#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
OR4F5	79501	genome.wustl.edu	37	1	69762	69762	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:69762T>G	ENST00000335137.3	+	1	672	c.672T>G	c.(670-672)gaT>gaG	p.D224E		NM_001005484.1	NP_001005484.1	Q8NH21	OR4F5_HUMAN	olfactory receptor, family 4, subfamily F, member 5	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|ovary(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;3.48e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.21e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCCCTTTAGATAAGTCGTCCA	0.423																																																0			1											9.0	6.0	8.0					1																	69762		1451	2368	3819	59625	SO:0001583	missense	79501			AB065592	CCDS30547.1	1p36.33	2012-08-09			ENSG00000186092	ENSG00000186092		"""GPCR / Class A : Olfactory receptors"""	14825	protein-coding gene	gene with protein product							Standard	NM_001005484		Approved		uc001aal.1	Q8NH21	OTTHUMG00000001094	ENST00000335137.3:c.672T>G	1.37:g.69762T>G	ENSP00000334393:p.Asp224Glu	Somatic		Capture	Illumina GAIIx	4	59625	Q5VT22	Missense_Mutation	SNP	ENST00000335137.3	37	CCDS30547.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	.	0.234	-1.019030	0.02078	.	.	ENSG00000186092	ENST00000534990;ENST00000335137	T	0.00029	8.91	2.31	-4.63	0.03359	GPCR, rhodopsin-like superfamily (1);	0.927544	0.08817	N	0.889311	T	0.00039	0.0001	N	0.00155	-1.965	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.36114	-0.9761	10	0.02654	T	1	.	0.9694	0.01413	0.1595:0.2771:0.3171:0.2464	.	224	Q8NH21	OR4F5_HUMAN	E	272;224	ENSP00000334393:D224E	ENSP00000334393:D224E	D	+	3	2	OR4F5	59625	0.000000	0.05858	0.049000	0.19019	0.012000	0.07955	-3.441000	0.00470	-1.434000	0.01975	-0.554000	0.04202	GAT		0.423	OR4F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003223.1	NM_001005484		Missense_Mutation
SLC6A3	6531	genome.wustl.edu	37	5	1409901	1409901	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr5:1409901G>C	ENST00000270349.9	-	10	1460	c.1333C>G	c.(1333-1335)Cgt>Ggt	p.R445G	SLC6A3_ENST00000453492.2_Missense_Mutation_p.R445G	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	445					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.R445G(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AAGAGCTCACGGTGTCTGTGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	5											204.0	147.0	166.0					5																	1409901		2203	4300	6503	1462901	SO:0001583	missense	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1333C>G	5.37:g.1409901G>C	ENSP00000270349:p.Arg445Gly	Somatic		Capture	Illumina GAIIx	4	1462901	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	14.05	2.421238	0.42918	.	.	ENSG00000142319	ENST00000270349;ENST00000453492	D;D	0.81996	-1.56;-1.56	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.93314	0.7869	H	0.95611	3.695	0.53688	D	0.999973	D	0.89917	1.0	D	0.85130	0.997	D	0.95126	0.8251	10	0.87932	D	0	.	14.0096	0.64488	0.0:0.0:1.0:0.0	.	445	Q01959	SC6A3_HUMAN	G	445	ENSP00000270349:R445G;ENSP00000399806:R445G	ENSP00000270349:R445G	R	-	1	0	SLC6A3	1462901	1.000000	0.71417	0.995000	0.50966	0.947000	0.59692	3.369000	0.52365	1.880000	0.54463	0.478000	0.44815	CGT		0.607	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044		Missense_Mutation
MSRB1	51734	genome.wustl.edu	37	16	1990804	1990804	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:1990804G>T	ENST00000361871.3	-	3	463	c.294C>A	c.(292-294)agC>agA	p.S98R	MSRB1_ENST00000564908.1_Missense_Mutation_p.Q145K|MSRB1_ENST00000399753.2_Missense_Mutation_p.Q220K|MSRB1_ENST00000489198.1_5'Flank	NM_016332.2	NP_057416.1	Q9NZV6	MSRB1_HUMAN	methionine sulfoxide reductase B1	98					actin filament polymerization (GO:0030041)|innate immune response (GO:0045087)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|methionine-R-sulfoxide reductase activity (GO:0070191)|peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)	p.S98R(1)								L-Methionine(DB00134)	TCAGCGAGCTGCTGAATATTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	16											47.0	48.0	48.0					16																	1990804		1893	4116	6009	1930805	SO:0001583	missense	51734			AF166124	CCDS42100.1	16p13.3	2012-05-22	2012-03-01	2012-03-01	ENSG00000198736	ENSG00000198736			14133	protein-coding gene	gene with protein product		606216	"""selenoprotein X, 1"""	SEPX1		10608886, 20634897	Standard	NM_016332		Approved	SelR, SepR, SelX	uc021tam.1	Q9NZV6	OTTHUMG00000129143	ENST00000361871.3:c.294C>A	16.37:g.1990804G>T	ENSP00000355084:p.Ser98Arg	Somatic		Capture	Illumina GAIIx	4	1930805	Q96RX6|Q9BTV2|Q9P0B1	Missense_Mutation	SNP	ENST00000361871.3	37	CCDS42100.1	SNP	46	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.44|14.44	2.537023|2.537023	0.45176|0.45176	.|.	.|.	ENSG00000198736|ENSG00000198736	ENST00000399753|ENST00000361871	T|D	0.79247|0.82893	-1.25|-1.66	4.61|4.61	2.22|2.22	0.28083|0.28083	.|.	.|.	.|.	.|.	.|.	D|D	0.90463|0.90463	0.7013|0.7013	M|M	0.92738|0.92738	3.34|3.34	0.26766|0.26766	N|N	0.96989|0.96989	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.83220|0.83220	-0.0069|-0.0069	7|7	0.87932|0.87932	D|D	0|0	.|.	10.7257|10.7257	0.46066|0.46066	0.1954:0.0:0.8046:0.0|0.1954:0.0:0.8046:0.0	.|.	.|.	.|.	.|.	K|R	220|98	ENSP00000382657:Q220K|ENSP00000355084:S98R	ENSP00000382657:Q220K|ENSP00000355084:S98R	Q|S	-|-	1|3	0|2	SEPX1|SEPX1	1930805|1930805	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.784000|0.784000	0.44337|0.44337	3.602000|3.602000	0.54066|0.54066	0.927000|0.927000	0.37143|0.37143	-0.145000|-0.145000	0.13849|0.13849	CAG|AGC		0.592	MSRB1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000251203.1	NM_016332		Missense_Mutation
MYOM1	8736	genome.wustl.edu	37	18	3079264	3079264	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:3079264G>C	ENST00000356443.4	-	34	4894	c.4561C>G	c.(4561-4563)Ccc>Gcc	p.P1521A	MYOM1_ENST00000261606.7_Missense_Mutation_p.P1425A|MYOM1_ENST00000400569.3_Missense_Mutation_p.P1521A	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1521					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.P1521A(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTCGGGGTGGGCTCGTTGATT	0.473																																																1	Substitution - Missense(1)	ovary(1)	18											100.0	96.0	97.0					18																	3079264		1909	4113	6022	3069264	SO:0001583	missense	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4561C>G	18.37:g.3079264G>C	ENSP00000348821:p.Pro1521Ala	Somatic		Capture	Illumina GAIIx	4	3069264	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919222	0.92249	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.32023	1.47;1.47;1.47	5.94	5.94	0.96194	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	M	0.79011	2.435	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.49409	-0.8943	10	0.09590	T	0.72	.	20.3594	0.98849	0.0:0.0:1.0:0.0	.	1425;1521	P52179-2;P52179	.;MYOM1_HUMAN	A	1521;1521;1425	ENSP00000348821:P1521A;ENSP00000383413:P1521A;ENSP00000261606:P1425A	ENSP00000261606:P1425A	P	-	1	0	MYOM1	3069264	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.441000	0.97557	2.816000	0.96949	0.563000	0.77884	CCC		0.473	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		Missense_Mutation
CELF5	60680	genome.wustl.edu	37	19	3282187	3282187	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:3282187T>C	ENST00000292672.2	+	7	851	c.814T>C	c.(814-816)Ttc>Ctc	p.F272L	CELF5_ENST00000541430.2_Missense_Mutation_p.F272L	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	272					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.F272L(1)		kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						CGGCGTGGCCTTCTCACCCTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	19											123.0	103.0	110.0					19																	3282187		2203	4300	6503	3233187	SO:0001583	missense	60680			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.814T>C	19.37:g.3282187T>C	ENSP00000292672:p.Phe272Leu	Somatic		Capture	Illumina GAIIx	4	3233187	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	CCDS12106.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.55	3.418393	0.62622	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.25250	2.54;1.87;1.81	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.16938	0.0407	N	0.20807	0.61	0.51012	D	0.999903	B;B;B	0.23442	0.041;0.085;0.004	B;B;B	0.31547	0.008;0.132;0.005	T	0.04053	-1.0981	10	0.07990	T	0.79	-24.1861	13.124	0.59342	0.0:0.0:0.0:1.0	.	158;272;272	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	L	272;272;158	ENSP00000292672:F272L;ENSP00000443498:F272L;ENSP00000335182:F158L	ENSP00000292672:F272L	F	+	1	0	CELF5	3233187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.372000	0.52387	1.845000	0.53610	0.454000	0.30748	TTC		0.617	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938		Missense_Mutation
DFFB	1677	genome.wustl.edu	37	1	3782259	3782259	+	Intron	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:3782259T>C	ENST00000378209.3	+	3	564				DFFB_ENST00000338895.3_Intron|DFFB_ENST00000378212.2_Silent_p.P98P	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)						apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GTCTGAGTCCTGGTGATTGCC	0.602																																																0			1											32.0	28.0	29.0					1																	3782259		876	1991	2867	3772119	SO:0001627	intron_variant	1677				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.242-117T>C	1.37:g.3782259T>C		Somatic		Capture	Illumina GAIIx	4	3772119	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000378209.3	37	CCDS52.1	SNP	55	WashU																																																																																				0.602	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669		Silent
LRG1	116844	genome.wustl.edu	37	19	4538173	4538173	+	Missense_Mutation	SNP	C	C	T	rs373305310		TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:4538173C>T	ENST00000306390.6	-	2	1283	c.823G>A	c.(823-825)Gtg>Atg	p.V275M	LRG1_ENST00000586883.1_5'Flank|PLIN5_ENST00000381848.3_5'Flank|PLIN5_ENST00000586133.1_5'Flank|CTB-50L17.14_ENST00000586020.1_Intron	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	275					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.V275M(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTCGGGCACGCTGGCCAGT	0.637																																																1	Substitution - Missense(1)	ovary(1)	19						C	MET/VAL	0,4406		0,0,2203	75.0	74.0	74.0		823	1.9	0.0	19		74	2,8598		0,2,4298	no	missense	LRG1	NM_052972.2	21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	275/348	4538173	2,13004	2203	4300	6503	4489173	SO:0001583	missense	116844				CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.823G>A	19.37:g.4538173C>T	ENSP00000302621:p.Val275Met	Somatic		Capture	Illumina GAIIx	4	4489173	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	37	CCDS12130.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	.	19.68	3.872973	0.72180	0.0	2.33E-4	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.02631	4.22	5.24	1.87	0.25490	.	0.651566	0.12751	N	0.442161	T	0.08223	0.0205	M	0.79693	2.465	0.09310	N	1	D	0.65815	0.995	P	0.53450	0.726	T	0.24012	-1.0172	10	0.62326	D	0.03	-19.9041	3.2528	0.06820	0.1805:0.5492:0.1744:0.0959	.	275	P02750	A2GL_HUMAN	M	275;258	ENSP00000302621:V275M	ENSP00000302621:V275M	V	-	1	0	LRG1	4489173	0.001000	0.12720	0.001000	0.08648	0.782000	0.44232	0.184000	0.16939	0.322000	0.23283	0.655000	0.94253	GTG		0.637	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972		Missense_Mutation
SEC14L5	9717	genome.wustl.edu	37	16	5055934	5055934	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:5055934A>G	ENST00000251170.7	+	12	1502	c.1322A>G	c.(1321-1323)gAg>gGg	p.E441G		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	441	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)	p.E441G(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						TTCATCAATGAGAACACCAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	16											44.0	45.0	45.0					16																	5055934		1910	4117	6027	4995935	SO:0001583	missense	9717			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1322A>G	16.37:g.5055934A>G	ENSP00000251170:p.Glu441Gly	Somatic		Capture	Illumina GAIIx	4	4995935		Missense_Mutation	SNP	ENST00000251170.7	37	CCDS45403.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	19.65	3.867435	0.72065	.	.	ENSG00000103184	ENST00000251170	T	0.62105	0.05	4.06	4.06	0.47325	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.64402	D	0.000001	T	0.78792	0.4339	M	0.89353	3.025	0.80722	D	1	D	0.54397	0.966	P	0.59643	0.861	D	0.83543	0.0097	10	0.72032	D	0.01	-15.9373	13.1919	0.59715	1.0:0.0:0.0:0.0	.	441	O43304	S14L5_HUMAN	G	441	ENSP00000251170:E441G	ENSP00000251170:E441G	E	+	2	0	SEC14L5	4995935	1.000000	0.71417	0.999000	0.59377	0.652000	0.38707	8.590000	0.90821	1.718000	0.51419	0.454000	0.30748	GAG		0.488	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434379.1			Missense_Mutation
