#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAMTS4	9507	hgsc.bcm.edu	37	1	161163824	161163824	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr1:161163824C>G	ENST00000367996.5	-	5	1877	c.1449G>C	c.(1447-1449)caG>caC	p.Q483H	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	483	Disintegrin.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.Q483H(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	AGTGTTTGGTCTGGCACATGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											50.0	55.0	53.0					1																	161163824		2203	4299	6502	159430448	SO:0001583	missense	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1449G>C	1.37:g.161163824C>G	ENSP00000356975:p.Gln483His	Somatic		Capture	SOLID	Phase_IV	159430448	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	CCDS1223.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.09	1.832829	0.32421	.	.	ENSG00000158859	ENST00000367996	T	0.03580	3.88	5.29	3.29	0.37713	.	0.000000	0.64402	D	0.000011	T	0.01454	0.0047	L	0.41632	1.29	0.80722	D	1	B	0.22146	0.065	B	0.25614	0.062	T	0.44436	-0.9328	10	0.32370	T	0.25	.	7.9115	0.29793	0.0:0.7329:0.0:0.2671	.	483	O75173	ATS4_HUMAN	H	483	ENSP00000356975:Q483H	ENSP00000356975:Q483H	Q	-	3	2	ADAMTS4	159430448	0.896000	0.30565	1.000000	0.80357	0.996000	0.88848	0.045000	0.14013	1.472000	0.48140	0.561000	0.74099	CAG		0.662	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099		Missense_Mutation
ANO6	196527	hgsc.bcm.edu	37	12	45810569	45810569	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr12:45810569G>C	ENST00000320560.8	+	17	2301	c.2099G>C	c.(2098-2100)aGa>aCa	p.R700T	ANO6_ENST00000425752.2_Missense_Mutation_p.R700T|ANO6_ENST00000423947.3_Missense_Mutation_p.R721T|ANO6_ENST00000435642.1_Missense_Mutation_p.R700T|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000441606.2_Missense_Mutation_p.R682T	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	700					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)	p.R700T(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTGGAAATAAGAGTGGACGCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	12											130.0	111.0	118.0					12																	45810569		2203	4300	6503	44096836	SO:0001583	missense	196527			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2099G>C	12.37:g.45810569G>C	ENSP00000320087:p.Arg700Thr	Somatic		Capture	SOLID	Phase_IV	44096836	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	CCDS31782.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.238096	0.95240	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.88559	0.6469	H	0.96175	3.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;0.998;0.999;1.0	D	0.91176	0.4972	10	0.87932	D	0	.	20.269	0.98464	0.0:0.0:1.0:0.0	.	682;721;700;700	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	T	700;721;700;700;682	ENSP00000391417:R700T;ENSP00000409126:R721T;ENSP00000413840:R700T;ENSP00000320087:R700T;ENSP00000413137:R682T	ENSP00000320087:R700T	R	+	2	0	ANO6	44096836	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	AGA		0.468	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743		Missense_Mutation
APLP2	334	hgsc.bcm.edu	37	11	129993574	129993574	+	Silent	SNP	C	C	G			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr11:129993574C>G	ENST00000263574.5	+	7	1062	c.990C>G	c.(988-990)ctC>ctG	p.L330L	APLP2_ENST00000543137.1_Silent_p.L237L|APLP2_ENST00000278756.7_Silent_p.L340L|APLP2_ENST00000528499.1_Intron|APLP2_ENST00000539648.1_Intron|APLP2_ENST00000338167.5_Silent_p.L330L|APLP2_ENST00000345598.5_Intron	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	330	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.L330L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		ACTTCGACCTCTCCAAGGGAA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	11											122.0	116.0	118.0					11																	129993574		2201	4297	6498	129498784	SO:0001819	synonymous_variant	334			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.990C>G	11.37:g.129993574C>G		Somatic		Capture	SOLID	Phase_IV	129498784	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	ENST00000263574.5	37	CCDS8486.1	SNP	32	Baylor																																																																																				0.542	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642		Silent
ARRDC3	57561	hgsc.bcm.edu	37	5	90671339	90671339	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr5:90671339C>G	ENST00000265138.3	-	4	868	c.602G>C	c.(601-603)gGc>gCc	p.G201A	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	201					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)	p.G201A(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		TGGGGTATAGCCCTTCCTTTC	0.368																																																1	Substitution - Missense(1)	ovary(1)	5											108.0	114.0	112.0					5																	90671339		2203	4300	6503	90707095	SO:0001583	missense	57561			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.602G>C	5.37:g.90671339C>G	ENSP00000265138:p.Gly201Ala	Somatic		Capture	SOLID	Phase_IV	90707095	A8K6T8|Q9P2H1	Missense_Mutation	SNP	ENST00000265138.3	37	CCDS34202.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.128880	0.94473	.	.	ENSG00000113369	ENST00000265138	T	0.16743	2.32	5.51	5.51	0.81932	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.28554	-1.0040	10	0.48119	T	0.1	-28.0432	19.4092	0.94662	0.0:1.0:0.0:0.0	.	201	Q96B67	ARRD3_HUMAN	A	201	ENSP00000265138:G201A	ENSP00000265138:G201A	G	-	2	0	ARRDC3	90707095	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.484000	0.81180	2.591000	0.87537	0.591000	0.81541	GGC		0.368	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369763.2	NM_020801		Missense_Mutation
ARSG	22901	hgsc.bcm.edu	37	17	66381226	66381226	+	Missense_Mutation	SNP	C	C	G	rs147264809		TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr17:66381226C>G	ENST00000448504.2	+	9	1800	c.1004C>G	c.(1003-1005)aCg>aGg	p.T335R	ARSG_ENST00000452479.2_Missense_Mutation_p.T171R|ARSG_ENST00000582154.1_3'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	335					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.T335R(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCCAAGCAGACGACCTGGGAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	17											74.0	74.0	74.0					17																	66381226		2203	4300	6503	63892821	SO:0001583	missense	22901			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1004C>G	17.37:g.66381226C>G	ENSP00000407193:p.Thr335Arg	Somatic		Capture	SOLID	Phase_IV	63892821	Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	ENST00000448504.2	37	CCDS11676.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	29.5	5.008752	0.93346	.	.	ENSG00000141337	ENST00000452479;ENST00000448504	.	.	.	5.64	5.64	0.86602	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.109289	0.64402	D	0.000006	D	0.83825	0.5338	M	0.83012	2.62	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.85588	0.1244	9	0.72032	D	0.01	.	18.4841	0.90823	0.0:1.0:0.0:0.0	.	335	Q96EG1	ARSG_HUMAN	R	335;234	.	ENSP00000407193:T234R	T	+	2	0	ARSG	63892821	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.787000	0.69013	2.652000	0.90054	0.655000	0.94253	ACG		0.552	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960		Missense_Mutation
CCDC67	159989	hgsc.bcm.edu	37	11	93104410	93104410	+	Silent	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr11:93104410C>T	ENST00000298050.3	+	7	853	c.753C>T	c.(751-753)ctC>ctT	p.L251L		NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	251					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)		p.L243L(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				ATCAGAAGCTCTTGCAAGAAC	0.308																																																1	Substitution - coding silent(1)	ovary(1)	11											55.0	52.0	53.0					11																	93104410		1827	4078	5905	92744058	SO:0001819	synonymous_variant	159989			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.753C>T	11.37:g.93104410C>T		Somatic		Capture	SOLID	Phase_IV	92744058	Q8NEF1|Q96LL7	Silent	SNP	ENST00000298050.3	37	CCDS44707.1	SNP	32	Baylor																																																																																				0.308	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181645		Silent
