG8_ENST00000396638.2_Missense_Mutation_p.S299R|SPAG8_ENST00000479751.1_5'UTR|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_Missense_Mutation_p.S299R|HINT2_ENST00000474908.1_5'Flank	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S299R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CATCCTGCATGCTTGGGACTT	0.517																																																1	Substitution - Missense(1)	ovary(1)	9											141.0	144.0	143.0					9																	35811022		2203	4300	6503	35801022	SO:0001628	intergenic_variant	26206			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35811022G>T		Somatic		Capture	SOLID	Phase_III	35801022	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	SNP	46	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.51|12.51	1.958405|1.958405	0.34565|0.34565	.|.	.|.	ENSG00000137098|ENSG00000137098	ENST00000497810|ENST00000340291;ENST00000484764;ENST00000396638	.|T;T;T	.|0.32515	.|1.45;1.51;1.51	5.99|5.99	1.45|1.45	0.22620|0.22620	.|.	.|0.744046	.|0.11805	.|N	.|0.527708	T|T	0.19846|0.19846	0.0477|0.0477	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|B;B	.|0.22003	.|0.023;0.063	.|B;B	.|0.24541	.|0.032;0.054	T|T	0.23904|0.23904	-1.0175|-1.0175	6|10	0.87932|0.35671	D|T	0|0.21	0.1347|0.1347	5.0798|5.0798	0.14651|0.14651	0.1741:0.0:0.5255:0.3004|0.1741:0.0:0.5255:0.3004	.|.	.|299;299	.|E9PDV6;Q99932-2	.|.;.	E|R	297|299;297;299	.|ENSP00000340982:S299R;ENSP00000418072:S297R;ENSP00000379878:S299R	ENSP00000419280:A52E|ENSP00000340982:S299R	A|S	-|-	2|3	0|2	SPAG8|SPAG8	35801022|35801022	0.000000|0.000000	0.05858|0.05858	0.523000|0.523000	0.27875|0.27875	0.987000|0.987000	0.75469|0.75469	0.124000|0.124000	0.15728|0.15728	0.384000|0.384000	0.24942|0.24942	-0.895000|-0.895000	0.02911|0.02911	GCA|AGC		0.517	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1			Missense_Mutation
ST6GALNAC3	256435	hgsc.bcm.edu	37	1	76877830	76877830	+	Silent	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:76877830A>G	ENST00000328299.3	+	3	499	c.351A>G	c.(349-351)gaA>gaG	p.E117E	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	117					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)	p.E117E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						GTTATGAAGAAGATGTCGGCC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	1											128.0	116.0	120.0					1																	76877830		2203	4300	6503	76650418	SO:0001819	synonymous_variant	256435				CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.351A>G	1.37:g.76877830A>G		Somatic		Capture	SOLID	Phase_III	76650418	Q6PCE0|Q6UX29|Q8N259	Silent	SNP	ENST00000328299.3	37	CCDS672.1	SNP	3	Baylor																																																																																				0.448	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		Silent
STRN3	29966	hgsc.bcm.edu	37	14	31424863	31424863	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:31424863C>T	ENST00000357479.5	-	3	619	c.423G>A	c.(421-423)ctG>ctA	p.L141L	STRN3_ENST00000355683.5_Silent_p.L141L	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	141					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L141L(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		CACCTTGGTTCAGTTCCGTGC	0.294																																																1	Substitution - coding silent(1)	ovary(1)	14											71.0	73.0	72.0					14																	31424863		2203	4299	6502	30494614	SO:0001819	synonymous_variant	29966				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.423G>A	14.37:g.31424863C>T		Somatic		Capture	SOLID	Phase_III	30494614	A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	ENST00000357479.5	37	CCDS41938.1	SNP	29	Baylor																																																																																				0.294	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574		Silent