GRM7	2917	genome.wustl.edu	37	3	6903441	6903441	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:6903441C>A	ENST00000357716.4	+	1	640	c.366C>A	c.(364-366)ttC>ttA	p.F122L	GRM7_ENST00000402647.2_Missense_Mutation_p.F122L|GRM7_ENST00000389336.4_Missense_Mutation_p.F122L|GRM7_ENST00000403881.1_Missense_Mutation_p.F122L|GRM7_ENST00000486284.1_Missense_Mutation_p.F122L	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	122					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.F122L(1)|p.F122F(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CGCTTACTTTCGTCCAGGCGC	0.592																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	3											70.0	67.0	68.0					3																	6903441		2203	4300	6503	6878441	SO:0001583	missense	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.366C>A	3.37:g.6903441C>A	ENSP00000350348:p.Phe122Leu	Somatic		Capture	Illumina GAIIx	4	6878441	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643770	0.67244	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0;-2.0	5.27	2.52	0.30459	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.87716	0.6247	L	0.54908	1.71	0.47009	D	0.999284	D;D;D	0.63046	0.99;0.992;0.985	D;D;D	0.75020	0.974;0.985;0.918	D	0.84370	0.0543	10	0.39692	T	0.17	.	7.5139	0.27590	0.0:0.663:0.0:0.337	.	122;122;122	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	L	122	ENSP00000350348:F122L;ENSP00000417536:F122L;ENSP00000373987:F122L;ENSP00000385664:F122L;ENSP00000384585:F122L	ENSP00000350348:F122L	F	+	3	2	GRM7	6878441	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.237000	0.32695	0.612000	0.30071	-0.251000	0.11542	TTC		0.592	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		Missense_Mutation
ATN1	1822	genome.wustl.edu	37	12	7048338	7048338	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:7048338C>T	ENST00000356654.4	+	7	3449	c.3212C>T	c.(3211-3213)gCa>gTa	p.A1071V	ATN1_ENST00000396684.2_Missense_Mutation_p.A1071V	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1071					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)	p.A1071V(1)		breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GCTATCCATGCAGGTGAGACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											65.0	42.0	50.0					12																	7048338		2178	4240	6418	6918599	SO:0001583	missense	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3212C>T	12.37:g.7048338C>T	ENSP00000349076:p.Ala1071Val	Somatic		Capture	Illumina GAIIx	4	6918599	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826263	0.71143	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.50813	0.73;0.73;0.73	4.71	4.71	0.59529	.	0.241555	0.21167	N	0.079043	T	0.45478	0.1344	N	0.12182	0.205	0.46416	D	0.999032	P	0.50066	0.931	P	0.53649	0.731	T	0.50303	-0.8844	10	0.46703	T	0.11	.	18.2266	0.89918	0.0:1.0:0.0:0.0	.	1071	P54259	ATN1_HUMAN	V	1071;1071;1071;656	ENSP00000349076:A1071V;ENSP00000379915:A1071V;ENSP00000441744:A1071V	ENSP00000229279:A656V	A	+	2	0	ATN1	6918599	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.956000	0.56722	2.615000	0.88500	0.555000	0.69702	GCA		0.597	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940		Missense_Mutation
CAGE1	285782	genome.wustl.edu	37	6	7373749	7373749	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:7373749C>A	ENST00000512086.1	-	5	1505	c.1303G>T	c.(1303-1305)Gta>Tta	p.V435L	CAGE1_ENST00000338150.4_Missense_Mutation_p.V435L|CAGE1_ENST00000502583.1_Missense_Mutation_p.V435L|CAGE1_ENST00000296742.7_Missense_Mutation_p.V299L|CAGE1_ENST00000379918.4_Missense_Mutation_p.V435L|CAGE1_ENST00000509324.1_5'Flank			Q8TC20	CAGE1_HUMAN	cancer antigen 1	435								p.V435L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					TACTGACTTACAGATTTATTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											122.0	109.0	113.0					6																	7373749		1837	4090	5927	7318748	SO:0001583	missense	285782			BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.1303G>T	6.37:g.7373749C>A	ENSP00000427583:p.Val435Leu	Somatic		Capture	Illumina GAIIx	4	7318748	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Missense_Mutation	SNP	ENST00000512086.1	37		SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.249	-1.007816	0.02112	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150;ENST00000542431;ENST00000512691	T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22	5.54	-2.36	0.06663	.	0.734007	0.12229	N	0.487609	T	0.04363	0.0120	N	0.15975	0.35	0.09310	N	1	B;B;B	0.10296	0.002;0.003;0.003	B;B;B	0.11329	0.006;0.004;0.006	T	0.38887	-0.9640	10	0.13470	T	0.59	-0.6299	1.9147	0.03294	0.2522:0.2209:0.3697:0.1571	.	435;435;435	Q8TC20-3;D6RCT9;Q8TC20	.;.;CAGE1_HUMAN	L	435;435;435;299;435;435;435;447	ENSP00000369250:V435L;ENSP00000425493:V435L;ENSP00000296742:V299L;ENSP00000427583:V435L;ENSP00000338107:V435L;ENSP00000423789:V447L	ENSP00000296742:V299L	V	-	1	0	CAGE1	7318748	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.353000	0.07691	0.035000	0.15519	-1.465000	0.01017	GTA		0.348	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745		Missense_Mutation
PNPLA6	10908	genome.wustl.edu	37	19	7619516	7619516	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:7619516C>T	ENST00000221249.6	+	24	2858	c.2427C>T	c.(2425-2427)gaC>gaT	p.D809D	PNPLA6_ENST00000545201.2_Silent_p.D782D|PNPLA6_ENST00000450331.3_Silent_p.D809D|PNPLA6_ENST00000414982.3_Silent_p.D857D|PNPLA6_ENST00000600737.1_Silent_p.D847D	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	848					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)	p.D809D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						ACCAGACGGACGCCTCGCTGA	0.662																																																1	Substitution - coding silent(1)	ovary(1)	19											87.0	75.0	79.0					19																	7619516		2203	4300	6503	7525516	SO:0001819	synonymous_variant	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2427C>T	19.37:g.7619516C>T		Somatic		Capture	Illumina GAIIx	4	7525516	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	ENST00000221249.6	37	CCDS32891.1	SNP	19	WashU																																																																																				0.662	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702		Silent
PFAS	5198	genome.wustl.edu	37	17	8158834	8158834	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:8158834G>A	ENST00000314666.6	+	5	532	c.399G>A	c.(397-399)ccG>ccA	p.P133P	PFAS_ENST00000545834.1_Intron	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	133					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)	p.P133P(1)		central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	CCCACCCCCCGTCAGCTGAGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	17											60.0	56.0	57.0					17																	8158834		2203	4300	6503	8099559	SO:0001819	synonymous_variant	5198			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.399G>A	17.37:g.8158834G>A		Somatic		Capture	Illumina GAIIx	4	8099559	A6H8V8	Silent	SNP	ENST00000314666.6	37	CCDS11136.1	SNP	40	WashU																																																																																				0.567	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2			Silent
MYH8	4626	genome.wustl.edu	37	17	10303802	10303802	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:10303802G>T	ENST00000403437.2	-	27	3734	c.3640C>A	c.(3640-3642)Cag>Aag	p.Q1214K	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1214					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.Q1214K(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TTGACCCGCTGCAAGTTGTCA	0.547									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							1	Substitution - Missense(1)	ovary(1)	17											120.0	106.0	111.0					17																	10303802		2203	4300	6503	10244527	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3640C>A	17.37:g.10303802G>T	ENSP00000384330:p.Gln1214Lys	Somatic		Capture	Illumina GAIIx	4	10244527	Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	CCDS11153.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684023	0.68157	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.78924	-1.22	5.35	5.35	0.76521	Myosin tail (1);	0.000000	0.39544	U	0.001333	T	0.80879	0.4708	M	0.63169	1.94	0.58432	D	0.999998	B	0.28291	0.206	B	0.37387	0.248	T	0.80115	-0.1517	10	0.87932	D	0	.	19.2529	0.93932	0.0:0.0:1.0:0.0	.	1214	P13535	MYH8_HUMAN	K	1214	ENSP00000384330:Q1214K	ENSP00000252173:Q1214K	Q	-	1	0	MYH8	10244527	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.385000	0.97223	2.785000	0.95823	0.655000	0.94253	CAG		0.547	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		Missense_Mutation
CLEC16A	23274	genome.wustl.edu	37	16	11121161	11121161	+	Intron	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:11121161A>C	ENST00000409790.1	+	13	1767				CLEC16A_ENST00000409552.3_Intron|CLEC16A_ENST00000465491.1_Intron	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A									p.0?(1)		breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GTACGCATCGAAAGGATTGAT	0.443																																																1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	16																																								11028662	SO:0001627	intron_variant	642451			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1537+2383A>C	16.37:g.11121161A>C		Somatic		Capture	Illumina GAIIx	4	11028662		Missense_Mutation	SNP	ENST00000409790.1	37	CCDS45409.1	SNP	9	WashU																																																																																				0.443	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328540.2	NM_015226		Missense_Mutation
ERVFRD-1	405754	genome.wustl.edu	37	6	11105323	11105323	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:11105323A>C	ENST00000472091.1	-	2	596	c.221T>G	c.(220-222)aTt>aGt	p.I74S	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Missense_Mutation_p.I74S	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	74					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)		p.I74S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						TCGATAGGAAATATGTAATTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											135.0	123.0	127.0					6																	11105323		2203	4300	6503	11213309	SO:0001583	missense	405754			AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.221T>G	6.37:g.11105323A>C	ENSP00000420174:p.Ile74Ser	Somatic		Capture	Illumina GAIIx	4	11213309		Missense_Mutation	SNP	ENST00000472091.1	37	CCDS4519.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	11.60	1.687702	0.29962	.	.	ENSG00000244476	ENST00000472091;ENST00000542862	T;T	0.17854	2.25;2.25	0.235	0.235	0.15431	.	.	.	.	.	T	0.08044	0.0201	L	0.27053	0.805	0.21256	N	0.999741	D	0.54964	0.969	P	0.53760	0.734	T	0.16689	-1.0394	8	0.87932	D	0	.	.	.	.	.	74	P60508	EFRD1_HUMAN	S	74	ENSP00000420174:I74S;ENSP00000444461:I74S	ENSP00000420174:I74S	I	-	2	0	ERVFRD-1	11213309	0.930000	0.31532	0.605000	0.28930	0.607000	0.37147	0.349000	0.20055	0.263000	0.21812	0.260000	0.18958	ATT		0.458	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353776.1	NM_207582		Missense_Mutation
ZNF833P	401898	genome.wustl.edu	37	19	11796542	11796542	+	lincRNA	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:11796542T>A	ENST00000344893.3	+	0	2541					NR_028594.1		Q6ZTB9	ZN833_HUMAN	zinc finger protein 833, pseudogene								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.S167R(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5						CCTTTCATAGTCATGAAGGGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	66.0	65.0					19																	11796542		2203	4298	6501	11657542			401898			BC137336		19p13.2	2010-08-03	2010-08-03	2010-08-03	ENSG00000197332	ENSG00000197332			33819	pseudogene	pseudogene			"""zinc finger protein 833"""	ZNF833			Standard	NR_028594		Approved		uc021upi.1	Q6ZTB9	OTTHUMG00000156530		19.37:g.11796542T>A		Somatic		Capture	Illumina GAIIx	4	11657542	B2RPA0	Missense_Mutation	SNP	ENST00000344893.3	37		SNP	58	WashU																																																																																				0.378	ZNF833P-001	KNOWN	basic|readthrough_transcript	lincRNA	lincRNA	OTTHUMT00000458891.1	NM_001013691		Missense_Mutation
NPPB	4879	genome.wustl.edu	37	1	11918481	11918481	+	Nonsense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:11918481C>A	ENST00000376468.3	-	2	275	c.178G>T	c.(178-180)Gag>Tag	p.E60*		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	60					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.E60*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	GATGTCTGCTCCACCTGCAGC	0.652																																																1	Substitution - Nonsense(1)	ovary(1)	1											24.0	26.0	26.0					1																	11918481		2203	4298	6501	11841068	SO:0001587	stop_gained	4879			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.178G>T	1.37:g.11918481C>A	ENSP00000365651:p.Glu60*	Somatic		Capture	Illumina GAIIx	4	11841068	B0ZBE9|Q6FGY0|Q9P2Q7	Nonsense_Mutation	SNP	ENST00000376468.3	37	CCDS140.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413027	0.62511	.	.	ENSG00000120937	ENST00000376468	.	.	.	4.31	-0.194	0.13240	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.5458	0.12079	0.0:0.4361:0.3542:0.2097	.	.	.	.	X	60	.	ENSP00000365651:E60X	E	-	1	0	NPPB	11841068	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-0.936000	0.03946	0.070000	0.16634	-0.291000	0.09656	GAG		0.652	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006854.1	NM_002521		Nonsense_Mutation
CIDEA	1149	genome.wustl.edu	37	18	12274107	12274107	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:12274107C>A	ENST00000320477.9	+	4	411	c.346C>A	c.(346-348)Ccc>Acc	p.P116T	CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a	116					apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.P150T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						CCAGCACGTCCCCACTTGCTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	18											78.0	63.0	68.0					18																	12274107		2203	4300	6503	12264107	SO:0001583	missense	1149			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.346C>A	18.37:g.12274107C>A	ENSP00000320209:p.Pro116Thr	Somatic		Capture	Illumina GAIIx	4	12264107	B0YIY7|Q6UPR7	Missense_Mutation	SNP	ENST00000320477.9	37	CCDS11856.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	4.783	0.145618	0.09134	.	.	ENSG00000176194	ENST00000320477	T	0.41400	1.0	5.03	2.05	0.26809	.	0.452094	0.22040	N	0.065479	T	0.28366	0.0701	L	0.57536	1.79	0.24533	N	0.994101	B;B	0.17852	0.017;0.024	B;B	0.10450	0.005;0.005	T	0.30621	-0.9972	10	0.02654	T	1	-17.5489	4.9343	0.13932	0.3791:0.5208:0.0:0.1001	.	150;116	Q8N5P9;O60543	.;CIDEA_HUMAN	T	116	ENSP00000320209:P116T	ENSP00000320209:P116T	P	+	1	0	CIDEA	12264107	0.001000	0.12720	0.050000	0.19076	0.003000	0.03518	0.021000	0.13489	1.225000	0.43566	0.655000	0.94253	CCC		0.587	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254599.2	NM_001279		Missense_Mutation