CCNT1	904	hgsc.bcm.edu	37	12	49093620	49093620	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0928-01	TCGA-10-0928-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr12:49093620A>C	ENST00000261900.3	-	5	659	c.437T>G	c.(436-438)tTt>tGt	p.F146C		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	146					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.F146C(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						TGTTAGTTCAAAGCCTTAAAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											193.0	195.0	194.0					12																	49093620		2203	4300	6503	47379887	SO:0001583	missense	904			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.437T>G	12.37:g.49093620A>C	ENSP00000261900:p.Phe146Cys	Somatic		Capture	SOLID	Phase_IV	47379887	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	a	22.1	4.245576	0.80024	.	.	ENSG00000129315	ENST00000261900	T	0.65178	-0.14	4.99	4.99	0.66335	Cyclin, N-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.84561	0.5499	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89173	0.3538	10	0.87932	D	0	-13.5106	13.98	0.64299	1.0:0.0:0.0:0.0	.	146	O60563	CCNT1_HUMAN	C	146	ENSP00000261900:F146C	ENSP00000261900:F146C	F	-	2	0	CCNT1	47379887	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.313000	0.96297	2.007000	0.58848	0.528000	0.53228	TTT		0.313	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240		Missense_Mutation
CD200R1	131450	hgsc.bcm.edu	37	3	112647781	112647781	+	Silent	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr3:112647781G>A	ENST00000471858.1	-	4	814	c.582C>T	c.(580-582)agC>agT	p.S194S	CD200R1_ENST00000308611.3_Silent_p.S217S|CD200R1_ENST00000295863.4_Silent_p.S172S|CD200R1_ENST00000440122.2_3'UTR|CD200R1_ENST00000490004.1_3'UTR	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	194	Ig-like C2-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.S217S(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						CTGTGCCATTGCTCCAGTATT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	3											135.0	108.0	117.0					3																	112647781		2203	4300	6503	114130471	SO:0001819	synonymous_variant	131450			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.582C>T	3.37:g.112647781G>A		Somatic		Capture	SOLID	Phase_IV	114130471	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Silent	SNP	ENST00000471858.1	37	CCDS2970.1	SNP	46	Baylor																																																																																				0.522	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354467.1	NM_138806		Silent
CPAMD8	27151	hgsc.bcm.edu	37	19	17132877	17132877	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0928-01	TCGA-10-0928-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr19:17132877C>G	ENST00000443236.1	-	2	379	c.348G>C	c.(346-348)caG>caC	p.Q116H	CPAMD8_ENST00000388925.4_Missense_Mutation_p.Q69H	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	69						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q116H(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCGGCTCACCCTGGGCCACCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											27.0	30.0	29.0					19																	17132877		1976	4157	6133	16993877	SO:0001583	missense	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.348G>C	19.37:g.17132877C>G	ENSP00000402505:p.Gln116His	Somatic		Capture	SOLID	Phase_IV	16993877	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	SNP	24	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.262|9.262	1.043453|1.043453	0.19748|0.19748	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440;ENST00000388925|ENST00000443236	T;T|.	0.53857|.	0.6;0.62|.	3.06|3.06	1.89|1.89	0.25635|0.25635	.|.	0.186232|.	0.32372|.	U|.	0.006185|.	T|T	0.31071|0.31071	0.0785|0.0785	L|L	0.36672|0.36672	1.1|1.1	0.28850|0.28850	N|N	0.896097|0.896097	P|.	0.48162|.	0.906|.	B|.	0.37780|.	0.258|.	T|T	0.23940|0.23940	-1.0174|-1.0174	10|5	0.46703|.	T|.	0.11|.	.|.	3.0921|3.0921	0.06297|0.06297	0.0:0.3855:0.0:0.6145|0.0:0.3855:0.0:0.6145	.|.	69|.	Q8IZJ3|.	CPMD8_HUMAN|.	H|T	116;69|127	ENSP00000291440:Q116H;ENSP00000373577:Q69H|.	ENSP00000291440:Q116H|.	Q|R	-|-	3|2	2|0	CPAMD8|CPAMD8	16993877|16993877	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.159000|0.159000	0.22180|0.22180	1.246000|1.246000	0.32803|0.32803	1.267000|1.267000	0.44247|0.44247	0.591000|0.591000	0.81541|0.81541	CAG|AGG		0.607	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692		Missense_Mutation
CYTH1	9267	hgsc.bcm.edu	37	17	76672214	76672214	+	Missense_Mutation	SNP	C	C	T	rs376898813		TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr17:76672214C>T	ENST00000446868.3	-	14	1226	c.1156G>A	c.(1156-1158)Gca>Aca	p.A386T	CYTH1_ENST00000591455.1_Missense_Mutation_p.A385T|CYTH1_ENST00000586175.1_5'UTR|CYTH1_ENST00000589296.1_Intron|CYTH1_ENST00000361101.4_Missense_Mutation_p.A386T|CYTH1_ENST00000589297.1_Missense_Mutation_p.A327T|CYTH1_ENST00000585509.1_Missense_Mutation_p.A327T			Q15438	CYH1_HUMAN	cytohesin 1	386					establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)	p.A386T(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						TTCCGTGCTGCGAGCATTTCG	0.572																																																1	Substitution - Missense(1)	ovary(1)	17						C	THR/ALA,THR/ALA	2,4404	2.1+/-5.4	0,2,2201	87.0	64.0	72.0		1156,1153	5.1	0.6	17		72	0,8600		0,0,4300	no	missense,missense	CYTH1	NM_004762.2,NM_017456.2	58,58	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	386/399,385/398	76672214	2,13004	2203	4300	6503	74183809	SO:0001583	missense	9267			M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.1156G>A	17.37:g.76672214C>T	ENSP00000389095:p.Ala386Thr	Somatic		Capture	SOLID	Phase_IV	74183809	A6NFW7|B7Z1T4|Q9P123|Q9P124	Missense_Mutation	SNP	ENST00000446868.3	37		SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503616	0.85176	4.54E-4	0.0	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000539525;ENST00000537048;ENST00000262763	T;T	0.13307	2.6;2.6	5.08	5.08	0.68730	.	0.116119	0.56097	D	0.000022	T	0.20495	0.0493	M	0.79475	2.455	0.80722	D	1	B	0.31931	0.347	B	0.22386	0.039	T	0.04294	-1.0962	10	0.56958	D	0.05	.	18.4292	0.90619	0.0:1.0:0.0:0.0	.	385	Q15438-2	.	T	386;386;327;327;385	ENSP00000389095:A386T;ENSP00000354398:A386T	ENSP00000262763:A385T	A	-	1	0	CYTH1	74183809	1.000000	0.71417	0.559000	0.28332	0.971000	0.66376	7.659000	0.83766	2.521000	0.84997	0.591000	0.81541	GCA		0.572	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762		Missense_Mutation
DCLK1	9201	hgsc.bcm.edu	37	13	36686117	36686117	+	Silent	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr13:36686117C>T	ENST00000360631.3	-	3	823	c.612G>A	c.(610-612)ctG>ctA	p.L204L	DCLK1_ENST00000255448.4_Silent_p.L204L|DCLK1_ENST00000379892.4_Silent_p.L204L			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	204	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.L204L(3)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCTTGTTCAGCAGAATCCTGA	0.527																																																3	Substitution - coding silent(3)	large_intestine(2)|ovary(1)	13											185.0	159.0	168.0					13																	36686117		2203	4300	6503	35584117	SO:0001819	synonymous_variant	9201			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.612G>A	13.37:g.36686117C>T		Somatic		Capture	SOLID	Phase_IV	35584117	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	37		SNP	25	Baylor																																																																																				0.527	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734		Silent