SYT1	6857	hgsc.bcm.edu	37	12	79679631	79679631	+	Silent	SNP	T	T	C			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr12:79679631T>C	ENST00000261205.4	+	5	888	c.231T>C	c.(229-231)ttT>ttC	p.F77F	SYT1_ENST00000457153.2_Silent_p.F77F|SYT1_ENST00000393240.3_Silent_p.F77F|SYT1_ENST00000552744.1_Silent_p.F77F	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	77					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)	p.F77F(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						CCTGCTGCTTTTGTATCTGTA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	12											146.0	138.0	140.0					12																	79679631		2203	4300	6503	78203762	SO:0001819	synonymous_variant	6857				CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.231T>C	12.37:g.79679631T>C		Somatic		Capture	SOLID	Phase_III	78203762	Q6AI31	Silent	SNP	ENST00000261205.4	37	CCDS9017.1	SNP	64	Baylor																																																																																				0.398	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259415.1	NM_005639		Silent
SYT7	9066	hgsc.bcm.edu	37	11	61286161	61286161	+	Missense_Mutation	SNP	A	A	T			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr11:61286161A>T	ENST00000263846.4	-	9	1477	c.1150T>A	c.(1150-1152)Tgg>Agg	p.W384R	SYT7_ENST00000542670.1_Missense_Mutation_p.W592R|SYT7_ENST00000540677.1_Missense_Mutation_p.W459R|SYT7_ENST00000539008.1_Missense_Mutation_p.W667R|SYT7_ENST00000542836.1_Missense_Mutation_p.W428R|SYT7_ENST00000535826.1_Missense_Mutation_p.W503R	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	384					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.W384R(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						ATGTCCTTCCAGTGCTTCACC	0.682																																																1	Substitution - Missense(1)	ovary(1)	11											51.0	42.0	45.0					11																	61286161		1820	3417	5237	61042737	SO:0001583	missense	9066			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.1150T>A	11.37:g.61286161A>T	ENSP00000263846:p.Trp384Arg	Somatic		Capture	SOLID	Phase_III	61042737	F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	CCDS31577.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957834	0.73902	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826	T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	3.82	3.82	0.43975	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.067357	0.64402	D	0.000005	D	0.90113	0.6911	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.988	D	0.92286	0.5837	10	0.87932	D	0	.	12.7459	0.57281	1.0:0.0:0.0:0.0	.	459;384	F5GZU9;O43581	.;SYT7_HUMAN	R	384;459;667;428;592;503	ENSP00000263846:W384R;ENSP00000444201:W459R;ENSP00000439694:W667R;ENSP00000444568:W428R;ENSP00000444019:W592R;ENSP00000437720:W503R	ENSP00000263846:W384R	W	-	1	0	SYT7	61042737	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.548000	0.90669	1.587000	0.49959	0.377000	0.23210	TGG		0.682	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		Missense_Mutation
TCP11	6954	hgsc.bcm.edu	37	6	35087098	35087098	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr6:35087098C>A	ENST00000512012.1	-	8	1342	c.1186G>T	c.(1186-1188)Ggc>Tgc	p.G396C	TCP11_ENST00000373979.2_Missense_Mutation_p.G334C|TCP11_ENST00000418521.2_Missense_Mutation_p.G333C|TCP11_ENST00000412155.2_Missense_Mutation_p.G358C|TCP11_ENST00000444780.2_Missense_Mutation_p.G404C|TCP11_ENST00000311875.5_Missense_Mutation_p.G409C|TCP11_ENST00000244645.3_Missense_Mutation_p.G334C|TCP11_ENST00000373974.4_Missense_Mutation_p.G363C			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	396					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G334C(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GCAACAAGGCCCATATTCTTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											252.0	211.0	225.0					6																	35087098		2203	4300	6503	35195076	SO:0001583	missense	6954				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.1186G>T	6.37:g.35087098C>A	ENSP00000425995:p.Gly396Cys	Somatic		Capture	SOLID	Phase_III	35195076	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37		SNP	22	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.62|18.62	3.663700|3.663700	0.67700|0.67700	.|.	.|.	ENSG00000124678|ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012|ENST00000502480	T;T;T;T;T;T;T;T|.	0.12984|.	2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63|.	4.91|4.91	4.02|4.02	0.46733|0.46733	.|.	0.136522|0.136522	0.48286|0.48286	D|D	0.000199|0.000199	T|T	0.73745|0.73745	0.3626|0.3626	M|M	0.88570|0.88570	2.965|2.965	0.46149|0.46149	D|D	0.99889|0.99889	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.997;0.997;0.998;0.999;0.998;0.994|.	T|T	0.77616|0.77616	-0.2521|-0.2521	10|6	0.49607|.	T|.	0.09|.	.|.	12.1039|12.1039	0.53801|0.53801	0.0:0.9135:0.0:0.0865|0.0:0.9135:0.0:0.0865	.|.	363;358;404;469;396;334|.	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2|.	.;.;.;.;TCP11_HUMAN;.|.	C|V	334;358;334;409;404;363;333;396|203	ENSP00000363091:G334C;ENSP00000402816:G358C;ENSP00000244645:G334C;ENSP00000308708:G409C;ENSP00000404479:G404C;ENSP00000363085:G363C;ENSP00000415320:G333C;ENSP00000425995:G396C|.	ENSP00000244645:G334C|.	G|G	-|-	1|2	0|0	TCP11|TCP11	35195076|35195076	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	2.720000|2.720000	0.47252|0.47252	2.439000|2.439000	0.82584|0.82584	0.467000|0.467000	0.42956|0.42956	GGC|GGG		0.453	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		Missense_Mutation