DAND5	199699	genome.wustl.edu	37	19	13080509	13080509	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:13080509T>G	ENST00000317060.2	+	1	214	c.35T>G	c.(34-36)cTg>cGg	p.L12R	DAND5_ENST00000585548.1_Missense_Mutation_p.L42R	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	12					atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)	p.L12R(1)		kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			CTTCTGTGCCTGCTTAGCGGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											108.0	110.0	109.0					19																	13080509		2203	4300	6503	12941509	SO:0001583	missense	199699			AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.35T>G	19.37:g.13080509T>G	ENSP00000323155:p.Leu12Arg	Somatic		Capture	Illumina GAIIx	4	12941509		Missense_Mutation	SNP	ENST00000317060.2	37	CCDS12291.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709728	0.48517	.	.	ENSG00000179284	ENST00000317060	T	0.44482	0.92	3.79	3.79	0.43588	.	0.000000	0.28914	N	0.013729	T	0.49695	0.1572	L	0.36672	1.1	0.29044	N	0.88491	D	0.89917	1.0	D	0.71656	0.974	T	0.44221	-0.9342	10	0.87932	D	0	-16.6365	8.945	0.35753	0.0:0.0:0.0:1.0	.	12	Q8N907	DAND5_HUMAN	R	12	ENSP00000323155:L12R	ENSP00000323155:L12R	L	+	2	0	DAND5	12941509	0.959000	0.32827	0.978000	0.43139	0.194000	0.23727	2.030000	0.41108	1.370000	0.46153	0.379000	0.24179	CTG		0.627	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452761.1	NM_152654		Missense_Mutation
MC5R	4161	genome.wustl.edu	37	18	13826421	13826421	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:13826421C>T	ENST00000324750.3	+	1	879	c.657C>T	c.(655-657)atC>atT	p.I219I	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	219					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)	p.I219I(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						TCAAGCGGATCGCGGCTCTGC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	18											286.0	243.0	258.0					18																	13826421		2203	4300	6503	13816421	SO:0001819	synonymous_variant	4161			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.657C>T	18.37:g.13826421C>T		Somatic		Capture	Illumina GAIIx	4	13816421	B0YJ34|Q502V1	Silent	SNP	ENST00000324750.3	37	CCDS11868.1	SNP	31	WashU																																																																																				0.627	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913		Silent
DCAF15	90379	genome.wustl.edu	37	19	14070608	14070608	+	Silent	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:14070608A>G	ENST00000254337.6	+	9	1362	c.1341A>G	c.(1339-1341)acA>acG	p.T447T		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	447					protein ubiquitination (GO:0016567)			p.T447T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						AGCAGCTCACACTAGACTTCG	0.592											OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	19											98.0	78.0	85.0					19																	14070608		2203	4300	6503	13931608	SO:0001819	synonymous_variant	90379			BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1341A>G	19.37:g.14070608A>G		Somatic	692	Capture	Illumina GAIIx	4	13931608	B3KS86|Q96DW0|Q9BU31	Silent	SNP	ENST00000254337.6	37	CCDS32926.1	SNP	6	WashU																																																																																				0.592	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353		Silent
OR10H4	126541	genome.wustl.edu	37	19	16060303	16060303	+	Silent	SNP	G	G	A	rs201781055		TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:16060303G>A	ENST00000322107.1	+	1	486	c.486G>A	c.(484-486)acG>acA	p.T162T		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T162T(1)		breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						TGGTGACAACGATAGTTTTCC	0.498													.|||	1	0.000199681	0.0	0.0	5008	,	,		23864	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19						G		1,4405	2.1+/-5.4	0,1,2202	242.0	204.0	217.0		486	-1.6	0.0	19		217	0,8600		0,0,4300	no	coding-synonymous	OR10H4	NM_001004465.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		162/317	16060303	1,13005	2203	4300	6503	15921303	SO:0001819	synonymous_variant	126541			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.486G>A	19.37:g.16060303G>A		Somatic		Capture	Illumina GAIIx	4	15921303	Q6IFJ2|Q96R57	Silent	SNP	ENST00000322107.1	37	CCDS32941.1	SNP	37	WashU																																																																																				0.498	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1			Silent
NSUN6	221078	genome.wustl.edu	37	10	18940060	18940060	+	Nonsense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:18940060C>A	ENST00000377304.4	-	1	491	c.73G>T	c.(73-75)Gag>Tag	p.E25*	RP11-139J15.7_ENST00000606425.1_Intron	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	25							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.E25*(1)		endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						TGACCTACCTCCTTATTCATA	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	10											109.0	110.0	110.0					10																	18940060		2202	4300	6502	18980066	SO:0001587	stop_gained	221078			BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.73G>T	10.37:g.18940060C>A	ENSP00000366519:p.Glu25*	Somatic		Capture	Illumina GAIIx	4	18980066	B0YJ54	Nonsense_Mutation	SNP	ENST00000377304.4	37	CCDS7130.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.648582	0.96714	.	.	ENSG00000241058	ENST00000377304	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	17.5868	0.87983	0.0:1.0:0.0:0.0	.	.	.	.	X	25	.	ENSP00000366519:E25X	E	-	1	0	NSUN6	18980066	1.000000	0.71417	0.981000	0.43875	0.183000	0.23260	5.419000	0.66435	2.577000	0.86979	0.655000	0.94253	GAG		0.343	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543		Nonsense_Mutation
NCAN	1463	genome.wustl.edu	37	19	19335156	19335156	+	Missense_Mutation	SNP	G	G	A	rs564199075		TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:19335156G>A	ENST00000252575.6	+	5	791	c.692G>A	c.(691-693)cGt>cAt	p.R231H	NCAN_ENST00000538881.1_5'Flank	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	231	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.R231H(2)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	TATGGCGACCGTAGCAGCCTT	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		15951	0.0		0.001	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	19											143.0	132.0	135.0					19																	19335156		2203	4300	6503	19196156	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.692G>A	19.37:g.19335156G>A	ENSP00000252575:p.Arg231His	Somatic		Capture	Illumina GAIIx	4	19196156	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.227873	0.95173	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.09630	2.96	4.83	4.83	0.62350	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.483161	0.15566	N	0.255685	T	0.27731	0.0682	L	0.47190	1.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00695	-1.1606	10	0.54805	T	0.06	.	15.4278	0.75069	0.0:0.0:1.0:0.0	.	231	O14594	NCAN_HUMAN	H	245;231	ENSP00000252575:R231H	ENSP00000252575:R231H	R	+	2	0	NCAN	19196156	0.998000	0.40836	0.997000	0.53966	0.983000	0.72400	2.938000	0.48987	2.240000	0.73641	0.561000	0.74099	CGT		0.597	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386		Missense_Mutation
NPC1	4864	genome.wustl.edu	37	18	21118554	21118554	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:21118554A>C	ENST00000269228.5	-	20	3547	c.2993T>G	c.(2992-2994)tTc>tGc	p.F998C	NPC1_ENST00000412552.2_Missense_Mutation_p.F680C|NPC1_ENST00000540608.1_5'Flank	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	998					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.F998C(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CATGGGCAGGAATCTCATGAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	18											132.0	135.0	134.0					18																	21118554		2203	4300	6503	19372552	SO:0001583	missense	4864			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2993T>G	18.37:g.21118554A>C	ENSP00000269228:p.Phe998Cys	Somatic		Capture	Illumina GAIIx	4	19372552	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599203	0.87055	.	.	ENSG00000141458	ENST00000269228;ENST00000412552	D;D	0.93659	-3.26;-3.17	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.96654	0.8908	M	0.85299	2.745	0.80722	D	1	P;D	0.76494	0.892;0.999	P;D	0.65987	0.627;0.94	D	0.97332	0.9951	10	0.87932	D	0	-33.0601	15.6629	0.77203	1.0:0.0:0.0:0.0	.	1009;998	Q59GR1;O15118	.;NPC1_HUMAN	C	998;680	ENSP00000269228:F998C;ENSP00000408606:F680C	ENSP00000269228:F998C	F	-	2	0	NPC1	19372552	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.328000	0.79160	2.165000	0.68154	0.533000	0.62120	TTC		0.552	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271		Missense_Mutation
EFHB	151651	genome.wustl.edu	37	3	19975027	19975027	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:19975027C>T	ENST00000295824.9	-	1	645	c.484G>A	c.(484-486)Gct>Act	p.A162T	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Intron	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	162							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						ATAACGAAAGCAGGCTTTCCC	0.498																																																0			3											98.0	103.0	101.0					3																	19975027		2203	4300	6503	19950031	SO:0001583	missense	151651			AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.484G>A	3.37:g.19975027C>T	ENSP00000295824:p.Ala162Thr	Somatic		Capture	Illumina GAIIx	4	19950031	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	CCDS33715.2	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	7.831	0.719767	0.15372	.	.	ENSG00000163576	ENST00000295824;ENST00000389256	T;T	0.23348	1.91;2.21	3.73	0.906	0.19314	.	.	.	.	.	T	0.13329	0.0323	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31641	-0.9936	8	.	.	.	0.3731	3.3814	0.07256	0.2008:0.5782:0.0:0.221	.	162	Q8N7U6	EFHB_HUMAN	T	162	ENSP00000295824:A162T;ENSP00000373908:A162T	.	A	-	1	0	EFHB	19950031	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.509000	0.06336	0.185000	0.20105	-0.314000	0.08810	GCT		0.498	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715		Missense_Mutation
DNAH3	55567	genome.wustl.edu	37	16	21093010	21093010	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:21093010T>G	ENST00000261383.3	-	20	2915	c.2916A>C	c.(2914-2916)gaA>gaC	p.E972D	DNAH3_ENST00000415178.1_Missense_Mutation_p.E972D	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	972	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E972D(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGCAGGTCGTTTCGGTGGGCT	0.438																																																1	Substitution - Missense(1)	ovary(1)	16											181.0	173.0	175.0					16																	21093010		2201	4300	6501	21000511	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2916A>C	16.37:g.21093010T>G	ENSP00000261383:p.Glu972Asp	Somatic		Capture	Illumina GAIIx	4	21000511	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	8.836	0.941153	0.18281	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.61980	0.06;0.06	5.27	2.99	0.34606	Dynein heavy chain, domain-2 (1);	0.142496	0.47093	N	0.000254	T	0.41328	0.1154	L	0.28115	0.83	0.35119	D	0.76684	B	0.13145	0.007	B	0.18561	0.022	T	0.30937	-0.9961	10	0.12103	T	0.63	.	5.8557	0.18718	0.1481:0.0832:0.0:0.7687	.	972	Q8TD57	DYH3_HUMAN	D	972	ENSP00000261383:E972D;ENSP00000394245:E972D	ENSP00000261383:E972D	E	-	3	2	DNAH3	21000511	0.991000	0.36638	0.964000	0.40570	0.727000	0.41649	0.751000	0.26348	0.323000	0.23307	0.533000	0.62120	GAA		0.438	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
CDR2	1039	genome.wustl.edu	37	16	22441186	22441186	+	5'UTR	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:22441186C>T	ENST00000569045.1	-	0	669				RRN3P3_ENST00000551766.1_RNA			Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa							cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		CACTGAGTCTCCTCCAGTGGT	0.493																																																0			16																																								22348687	SO:0001623	5_prime_UTR_variant	0			M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000569045.1:c.-157G>A	16.37:g.22441186C>T		Somatic		Capture	Illumina GAIIx	4	22348687	A8K8A8|Q13977	Missense_Mutation	SNP	ENST00000569045.1	37		SNP	30	WashU																																																																																				0.493	CDR2-006	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000430087.1			Missense_Mutation
ARID1A	8289	genome.wustl.edu	37	1	27087417	27087417	+	Nonsense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:27087417C>G	ENST00000324856.7	+	5	2362	c.1991C>G	c.(1990-1992)tCa>tGa	p.S664*	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.S281*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.S664*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	664					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.S664*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GTGAGCACATCAGGGATTTCC	0.517			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Nonsense(1)	ovary(1)	1											133.0	137.0	135.0					1																	27087417		2203	4300	6503	26960004	SO:0001587	stop_gained	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1991C>G	1.37:g.27087417C>G	ENSP00000320485:p.Ser664*	Somatic		Capture	Illumina GAIIx	4	26960004	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	39	7.421142	0.98272	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-9.1652	20.3932	0.98965	0.0:1.0:0.0:0.0	.	.	.	.	X	664;664;281	.	ENSP00000320485:S664X	S	+	2	0	ARID1A	26960004	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.824000	0.97209	0.655000	0.94253	TCA		0.517	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135		Nonsense_Mutation