DDX59	83479	hgsc.bcm.edu	37	1	200617689	200617689	+	Missense_Mutation	SNP	G	G	C	rs145880966		TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr1:200617689G>C	ENST00000331314.6	-	7	1687	c.1474C>G	c.(1474-1476)Ctt>Gtt	p.L492V	DDX59_ENST00000367348.3_Missense_Mutation_p.L492V|DDX59_ENST00000447706.2_Missense_Mutation_p.L492V	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	492	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.L492V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TCTCCTTCAAGTAATCCCTTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	1						G	VAL/LEU	0,4406		0,0,2203	116.0	114.0	115.0		1474	4.5	0.1	1	dbSNP_134	115	2,8598	2.2+/-6.3	0,2,4298	no	missense	DDX59	NM_001031725.4	32	0,2,6501	CC,CG,GG		0.0233,0.0,0.0154	benign	492/620	200617689	2,13004	2203	4300	6503	198884312	SO:0001583	missense	83479			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.1474C>G	1.37:g.200617689G>C	ENSP00000330460:p.Leu492Val	Somatic		Capture	SOLID	Phase_IV	198884312	Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	37	CCDS30964.1	SNP	36	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.151708|3.151708	0.57151|0.57151	0.0|0.0	2.33E-4|2.33E-4	ENSG00000118197|ENSG00000118197	ENST00000447706;ENST00000413408;ENST00000367348;ENST00000367346;ENST00000331314;ENST00000433235|ENST00000452560;ENST00000429498	T;T;T;T;T|.	0.75154|.	-0.91;-0.91;-0.91;-0.91;-0.91|.	5.5|5.5	4.49|4.49	0.54785|0.54785	Helicase, C-terminal (3);|.	0.119854|.	0.64402|.	D|.	0.000019|.	T|T	0.57066|0.57066	0.2028|0.2028	L|L	0.43701|0.43701	1.375|1.375	0.58432|0.58432	D|D	0.999998|0.999998	P;P|.	0.45396|.	0.857;0.766|.	P;P|.	0.51324|.	0.666;0.666|.	T|T	0.52313|0.52313	-0.8592|-0.8592	10|5	0.44086|.	T|.	0.13|.	-21.7279|-21.7279	10.6506|10.6506	0.45647|0.45647	0.1607:0.0:0.8393:0.0|0.1607:0.0:0.8393:0.0	.|.	492;492|.	B7Z5N6;Q5T1V6|.	.;DDX59_HUMAN|.	V|S	492;130;492;78;492;135|28;69	ENSP00000394367:L492V;ENSP00000394304:L130V;ENSP00000356317:L492V;ENSP00000330460:L492V;ENSP00000409954:L135V|.	ENSP00000330460:L492V|.	L|T	-|-	1|2	0|0	DDX59|DDX59	198884312|198884312	1.000000|1.000000	0.71417|0.71417	0.057000|0.057000	0.19452|0.19452	0.182000|0.182000	0.23217|0.23217	5.271000|5.271000	0.65553|0.65553	2.577000|2.577000	0.86979|0.86979	0.643000|0.643000	0.83706|0.83706	CTT|ACT		0.358	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4		Missense_Mutation
DENND4A	10260	hgsc.bcm.edu	37	15	66010133	66010133	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr15:66010133G>C	ENST00000431932.2	-	13	1998	c.1790C>G	c.(1789-1791)tCt>tGt	p.S597C	MIR4511_ENST00000582784.1_RNA|DENND4A_ENST00000443035.3_Missense_Mutation_p.S597C	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	597	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S597C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GGCAAAGAGAGAGGCTGCATC	0.398																																																1	Substitution - Missense(1)	ovary(1)	15											49.0	53.0	52.0					15																	66010133		1864	4111	5975	63797187	SO:0001583	missense	10260			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1790C>G	15.37:g.66010133G>C	ENSP00000396830:p.Ser597Cys	Somatic		Capture	SOLID	Phase_IV	63797187	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674889	0.88445	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.44881	0.91;0.91	5.63	5.63	0.86233	dDENN (3);	0.000000	0.85682	D	0.000000	T	0.69079	0.3071	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.986;1.0;0.999	T	0.72475	-0.4282	10	0.87932	D	0	.	19.6818	0.95967	0.0:0.0:1.0:0.0	.	597;597;597	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	C	597	ENSP00000391167:S597C;ENSP00000396830:S597C	ENSP00000396830:S597C	S	-	2	0	DENND4A	63797187	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.869000	0.99810	2.641000	0.89580	0.591000	0.81541	TCT		0.398	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848		Missense_Mutation
DNAH7	56171	hgsc.bcm.edu	37	2	196737142	196737142	+	Silent	SNP	G	G	T			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr2:196737142G>T	ENST00000312428.6	-	40	6565	c.6465C>A	c.(6463-6465)ggC>ggA	p.G2155G		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2155	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.G2155G(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAGTCATTGTGCCATTTACGA	0.323																																																1	Substitution - coding silent(1)	ovary(1)	2											168.0	150.0	156.0					2																	196737142		1828	4085	5913	196445387	SO:0001819	synonymous_variant	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6465C>A	2.37:g.196737142G>T		Somatic		Capture	SOLID	Phase_IV	196445387	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1	SNP	46	Baylor																																																																																				0.323	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		Silent
DST	667	hgsc.bcm.edu	37	6	56425125	56425125	+	Frame_Shift_Del	DEL	C	C	-			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr6:56425125delC	ENST00000361203.3	-	54	13781	c.13774delG	c.(13774-13776)gccfs	p.A4592fs	DST_ENST00000370788.2_Frame_Shift_Del_p.A2506fs|DST_ENST00000370754.5_Frame_Shift_Del_p.A4772fs|DST_ENST00000446842.2_Frame_Shift_Del_p.A4268fs|DST_ENST00000244364.6_Frame_Shift_Del_p.A2180fs|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Frame_Shift_Del_p.A2506fs|DST_ENST00000370769.4_Frame_Shift_Del_p.A4594fs			Q03001	DYST_HUMAN	dystonin	4592					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.A4594fs*8(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATCTGGGGGCCTCAGGAGTA	0.398																																																1	Deletion - Frameshift(1)	ovary(1)	6											95.0	93.0	93.0					6																	56425125		1861	4095	5956	56533084	SO:0001589	frameshift_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.13774delG	6.37:g.56425125delC	ENSP00000354508:p.Ala4592fs	Somatic		Capture	SOLID	Phase_IV	56533084	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Del	DEL	ENST00000361203.3	37		DEL	26	Baylor																																																																																				0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Frame_Shift_Del
EZR	7430	hgsc.bcm.edu	37	6	159206613	159206613	+	Silent	SNP	C	C	A			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr6:159206613C>A	ENST00000367075.3	-	5	363	c.195G>T	c.(193-195)gtG>gtT	p.V65V	EZR_ENST00000476189.1_5'UTR|EZR_ENST00000392177.4_Silent_p.V33V|EZR_ENST00000337147.7_Silent_p.V65V	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	65	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)	p.V65V(1)	EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CCTGGGCAGACACCTGCACGA	0.562			T	ROS1	NSCLC																																		Dom	yes		6	6q25.3	7430	ezrin		E	1	Substitution - coding silent(1)	ovary(1)	6											41.0	40.0	40.0					6																	159206613		2203	4300	6503	159126601	SO:0001819	synonymous_variant	7430			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.195G>T	6.37:g.159206613C>A		Somatic		Capture	SOLID	Phase_IV	159126601	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	37	CCDS5258.1	SNP	17	Baylor																																																																																				0.562	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379		Silent
FAM24A	118670	hgsc.bcm.edu	37	10	124672470	124672470	+	Nonstop_Mutation	SNP	A	A	T			TCGA-10-0928-01	TCGA-10-0928-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr10:124672470A>T	ENST00000368894.1	+	3	439	c.318A>T	c.(316-318)tgA>tgT	p.*106C		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	0						extracellular region (GO:0005576)		p.*106C(1)		large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		AGGGCCTCTGACTTGGGAAAG	0.398																																																1	Nonstop extension(1)	ovary(1)	10											87.0	70.0	75.0					10																	124672470		2203	4300	6503	124662460	SO:0001578	stop_lost	118670				CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.318A>T	10.37:g.124672470A>T	ENSP00000357889:p.*106Cysext*35	Somatic		Capture	SOLID	Phase_IV	124662460		Missense_Mutation	SNP	ENST00000368894.1	37	CCDS31304.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.496	0.863227	0.17250	.	.	ENSG00000203795	ENST00000368894	.	.	.	3.57	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8287	0.35072	1.0:0.0:0.0:0.0	.	.	.	.	C	106	.	.	X	+	3	0	FAM24A	124662460	0.941000	0.31946	0.126000	0.21872	0.113000	0.19764	3.345000	0.52182	1.864000	0.54056	0.459000	0.35465	TGA		0.398	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050824.1	XM_058332		Missense_Mutation