TEKT1	83659	hgsc.bcm.edu	37	17	6722512	6722512	+	Splice_Site	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr17:6722512C>A	ENST00000338694.2	-	3	485	c.356G>T	c.(355-357)aGg>aTg	p.R119M	TEKT1_ENST00000535086.1_Intron	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	119						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R119M(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				TCGCTCCTACCTGTATGCCAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	17											134.0	122.0	126.0					17																	6722512		2203	4300	6503	6663236	SO:0001630	splice_region_variant	83659				CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.356+1G>T	17.37:g.6722512C>A		Somatic		Capture	SOLID	Phase_III	6663236	D3DTM7	Missense_Mutation	SNP	ENST00000338694.2	37	CCDS11083.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826419	0.71143	.	.	ENSG00000167858	ENST00000338694	T	0.26810	1.71	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.62889	0.2465	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74864	-0.3519	9	.	.	.	.	15.9542	0.79871	0.0:1.0:0.0:0.0	.	119	Q969V4	TEKT1_HUMAN	M	119	ENSP00000341346:R119M	.	R	-	2	0	TEKT1	6663236	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	6.657000	0.74402	2.424000	0.82194	0.655000	0.94253	AGG		0.453	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	Missense_Mutation	Missense_Mutation
TEX11	56159	hgsc.bcm.edu	37	X	69826842	69826842	+	Silent	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chrX:69826842C>T	ENST00000395889.2	-	24	2117	c.1962G>A	c.(1960-1962)gtG>gtA	p.V654V	TEX11_ENST00000344304.3_Silent_p.V654V|TEX11_ENST00000374333.2_Silent_p.V639V|TEX11_ENST00000374320.2_Silent_p.V329V	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	654					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.V639V(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					CTCTCATCATCACTGGATCTT	0.313																																																1	Substitution - coding silent(1)	ovary(1)	X											58.0	53.0	55.0					X																	69826842		2202	4293	6495	69743567	SO:0001819	synonymous_variant	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1962G>A	X.37:g.69826842C>T		Somatic		Capture	SOLID	Phase_III	69743567	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Silent	SNP	ENST00000395889.2	37	CCDS35323.1	SNP	29	Baylor																																																																																				0.313	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1			Silent
TG	7038	hgsc.bcm.edu	37	8	133935682	133935682	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr8:133935682G>C	ENST00000220616.4	+	22	4668	c.4628G>C	c.(4627-4629)tGt>tCt	p.C1543S	TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1543	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.C1543S(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AAGGCCTTCTGTGTGGACGGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	8											93.0	86.0	88.0					8																	133935682		2203	4300	6503	134004864	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4628G>C	8.37:g.133935682G>C	ENSP00000220616:p.Cys1543Ser	Somatic		Capture	SOLID	Phase_III	134004864	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012272	0.54468	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	D	0.99470	-5.96	4.84	4.84	0.62591	Thyroglobulin type-1 (5);	0.000000	0.64402	D	0.000007	D	0.99411	0.9792	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98530	1.0627	10	0.87932	D	0	.	13.429	0.61044	0.0:0.0:1.0:0.0	.	1543	P01266	THYG_HUMAN	S	349;1543	ENSP00000220616:C1543S	ENSP00000220616:C1543S	C	+	2	0	TG	134004864	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	5.563000	0.67352	2.247000	0.74100	0.555000	0.69702	TGT		0.592	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Missense_Mutation