STK38L	23012	genome.wustl.edu	37	12	27462047	27462047	+	Splice_Site	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:27462047G>C	ENST00000389032.3	+	5	479	c.310G>C	c.(310-312)Gtg>Ctg	p.V104L	STK38L_ENST00000539577.1_Splice_Site_p.V11L	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like									p.V104L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					TATCTTTTAGGTGCGGTTGGT	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											77.0	77.0	77.0					12																	27462047		2203	4300	6503	27353314	SO:0001630	splice_region_variant	23012			AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.310-1G>C	12.37:g.27462047G>C		Somatic		Capture	Illumina GAIIx	4	27353314		Missense_Mutation	SNP	ENST00000389032.3	37	CCDS31761.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698302	0.88830	.	.	ENSG00000211455	ENST00000541191;ENST00000389032;ENST00000545470;ENST00000539577;ENST00000543246;ENST00000544969	T;T;T;T;T;T	0.60797	1.5;1.5;0.16;0.16;1.5;1.5	4.63	4.63	0.57726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83631	0.5296	H	0.98276	4.19	0.80722	D	1	P;D	0.55385	0.868;0.971	P;P	0.58577	0.619;0.841	D	0.90927	0.4787	9	.	.	.	.	17.8745	0.88821	0.0:0.0:1.0:0.0	.	11;104	B4E3J8;Q9Y2H1	.;ST38L_HUMAN	L	104;104;63;11;104;104	ENSP00000437856:V104L;ENSP00000373684:V104L;ENSP00000439457:V63L;ENSP00000446386:V11L;ENSP00000442253:V104L;ENSP00000440279:V104L	.	V	+	1	0	STK38L	27353314	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.792000	0.99085	2.293000	0.77203	0.467000	0.42956	GTG		0.343	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403297.1	NM_015000	Missense_Mutation	Missense_Mutation
RHOT1	55288	genome.wustl.edu	37	17	30503219	30503219	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:30503219G>C	ENST00000333942.6	+	6	555	c.316G>C	c.(316-318)Gac>Cac	p.D106H	RHOT1_ENST00000354266.3_Missense_Mutation_p.D85H|RHOT1_ENST00000394692.2_Missense_Mutation_p.D106H|RHOT1_ENST00000358365.3_Missense_Mutation_p.D106H|RHOT1_ENST00000583994.1_5'UTR|RHOT1_ENST00000581094.1_Missense_Mutation_p.D106H|RHOT1_ENST00000545287.2_Missense_Mutation_p.D106H|RHOT1_ENST00000580976.1_Intron	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	106	Miro 1.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D106H(1)		NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TGAAAGAACAGACAAAGACAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	17											62.0	61.0	61.0					17																	30503219		2203	4298	6501	27527332	SO:0001583	missense	55288			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.316G>C	17.37:g.30503219G>C	ENSP00000334724:p.Asp106His	Somatic		Capture	Illumina GAIIx	4	27527332	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	37	CCDS32612.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574606	0.45902	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942;ENST00000545287	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.14	5.14	0.70334	Small GTP-binding protein domain (1);MIRO (1);	0.000000	0.85682	D	0.000000	T	0.64886	0.2639	N	0.05467	-0.045	0.80722	D	1	B;B;B;B	0.19583	0.037;0.027;0.02;0.01	B;B;B;B	0.26202	0.067;0.049;0.029;0.018	T	0.61907	-0.6966	10	0.46703	T	0.11	-10.2141	18.6223	0.91326	0.0:0.0:1.0:0.0	.	106;106;106;106	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	H	106	ENSP00000351132:D106H;ENSP00000378184:D106H;ENSP00000334724:D106H;ENSP00000439737:D106H	ENSP00000334724:D106H	D	+	1	0	RHOT1	27527332	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.460000	0.97641	2.385000	0.81259	0.655000	0.94253	GAC		0.333	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307		Missense_Mutation
CDK5R1	8851	genome.wustl.edu	37	17	30815160	30815160	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:30815160C>T	ENST00000313401.3	+	2	1211	c.522C>T	c.(520-522)ccC>ccT	p.P174P		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	174					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)	p.P174P(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			CCACGGACCCCGTGCTCTGGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	17											53.0	55.0	54.0					17																	30815160		2203	4299	6502	27839273	SO:0001819	synonymous_variant	8851			X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.522C>T	17.37:g.30815160C>T		Somatic		Capture	Illumina GAIIx	4	27839273	E1P664|Q5U0G3	Silent	SNP	ENST00000313401.3	37	CCDS11273.1	SNP	23	WashU																																																																																				0.662	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256264.1	NM_003885		Silent
NUGGC	389643	genome.wustl.edu	37	8	27887889	27887889	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr8:27887889T>A	ENST00000413272.2	-	16	2097	c.1955A>T	c.(1954-1956)aAg>aTg	p.K652M	NUGGC_ENST00000341513.6_Missense_Mutation_p.K652M	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	652					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K652M(1)									GATCCTCCTCTTCCTTCTGAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	8											47.0	53.0	51.0					8																	27887889		2026	4155	6181	27943808	SO:0001583	missense	389643			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1955A>T	8.37:g.27887889T>A	ENSP00000408697:p.Lys652Met	Somatic		Capture	Illumina GAIIx	4	27943808	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664376	0.67700	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.18960	2.19;2.18	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.33644	0.0870	L	0.34521	1.04	0.43953	D	0.99662	D	0.89917	1.0	D	0.91635	0.999	T	0.07947	-1.0746	10	0.72032	D	0.01	-25.2563	11.2515	0.49028	0.0:0.0:0.0:1.0	.	652	Q68CJ6	SLIP_HUMAN	M	652	ENSP00000408697:K652M;ENSP00000345031:K652M	ENSP00000345031:K652M	K	-	2	0	C8orf80	27943808	1.000000	0.71417	0.962000	0.40283	0.724000	0.41520	2.730000	0.47335	1.963000	0.57068	0.460000	0.39030	AAG		0.562	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906		Missense_Mutation
MTUS2	23281	genome.wustl.edu	37	13	29898764	29898764	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr13:29898764G>A	ENST00000431530.3	+	5	2909	c.2851G>A	c.(2851-2853)Gct>Act	p.A951T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	941	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.A951T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AAAGAAAGATGCTCAGAAAGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	13											75.0	64.0	67.0					13																	29898764		1855	4101	5956	28796764	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2851G>A	13.37:g.29898764G>A	ENSP00000392057:p.Ala951Thr	Somatic		Capture	Illumina GAIIx	4	28796764	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	1.037	-0.680004	0.03353	.	.	ENSG00000132938	ENST00000431530	T	0.12147	2.71	4.75	0.87	0.19102	.	1.255290	0.05486	N	0.555590	T	0.07908	0.0198	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40794	-0.9544	9	.	.	.	.	4.9449	0.13984	0.0842:0.2632:0.518:0.1346	.	941	Q5JR59	MTUS2_HUMAN	T	951	ENSP00000392057:A951T	.	A	+	1	0	MTUS2	28796764	0.415000	0.25416	0.017000	0.16124	0.266000	0.26442	0.466000	0.22019	-0.273000	0.09246	-1.284000	0.01376	GCT		0.378	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		Missense_Mutation
WRN	7486	genome.wustl.edu	37	8	30949409	30949409	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr8:30949409T>G	ENST00000298139.5	+	16	2142	c.1893T>G	c.(1891-1893)atT>atG	p.I631M		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	631	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.I631M(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TAACAGATATTAAATTGTGAG	0.363			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	1	Substitution - Missense(1)	ovary(1)	8											106.0	100.0	102.0					8																	30949409		2203	4300	6503	31068951	SO:0001583	missense	7486	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1893T>G	8.37:g.30949409T>G	ENSP00000298139:p.Ile631Met	Somatic		Capture	Illumina GAIIx	4	31068951	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	SNP	61	WashU	.	.	.	.	.	.	.	.	.	.	T	13.34	2.208687	0.39003	.	.	ENSG00000165392	ENST00000298139	T	0.15718	2.4	5.27	2.79	0.32731	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	1.084320	0.07048	N	0.831397	T	0.28466	0.0704	L	0.49350	1.555	0.25999	N	0.982142	B;P	0.45011	0.265;0.848	B;P	0.57371	0.37;0.819	T	0.21008	-1.0258	10	0.36615	T	0.2	-1.7984	5.0824	0.14663	0.1428:0.1416:0.0:0.7156	.	41;631	Q59F09;Q14191	.;WRN_HUMAN	M	631	ENSP00000298139:I631M	ENSP00000298139:I631M	I	+	3	3	WRN	31068951	1.000000	0.71417	0.984000	0.44739	0.103000	0.19146	0.805000	0.27112	1.996000	0.58369	0.533000	0.62120	ATT		0.363	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1			Missense_Mutation
DMD	1756	genome.wustl.edu	37	X	32380910	32380910	+	Nonsense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:32380910C>A	ENST00000357033.4	-	37	5526	c.5320G>T	c.(5320-5322)Gga>Tga	p.G1774*	DMD_ENST00000378677.2_Nonsense_Mutation_p.G1770*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1774	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.G1769*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTACCTTTCCAGTCTTAATT	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	X											172.0	136.0	148.0					X																	32380910		2202	4300	6502	32290831	SO:0001587	stop_gained	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5320G>T	X.37:g.32380910C>A	ENSP00000354923:p.Gly1774*	Somatic		Capture	Illumina GAIIx	4	32290831	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	48	13.966466	0.99772	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.36	5.36	0.76844	.	0.000000	0.34223	U	0.004157	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	.	18.1316	0.89603	0.0:1.0:0.0:0.0	.	.	.	.	X	1766;433;430;1770;1774;1774;1651	.	ENSP00000354923:G1774X	G	-	1	0	DMD	32290831	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.083000	0.64456	2.218000	0.71995	0.544000	0.68410	GGA		0.483	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		Nonsense_Mutation
DDX52	11056	genome.wustl.edu	37	17	35990068	35990068	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:35990068C>A	ENST00000349699.2	-	5	782	c.739G>T	c.(739-741)Gcc>Tcc	p.A247S	DDX52_ENST00000394367.3_Missense_Mutation_p.A139S	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	247	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.A247S(1)		biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				ACCTGGCTGGCAAGTTCTCGT	0.363																																																1	Substitution - Missense(1)	ovary(1)	17											138.0	131.0	133.0					17																	35990068		2203	4300	6503	33064181	SO:0001583	missense	11056			AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.739G>T	17.37:g.35990068C>A	ENSP00000268854:p.Ala247Ser	Somatic		Capture	Illumina GAIIx	4	33064181	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.590649	0.96590	.	.	ENSG00000141141	ENST00000349699;ENST00000394367	T;T	0.20881	2.04;2.04	6.06	6.06	0.98353	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.097095	0.64402	D	0.000001	T	0.52191	0.1719	M	0.78456	2.415	0.80722	D	1	P	0.35011	0.48	P	0.58172	0.834	T	0.41197	-0.9522	10	0.62326	D	0.03	.	19.6279	0.95687	0.0:1.0:0.0:0.0	.	247	Q9Y2R4	DDX52_HUMAN	S	247;139	ENSP00000268854:A247S;ENSP00000377893:A139S	ENSP00000268854:A247S	A	-	1	0	DDX52	33064181	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.267000	0.78462	2.880000	0.98712	0.650000	0.86243	GCC		0.363	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300		Missense_Mutation
FNDC5	252995	genome.wustl.edu	37	1	33333432	33333432	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:33333432T>A	ENST00000373471.3	-	4	487	c.421A>T	c.(421-423)Atg>Ttg	p.M141L	FNDC5_ENST00000496770.1_Missense_Mutation_p.M66L|FNDC5_ENST00000609187.1_Missense_Mutation_p.M66L	NM_001171940.1|NM_153756.2	NP_001165411.2|NP_715637.2	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5	141					positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)		p.M66L(1)		breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ATCTCTTTCATGGTTACCTCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											178.0	143.0	155.0					1																	33333432		2203	4300	6503	33106019	SO:0001583	missense	252995			AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000373471.3:c.421A>T	1.37:g.33333432T>A	ENSP00000362570:p.Met141Leu	Somatic		Capture	Illumina GAIIx	4	33106019	A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	Missense_Mutation	SNP	ENST00000373471.3	37		SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785177	0.70222	.	.	ENSG00000160097	ENST00000373470;ENST00000373471	.	.	.	5.02	5.02	0.67125	.	0.040493	0.85682	D	0.000000	T	0.60064	0.2240	L	0.53249	1.67	0.51482	D	0.999929	B;P	0.35745	0.112;0.518	B;P	0.47827	0.069;0.558	T	0.56438	-0.7979	9	0.23891	T	0.37	-1.4451	9.5809	0.39488	0.0:0.079:0.0:0.921	.	66;125	Q8NAU1-3;Q8NAU1	.;FNDC5_HUMAN	L	66	.	ENSP00000362569:M66L	M	-	1	0	FNDC5	33106019	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	5.736000	0.68597	2.034000	0.60081	0.533000	0.62120	ATG		0.562	FNDC5-001	KNOWN	non_ATG_start|basic	protein_coding	protein_coding	OTTHUMT00000011467.3	NM_153756		Missense_Mutation