FBLN1	2192	hgsc.bcm.edu	37	22	45938104	45938118	+	In_Frame_Del	DEL	GTTTCCGCTGCGAAT	GTTTCCGCTGCGAAT	-	rs370157465|rs371901304|rs142302254		TCGA-10-0928-01	TCGA-10-0928-11	GTTTCCGCTGCGAAT	GTTTCCGCTGCGAAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr22:45938104_45938118delGTTTCCGCTGCGAAT	ENST00000327858.6	+	10	1231_1245	c.1136_1150delGTTTCCGCTGCGAAT	c.(1135-1152)agtttccgctgcgaatgc>agc	p.FRCEC380del	FBLN1_ENST00000442170.2_In_Frame_Del_p.FRCEC380del|FBLN1_ENST00000348697.2_In_Frame_Del_p.FRCEC380del|FBLN1_ENST00000402984.3_In_Frame_Del_p.FRCEC418del|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000340923.5_In_Frame_Del_p.FRCEC380del|FBLN1_ENST00000262722.7_In_Frame_Del_p.FRCEC380del	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	380	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Self-association and FN1-binding; calcium is necessary for homotypic binding, but not for heterotypic binding.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.F380_C384delFRCEC(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCTCCCGGCAGTTTCCGCTGCGAATGCAAGACGGG	0.609																																																1	Deletion - In frame(1)	ovary(1)	22																																								44316782	SO:0001651	inframe_deletion	2192				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1136_1150delGTTTCCGCTGCGAAT	22.37:g.45938104_45938118delGTTTCCGCTGCGAAT	ENSP00000331544:p.Phe380_Cys384del	Somatic		Capture	SOLID	Phase_IV	44316768	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	In_Frame_Del	DEL	ENST00000327858.6	37	CCDS14067.1	DEL	36	Baylor																																																																																				0.609	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486		In_Frame_Del
FNBP1	23048	hgsc.bcm.edu	37	9	132658207	132658207	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr9:132658207C>T	ENST00000446176.2	-	16	1942	c.1756G>A	c.(1756-1758)Gat>Aat	p.D586N	FNBP1_ENST00000420781.1_Missense_Mutation_p.D577N|FNBP1_ENST00000443566.2_Missense_Mutation_p.D214N|FNBP1_ENST00000355681.3_Missense_Mutation_p.D557N	NM_015033.2	NP_055848.1	Q96RU3	FNBP1_HUMAN	formin binding protein 1	586	Interaction with ARHGAP17, DAAM1, DIAPH1 and DIAPH2.|Interaction with DNM1 and DNM3.|Interaction with DNM2 and WASL.|Interaction with FASLG.|Interaction with PDE6G. {ECO:0000250}.|Required for interaction with TNKS.|Required for self-association and induction of membrane tubulation.|SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)	coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)						Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		GTCCAGCCATCGCCTTTGTCT	0.423			T	MLL	AML																																		Dom	yes		9	9q23	23048	formin binding protein 1 (FBP17)		L	0			9											114.0	107.0	109.0					9																	132658207		1927	4133	6060	131698028	SO:0001583	missense	23048			AB011126	CCDS48040.1	9q34	2008-02-05			ENSG00000187239	ENSG00000187239			17069	protein-coding gene	gene with protein product		606191				9628581, 11438682	Standard	XM_005251815		Approved	FBP17, KIAA0554	uc004byw.1	Q96RU3	OTTHUMG00000020800	ENST00000446176.2:c.1756G>A	9.37:g.132658207C>T	ENSP00000413625:p.Asp586Asn	Somatic		Capture	SOLID	Phase_IV	131698028	O60301|Q3MIN8|Q5TC87|Q5TC88|Q6P658|Q7LGG2|Q9H8H8|Q9NWD1	Missense_Mutation	SNP	ENST00000446176.2	37	CCDS48040.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.081805	0.94050	.	.	ENSG00000187239	ENST00000372416;ENST00000446176;ENST00000420781;ENST00000372415;ENST00000443566;ENST00000355681	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.11	5.11	0.69529	Src homology-3 domain (4);	0.044789	0.85682	D	0.000000	T	0.72630	0.3484	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.991;0.999;0.999;0.98;0.981;1.0;0.968;0.999	T	0.75841	-0.3175	10	0.87932	D	0	-48.8143	17.8863	0.88855	0.0:1.0:0.0:0.0	.	581;576;214;520;557;537;581;586	B7ZL12;B7ZL13;E7EPB7;B7ZL14;Q96RU3-3;Q5QP69;Q96RU3-2;Q96RU3	.;.;.;.;.;.;.;FNBP1_HUMAN	N	586;586;577;586;214;557	ENSP00000413625:D586N;ENSP00000407548:D577N;ENSP00000389117:D214N;ENSP00000347907:D557N	ENSP00000347907:D557N	D	-	1	0	FNBP1	131698028	1.000000	0.71417	0.188000	0.23233	0.849000	0.48306	7.445000	0.80570	2.538000	0.85594	0.561000	0.74099	GAT		0.423	FNBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054630.2			Missense_Mutation
GNAT1	2779	hgsc.bcm.edu	37	3	50232277	50232277	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr3:50232277G>C	ENST00000433068.1	+	8	998	c.942G>C	c.(940-942)gaG>gaC	p.E314D	GNAT1_ENST00000232461.3_Missense_Mutation_p.E314D	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	314					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.E314D(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		ACGTGAAGGAGATCTATTCCC	0.567											OREG0015580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	3											101.0	81.0	88.0					3																	50232277		2203	4300	6503	50207281	SO:0001583	missense	2779				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.942G>C	3.37:g.50232277G>C	ENSP00000387555:p.Glu314Asp	Somatic	968	Capture	SOLID	Phase_IV	50207281	Q4VBN2	Missense_Mutation	SNP	ENST00000433068.1	37	CCDS2812.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407333	0.83230	.	.	ENSG00000114349	ENST00000232461;ENST00000433068	D;D	0.88896	-2.44;-2.44	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.92668	0.7670	M	0.66560	2.04	0.53005	D	0.999962	D	0.63046	0.992	D	0.75020	0.985	D	0.92708	0.6180	10	0.59425	D	0.04	.	11.1405	0.48400	0.0912:0.0:0.9088:0.0	.	314	P11488	GNAT1_HUMAN	D	314	ENSP00000232461:E314D;ENSP00000387555:E314D	ENSP00000232461:E314D	E	+	3	2	GNAT1	50207281	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.882000	0.28186	2.243000	0.73865	0.491000	0.48974	GAG		0.567	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172		Missense_Mutation
HDAC4	9759	hgsc.bcm.edu	37	2	240024584	240024584	+	Silent	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr2:240024584G>A	ENST00000345617.3	-	16	2897	c.2106C>T	c.(2104-2106)cgC>cgT	p.R702R	HDAC4_ENST00000543185.1_Silent_p.R286R|HDAC4_ENST00000541256.1_Silent_p.R676R	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	702	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R702R(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		CCTTGCGTCCGCGGATGCACT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	2											116.0	93.0	101.0					2																	240024584		2203	4300	6503	239689521	SO:0001819	synonymous_variant	9759			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2106C>T	2.37:g.240024584G>A		Somatic		Capture	SOLID	Phase_IV	239689521	Q9UND6	Silent	SNP	ENST00000345617.3	37	CCDS2529.1	SNP	38	Baylor																																																																																				0.587	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037		Silent
HOOK1	51361	hgsc.bcm.edu	37	1	60324139	60324139	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr1:60324139G>A	ENST00000371208.3	+	13	1539	c.1282G>A	c.(1282-1284)Gaa>Aaa	p.E428K	HOOK1_ENST00000395561.2_Missense_Mutation_p.E386K|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	428	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.E428K(1)		biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					AGAAACAAATGAAGAGCTTCG	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	94.0	93.0					1																	60324139		2203	4300	6503	60096727	SO:0001583	missense	51361			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1282G>A	1.37:g.60324139G>A	ENSP00000360252:p.Glu428Lys	Somatic		Capture	SOLID	Phase_IV	60096727	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	37	CCDS612.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959720	0.92791	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.22336	1.96;1.96	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.52320	-0.8591	10	0.44086	T	0.13	.	15.3769	0.74615	0.0:0.0:1.0:0.0	.	428	Q9UJC3	HOOK1_HUMAN	K	428;386	ENSP00000360252:E428K;ENSP00000378928:E386K	ENSP00000360252:E428K	E	+	1	0	HOOK1	60096727	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.290000	0.89925	2.287000	0.76781	0.462000	0.41574	GAA		0.353	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888		Missense_Mutation