TOMM70A	9868	hgsc.bcm.edu	37	3	100105124	100105124	+	Missense_Mutation	SNP	T	T	G			TCGA-09-1665-01	TCGA-09-1665-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr3:100105124T>G	ENST00000284320.5	-	3	1011	c.563A>C	c.(562-564)aAa>aCa	p.K188T		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	188					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)	p.K188T(1)		endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						AAAGAGAGCTTTCACATATTT	0.328																																																1	Substitution - Missense(1)	ovary(1)	3											165.0	160.0	162.0					3																	100105124		2203	4300	6503	101587814	SO:0001583	missense	9868			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.563A>C	3.37:g.100105124T>G	ENSP00000284320:p.Lys188Thr	Somatic		Capture	SOLID	Phase_III	101587814	D3DN48	Missense_Mutation	SNP	ENST00000284320.5	37	CCDS33807.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	28.4	4.918519	0.92249	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	T	0.76709	-1.04	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.89629	0.6770	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90445	0.4434	10	0.52906	T	0.07	-21.0775	16.6407	0.85098	0.0:0.0:0.0:1.0	.	188	O94826	TOM70_HUMAN	T	188;81	ENSP00000284320:K188T	ENSP00000284320:K188T	K	-	2	0	TOMM70A	101587814	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.482000	0.81143	2.326000	0.78906	0.533000	0.62120	AAA		0.328	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2			Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7577506	7577506	+	Missense_Mutation	SNP	C	C	A			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr17:7577506C>A	ENST00000269305.4	-	7	964	c.775G>T	c.(775-777)Gac>Tac	p.D259Y	TP53_ENST00000420246.2_Missense_Mutation_p.D259Y|TP53_ENST00000359597.4_Missense_Mutation_p.D259Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.D259Y|TP53_ENST00000455263.2_Missense_Mutation_p.D259Y|TP53_ENST00000413465.2_Missense_Mutation_p.D259Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	259	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in a sporadic cancer; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> S (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D259Y(21)|p.0?(8)|p.D259N(6)|p.D259fs*5(3)|p.D259fs*86(3)|p.D259F(3)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)|p.D259H(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACCTGGAGTCTTCCAGTGTG	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(32)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(3)|Deletion - In frame(1)|Unknown(1)	ovary(10)|lung(8)|large_intestine(7)|oesophagus(6)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|thyroid(1)|stomach(1)|soft_tissue(1)|cervix(1)|urinary_tract(1)|breast(1)|skin(1)|eye(1)|autonomic_ganglia(1)	17											135.0	95.0	109.0					17																	7577506		2203	4300	6503	7518231	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.775G>T	17.37:g.7577506C>A	ENSP00000269305:p.Asp259Tyr	Somatic		Capture	SOLID	Phase_III	7518231	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635716	0.47049	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.52	4.52	0.55395	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.164918	0.53938	D	0.000053	D	0.99667	0.9876	M	0.73962	2.25	0.46774	D	0.999194	B;D;B;B;D	0.76494	0.097;0.983;0.03;0.338;0.999	B;P;B;B;D	0.72075	0.191;0.847;0.093;0.29;0.976	D	0.97265	0.9907	10	0.72032	D	0.01	-22.926	15.1458	0.72650	0.0:1.0:0.0:0.0	.	259;259;259;259;259	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	Y	259;259;259;259;259;259;248;127	ENSP00000410739:D259Y;ENSP00000352610:D259Y;ENSP00000269305:D259Y;ENSP00000398846:D259Y;ENSP00000391127:D259Y;ENSP00000391478:D259Y;ENSP00000425104:D127Y	ENSP00000269305:D259Y	D	-	1	0	TP53	7518231	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	2.570000	0.45981	2.517000	0.84864	0.462000	0.41574	GAC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TTN	7273	hgsc.bcm.edu	37	2	179612521	179612521	+	Intron	SNP	G	G	T	rs372890240		TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr2:179612521G>T	ENST00000591111.1	-	45	10585				