RBL1	5933	genome.wustl.edu	37	20	35661068	35661068	+	Splice_Site	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr20:35661068C>G	ENST00000373664.3	-	16	2448	c.2382G>C	c.(2380-2382)aaG>aaC	p.K794N	RBL1_ENST00000344359.3_Splice_Site_p.K794N	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	794	Domain B.|Pocket; binds T and E1A.				chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)	p.K794N(1)		NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				AAACACATACCTTTCTGTAAA	0.338																																																1	Substitution - Missense(1)	ovary(1)	20											171.0	167.0	168.0					20																	35661068		2203	4300	6503	35094482	SO:0001630	splice_region_variant	5933			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.2382+1G>C	20.37:g.35661068C>G		Somatic		Capture	Illumina GAIIx	4	35094482	A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	ENST00000373664.3	37	CCDS13289.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538110	0.85917	.	.	ENSG00000080839	ENST00000373664;ENST00000344359	D;D	0.94931	-3.56;-3.56	5.3	5.3	0.74995	Retinoblastoma-associated protein, B-box (1);Cyclin-like (2);	0.054445	0.64402	D	0.000001	D	0.97820	0.9284	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.992;0.998	D	0.98109	1.0419	9	.	.	.	-17.7112	19.1532	0.93499	0.0:1.0:0.0:0.0	.	794;794	P28749-2;P28749	.;RBL1_HUMAN	N	794	ENSP00000362768:K794N;ENSP00000343646:K794N	.	K	-	3	2	RBL1	35094482	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.777000	0.68931	2.775000	0.95449	0.650000	0.86243	AAG		0.338	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079067.2	NM_002895	Missense_Mutation	Missense_Mutation
PDXP	57026	genome.wustl.edu	37	22	38061647	38061647	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr22:38061647G>C	ENST00000215904.6	+	2	716	c.660G>C	c.(658-660)gaG>gaC	p.E220D	SH3BP1_ENST00000599616.1_Missense_Mutation_p.E529D|PDXP_ENST00000403251.1_Missense_Mutation_p.E3D	NM_020315.4	NP_064711.1	Q96GD0	PLPP_HUMAN	pyridoxal (pyridoxine, vitamin B6) phosphatase	220					actin rod assembly (GO:0031247)|cellular response to ATP (GO:0071318)|positive regulation of actin filament depolymerization (GO:0030836)|protein dephosphorylation (GO:0006470)|pyridoxal phosphate catabolic process (GO:0032361)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heat shock protein binding (GO:0031072)|magnesium ion binding (GO:0000287)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|pyridoxal phosphatase activity (GO:0033883)	p.E220D(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(2)	9	Melanoma(58;0.0574)					ACATGTTCGAGTGCATCACGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	22											103.0	87.0	92.0					22																	38061647		2203	4300	6503	36391593	SO:0001583	missense	57026			BC064922	CCDS13953.1	22q12.3	2005-08-16			ENSG00000241360	ENSG00000241360			30259	protein-coding gene	gene with protein product		609246				14522954	Standard	NM_020315		Approved	dJ37E16.5, FLJ32703		Q96GD0	OTTHUMG00000044618	ENST00000215904.6:c.660G>C	22.37:g.38061647G>C	ENSP00000215904:p.Glu220Asp	Somatic		Capture	Illumina GAIIx	4	36391593	Q9UGY2	Missense_Mutation	SNP	ENST00000215904.6	37	CCDS13953.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	8.247	0.808153	0.16467	.	.	ENSG00000241360	ENST00000215904;ENST00000403251	T;T	0.30448	1.53;1.53	5.52	4.49	0.54785	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	.	.	.	.	T	0.07728	0.0194	N	0.00885	-1.115	0.29907	N	0.823915	B;B	0.09022	0.0;0.002	B;B	0.19148	0.001;0.024	T	0.33854	-0.9852	9	0.02654	T	1	-10.4784	4.3701	0.11244	0.0769:0.1276:0.5236:0.272	.	220;529	Q96GD0;Q6ZT62	PLPP_HUMAN;.	D	220;3	ENSP00000215904:E220D;ENSP00000385336:E3D	ENSP00000215904:E220D	E	+	3	2	PDXP	36391593	0.998000	0.40836	1.000000	0.80357	0.979000	0.70002	0.377000	0.20552	1.310000	0.45006	0.561000	0.74099	GAG		0.652	PDXP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104105.2	NM_020315		Missense_Mutation
CEP89	84902	genome.wustl.edu	37	19	33422396	33422396	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:33422396T>A	ENST00000305768.5	-	9	1056	c.968A>T	c.(967-969)cAt>cTt	p.H323L	CEP89_ENST00000590597.2_Missense_Mutation_p.H323L	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	323					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.H323L(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						ATTCAAACGATGGACAGTCAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											103.0	88.0	93.0					19																	33422396		2203	4300	6503	38114236	SO:0001583	missense	84902			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.968A>T	19.37:g.33422396T>A	ENSP00000306105:p.His323Leu	Somatic		Capture	Illumina GAIIx	4	38114236	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	26.7	4.762898	0.89932	.	.	ENSG00000121289	ENST00000305768	T	0.37411	1.2	5.51	5.51	0.81932	.	0.240709	0.48767	D	0.000180	T	0.57110	0.2031	M	0.79475	2.455	0.44780	D	0.997787	D;D;D	0.69078	0.983;0.997;0.982	P;P;P	0.60682	0.755;0.878;0.79	T	0.59032	-0.7530	10	0.40728	T	0.16	-11.94	14.5858	0.68322	0.0:0.0:0.0:1.0	.	323;76;323	Q96ST8-3;Q96ST8-2;Q96ST8	.;.;CEP89_HUMAN	L	323	ENSP00000306105:H323L	ENSP00000306105:H323L	H	-	2	0	CEP89	38114236	1.000000	0.71417	0.984000	0.44739	0.987000	0.75469	6.782000	0.75073	2.091000	0.63221	0.477000	0.44152	CAT		0.363	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		Missense_Mutation
BUB1B	701	genome.wustl.edu	37	15	40504774	40504774	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:40504774T>A	ENST00000287598.6	+	19	2655	c.2460T>A	c.(2458-2460)gaT>gaA	p.D820E	BUB1B_ENST00000412359.3_Missense_Mutation_p.D834E	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	820	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		AAGATTTTGATCATTTTTGCA	0.318			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																													yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0			15											117.0	111.0	113.0					15																	40504774		2203	4300	6503	38292066	SO:0001583	missense	701	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2460T>A	15.37:g.40504774T>A	ENSP00000287598:p.Asp820Glu	Somatic		Capture	Illumina GAIIx	4	38292066	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	ENST00000287598.6	37	CCDS10053.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	4.139	0.024197	0.08006	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.18810	2.19;2.19	5.1	0.0214	0.14129	Protein kinase-like domain (1);	0.252366	0.33382	N	0.004972	T	0.07279	0.0184	N	0.12746	0.255	0.18873	N	0.999989	B	0.21606	0.058	B	0.24701	0.055	T	0.36016	-0.9765	10	0.02654	T	1	-12.2534	3.6394	0.08161	0.2717:0.3193:0.0:0.409	.	820	O60566	BUB1B_HUMAN	E	820;834;703	ENSP00000287598:D820E;ENSP00000398470:D834E	ENSP00000287598:D820E	D	+	3	2	BUB1B	38292066	0.220000	0.23631	0.640000	0.29408	0.274000	0.26718	0.036000	0.13819	0.298000	0.22638	-0.256000	0.11100	GAT		0.318	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4			Missense_Mutation
SCN10A	6336	genome.wustl.edu	37	3	38739846	38739846	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:38739846G>A	ENST00000449082.2	-	27	4864	c.4865C>T	c.(4864-4866)tCt>tTt	p.S1622F		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1622					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S1622F(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	ACCGAAGATAGAGTAGATGAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	3											184.0	169.0	175.0					3																	38739846		2203	4300	6503	38714850	SO:0001583	missense	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.4865C>T	3.37:g.38739846G>A	ENSP00000390600:p.Ser1622Phe	Somatic		Capture	Illumina GAIIx	4	38714850	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334029	0.81801	.	.	ENSG00000185313	ENST00000449082	D	0.97850	-4.57	5.42	5.42	0.78866	Ion transport (1);	0.058698	0.64402	D	0.000001	D	0.99158	0.9709	H	0.95982	3.75	0.58432	D	0.99999	D	0.76494	0.999	D	0.66196	0.942	D	0.99129	1.0852	10	0.87932	D	0	.	19.406	0.94647	0.0:0.0:1.0:0.0	.	1622	Q9Y5Y9	SCNAA_HUMAN	F	1622	ENSP00000390600:S1622F	ENSP00000390600:S1622F	S	-	2	0	SCN10A	38714850	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.644000	0.98468	2.822000	0.97130	0.655000	0.94253	TCT		0.547	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		Missense_Mutation
CCR8	1237	genome.wustl.edu	37	3	39374518	39374518	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:39374518C>G	ENST00000326306.4	+	2	834	c.696C>G	c.(694-696)aaC>aaG	p.N232K	CCR8_ENST00000414803.1_3'UTR|CCR8_ENST00000545843.1_Missense_Mutation_p.N149K	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	232					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)	p.N232K(1)		NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		AAAACCACAACAAGACCAAGG	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											122.0	104.0	110.0					3																	39374518		2203	4300	6503	39349522	SO:0001583	missense	1237			D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.696C>G	3.37:g.39374518C>G	ENSP00000326432:p.Asn232Lys	Somatic		Capture	Illumina GAIIx	4	39349522	B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Missense_Mutation	SNP	ENST00000326306.4	37	CCDS2684.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.476	-0.882204	0.02530	.	.	ENSG00000179934	ENST00000326306;ENST00000545843	T;T	0.35973	1.28;1.28	4.65	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.438172	0.25035	N	0.033654	T	0.14614	0.0353	N	0.10760	0.04	0.41110	D	0.985736	B;B	0.12013	0.005;0.005	B;B	0.23150	0.044;0.044	T	0.21484	-1.0244	10	0.02654	T	1	.	8.6781	0.34191	0.2329:0.3861:0.381:0.0	.	232;149	P51685;Q3KNR3	CCR8_HUMAN;.	K	232;149	ENSP00000326432:N232K;ENSP00000440474:N149K	ENSP00000326432:N232K	N	+	3	2	CCR8	39349522	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	0.858000	0.27845	0.546000	0.28920	0.655000	0.94253	AAC		0.423	CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254058.2	NM_005201		Missense_Mutation
BRWD1	54014	genome.wustl.edu	37	21	40646359	40646359	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr21:40646359C>A	ENST00000333229.2	-	13	1512	c.1185G>T	c.(1183-1185)tgG>tgT	p.W395C	BRWD1_ENST00000380800.3_Missense_Mutation_p.W395C|BRWD1_ENST00000342449.3_Missense_Mutation_p.W395C	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	395					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W395C(1)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GCTCAAATCTCCAAATCCGTG	0.403																																					Melanoma(170;988 1986 4794 16843 39731)											1	Substitution - Missense(1)	ovary(1)	21											234.0	187.0	203.0					21																	40646359		2203	4300	6503	39568229	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.1185G>T	21.37:g.40646359C>A	ENSP00000330753:p.Trp395Cys	Somatic		Capture	Illumina GAIIx	4	39568229	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	SNP	30	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.620979|4.620979	0.87460|0.87460	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000455867|ENST00000333229;ENST00000342449;ENST00000380800	.|D;D;D	.|0.83506	.|-1.73;-1.73;-1.73	5.55|5.55	5.55|5.55	0.83447|0.83447	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.000000	.|0.64402	.|D	.|0.000004	.|D	.|0.94840	.|0.8333	H|H	0.97564|0.97564	4.03|4.03	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;1.0	.|D	.|0.96330	.|0.9243	.|10	.|0.87932	.|D	.|0	-4.0065|-4.0065	19.5042|19.5042	0.95108|0.95108	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|106;395;395	.|Q5R2U6;Q9NSI6-2;Q9NSI6	.|.;.;BRWD1_HUMAN	X|C	107|395	.|ENSP00000330753:W395C;ENSP00000344333:W395C;ENSP00000370178:W395C	.|ENSP00000330753:W395C	E|W	-|-	1|3	0|0	BRWD1|BRWD1	39568229|39568229	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.354000|7.354000	0.79424|0.79424	2.626000|2.626000	0.88956|0.88956	0.484000|0.484000	0.47621|0.47621	GAG|TGG		0.403	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656		Missense_Mutation
EHD4	30844	genome.wustl.edu	37	15	42245976	42245976	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:42245976G>A	ENST00000220325.4	-	2	482	c.399C>T	c.(397-399)aaC>aaT	p.N133N		NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4	133	Dynamin-type G.				cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.N133N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		TCAGGAAAGCGTTTCCAAAGC	0.468																																																1	Substitution - coding silent(1)	ovary(1)	15											106.0	106.0	106.0					15																	42245976		2203	4299	6502	40033268	SO:0001819	synonymous_variant	30844			AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.399C>T	15.37:g.42245976G>A		Somatic		Capture	Illumina GAIIx	4	40033268	Q9HAR1|Q9NZN2	Silent	SNP	ENST00000220325.4	37	CCDS10081.1	SNP	40	WashU																																																																																				0.468	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252737.2	NM_139265		Silent
PHOX2B	8929	genome.wustl.edu	37	4	41750608	41750608	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:41750608G>T	ENST00000226382.2	-	1	379	c.20C>A	c.(19-21)tCt>tAt	p.S7Y	RP11-227F19.2_ENST00000510602.1_lincRNA|RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	7					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.S7Y(1)		autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						ATTGAGGTAAGAATATTCCAT	0.478			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	1	Substitution - Missense(1)	ovary(1)	4											33.0	34.0	33.0					4																	41750608		2203	4300	6503	41445365	SO:0001583	missense	8929	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.20C>A	4.37:g.41750608G>T	ENSP00000226382:p.Ser7Tyr	Somatic		Capture	Illumina GAIIx	4	41445365	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755881	0.69648	.	.	ENSG00000109132	ENST00000226382	D	0.91577	-2.87	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.95046	0.8396	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95051	0.8187	10	0.87932	D	0	.	19.7607	0.96316	0.0:0.0:1.0:0.0	.	7	Q99453	PHX2B_HUMAN	Y	7	ENSP00000226382:S7Y	ENSP00000226382:S7Y	S	-	2	0	PHOX2B	41445365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.631000	0.98424	2.686000	0.91538	0.561000	0.74099	TCT		0.478	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2			Missense_Mutation