HPS3	84343	hgsc.bcm.edu	37	3	148885739	148885739	+	Silent	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr3:148885739G>A	ENST00000296051.2	+	16	2996	c.2856G>A	c.(2854-2856)gaG>gaA	p.E952E	HPS3_ENST00000460120.1_Silent_p.E787E	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	952					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.E952E(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTGGTGGAGAGAAGTATCAAC	0.299									Hermansky-Pudlak syndrome																																							1	Substitution - coding silent(1)	ovary(1)	3											98.0	104.0	102.0					3																	148885739		2203	4298	6501	150368429	SO:0001819	synonymous_variant	84343	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.2856G>A	3.37:g.148885739G>A		Somatic		Capture	SOLID	Phase_IV	150368429	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	ENST00000296051.2	37	CCDS3140.1	SNP	33	Baylor																																																																																				0.299	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383		Silent
HSPA1L	3305	hgsc.bcm.edu	37	6	31778204	31778204	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr6:31778204C>G	ENST00000375654.4	-	2	1735	c.1546G>C	c.(1546-1548)Gag>Cag	p.E516Q	HSPA1L_ENST00000417199.3_Missense_Mutation_p.E516Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	516					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.E516Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CGCTCAATCTCCTCCTTGCTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	6											176.0	168.0	171.0					6																	31778204		2203	4300	6503	31886183	SO:0001583	missense	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1546G>C	6.37:g.31778204C>G	ENSP00000364805:p.Glu516Gln	Somatic		Capture	SOLID	Phase_IV	31886183	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739490	0.49045	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.01197	5.19;5.19	5.55	4.64	0.57946	.	0.225916	0.22588	N	0.058138	T	0.01156	0.0038	M	0.67700	2.07	0.50813	D	0.999891	B	0.15141	0.012	B	0.26693	0.072	T	0.48210	-0.9055	10	0.62326	D	0.03	-16.9309	14.4293	0.67238	0.0:0.8526:0.1474:0.0	.	516	P34931	HS71L_HUMAN	Q	516;516;461	ENSP00000364805:E516Q;ENSP00000387691:E516Q	ENSP00000364804:E461Q	E	-	1	0	HSPA1L	31886183	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.921000	0.70028	2.890000	0.99128	0.585000	0.79938	GAG		0.478	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			Missense_Mutation
HYDIN	54768	hgsc.bcm.edu	37	16	70998699	70998699	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0928-01	TCGA-10-0928-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr16:70998699T>A	ENST00000393567.2	-	37	5870	c.5720A>T	c.(5719-5721)aAa>aTa	p.K1907I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1907					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.K1858I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTTTATCTCTTTGAAGTACTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	16											28.0	23.0	24.0					16																	70998699		1778	4027	5805	69556200	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5720A>T	16.37:g.70998699T>A	ENSP00000377197:p.Lys1907Ile	Somatic		Capture	SOLID	Phase_IV	69556200	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.53	2.861013	0.51482	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.42513	0.97	4.93	1.41	0.22369	.	0.514459	0.14061	U	0.344049	T	0.39682	0.1087	L	0.29908	0.895	0.80722	D	1	P	0.44195	0.828	P	0.50896	0.653	T	0.16571	-1.0398	10	0.66056	D	0.02	.	8.5797	0.33621	0.0:0.23:0.0:0.77	.	1906	F8WD23	.	I	1907;1906	ENSP00000377197:K1907I	ENSP00000310485:K198I	K	-	2	0	HYDIN	69556200	0.825000	0.29262	0.956000	0.39512	0.257000	0.26127	1.489000	0.35562	-0.022000	0.13986	-0.571000	0.04153	AAA		0.507	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Missense_Mutation
IL1RAPL1	11141	hgsc.bcm.edu	37	X	29935625	29935625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-10-0928-01	TCGA-10-0928-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chrX:29935625G>T	ENST00000378993.1	+	7	1496	c.823G>T	c.(823-825)Gga>Tga	p.G275*	IL1RAPL1_ENST00000302196.4_Nonsense_Mutation_p.G275*	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	275	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.G275*(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGGGTACAGCGGAGATGTCAG	0.348																																																1	Substitution - Nonsense(1)	ovary(1)	X											59.0	55.0	57.0					X																	29935625		2202	4300	6502	29845546	SO:0001587	stop_gained	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.823G>T	X.37:g.29935625G>T	ENSP00000368278:p.Gly275*	Somatic		Capture	SOLID	Phase_IV	29845546	A0AVG4|Q9UJ53	Nonsense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	44	10.819807	0.99472	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1532	0.93499	0.0:0.0:1.0:0.0	.	.	.	.	X	275	.	.	G	+	1	0	IL1RAPL1	29845546	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	9.431000	0.97494	2.474000	0.83562	0.600000	0.82982	GGA		0.348	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		Nonsense_Mutation
NYNRIN	57523	hgsc.bcm.edu	37	14	24879216	24879216	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0928-01	TCGA-10-0928-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr14:24879216T>G	ENST00000382554.3	+	4	2534	c.2216T>G	c.(2215-2217)tTt>tGt	p.F739C		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	739					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)	p.F739C(1)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						AAGCACCAGTTTCAGATGGAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	14											21.0	24.0	23.0					14																	24879216		1940	4117	6057	23949056	SO:0001583	missense	57523			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2216T>G	14.37:g.24879216T>G	ENSP00000371994:p.Phe739Cys	Somatic		Capture	SOLID	Phase_IV	23949056	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.19	1.282925	0.23392	.	.	ENSG00000205978	ENST00000382554	T	0.10477	2.87	4.75	-3.36	0.04913	.	.	.	.	.	T	0.04679	0.0127	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40079	-0.9582	9	0.44086	T	0.13	.	1.5242	0.02522	0.1342:0.4381:0.1337:0.2939	.	739	Q9P2P1	NYNRI_HUMAN	C	739	ENSP00000371994:F739C	ENSP00000371994:F739C	F	+	2	0	NYNRIN	23949056	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.193000	0.17116	-0.336000	0.08438	-0.899000	0.02877	TTT		0.632	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1			Missense_Mutation
EDF1	8721	hgsc.bcm.edu	37	9	139754426	139754426	+	IGR	SNP	A	A	G			TCGA-10-0928-01	TCGA-10-0928-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr9:139754426A>G	ENST00000224073.1	-	0	640				MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Silent_p.G1173G|MAMDC4_ENST00000317446.2_Silent_p.G1094G	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1						endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GACTTGGGGGACGGCGCTGGC	0.622																																																0			9											56.0	55.0	55.0					9																	139754426		2200	4300	6500	138874247	SO:0001628	intergenic_variant	158056			AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948		9.37:g.139754426A>G		Somatic		Capture	SOLID	Phase_IV	138874247	Q5T5T2|Q9UIM1	Silent	SNP	ENST00000224073.1	37	CCDS7011.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	.	5.820	0.335524	0.11013	.	.	ENSG00000177943	ENST00000413647	.	.	.	4.77	-9.53	0.00575	.	.	.	.	.	T	0.24044	0.0582	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.13602	-1.0503	4	.	.	.	-7.9033	7.156	0.25637	0.0801:0.4296:0.3614:0.1288	.	.	.	.	A	1159	.	.	T	+	1	0	MAMDC4	138874247	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-7.009000	0.00047	-3.981000	0.00085	-1.262000	0.01453	ACG		0.622	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055143.1			Silent