TTN_ENST00000460472.2_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.A4869D|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A4869D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAGAAAGAAGCTTCATTCTG	0.358																																																1	Substitution - Missense(1)	ovary(1)	2						G	,,ASP/ALA,,	1,4405	2.1+/-5.4	0,1,2202	50.0	50.0	50.0		,,14606,,	-2.0	0.0	2		50	0,8596		0,0,4298	no	intron,intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,126,,	0,1,6500	TT,TG,GG		0.0,0.0227,0.0077	,,,,	,,4869/5605,,	179612521	1,13001	2203	4298	6501	179320766	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+5329C>A	2.37:g.179612521G>T		Somatic		Capture	SOLID	Phase_III	179320766	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039962	0.35989	2.27E-4	0.0	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.57595	0.39	6.05	-2.04	0.07343	.	.	.	.	.	T	0.21509	0.0518	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.15870	0.014	T	0.19679	-1.0298	9	0.12430	T	0.62	.	0.3872	0.00404	0.3195:0.1224:0.2282:0.3299	.	4869	Q8WZ42-6	.	D	4869;183	ENSP00000354117:A4869D	ENSP00000304714:A183D	A	-	2	0	TTN	179320766	0.865000	0.29922	0.000000	0.03702	0.003000	0.03518	1.794000	0.38774	-0.058000	0.13177	-0.912000	0.02778	GCT		0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
ZCCHC9	84240	hgsc.bcm.edu	37	5	80608438	80608438	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr5:80608438C>T	ENST00000254037.2	+	5	3928	c.773C>T	c.(772-774)cCg>cTg	p.P258L	ZCCHC9_ENST00000438268.2_Missense_Mutation_p.P258L|ZCCHC9_ENST00000506458.1_3'UTR|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.P258L|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.P258L			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	258					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P258L(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		GTACCTAAACCGCAAAAACCC	0.383																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	5											97.0	92.0	94.0					5																	80608438		2203	4300	6503	80644194	SO:0001583	missense	84240			BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.773C>T	5.37:g.80608438C>T	ENSP00000254037:p.Pro258Leu	Somatic		Capture	SOLID	Phase_III	80644194	B2RAE7|Q9H027	Missense_Mutation	SNP	ENST00000254037.2	37	CCDS4054.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	2.024	-0.423953	0.04734	.	.	ENSG00000131732	ENST00000254037;ENST00000407610;ENST00000380199;ENST00000438268	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.89	-0.114	0.13564	.	0.581781	0.20307	N	0.094920	T	0.16981	0.0408	N	0.05124	-0.11	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22626	-1.0211	10	0.17832	T	0.49	0.1757	7.2423	0.26104	0.1132:0.3643:0.0:0.5225	.	258	Q8N567	ZCHC9_HUMAN	L	258	ENSP00000254037:P258L;ENSP00000385047:P258L;ENSP00000369546:P258L;ENSP00000412637:P258L	ENSP00000254037:P258L	P	+	2	0	ZCCHC9	80644194	0.000000	0.05858	0.009000	0.14445	0.364000	0.29643	-0.564000	0.05936	-0.086000	0.12550	-0.137000	0.14449	CCG		0.383	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1	NM_032280		Missense_Mutation
ZEB2	9839	hgsc.bcm.edu	37	2	145156010	145156010	+	Missense_Mutation	SNP	G	G	T			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr2:145156010G>T	ENST00000558170.2	-	8	3928	c.2744C>A	c.(2743-2745)aCc>aAc	p.T915N	ZEB2_ENST00000409487.3_Missense_Mutation_p.T915N|ZEB2_ENST00000539609.3_Missense_Mutation_p.T891N|ZEB2_ENST00000303660.4_Missense_Mutation_p.T915N	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	915					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.T915N(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		AGGAATACTGGTCTGGACTGG	0.502																																					Melanoma(33;1235 1264 5755 16332)											1	Substitution - Missense(1)	ovary(1)	2											172.0	167.0	169.0					2																	145156010		2203	4300	6503	144872480	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2744C>A	2.37:g.145156010G>T	ENSP00000454157:p.Thr915Asn	Somatic		Capture	SOLID	Phase_III	144872480	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	4.310	0.056899	0.08339	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.12039	2.74;2.72;2.72	5.83	5.83	0.93111	.	0.044485	0.85682	D	0.000000	T	0.07954	0.0199	N	0.02539	-0.55	0.80722	D	1	B;P;P;P	0.42827	0.01;0.791;0.596;0.596	B;B;B;B	0.40864	0.009;0.342;0.26;0.26	T	0.47674	-0.9099	10	0.25106	T	0.35	-10.1069	20.1374	0.98035	0.0:0.0:1.0:0.0	.	891;780;914;915	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	N	891;915;915	ENSP00000443792:T891N;ENSP00000302501:T915N;ENSP00000386854:T915N	ENSP00000302501:T915N	T	-	2	0	ZEB2	144872480	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.763000	0.94921	0.563000	0.77884	ACC		0.502	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		Missense_Mutation