HECW1	23072	genome.wustl.edu	37	7	43532713	43532713	+	Missense_Mutation	SNP	G	G	A	rs569020073	byFrequency	TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:43532713G>A	ENST00000395891.2	+	19	3976	c.3371G>A	c.(3370-3372)cGc>cAc	p.R1124H	HECW1_ENST00000453890.1_Missense_Mutation_p.R1090H	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1124					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R1103H(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCATTTCTTCGCCAGCCAAAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	7											75.0	72.0	73.0					7																	43532713		1931	4149	6080	43499238	SO:0001583	missense	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3371G>A	7.37:g.43532713G>A	ENSP00000379228:p.Arg1124His	Somatic		Capture	Illumina GAIIx	4	43499238	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.195524	0.94960	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.85484	-1.99;-1.99	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.91246	0.7241	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.985	D	0.90120	0.4198	10	0.38643	T	0.18	.	18.624	0.91331	0.0:0.0:1.0:0.0	.	1090;1124	B4DH42;Q76N89	.;HECW1_HUMAN	H	1124;1090;1124	ENSP00000379228:R1124H;ENSP00000407774:R1090H	ENSP00000265522:R1124H	R	+	2	0	HECW1	43499238	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.400000	0.97290	2.499000	0.84300	0.655000	0.94253	CGC		0.463	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		Missense_Mutation
NPC1L1	29881	genome.wustl.edu	37	7	44556455	44556455	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:44556455G>A	ENST00000289547.4	-	17	3502	c.3447C>T	c.(3445-3447)ccC>ccT	p.P1149P	NPC1L1_ENST00000546276.1_Silent_p.P1076P|NPC1L1_ENST00000381160.3_Silent_p.P1122P	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1149					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.P1149P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CAGCGAAGGTGGGCACAAGGC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	7											83.0	74.0	77.0					7																	44556455		2203	4300	6503	44522980	SO:0001819	synonymous_variant	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3447C>T	7.37:g.44556455G>A		Somatic		Capture	Illumina GAIIx	4	44522980	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1	SNP	47	WashU																																																																																				0.587	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389		Silent
ZNF197	10168	genome.wustl.edu	37	3	44670729	44670729	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:44670729C>A	ENST00000396058.1	+	1	250	c.83C>A	c.(82-84)aCc>aAc	p.T28N	RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Missense_Mutation_p.T28N|ZNF197_ENST00000344387.4_Missense_Mutation_p.T28N|ZNF197_ENST00000383744.4_Missense_Mutation_p.T28N			O14709	ZN197_HUMAN	zinc finger protein 197	28					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T28N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AAATGGGGAACCAGCTTCCAA	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											113.0	126.0	121.0					3																	44670729		2203	4300	6503	44645733	SO:0001583	missense	10168			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.83C>A	3.37:g.44670729C>A	ENSP00000379370:p.Thr28Asn	Somatic		Capture	Illumina GAIIx	4	44645733	B2RAH8|Q86VG0	Missense_Mutation	SNP	ENST00000396058.1	37	CCDS2717.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	14.71	2.618085	0.46736	.	.	ENSG00000186448	ENST00000412641;ENST00000383744;ENST00000536299;ENST00000344387;ENST00000383745;ENST00000396058	T;T;T;T;T	0.09911	2.93;5.68;3.35;5.68;3.35	4.88	4.0	0.46444	.	0.201697	0.24745	N	0.035950	T	0.05227	0.0139	N	0.08118	0	0.23506	N	0.99754	P;P	0.40578	0.722;0.534	B;B	0.34779	0.189;0.123	T	0.31364	-0.9946	10	0.42905	T	0.14	.	10.6287	0.45523	0.0:0.9087:0.0:0.0913	.	28;28	Q86VG0;O14709	.;ZN197_HUMAN	N	28	ENSP00000394713:T28N;ENSP00000373250:T28N;ENSP00000345809:T28N;ENSP00000373251:T28N;ENSP00000379370:T28N	ENSP00000334616:T28N	T	+	2	0	ZNF197	44645733	0.770000	0.28543	0.998000	0.56505	0.993000	0.82548	0.783000	0.26802	1.406000	0.46857	0.655000	0.94253	ACC		0.478	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991		Missense_Mutation
SHKBP1	92799	genome.wustl.edu	37	19	41089374	41089374	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:41089374G>C	ENST00000291842.5	+	11	1080	c.1031G>C	c.(1030-1032)gGc>gCc	p.G344A	SHKBP1_ENST00000600733.1_Missense_Mutation_p.G319A	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	344					protein homooligomerization (GO:0051260)			p.G344A(1)		breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGCAACAACGGCTCCATTTAC	0.662																																																1	Substitution - Missense(1)	ovary(1)	19											41.0	36.0	38.0					19																	41089374		2203	4300	6503	45781214	SO:0001583	missense	92799			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1031G>C	19.37:g.41089374G>C	ENSP00000291842:p.Gly344Ala	Somatic		Capture	Illumina GAIIx	4	45781214	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	CCDS12560.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743392	0.89663	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.14022	2.54	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44117	0.1278	M	0.85197	2.74	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.97110	1.0;1.0;0.998;0.998;0.997;0.995	T	0.49606	-0.8922	10	0.87932	D	0	-5.1287	17.6664	0.88203	0.0:0.0:1.0:0.0	.	222;181;267;181;344;344	B4DLI0;B4DUW2;B4DUV2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;.;SHKB1_HUMAN	A	344;181	ENSP00000291842:G344A	ENSP00000291842:G344A	G	+	2	0	SHKBP1	45781214	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.216000	0.95154	2.480000	0.83734	0.555000	0.69702	GGC		0.662	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392		Missense_Mutation
MAST2	23139	genome.wustl.edu	37	1	46501738	46501738	+	Nonstop_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:46501738G>C	ENST00000361297.2	+	29	5680	c.5397G>C	c.(5395-5397)taG>taC	p.*1799Y	MAST2_ENST00000372009.2_Nonstop_Mutation_p.*1609Y	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.*1799Y(1)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					AGCAAACATAGCAGTTGTTTG	0.468																																																1	Nonstop extension(1)	ovary(1)	1											50.0	52.0	52.0					1																	46501738		1894	4082	5976	46274325	SO:0001578	stop_lost	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.5397G>C	1.37:g.46501738G>C	ENSP00000354671:p.*1799Tyrext*?	Somatic		Capture	Illumina GAIIx	4	46274325		Nonstop_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656835	0.47467	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	.	.	.	5.06	0.768	0.18487	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5139	0.33235	0.3331:0.0:0.6669:0.0	.	.	.	.	Y	1799;1609	.	.	X	+	3	2	MAST2	46274325	0.997000	0.39634	0.052000	0.19188	0.585000	0.36419	1.030000	0.30153	-0.000000	0.14550	-0.143000	0.13931	TAG		0.468	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112		Nonstop_Mutation
LRRC2	79442	genome.wustl.edu	37	3	46563074	46563074	+	Missense_Mutation	SNP	C	C	T	rs146766759	byFrequency	TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:46563074C>T	ENST00000395905.3	-	8	1396	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	LRRC2_ENST00000296144.3_Missense_Mutation_p.R335Q	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	335								p.R335Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		TTGGCGATCCCGTTCACTTTC	0.333																																																1	Substitution - Missense(1)	ovary(1)	3											110.0	108.0	109.0					3																	46563074		2203	4300	6503	46538078	SO:0001583	missense	79442			AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.1004G>A	3.37:g.46563074C>T	ENSP00000379241:p.Arg335Gln	Somatic		Capture	Illumina GAIIx	4	46538078	B2RDQ7|Q96LT5	Missense_Mutation	SNP	ENST00000395905.3	37	CCDS2741.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	10.69	1.422048	0.25639	.	.	ENSG00000163827	ENST00000395905;ENST00000296144	T;T	0.16743	2.32;2.32	4.56	-5.88	0.02290	.	1.152970	0.06570	N	0.748301	T	0.09423	0.0232	N	0.12182	0.205	0.28946	N	0.890705	B	0.02656	0.0	B	0.01281	0.0	T	0.34403	-0.9830	10	0.36615	T	0.2	.	12.606	0.56523	0.0:0.567:0.0:0.433	.	335	Q9BYS8	LRRC2_HUMAN	Q	335	ENSP00000379241:R335Q;ENSP00000296144:R335Q	ENSP00000296144:R335Q	R	-	2	0	LRRC2	46538078	0.521000	0.26258	0.640000	0.29408	0.931000	0.56810	-0.054000	0.11826	-1.194000	0.02684	-0.469000	0.05056	CGG		0.333	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257375.2			Missense_Mutation
PSMC3	5702	genome.wustl.edu	37	11	47444497	47444497	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:47444497T>G	ENST00000298852.3	-	7	776	c.619A>C	c.(619-621)Aac>Cac	p.N207H	PSMC3_ENST00000530912.1_Missense_Mutation_p.N165H|PSMC3_ENST00000602866.1_Missense_Mutation_p.N191H	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	207					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.N207H(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCCTTGTGGTTCATTGGCAAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											103.0	104.0	104.0					11																	47444497		2201	4298	6499	47401073	SO:0001583	missense	5702			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.619A>C	11.37:g.47444497T>G	ENSP00000298852:p.Asn207His	Somatic		Capture	Illumina GAIIx	4	47401073	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	ENST00000298852.3	37	CCDS7935.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	24.5	4.533111	0.85812	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000524447;ENST00000531051;ENST00000530887;ENST00000530651;ENST00000527906	D;D	0.94793	-3.52;-3.52	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.91348	0.7271	N	0.16743	0.435	0.80722	D	1	P;P	0.47409	0.823;0.895	P;P	0.47430	0.497;0.547	D	0.92970	0.6397	10	0.87932	D	0	-39.0895	15.1702	0.72865	0.0:0.0:0.0:1.0	.	165;207	E9PM69;P17980	.;PRS6A_HUMAN	H	207;165;151;151;172;172;172	ENSP00000298852:N207H;ENSP00000433097:N165H	ENSP00000298852:N207H	N	-	1	0	PSMC3	47401073	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.040000	0.89188	1.981000	0.57761	0.533000	0.62120	AAC		0.592	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804		Missense_Mutation
DHX30	22907	genome.wustl.edu	37	3	47888807	47888807	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:47888807G>A	ENST00000445061.1	+	12	2381	c.1974G>A	c.(1972-1974)ctG>ctA	p.L658L	DHX30_ENST00000348968.4_Silent_p.L630L|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Silent_p.L686L|DHX30_ENST00000446256.2_Silent_p.L619L	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	658	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.L658L(1)		endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TGACTGATCTGGTTCTGCACA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	3											190.0	153.0	166.0					3																	47888807		2203	4300	6503	47863811	SO:0001819	synonymous_variant	22907			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1974G>A	3.37:g.47888807G>A		Somatic		Capture	Illumina GAIIx	4	47863811	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	37	CCDS2759.1	SNP	47	WashU																																																																																				0.607	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		Silent
OR4C46	119749	genome.wustl.edu	37	11	51515862	51515862	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:51515862A>T	ENST00000328188.1	+	1	581	c.581A>T	c.(580-582)gAa>gTa	p.E194V		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E194V(1)		endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CATATGCTGGAACTCTTCATT	0.463																																																1	Substitution - Missense(1)	ovary(1)	11											139.0	122.0	128.0					11																	51515862		2201	4296	6497	51372438	SO:0001583	missense	119749				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.581A>T	11.37:g.51515862A>T	ENSP00000329056:p.Glu194Val	Somatic		Capture	Illumina GAIIx	4	51372438		Missense_Mutation	SNP	ENST00000328188.1	37	CCDS31498.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	.	1.856	-0.463731	0.04476	.	.	ENSG00000185926	ENST00000328188	T	0.00258	8.41	2.47	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000285	T	0.00144	0.0004	L	0.33792	1.035	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42832	-0.9428	10	0.72032	D	0.01	.	5.2022	0.15271	0.4432:0.0:0.5568:0.0	.	194	A6NHA9	O4C46_HUMAN	V	194	ENSP00000329056:E194V	ENSP00000329056:E194V	E	+	2	0	OR4C46	51372438	0.257000	0.24022	0.001000	0.08648	0.006000	0.05464	0.922000	0.28734	0.013000	0.14918	-1.730000	0.00700	GAA		0.463	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		Missense_Mutation