MUC19	283463	hgsc.bcm.edu	37	12	40821802	40821802	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr12:40821802G>A	ENST00000454784.4	+	13	1284	c.551G>A	c.(550-552)gGa>gAa	p.G184E	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	184					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GGAGAGAAAGGAAAATGTGTA	0.413																																																0			12																																								39108069	SO:0001583	missense	283463			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.551G>A	12.37:g.40821802G>A	ENSP00000476404:p.Gly184Glu	Somatic		Capture	SOLID	Phase_IV	39108069	Q8NA85	Missense_Mutation	SNP	ENST00000454784.4	37		SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.09	3.547236	0.65311	.	.	ENSG00000205592	ENST00000425730	.	.	.	5.89	3.86	0.44501	.	.	.	.	.	T	0.42471	0.1204	L	0.52823	1.66	0.29298	N	0.868882	.	.	.	.	.	.	T	0.36720	-0.9736	6	0.34782	T	0.22	.	7.0981	0.25321	0.0748:0.119:0.6692:0.1371	.	.	.	.	E	413	.	ENSP00000395253:G413E	G	+	2	0	MUC19	39108069	0.987000	0.35691	0.988000	0.46212	0.951000	0.60555	1.853000	0.39358	1.467000	0.48044	0.591000	0.81541	GGA		0.413	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000384257.6	XM_003403524		Missense_Mutation
NOD1	10392	hgsc.bcm.edu	37	7	30487962	30487962	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0928-01	TCGA-10-0928-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr7:30487962T>G	ENST00000222823.4	-	7	2762	c.2237A>C	c.(2236-2238)aAg>aCg	p.K746T		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	746					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)	p.K746T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GCTTAGCACCTTTACCCCACC	0.423																																																1	Substitution - Missense(1)	ovary(1)	7											168.0	156.0	160.0					7																	30487962		2203	4300	6503	30454487	SO:0001583	missense	10392			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2237A>C	7.37:g.30487962T>G	ENSP00000222823:p.Lys746Thr	Somatic		Capture	SOLID	Phase_IV	30454487	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	CCDS5427.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.60	1.394943	0.25205	.	.	ENSG00000106100	ENST00000222823	T	0.53857	0.6	5.61	4.45	0.53987	.	0.136010	0.64402	D	0.000003	T	0.39410	0.1077	L	0.31207	0.915	0.80722	D	1	P	0.35793	0.521	B	0.38378	0.272	T	0.21075	-1.0256	10	0.29301	T	0.29	.	8.9036	0.35510	0.0:0.146:0.0:0.854	.	746	Q9Y239	NOD1_HUMAN	T	746	ENSP00000222823:K746T	ENSP00000222823:K746T	K	-	2	0	NOD1	30454487	1.000000	0.71417	0.999000	0.59377	0.023000	0.10783	4.405000	0.59741	2.142000	0.66516	0.533000	0.62120	AAG		0.423	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2			Missense_Mutation
NPAS3	64067	hgsc.bcm.edu	37	14	33684437	33684437	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr14:33684437C>T	ENST00000356141.4	+	3	190	c.190C>T	c.(190-192)Cgg>Tgg	p.R64W	NPAS3_ENST00000341321.4_Missense_Mutation_p.R64W|NPAS3_ENST00000551008.1_5'UTR|NPAS3_ENST00000547068.1_5'UTR|NPAS3_ENST00000551492.1_Missense_Mutation_p.R71W|NPAS3_ENST00000346562.2_Missense_Mutation_p.R34W|NPAS3_ENST00000548645.1_Missense_Mutation_p.R34W|NPAS3_ENST00000357798.5_Missense_Mutation_p.R34W			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	64	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)	p.R34W(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TCGCTCCCGCCGGGGAAAAGA	0.458																																																1	Substitution - Missense(1)	ovary(1)	14											64.0	70.0	68.0					14																	33684437		2203	4300	6503	32754188	SO:0001583	missense	64067			AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.190C>T	14.37:g.33684437C>T	ENSP00000348460:p.Arg64Trp	Somatic		Capture	SOLID	Phase_IV	32754188	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544839	0.86022	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;D;T;T;T	0.99232	0.74;0.15;0.31;-5.6;0.64;0.55;0.78	5.96	5.05	0.67936	Helix-loop-helix DNA-binding (4);	0.000000	0.64402	D	0.000011	D	0.99354	0.9773	M	0.77406	2.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98877	1.0768	10	0.87932	D	0	.	16.4171	0.83745	0.1325:0.8675:0.0:0.0	.	34;64;34;34	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	W	41;71;34;64;34;64;34	ENSP00000448373:R41W;ENSP00000450392:R71W;ENSP00000319610:R34W;ENSP00000344158:R64W;ENSP00000448916:R34W;ENSP00000348460:R64W;ENSP00000350446:R34W	ENSP00000344158:R64W	R	+	1	2	NPAS3	32754188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.007000	0.57093	1.476000	0.48215	0.655000	0.94253	CGG		0.458	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1			Missense_Mutation
PABPC3	5042	hgsc.bcm.edu	37	13	25671668	25671668	+	Missense_Mutation	SNP	G	G	C	rs559352299		TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr13:25671668G>C	ENST00000281589.3	+	1	1369	c.1332G>C	c.(1330-1332)aaG>aaC	p.K444N		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	444					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.K444N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TCCAAAATAAGCCCAGTGCTA	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											138.0	136.0	137.0					13																	25671668		2203	4300	6503	24569668	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1332G>C	13.37:g.25671668G>C	ENSP00000281589:p.Lys444Asn	Somatic		Capture	SOLID	Phase_IV	24569668	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.980	-0.006629	0.07773	.	.	ENSG00000151846	ENST00000281589	T	0.26810	1.71	0.555	0.555	0.17247	.	0.098626	0.41194	U	0.000937	T	0.10337	0.0253	N	0.08118	0	0.29225	N	0.873694	B	0.02656	0.0	B	0.01281	0.0	T	0.18178	-1.0345	10	0.27082	T	0.32	.	6.8676	0.24102	1.0E-4:0.0:0.9999:0.0	.	444	Q9H361	PABP3_HUMAN	N	444	ENSP00000281589:K444N	ENSP00000281589:K444N	K	+	3	2	PABPC3	24569668	1.000000	0.71417	0.902000	0.35471	0.096000	0.18686	5.941000	0.70195	0.564000	0.29238	0.313000	0.20887	AAG		0.507	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		Missense_Mutation
PDCD11	22984	hgsc.bcm.edu	37	10	105200054	105200054	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr10:105200054C>T	ENST00000369797.3	+	29	4250	c.4156C>T	c.(4156-4158)Cac>Tac	p.H1386Y		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1386	S1 motif 12. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)	p.H1386Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TAGCCTTAACCACCAGAAGAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	10											88.0	98.0	94.0					10																	105200054		2201	4296	6497	105190044	SO:0001583	missense	22984			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.4156C>T	10.37:g.105200054C>T	ENSP00000358812:p.His1386Tyr	Somatic		Capture	SOLID	Phase_IV	105190044	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995105	0.35226	.	.	ENSG00000148843	ENST00000369797	T	0.16897	2.31	6.04	1.85	0.25348	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	1.262220	0.04676	N	0.411545	T	0.10809	0.0264	N	0.25647	0.755	0.09310	N	1	P	0.36171	0.541	B	0.24701	0.055	T	0.27157	-1.0082	10	0.66056	D	0.02	0.0098	4.2899	0.10872	0.2314:0.5114:0.0:0.2571	.	1386	Q14690	RRP5_HUMAN	Y	1386	ENSP00000358812:H1386Y	ENSP00000358812:H1386Y	H	+	1	0	PDCD11	105190044	0.025000	0.19082	0.414000	0.26521	0.925000	0.55904	0.382000	0.20635	0.407000	0.25591	0.561000	0.74099	CAC		0.532	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1			Missense_Mutation