ZFYVE26	23503	hgsc.bcm.edu	37	14	68232956	68232956	+	Frame_Shift_Del	DEL	G	G	-			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:68232956delG	ENST00000347230.4	-	32	6137	c.5999delC	c.(5998-6000)gctfs	p.A2000fs	ZFYVE26_ENST00000555452.1_Frame_Shift_Del_p.A2000fs	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2000					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.A2000fs*10(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GTCACAAAGAGCCAAGTCTTG	0.507																																																1	Deletion - Frameshift(1)	ovary(1)	14											60.0	63.0	62.0					14																	68232956		2203	4300	6503	67302709	SO:0001589	frameshift_variant	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.5999delC	14.37:g.68232956delG	ENSP00000251119:p.Ala2000fs	Somatic		Capture	SOLID	Phase_III	67302709	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Frame_Shift_Del	DEL	ENST00000347230.4	37	CCDS9788.1	DEL	34	Baylor																																																																																				0.507	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		Frame_Shift_Del
ZFYVE26	23503	hgsc.bcm.edu	37	14	68244362	68244362	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr14:68244362A>C	ENST00000347230.4	-	25	5026	c.4888T>G	c.(4888-4890)Ttg>Gtg	p.L1630V	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.L1630V	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1630					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.L1630V(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TAGTTGGCCAAGAAGTGAGAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	14											235.0	199.0	211.0					14																	68244362		2203	4300	6503	67314115	SO:0001583	missense	23503			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.4888T>G	14.37:g.68244362A>C	ENSP00000251119:p.Leu1630Val	Somatic		Capture	SOLID	Phase_III	67314115	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.52	3.410102	0.62399	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.34072	1.55;1.38	5.5	3.13	0.36017	.	0.082634	0.50627	D	0.000101	T	0.50188	0.1601	M	0.71581	2.175	0.37289	D	0.908193	D;D	0.65815	0.995;0.993	D;P	0.63957	0.92;0.875	T	0.51236	-0.8731	10	0.31617	T	0.26	-7.3663	7.4705	0.27347	0.7465:0.0:0.2535:0.0	.	1630;1630	G3V2D8;Q68DK2	.;ZFY26_HUMAN	V	1630;1609;1630	ENSP00000251119:L1630V;ENSP00000450603:L1630V	ENSP00000251119:L1630V	L	-	1	2	ZFYVE26	67314115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.146000	0.31589	0.381000	0.24851	0.460000	0.39030	TTG		0.532	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		Missense_Mutation
ZNF211	10520	hgsc.bcm.edu	37	19	58152755	58152755	+	Missense_Mutation	SNP	A	A	C			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr19:58152755A>C	ENST00000347302.3	+	3	1080	c.901A>C	c.(901-903)Att>Ctt	p.I301L	ZNF211_ENST00000420680.1_Missense_Mutation_p.I305L|ZNF211_ENST00000544273.1_Missense_Mutation_p.I313L|ZNF211_ENST00000391703.3_Missense_Mutation_p.I240L|ZNF211_ENST00000541801.1_Missense_Mutation_p.I292L|ZNF211_ENST00000299871.5_Missense_Mutation_p.I366L|ZNF211_ENST00000254182.7_Missense_Mutation_p.I292L|ZNF211_ENST00000240731.4_Missense_Mutation_p.I314L	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I314L(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTCCAGTTTCATTATACATCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											80.0	77.0	78.0					19																	58152755		2203	4300	6503	62844567	SO:0001583	missense	10520			U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.901A>C	19.37:g.58152755A>C	ENSP00000339562:p.Ile301Leu	Somatic		Capture	SOLID	Phase_III	62844567	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	ENST00000347302.3	37	CCDS12957.1	SNP	8	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.24|11.24	1.581171|1.581171	0.28180|0.28180	.|.	.|.	ENSG00000121417|ENSG00000121417	ENST00000407202|ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731	.