PKHD1	5314	genome.wustl.edu	37	6	51917880	51917880	+	Missense_Mutation	SNP	C	C	G	rs144455663		TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:51917880C>G	ENST00000371117.3	-	21	2409	c.2134G>C	c.(2134-2136)Gta>Cta	p.V712L	PKHD1_ENST00000340994.4_Missense_Mutation_p.V712L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	712					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.V712L(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTACCTGTTACGTTTGTGTCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	6						C	LEU/VAL,LEU/VAL	2,4404	4.2+/-10.8	0,2,2201	63.0	63.0	63.0		2134,2134	-7.6	0.0	6	dbSNP_134	63	0,8600		0,0,4300	no	missense,missense	PKHD1	NM_138694.3,NM_170724.2	32,32	0,2,6501	GG,GC,CC		0.0,0.0454,0.0154	benign,benign	712/4075,712/3397	51917880	2,13004	2203	4300	6503	52025839	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2134G>C	6.37:g.51917880C>G	ENSP00000360158:p.Val712Leu	Somatic		Capture	Illumina GAIIx	4	52025839	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	6.639	0.486353	0.12641	4.54E-4	0.0	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86865	-1.97;-2.18	5.63	-7.61	0.01299	.	1.280890	0.05176	N	0.500306	T	0.39009	0.1062	N	0.01874	-0.695	0.09310	N	0.999998	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.43925	-0.9361	10	0.23302	T	0.38	.	4.8656	0.13607	0.1438:0.4822:0.0934:0.2805	.	712;712	P08F94-2;P08F94	.;PKHD1_HUMAN	L	712	ENSP00000360158:V712L;ENSP00000341097:V712L	ENSP00000341097:V712L	V	-	1	0	PKHD1	52025839	0.244000	0.23889	0.017000	0.16124	0.841000	0.47740	-0.640000	0.05440	-1.308000	0.02318	-0.152000	0.13540	GTA		0.463	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Missense_Mutation
HNRNPA1	3178	genome.wustl.edu	37	12	54675236	54675236	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:54675236G>A	ENST00000340913.6	+	2	135	c.82G>A	c.(82-84)Gag>Aag	p.E28K	HNRNPA1_ENST00000547276.1_Missense_Mutation_p.E28K|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.E28K|HNRNPA1_ENST00000330752.8_Missense_Mutation_p.E28K|RP11-968A15.8_ENST00000553061.1_RNA|CBX5_ENST00000209875.4_5'Flank|RP11-968A15.2_ENST00000547177.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	28	Globular A domain.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)	p.E28K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						AACAACTGATGAGAGCCTGAG	0.502																																					Colon(83;502 1289 8436 16406 24870)											1	Substitution - Missense(1)	ovary(1)	12											51.0	54.0	53.0					12																	54675236		2082	4246	6328	52961503	SO:0001583	missense	3178			BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.82G>A	12.37:g.54675236G>A	ENSP00000341826:p.Glu28Lys	Somatic		Capture	Illumina GAIIx	4	52961503	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185953	0.78789	.	.	ENSG00000135486	ENST00000546500;ENST00000547708;ENST00000547617;ENST00000552494;ENST00000340913;ENST00000330752;ENST00000552591;ENST00000551702;ENST00000551133;ENST00000547276;ENST00000548688	D;D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	D	0.000035	D	0.89787	0.6816	L	0.46741	1.465	0.58432	D	0.999998	P;P;P;B;P;P	0.50617	0.751;0.937;0.753;0.006;0.937;0.89	P;P;B;B;P;P	0.52758	0.586;0.708;0.256;0.044;0.708;0.671	D	0.91003	0.4844	10	0.72032	D	0.01	.	15.3753	0.74598	0.0:0.0:1.0:0.0	.	28;28;28;28;28;28	F8VRQ1;F8W6I7;F8VSB5;P09651-3;P09651-2;P09651	.;.;.;.;.;ROA1_HUMAN	K	28;28;28;28;28;28;28;28;28;28;47	ENSP00000448617:E28K;ENSP00000448229:E28K;ENSP00000341826:E28K;ENSP00000333504:E28K;ENSP00000448117:E28K;ENSP00000447260:E28K;ENSP00000447782:E47K	ENSP00000333504:E28K	E	+	1	0	HNRNPA1	52961503	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.752000	0.98900	2.407000	0.81776	0.491000	0.48974	GAG		0.502	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157		Missense_Mutation
NCKAP1L	3071	genome.wustl.edu	37	12	54930003	54930003	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:54930003C>G	ENST00000293373.6	+	28	3126	c.3047C>G	c.(3046-3048)tCt>tGt	p.S1016C	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.S966C	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	1016					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)	p.S1016C(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						ACTGACCCTTCTTCCTTTTAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											132.0	107.0	115.0					12																	54930003		2203	4300	6503	53216270	SO:0001583	missense	3071			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.3047C>G	12.37:g.54930003C>G	ENSP00000293373:p.Ser1016Cys	Somatic		Capture	Illumina GAIIx	4	53216270	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765421	0.31228	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.31769	1.48;1.48	4.16	4.16	0.48862	.	0.388995	0.27668	N	0.018350	T	0.30039	0.0752	N	0.24115	0.695	0.26665	N	0.971848	P	0.50710	0.938	P	0.54372	0.75	T	0.05989	-1.0852	10	0.66056	D	0.02	-5.8653	8.0287	0.30453	0.0:0.89:0.0:0.11	.	1016	P55160	NCKPL_HUMAN	C	1016;966	ENSP00000293373:S1016C;ENSP00000445596:S966C	ENSP00000293373:S1016C	S	+	2	0	NCKAP1L	53216270	0.044000	0.20184	0.827000	0.32855	0.226000	0.24999	0.490000	0.22403	2.336000	0.79503	0.655000	0.94253	TCT		0.483	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337		Missense_Mutation
CACNA1D	776	genome.wustl.edu	37	3	53758006	53758006	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:53758006G>A	ENST00000350061.5	+	14	2591	c.2080G>A	c.(2080-2082)Gca>Aca	p.A694T	CACNA1D_ENST00000288139.4_Missense_Mutation_p.A714T|CACNA1D_ENST00000422281.2_Missense_Mutation_p.A694T	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	694					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)	p.A714T(1)		breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTCCCTCAAGCACTTCTCAC	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	87.0	89.0					3																	53758006		2203	4300	6503	53733046	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2080G>A	3.37:g.53758006G>A	ENSP00000288133:p.Ala694Thr	Somatic		Capture	Illumina GAIIx	4	53733046	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.189236	0.94923	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.98876	-5.2;-5.2;-5.2;-5.2	5.77	5.77	0.91146	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99348	0.9771	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.76494	0.998;0.977;0.992;0.999	D;P;D;D	0.72075	0.976;0.904;0.949;0.959	D	0.99063	1.0831	10	0.87932	D	0	.	19.981	0.97324	0.0:0.0:1.0:0.0	.	694;387;694;714	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	T	694;714;694;387	ENSP00000288133:A694T;ENSP00000288139:A714T;ENSP00000409174:A694T;ENSP00000418014:A387T	ENSP00000288139:A714T	A	+	1	0	CACNA1D	53733046	1.000000	0.71417	0.694000	0.30210	0.972000	0.66771	4.839000	0.62810	2.729000	0.93468	0.585000	0.79938	GCA		0.483	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720		Missense_Mutation
USP24	23358	genome.wustl.edu	37	1	55544264	55544264	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:55544264A>G	ENST00000294383.6	-	61	7260	c.7261T>C	c.(7261-7263)Tac>Cac	p.Y2421H	USP24_ENST00000407756.1_Missense_Mutation_p.Y2261H	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2421					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.Y2338H(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AAACAGCAGTACACTACCATC	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	83.0	84.0					1																	55544264		1986	4179	6165	55316852	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.7261T>C	1.37:g.55544264A>G	ENSP00000294383:p.Tyr2421His	Somatic		Capture	Illumina GAIIx	4	55316852	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	14.34	2.505083	0.44558	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02916	4.11;4.14	5.72	3.43	0.39272	.	0.000000	0.64402	D	0.000001	T	0.01661	0.0053	N	0.11201	0.11	0.49687	D	0.999817	B	0.06786	0.001	B	0.08055	0.003	T	0.49051	-0.8979	10	0.08381	T	0.77	.	10.0352	0.42125	0.8643:0.0:0.1357:0.0	.	2261	B7WPF4	.	H	2421;2261	ENSP00000294383:Y2421H;ENSP00000385700:Y2261H	ENSP00000294383:Y2421H	Y	-	1	0	USP24	55316852	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.048000	0.76606	0.448000	0.26722	0.533000	0.62120	TAC		0.438	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			Missense_Mutation
OR5D16	390144	genome.wustl.edu	37	11	55606330	55606330	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:55606330G>C	ENST00000378396.1	+	1	103	c.103G>C	c.(103-105)Gca>Cca	p.A35P		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A35P(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TGTATTTCTGGCAGTCTACGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											127.0	120.0	122.0					11																	55606330		2201	4296	6497	55362906	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.103G>C	11.37:g.55606330G>C	ENSP00000367649:p.Ala35Pro	Somatic		Capture	Illumina GAIIx	4	55362906	Q6IF65|Q96RB4	Missense_Mutation	SNP	ENST00000378396.1	37	CCDS31512.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	.	12.58	1.981043	0.34942	.	.	ENSG00000205029	ENST00000378396	T	0.00450	7.36	4.15	-0.707	0.11245	.	.	.	.	.	T	0.00552	0.0018	L	0.48877	1.53	0.09310	N	1	D	0.53885	0.963	P	0.61800	0.894	T	0.53236	-0.8467	9	0.52906	T	0.07	-2.1247	3.8684	0.09025	0.0844:0.2391:0.448:0.2285	.	35	Q8NGK9	OR5DG_HUMAN	P	35	ENSP00000367649:A35P	ENSP00000367649:A35P	A	+	1	0	OR5D16	55362906	0.000000	0.05858	0.001000	0.08648	0.827000	0.46813	-4.587000	0.00212	0.021000	0.15133	0.530000	0.56133	GCA		0.433	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334506.1	NM_001005496		Missense_Mutation
NLRC5	84166	genome.wustl.edu	37	16	57089399	57089399	+	Silent	SNP	G	G	A	rs144081659	byFrequency	TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:57089399G>A	ENST00000262510.6	+	27	3939	c.3714G>A	c.(3712-3714)ttG>ttA	p.L1238L	NLRC5_ENST00000539144.1_Intron|NLRC5_ENST00000436936.1_Silent_p.L1238L|RP11-322D14.2_ENST00000562970.1_RNA|NLRC5_ENST00000308149.7_Intron	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1238					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.L1238L(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				TCTGCTGGTTGCTGAGCAAGT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	16						G		3,4393	6.2+/-15.9	0,3,2195	94.0	72.0	79.0		3714	-0.1	0.5	16	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	NLRC5	NM_032206.3		0,3,6495	AA,AG,GG		0.0,0.0682,0.0231		1238/1867	57089399	3,12993	2198	4300	6498	55646900	SO:0001819	synonymous_variant	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3714G>A	16.37:g.57089399G>A		Somatic		Capture	Illumina GAIIx	4	55646900	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	CCDS10773.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.202743	0.01581	6.82E-4	0.0	ENSG00000140853	ENST00000538805	.	.	.	4.7	-0.129	0.13502	.	.	.	.	.	T	0.42832	0.1220	.	.	.	0.44711	D	0.9977	.	.	.	.	.	.	T	0.28776	-1.0033	4	.	.	.	.	2.769	0.05328	0.4399:0.0:0.3523:0.2079	.	.	.	.	T	990	.	.	A	+	1	0	NLRC5	55646900	0.050000	0.20438	0.532000	0.27989	0.053000	0.15095	0.012000	0.13287	0.442000	0.26555	0.591000	0.81541	GCT		0.592	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		Silent
COL21A1	81578	genome.wustl.edu	37	6	56044490	56044490	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:56044490C>T	ENST00000244728.5	-	3	923	c.526G>A	c.(526-528)Gat>Aat	p.D176N	COL21A1_ENST00000535941.1_Missense_Mutation_p.D176N|COL21A1_ENST00000370819.1_Missense_Mutation_p.D176N	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	176	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D176N(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AGTTCGGCATCTTCTGTTTCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											94.0	88.0	90.0					6																	56044490		1945	4145	6090	56152449	SO:0001583	missense	81578			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.526G>A	6.37:g.56044490C>T	ENSP00000244728:p.Asp176Asn	Somatic		Capture	Illumina GAIIx	4	56152449	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.44	2.534844	0.45073	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811	D;D;D	0.83250	-1.7;-1.7;-1.7	4.66	4.66	0.58398	von Willebrand factor, type A (3);	0.326534	0.25427	N	0.030760	T	0.47469	0.1447	N	0.01742	-0.745	0.80722	D	1	P;B	0.37276	0.589;0.175	B;B	0.33620	0.167;0.052	T	0.60326	-0.7285	10	0.18276	T	0.48	.	17.9099	0.88930	0.0:1.0:0.0:0.0	.	176;176	Q96P44-3;Q96P44	.;COLA1_HUMAN	N	176	ENSP00000244728:D176N;ENSP00000359855:D176N;ENSP00000444384:D176N	ENSP00000244728:D176N	D	-	1	0	COL21A1	56152449	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.814000	0.55643	2.283000	0.76528	0.585000	0.79938	GAT		0.398	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2			Missense_Mutation
ZNF610	162963	genome.wustl.edu	37	19	52856964	52856964	+	Silent	SNP	C	C	T	rs375754279		TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:52856964C>T	ENST00000403906.3	+	4	549	c.93C>T	c.(91-93)atC>atT	p.I31I	ZNF610_ENST00000327920.8_Silent_p.I31I|ZNF610_ENST00000601151.1_Silent_p.I31I|ZNF610_ENST00000321287.8_Silent_p.I31I	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	31	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I31I(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ACGTGGCCATCGAATTCTCTC	0.438																																																1	Substitution - coding silent(1)	ovary(1)	19						C	,,,	1,4405	2.1+/-5.4	0,1,2202	98.0	98.0	98.0		93,93,93,93	-2.9	0.9	19		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF610	NM_001161425.1,NM_001161426.1,NM_001161427.1,NM_173530.2	,,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,,	31/463,31/463,31/420,31/463	52856964	2,13004	2203	4300	6503	57548776	SO:0001819	synonymous_variant	162963			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.93C>T	19.37:g.52856964C>T		Somatic		Capture	Illumina GAIIx	4	57548776	A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	ENST00000403906.3	37	CCDS12851.1	SNP	31	WashU																																																																																				0.438	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		Silent