PITPNM3	83394	hgsc.bcm.edu	37	17	6381332	6381332	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr17:6381332G>A	ENST00000262483.8	-	8	950	c.863C>T	c.(862-864)gCc>gTc	p.A288V	PITPNM3_ENST00000421306.3_Missense_Mutation_p.A252V	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	288	Ser-rich.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.A288V(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCTGCTGCTGGCAGGGCTGTC	0.682																																																1	Substitution - Missense(1)	ovary(1)	17											59.0	67.0	64.0					17																	6381332		2203	4300	6503	6322056	SO:0001583	missense	83394			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.863C>T	17.37:g.6381332G>A	ENSP00000262483:p.Ala288Val	Somatic		Capture	SOLID	Phase_IV	6322056	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	ENST00000262483.8	37	CCDS11076.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156166	0.38021	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.18960	2.18;2.18	4.72	3.75	0.43078	.	0.207650	0.48767	D	0.000172	T	0.08758	0.0217	N	0.08118	0	0.22050	N	0.999392	B;B	0.15141	0.011;0.012	B;B	0.15484	0.013;0.004	T	0.33137	-0.9880	10	0.15066	T	0.55	.	6.3807	0.21533	0.0:0.7006:0.1999:0.0995	.	252;288	F8WEW5;Q9BZ71	.;PITM3_HUMAN	V	288;252	ENSP00000262483:A288V;ENSP00000407882:A252V	ENSP00000262483:A288V	A	-	2	0	PITPNM3	6322056	0.010000	0.17322	1.000000	0.80357	0.987000	0.75469	0.698000	0.25571	1.222000	0.43521	-0.344000	0.07964	GCC		0.682	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220		Missense_Mutation
PPAP2A	8611	hgsc.bcm.edu	37	5	54721866	54721866	+	Splice_Site	SNP	A	A	C			TCGA-10-0928-01	TCGA-10-0928-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr5:54721866A>C	ENST00000307259.8	-	5	971	c.551T>G	c.(550-552)cTt>cGt	p.L184R	PPAP2A_ENST00000264775.5_Splice_Site_p.L185R	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	184					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)	p.L185R(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				TTGAAGATAAAGCTAAAAGAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	5											51.0	51.0	51.0					5																	54721866		2203	4300	6503	54757623	SO:0001630	splice_region_variant	8611			AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.550-1T>G	5.37:g.54721866A>C		Somatic		Capture	SOLID	Phase_IV	54757623	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	ENST00000307259.8	37	CCDS34159.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	24.1	4.496034	0.85069	.	.	ENSG00000067113	ENST00000264775;ENST00000307259	T;T	0.78126	-1.15;-1.15	5.65	5.65	0.86999	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.332353	0.32386	N	0.006175	D	0.92909	0.7744	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.95405	0.8493	10	0.66056	D	0.02	-6.0735	16.1611	0.81712	1.0:0.0:0.0:0.0	.	184;185	O14494;G3XA95	LPP1_HUMAN;.	R	185;184	ENSP00000264775:L185R;ENSP00000302229:L184R	ENSP00000264775:L185R	L	-	2	0	PPAP2A	54757623	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	8.910000	0.92685	2.272000	0.75746	0.460000	0.39030	CTT		0.358	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368073.1		Missense_Mutation	Missense_Mutation
PRB1	5542	hgsc.bcm.edu	37	12	11506403	11506403	+	Intron	SNP	A	A	G	rs113897264	byFrequency	TCGA-10-0928-01	TCGA-10-0928-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr12:11506403A>G	ENST00000500254.2	-	4	351				PRB1_ENST00000545626.1_Intron|PRB1_ENST00000546254.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGAGATTGGGAACTTCGGGAC	0.622													a|||	1180	0.235623	0.1762	0.1801	5008	,	,		10779	0.3363		0.174	False		,,,				2504	0.3149															0			12											11.0	7.0	8.0					12																	11506403		970	1876	2846	11397670	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.314-79T>C	12.37:g.11506403A>G		Somatic		Capture	SOLID	Phase_IV	11397670	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	ENST00000500254.2	37	CCDS8642.1	SNP	9	Baylor																																																																																				0.622	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039		Missense_Mutation
RAPGEF6	51735	hgsc.bcm.edu	37	5	130766743	130766743	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0928-01	TCGA-10-0928-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr5:130766743T>G	ENST00000509018.1	-	26	4479	c.4274A>C	c.(4273-4275)aAa>aCa	p.K1425T	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.K1433T|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.K1438T|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.K1433T|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.K1475T	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1425	Ser-rich.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.K1425T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TAGGCTTCCTTTACACTGCCC	0.468																																					Melanoma(168;435 1955 13113 13877 23213)											1	Substitution - Missense(1)	ovary(1)	5											121.0	123.0	122.0					5																	130766743		2203	4300	6503	130794642	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.4274A>C	5.37:g.130766743T>G	ENSP00000421684:p.Lys1425Thr	Somatic		Capture	SOLID	Phase_IV	130794642	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.461	1.093049	0.20471	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000514667	T;T;T;T;T	0.26067	1.86;1.76;1.76;1.86;1.95	5.11	1.42	0.22433	.	0.286010	0.40144	N	0.001169	T	0.22551	0.0544	L	0.51422	1.61	0.80722	D	1	B;B;B;B;B	0.28552	0.075;0.215;0.032;0.008;0.215	B;B;B;B;B	0.32465	0.055;0.146;0.044;0.046;0.146	T	0.04294	-1.0962	10	0.36615	T	0.2	.	8.7859	0.34821	0.0:0.2192:0.0:0.7808	.	1433;1433;1475;1438;1425	A3KN82;B7ZML2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;RPGF6_HUMAN	T	1425;1438;1433;1433;1438;1475	ENSP00000421684:K1425T;ENSP00000309298:K1438T;ENSP00000426081:K1433T;ENSP00000296859:K1433T;ENSP00000426948:K1475T	ENSP00000426948:K1475T	K	-	2	0	RAPGEF6;FNIP1	130794642	1.000000	0.71417	0.968000	0.41197	0.148000	0.21650	2.470000	0.45119	0.371000	0.24564	-0.290000	0.09829	AAA		0.468	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340		Missense_Mutation
RARS2	57038	hgsc.bcm.edu	37	6	88234357	88234357	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0928-01	TCGA-10-0928-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr6:88234357C>T	ENST00000369536.5	-	11	937	c.892G>A	c.(892-894)Gta>Ata	p.V298I		NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	298					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.V298I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		AGATCTACTACAGCCGTTCCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											99.0	96.0	97.0					6																	88234357		2203	4300	6503	88291076	SO:0001583	missense	57038			AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.892G>A	6.37:g.88234357C>T	ENSP00000358549:p.Val298Ile	Somatic		Capture	SOLID	Phase_IV	88291076	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	CCDS5011.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.216	0.407993	0.11754	.	.	ENSG00000146282	ENST00000369536	T	0.64991	-0.13	5.6	1.69	0.24217	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.184455	0.47455	N	0.000223	T	0.23532	0.0569	L	0.33293	1	0.46954	D	0.999265	B	0.06786	0.001	B	0.16289	0.015	T	0.17258	-1.0375	10	0.07644	T	0.81	.	9.7589	0.40519	0.0:0.6482:0.0:0.3518	.	298	Q5T160	SYRM_HUMAN	I	298	ENSP00000358549:V298I	ENSP00000358549:V298I	V	-	1	0	RARS2	88291076	0.962000	0.33011	0.999000	0.59377	0.108000	0.19459	0.540000	0.23191	0.281000	0.22233	0.563000	0.77884	GTA		0.393	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320		Missense_Mutation
RELN	5649	hgsc.bcm.edu	37	7	103113287	103113287	+	Missense_Mutation	SNP	C	C	T	rs149434986	byFrequency	TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr7:103113287C>T	ENST00000428762.1	-	65	10514	c.10355G>A	c.(10354-10356)aGa>aAa	p.R3452K	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.R3452K|RELN_ENST00000343529.5_Missense_Mutation_p.R3450K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3452	Arg-rich (basic).				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R3450K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGACCTTCGTCTTCTGTTGTA	0.373																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7						C	LYS/ARG,LYS/ARG	0,4406		0,0,2203	174.0	163.0	166.0		10355,10349	5.8	1.0	7	dbSNP_134	166	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	RELN	NM_005045.3,NM_173054.2	26,26	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	3452/3461,3450/3459	103113287	3,13003	2203	4300	6503	102900523	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10355G>A	7.37:g.103113287C>T	ENSP00000392423:p.Arg3452Lys	Somatic		Capture	SOLID	Phase_IV	102900523	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386301	0.82902	0.0	3.49E-4	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828	T;T;T	0.77750	-1.12;-1.12;-1.12	5.75	5.75	0.90469	.	0.118364	0.56097	D	0.000024	T	0.73560	0.3602	N	0.02011	-0.69	0.49483	D	0.999793	B;P	0.52842	0.063;0.956	B;D	0.65010	0.031;0.931	T	0.81653	-0.0835	10	0.48119	T	0.1	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	3450;3452	P78509-2;P78509	.;RELN_HUMAN	K	3452;3450;3452;969	ENSP00000392423:R3452K;ENSP00000345694:R3450K;ENSP00000388446:R3452K	ENSP00000345694:R3450K	R	-	2	0	RELN	102900523	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.077000	0.57598	2.719000	0.93026	0.655000	0.94253	AGA		0.373	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