|T;T;T;T;T;T;T;T	.|0.14640	.|2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49	3.67|3.67	-1.41|-1.41	0.08941|0.08941	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.06188|0.06188	0.0160|0.0160	N|N	0.13043|0.13043	0.29|0.29	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.33318	.|0.009;0.009;0.408;0.009;0.011;0.011	.|B;B;B;B;B;B	.|0.27170	.|0.008;0.008;0.077;0.008;0.014;0.014	T|T	0.32745|0.32745	-0.9895|-0.9895	5|9	.|0.40728	.|T	.|0.16	.|.	5.6889|5.6889	0.17819|0.17819	0.3927:0.427:0.1803:0.0|0.3927:0.427:0.1803:0.0	.|.	.|305;313;366;292;301;314	.|Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1	.|.;.;.;.;ZN211_HUMAN;.	P|L	304|305;301;292;240;292;366;313;314	.|ENSP00000399193:I305L;ENSP00000339562:I301L;ENSP00000254182:I292L;ENSP00000375584:I240L;ENSP00000442601:I292L;ENSP00000299871:I366L;ENSP00000441386:I313L;ENSP00000240731:I314L	.|ENSP00000240731:I314L	H|I	+|+	2|1	0|0	ZNF211|ZNF211	62844567|62844567	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.985000|0.985000	0.73830|0.73830	-0.778000|-0.778000	0.04664|0.04664	-0.510000|-0.510000	0.06523|0.06523	0.472000|0.472000	0.43445|0.43445	CAT|ATT		0.413	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1			Missense_Mutation
ZBTB18	10472	hgsc.bcm.edu	37	1	244217166	244217170	+	Frame_Shift_Del	DEL	TTTTC	TTTTC	-			TCGA-09-1665-01	TCGA-09-1665-11	TTTTC	TTTTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr1:244217166_244217170delTTTTC	ENST00000358704.4	+	2	239_243	c.90_94delTTTTC	c.(88-96)ggttttcttfs	p.FL31fs		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	22	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F22fs*2(1)									GACACCAGGGTTTTCTTTGTGACTG	0.488																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								242283793	SO:0001589	frameshift_variant	10472			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.90_94delTTTTC	1.37:g.244217166_244217170delTTTTC	ENSP00000351539:p.Phe31fs	Somatic		Capture	SOLID	Phase_III	242283789	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Frame_Shift_Del	DEL	ENST00000358704.4	37	CCDS1622.1	DEL	60	Baylor																																																																																				0.488	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768		Frame_Shift_Del
ZNF333	84449	hgsc.bcm.edu	37	19	14829061	14829061	+	Missense_Mutation	SNP	A	A	G			TCGA-09-1665-01	TCGA-09-1665-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr19:14829061A>G	ENST00000292530.6	+	12	1013	c.922A>G	c.(922-924)Aaa>Gaa	p.K308E	ZNF333_ENST00000540689.2_Intron|ZNF333_ENST00000536363.1_Missense_Mutation_p.K199E	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K308E(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						GCCTGGAGAAAAACTCTATAA	0.393																																					NSCLC(60;75 1281 16985 25154 29885)											1	Substitution - Missense(1)	ovary(1)	19											49.0	50.0	49.0					19																	14829061		2203	4300	6503	14690061	SO:0001583	missense	84449				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.922A>G	19.37:g.14829061A>G	ENSP00000292530:p.Lys308Glu	Somatic		Capture	SOLID	Phase_III	14690061	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	ENST00000292530.6	37	CCDS12316.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.52	2.261197	0.39995	.	.	ENSG00000160961	ENST00000536363;ENST00000292530	T;T	0.63913	4.5;-0.07	3.29	-3.19	0.05171	.	.	.	.	.	T	0.63593	0.2524	M	0.93241	3.395	0.09310	N	1	B	0.30068	0.267	B	0.22386	0.039	T	0.58476	-0.7630	9	0.87932	D	0	.	5.6744	0.17741	0.3738:0.474:0.1522:0.0	.	308	Q96JL9	ZN333_HUMAN	E	199;308	ENSP00000439749:K199E;ENSP00000292530:K308E	ENSP00000292530:K308E	K	+	1	0	ZNF333	14690061	0.433000	0.25562	0.000000	0.03702	0.275000	0.26752	3.428000	0.52792	-1.000000	0.03438	0.377000	0.23210	AAA		0.393	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466496.1	NM_032433		Missense_Mutation