SCN5A	6331	hgsc.bcm.edu	37	3	38651337	38651337	+	Silent	SNP	G	G	T			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr3:38651337G>T	ENST00000333535.4	-	7	971	c.822C>A	c.(820-822)ggC>ggA	p.G274G	SCN5A_ENST00000443581.1_Silent_p.G274G|SCN5A_ENST00000425664.1_Silent_p.G274G|SCN5A_ENST00000450102.2_Silent_p.G274G|SCN5A_ENST00000449557.2_Silent_p.G274G|SCN5A_ENST00000451551.2_Silent_p.G274G|SCN5A_ENST00000413689.1_Silent_p.G274G|SCN5A_ENST00000423572.2_Silent_p.G274G|SCN5A_ENST00000414099.2_Silent_p.G274G|SCN5A_ENST00000455624.2_Silent_p.G274G			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	274					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.G274G(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCTTAGGTTGCCCATGAAGA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	3											79.0	85.0	83.0					3																	38651337		2187	4289	6476	38626341	SO:0001819	synonymous_variant	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.822C>A	3.37:g.38651337G>T		Somatic		Capture	SOLID	Phase_IV	38626341	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	ENST00000333535.4	37	CCDS46796.1	SNP	46	Baylor																																																																																				0.597	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		Silent
SCN5A	6331	hgsc.bcm.edu	37	3	38651343	38651343	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr3:38651343G>T	ENST00000333535.4	-	7	965	c.816C>A	c.(814-816)ttC>ttA	p.F272L	SCN5A_ENST00000443581.1_Missense_Mutation_p.F272L|SCN5A_ENST00000425664.1_Missense_Mutation_p.F272L|SCN5A_ENST00000450102.2_Missense_Mutation_p.F272L|SCN5A_ENST00000449557.2_Missense_Mutation_p.F272L|SCN5A_ENST00000451551.2_Missense_Mutation_p.F272L|SCN5A_ENST00000413689.1_Missense_Mutation_p.F272L|SCN5A_ENST00000423572.2_Missense_Mutation_p.F272L|SCN5A_ENST00000414099.2_Missense_Mutation_p.F272L|SCN5A_ENST00000455624.2_Missense_Mutation_p.F272L			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	272					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.F272L(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GGTTGCCCATGAAGAGCTGCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											80.0	86.0	84.0					3																	38651343		2181	4288	6469	38626347	SO:0001583	missense	6331			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.816C>A	3.37:g.38651343G>T	ENSP00000328968:p.Phe272Leu	Somatic		Capture	SOLID	Phase_IV	38626347	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250643	0.80135	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557;ENST00000399254	D;D;D;D;D;D;D;D;D;D	0.99089	-5.41;-5.41;-5.41;-5.41;-5.41;-5.41;-5.41;-5.41;-5.41;-5.41	5.34	3.56	0.40772	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99435	0.9800	H	0.96015	3.755	0.44985	D	0.998009	D;D;D;D;D;D;D	0.76494	0.999;0.99;0.992;0.999;0.999;0.999;0.998	D;D;D;D;D;D;D	0.80764	0.992;0.979;0.987;0.992;0.992;0.994;0.987	D	0.98826	1.0749	10	0.87932	D	0	.	11.0722	0.48010	0.2068:0.0:0.7932:0.0	.	272;272;272;272;272;272;272	E9PEF3;Q14524-3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	L	272;272;272;272;272;272;272;272;272;272;82	ENSP00000398962:F272L;ENSP00000398266:F272L;ENSP00000410257:F272L;ENSP00000388797:F272L;ENSP00000397915:F272L;ENSP00000416634:F272L;ENSP00000328968:F272L;ENSP00000399524:F272L;ENSP00000403355:F272L;ENSP00000413996:F272L	ENSP00000328968:F272L	F	-	3	2	SCN5A	38626347	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.747000	0.38298	0.836000	0.34901	-0.140000	0.14226	TTC		0.607	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056		Missense_Mutation
ZFYVE28	57732	hgsc.bcm.edu	37	4	2275014	2275014	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0928-01	TCGA-10-0928-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr4:2275014C>A	ENST00000290974.2	-	10	2548	c.2209G>T	c.(2209-2211)Gtg>Ttg	p.V737L	ZFYVE28_ENST00000515312.1_Missense_Mutation_p.V667L|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.V707L|ZFYVE28_ENST00000508471.1_Missense_Mutation_p.V42L	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	737					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.V737L(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						TGGTCAGCCACACCTGAGGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	4											119.0	122.0	121.0					4																	2275014		2203	4300	6503	2244812	SO:0001583	missense	57732			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.2209G>T	4.37:g.2275014C>A	ENSP00000290974:p.Val737Leu	Somatic		Capture	SOLID	Phase_IV	2244812	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	37	CCDS33942.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237473	0.58886	.	.	ENSG00000159733	ENST00000508471;ENST00000290974;ENST00000511071;ENST00000515312	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.17	4.17	0.49024	.	0.138437	0.48286	N	0.000192	T	0.63034	0.2477	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.83275	0.996;0.978	T	0.65763	-0.6089	10	0.46703	T	0.11	.	13.9863	0.64337	0.0:1.0:0.0:0.0	.	707;737	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	L	42;737;707;667	ENSP00000427654:V42L;ENSP00000290974:V737L;ENSP00000425706:V707L;ENSP00000426299:V667L	ENSP00000290974:V737L	V	-	1	0	ZFYVE28	2244812	1.000000	0.71417	0.996000	0.52242	0.774000	0.43823	5.377000	0.66184	1.884000	0.54569	0.555000	0.69702	GTG		0.557	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371		Missense_Mutation
ZMAT5	55954	hgsc.bcm.edu	37	22	30134344	30134344	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0928-01	TCGA-10-0928-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0928-01	TCGA-10-0928-11	g.chr22:30134344G>A	ENST00000344318.3	-	5	474	c.358C>T	c.(358-360)Cgg>Tgg	p.R120W	ZMAT5_ENST00000397781.3_Missense_Mutation_p.R120W	NM_001003692.1	NP_001003692.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	120					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	zinc ion binding (GO:0008270)	p.R120W(2)		large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)			GAGCTCAGCCGCTTGGCTCTC	0.667																																																2	Substitution - Missense(2)	ovary(2)	22											72.0	63.0	66.0					22																	30134344		2203	4300	6503	28464344	SO:0001583	missense	55954				CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319		"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""					9847074	Standard	NM_019103		Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.358C>T	22.37:g.30134344G>A	ENSP00000344241:p.Arg120Trp	Somatic		Capture	SOLID	Phase_IV	28464344	A8K9F6	Missense_Mutation	SNP	ENST00000344318.3	37	CCDS13868.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816252	0.70912	.	.	ENSG00000100319	ENST00000344318;ENST00000397781	.	.	.	5.16	1.8	0.24995	.	0.294509	0.37178	N	0.002220	T	0.52041	0.1710	L	0.56769	1.78	0.40804	D	0.983368	D	0.76494	0.999	P	0.50490	0.642	T	0.53005	-0.8499	9	0.87932	D	0	-30.5992	6.6706	0.23066	0.0856:0.0:0.416:0.4984	.	120	Q9UDW3	ZMAT5_HUMAN	W	120	.	ENSP00000344241:R120W	R	-	1	2	ZMAT5	28464344	0.996000	0.38824	0.999000	0.59377	0.956000	0.61745	0.933000	0.28897	0.281000	0.22233	0.505000	0.49811	CGG		0.667	ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322114.1	NM_019103		Missense_Mutation