ZNF500	26048	hgsc.bcm.edu	37	16	4802730	4802730	+	Missense_Mutation	SNP	C	C	T			TCGA-09-1665-01	TCGA-09-1665-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr16:4802730C>T	ENST00000219478.6	-	6	1389	c.1090G>A	c.(1090-1092)Gac>Aac	p.D364N	ZNF500_ENST00000591026.1_5'UTR|ZNF500_ENST00000545009.1_Missense_Mutation_p.D364N|RP11-127I20.7_ENST00000588099.1_RNA			O60304	ZN500_HUMAN	zinc finger protein 500	364					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D364N(1)		endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						TTGGAGCGGTCGCTAAAGCCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											89.0	75.0	80.0					16																	4802730		2197	4300	6497	4742731	SO:0001583	missense	26048			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.1090G>A	16.37:g.4802730C>T	ENSP00000219478:p.Asp364Asn	Somatic		Capture	SOLID	Phase_III	4742731	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	37	CCDS32383.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917716	0.52546	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.07327	3.2;3.2	3.92	2.96	0.34315	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06690	0.0171	N	0.05383	-0.06	0.20873	N	0.999839	D;D	0.57899	0.981;0.981	P;P	0.53689	0.732;0.645	T	0.33420	-0.9869	9	0.18276	T	0.48	.	6.3083	0.21151	0.0:0.765:0.0:0.235	.	364;364	B4DNN9;O60304	.;ZN500_HUMAN	N	364	ENSP00000445714:D364N;ENSP00000219478:D364N	ENSP00000219478:D364N	D	-	1	0	ZNF500	4742731	0.000000	0.05858	0.997000	0.53966	0.996000	0.88848	-0.259000	0.08721	0.645000	0.30675	0.655000	0.94253	GAC		0.622	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507		Missense_Mutation
ZNF563	147837	hgsc.bcm.edu	37	19	12429870	12429870	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr19:12429870G>C	ENST00000293725.5	-	4	1174	c.969C>G	c.(967-969)agC>agG	p.S323R		NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S323R(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GTATCTGAAAGCTTCCAAGAT	0.423																																					GBM(39;623 795 5132 29510 31476)											1	Substitution - Missense(1)	ovary(1)	19											176.0	166.0	170.0					19																	12429870		2203	4300	6503	12290870	SO:0001583	missense	147837			BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.969C>G	19.37:g.12429870G>C	ENSP00000293725:p.Ser323Arg	Somatic		Capture	SOLID	Phase_III	12290870	B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	37	CCDS12270.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037907	0.35989	.	.	ENSG00000188868	ENST00000293725	T	0.15834	2.39	0.84	-1.68	0.08212	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28067	0.0692	L	0.49699	1.58	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.13710	-1.0499	9	0.45353	T	0.12	.	5.3318	0.15936	0.7962:0.0:0.2038:0.0	.	323	Q8TA94	ZN563_HUMAN	R	323	ENSP00000293725:S323R	ENSP00000293725:S323R	S	-	3	2	ZNF563	12290870	0.000000	0.05858	0.009000	0.14445	0.472000	0.32918	-3.674000	0.00396	-0.327000	0.08551	-0.657000	0.03884	AGC		0.423	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276		Missense_Mutation
CHAMP1	283489	hgsc.bcm.edu	37	13	115090737	115090737	+	Missense_Mutation	SNP	G	G	C			TCGA-09-1665-01	TCGA-09-1665-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-09-1665-01	TCGA-09-1665-11	g.chr13:115090737G>C	ENST00000361283.1	+	3	1729	c.1420G>C	c.(1420-1422)Ggt>Cgt	p.G474R		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	474	Mediates interaction with MAD2L2.|Mediates localization to the spindle and the kinetochore and is required for the attachment of spindle microtubules to the kinetochore.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G474R(1)									AAGTTCCCGTGGTGGTTCTCC	0.493																																																1	Substitution - Missense(1)	ovary(1)	13											209.0	245.0	233.0					13																	115090737		2203	4300	6503	114108839	SO:0001583	missense	283489			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.1420G>C	13.37:g.115090737G>C	ENSP00000354730:p.Gly474Arg	Somatic		Capture	SOLID	Phase_III	114108839	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	ENST00000361283.1	37	CCDS9545.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430282	0.25726	.	.	ENSG00000198824	ENST00000361283	T	0.01197	5.19	5.8	4.0	0.46444	.	0.333575	0.25104	N	0.033114	T	0.01061	0.0035	L	0.36672	1.1	0.22835	N	0.998671	P	0.36837	0.571	B	0.33254	0.16	T	0.51748	-0.8666	9	.	.	.	-5.1512	5.8505	0.18689	0.075:0.1354:0.6497:0.14	.	474	Q96JM3	ZN828_HUMAN	R	474	ENSP00000354730:G474R	.	G	+	1	0	ZNF828	114108839	0.001000	0.12720	1.000000	0.80357	0.991000	0.79684	-0.319000	0.08039	1.448000	0.47680	0.650000	0.86243	GGT		0.493	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436		Missense_Mutation