LILRB4	11006	genome.wustl.edu	37	19	55175798	55175798	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:55175798G>A	ENST00000391736.1	+	6	832	c.517G>A	c.(517-519)Gct>Act	p.A173T	LILRB4_ENST00000270452.2_Missense_Mutation_p.A173T|LILRB4_ENST00000430952.2_Missense_Mutation_p.A173T|LILRB4_ENST00000391734.3_Missense_Mutation_p.A173T|LILRB4_ENST00000391733.3_Missense_Mutation_p.A173T	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	173	Ig-like C2-type 2.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.A173T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		AGAGCACGGAGCTCAGCAGCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											104.0	91.0	95.0					19																	55175798		2203	4300	6503	59867610	SO:0001583	missense	11006			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.517G>A	19.37:g.55175798G>A	ENSP00000375616:p.Ala173Thr	Somatic		Capture	Illumina GAIIx	4	59867610	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	2.960	-0.214785	0.06101	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00695	5.83;5.83;5.83;5.83;5.83;5.83	1.93	-3.85	0.04243	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00637	0.0021	L	0.41824	1.3	0.09310	N	1	B;B;B;B;B	0.25272	0.055;0.039;0.122;0.056;0.011	B;B;B;B;B	0.28465	0.037;0.039;0.09;0.015;0.026	T	0.47674	-0.9099	9	0.12103	T	0.63	.	0.9886	0.01451	0.1406:0.2848:0.2033:0.3713	.	173;173;173;173;173	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	T	173	ENSP00000375616:A173T;ENSP00000270452:A173T;ENSP00000408995:A173T;ENSP00000375614:A173T;ENSP00000375613:A173T;ENSP00000401962:A173T	ENSP00000270452:A173T	A	+	1	0	LILRB4	59867610	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.236000	0.01201	-2.387000	0.00589	-0.719000	0.03609	GCT		0.592	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			Missense_Mutation
SS18L1	26039	genome.wustl.edu	37	20	60740531	60740531	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr20:60740531C>T	ENST00000331758.3	+	8	903	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W	SS18L1_ENST00000421564.1_Missense_Mutation_p.R293W|SS18L1_ENST00000370848.4_Missense_Mutation_p.R296W	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	293	Gln-rich.|MFD domain. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)		p.R293W(1)	SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			GAGCTACGACCGGTCCTTCGA	0.617			T	SSX1	synovial sarcoma																																		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	1	Substitution - Missense(1)	ovary(1)	20											78.0	58.0	64.0					20																	60740531		2203	4300	6503	60173926	SO:0001583	missense	26039			AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.877C>T	20.37:g.60740531C>T	ENSP00000333012:p.Arg293Trp	Somatic		Capture	Illumina GAIIx	4	60173926	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Missense_Mutation	SNP	ENST00000331758.3	37	CCDS13491.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653949	0.47362	.	.	ENSG00000184402	ENST00000421564;ENST00000331758;ENST00000370848	T;T;T	0.37915	1.17;1.17;1.2	5.09	1.56	0.23342	.	0.053577	0.64402	D	0.000002	T	0.55386	0.1917	L	0.59436	1.845	0.35417	D	0.792929	D;D	0.89917	1.0;1.0	D;D	0.87578	0.965;0.998	T	0.70029	-0.4984	10	0.87932	D	0	-51.9805	16.4383	0.83889	0.4049:0.5951:0.0:0.0	.	293;293	B4DSR7;O75177	.;CREST_HUMAN	W	293;293;296	ENSP00000393999:R293W;ENSP00000333012:R293W;ENSP00000359885:R296W	ENSP00000333012:R293W	R	+	1	2	SS18L1	60173926	0.992000	0.36948	0.932000	0.37286	0.186000	0.23388	1.432000	0.34936	0.514000	0.28300	0.313000	0.20887	CGG		0.617	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2			Missense_Mutation
PGA3	643834	genome.wustl.edu	37	11	60971723	60971723	+	Silent	SNP	C	C	A	rs527696591	byFrequency	TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:60971723C>A	ENST00000325558.6	+	2	386	c.201C>A	c.(199-201)ccC>ccA	p.P67P		NM_001079807.1	NP_001073275.1	P0DJD8	PEPA3_HUMAN	pepsinogen 3, group I (pepsinogen A)	67					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.P67P(1)		endometrium(1)|lung(1)|ovary(1)|skin(2)	5						ATGAACAGCCCCTGGAGAACT	0.602													C|||	4	0.000798722	0.003	0.0	5008	,	,		20048	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11											64.0	72.0	69.0					11																	60971723		1901	3872	5773	60728299	SO:0001819	synonymous_variant	643834			AL832946	CCDS31574.1	11q13	2006-12-13			ENSG00000229859	ENSG00000229859	3.4.23.1		8885	protein-coding gene	gene with protein product		169710				6300126	Standard	NM_001079807		Approved		uc001nqx.3	P0DJD8	OTTHUMG00000168071	ENST00000325558.6:c.201C>A	11.37:g.60971723C>A		Somatic		Capture	Illumina GAIIx	4	60728299	A8K749|B2R7D6|B7ZW75|P00790|Q7M4R0|Q8N1E3	Silent	SNP	ENST00000325558.6	37	CCDS31574.1	SNP	22	WashU																																																																																				0.602	PGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397955.2	NM_001079807		Silent
CDH19	28513	genome.wustl.edu	37	18	64178858	64178858	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:64178858T>A	ENST00000262150.2	-	10	1815	c.1523A>T	c.(1522-1524)aAt>aTt	p.N508I	CDH19_ENST00000540086.1_Intron	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	1778	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N508I(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TACAGATAGATTAAAGTAAAA	0.308																																																1	Substitution - Missense(1)	ovary(1)	18											85.0	86.0	86.0					18																	64178858		2202	4296	6498	62329838	SO:0001583	missense	28513			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1523A>T	18.37:g.64178858T>A	ENSP00000262150:p.Asn508Ile	Somatic		Capture	Illumina GAIIx	4	62329838	O15098	Missense_Mutation	SNP	ENST00000262150.2	37	CCDS11994.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	5.641	0.302872	0.10678	.	.	ENSG00000071991	ENST00000262150	T	0.37411	1.2	5.03	3.85	0.44370	Cadherin (4);Cadherin-like (1);	0.301936	0.35838	N	0.002957	T	0.31949	0.0813	L	0.36672	1.1	0.29044	N	0.884924	B	0.33044	0.395	B	0.41571	0.36	T	0.28839	-1.0031	10	0.59425	D	0.04	.	6.5221	0.22281	0.0:0.0781:0.3009:0.621	.	508	Q9H159	CAD19_HUMAN	I	508	ENSP00000262150:N508I	ENSP00000262150:N508I	N	-	2	0	CDH19	62329838	0.670000	0.27512	0.235000	0.24058	0.575000	0.36095	0.805000	0.27112	1.020000	0.39573	0.477000	0.44152	AAT		0.308	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153		Missense_Mutation
THOC7	80145	genome.wustl.edu	37	3	63820831	63820831	+	Splice_Site	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:63820831T>A	ENST00000295899.5	-	7	658	c.546A>T	c.(544-546)gaA>gaT	p.E182D	THOC7_ENST00000498422.1_5'Flank|C3orf49_ENST00000295896.8_Intron	NM_025075.2	NP_079351.2	Q6I9Y2	THOC7_HUMAN	THO complex 7 homolog (Drosophila)	182	Interaction with NIF3L1.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.E182D(1)		central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4				BRCA - Breast invasive adenocarcinoma(55;0.000439)|Kidney(15;0.00194)|KIRC - Kidney renal clear cell carcinoma(15;0.00218)		TCTACTTACTTTCCAATGTTT	0.328																																					Colon(48;665 1127 6720 18651)											1	Substitution - Missense(1)	ovary(1)	3											59.0	61.0	60.0					3																	63820831		2203	4299	6502	63795871	SO:0001630	splice_region_variant	80145			BC020599	CCDS2900.1, CCDS74957.1	3p14.1	2013-02-11			ENSG00000163634	ENSG00000163634		"""THO complex subunits"""	29874	protein-coding gene	gene with protein product	"""Ngg1 interacting factor 3 like 1 binding protein 1"", ""functional spliceosome-associated protein 24"""	611965				12951069	Standard	NM_001285404		Approved	NIF3L1BP1, FLJ23445, fSAP24	uc003dlt.4	Q6I9Y2	OTTHUMG00000158767	ENST00000295899.5:c.547+1A>T	3.37:g.63820831T>A		Somatic		Capture	Illumina GAIIx	4	63795871	Q6P1L3|Q8WUF2|Q9H5H0	Missense_Mutation	SNP	ENST00000295899.5	37	CCDS2900.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	11.64	1.698838	0.30142	.	.	ENSG00000163634	ENST00000295899	.	.	.	5.74	4.59	0.56863	.	0.087720	0.85682	D	0.000000	T	0.28167	0.0695	N	0.10945	0.07	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.07083	-1.0791	9	0.09843	T	0.71	-38.2729	8.5602	0.33505	0.0:0.1573:0.0:0.8427	.	182	Q6I9Y2	THOC7_HUMAN	D	182	.	ENSP00000295899:E182D	E	-	3	2	THOC7	63795871	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.601000	0.36773	1.014000	0.39417	0.455000	0.32223	GAA		0.328	THOC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352096.1	NM_025075	Missense_Mutation	Missense_Mutation
DIS3L	115752	genome.wustl.edu	37	15	66618704	66618704	+	Splice_Site	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:66618704T>G	ENST00000319212.4	+	12	2251		c.e12+2		DIS3L_ENST00000319194.5_Splice_Site|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease						RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.?(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AGATACACGGTATTCCTCTTT	0.458																																																1	Unknown(1)	ovary(1)	15											29.0	31.0	30.0					15																	66618704		2183	4281	6464	64405758	SO:0001630	splice_region_variant	115752				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2201+2T>G	15.37:g.66618704T>G		Somatic		Capture	Illumina GAIIx	4	64405758	Q8N1N8|Q8WTU9|Q96CM7	Splice_Site_SNP	SNP	ENST00000319212.4	37	CCDS45286.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	16.43	3.122421	0.56613	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.814	0.63281	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DIS3L	64405758	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	6.238000	0.72350	2.029000	0.59856	0.379000	0.24179	.		0.458	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	Intron	Splice_Site_SNP
GPX2	2877	genome.wustl.edu	37	14	65406266	65406266	+	Silent	SNP	G	G	C	rs527885375		TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr14:65406266G>C	ENST00000389614.5	-	2	599	c.513C>G	c.(511-513)cgC>cgG	p.R171R	FNTB_ENST00000447296.2_Intron|FNTB_ENST00000542227.1_Intron|CHURC1-FNTB_ENST00000549987.1_Intron	NM_002083.3	NP_002074.2	P18283	GPX2_HUMAN	glutathione peroxidase 2 (gastrointestinal)	171					interaction with symbiont (GO:0051702)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|response to oxidative stress (GO:0006979)|response to symbiotic bacterium (GO:0009609)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|glutathione peroxidase activity (GO:0004602)	p.R171R(1)		large_intestine(2)|ovary(1)|skin(1)	4				all cancers(60;0.00117)|OV - Ovarian serous cystadenocarcinoma(108;0.00557)|BRCA - Breast invasive adenocarcinoma(234;0.00971)	Glutathione(DB00143)	TTGGGAAGGTGCGGCTGTAGC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	14											157.0	153.0	154.0					14																	65406266		2001	4171	6172	64476019	SO:0001819	synonymous_variant	2877				CCDS41964.1	14q23.3	2012-05-22			ENSG00000176153	ENSG00000176153	1.11.1.9		4554	protein-coding gene	gene with protein product		138319				8428933, 8287691	Standard	NM_002083		Approved	GSHPX-GI	uc021ruq.2	P18283	OTTHUMG00000171677	ENST00000389614.5:c.513C>G	14.37:g.65406266G>C		Somatic		Capture	Illumina GAIIx	4	64476019	Q6PJ52|Q8WWI7|Q9NRP9	Silent	SNP	ENST00000389614.5	37	CCDS41964.1	SNP	46	WashU																																																																																				0.537	GPX2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000414708.1			Silent
Unknown	0	genome.wustl.edu	37	9	69067903	69067903	+	IGR	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr9:69067903A>G								MIR1299 (65582 upstream) : PGM5P2 (12336 downstream)																							aaaagagaagatgaagaaACC	0.279																																																0			9																																								68357723	SO:0001628	intergenic_variant																																9.37:g.69067903A>G		Somatic		Capture	Illumina GAIIx	4	68357723		Missense_Mutation	SNP		37		SNP	12	WashU																																																																																			0	0.279									Missense_Mutation
DCAF5	8816	genome.wustl.edu	37	14	69521948	69521948	+	Silent	SNP	G	G	T	rs144184761		TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr14:69521948G>T	ENST00000341516.5	-	9	1602	c.1455C>A	c.(1453-1455)ccC>ccA	p.P485P	DCAF5_ENST00000556847.1_Silent_p.P403P|DCAF5_ENST00000554215.1_Silent_p.P403P|DCAF5_ENST00000553293.1_5'UTR|DCAF5_ENST00000557386.1_Silent_p.P484P	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	485					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.P485P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TGACCCGCAGGGGCCCCAGGT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	14											37.0	38.0	38.0					14																	69521948		2203	4300	6503	68591701	SO:0001819	synonymous_variant	8816			AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1455C>A	14.37:g.69521948G>T		Somatic		Capture	Illumina GAIIx	4	68591701	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	ENST00000341516.5	37	CCDS32106.1	SNP	43	WashU																																																																																				0.627	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861		Silent
MED12	9968	genome.wustl.edu	37	X	70352803	70352803	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:70352803C>G	ENST00000374080.3	+	32	4556	c.4524C>G	c.(4522-4524)caC>caG	p.H1508Q	MED12_ENST00000333646.6_Missense_Mutation_p.H1508Q|MED12_ENST00000374102.1_Missense_Mutation_p.H1508Q			Q93074	MED12_HUMAN	mediator complex subunit 12	1508					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCCAGGTGCACCAGGTACAGA	0.522			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0			X											36.0	33.0	34.0					X																	70352803		2002	4155	6157	70269528	SO:0001583	missense	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4524C>G	X.37:g.70352803C>G	ENSP00000363193:p.His1508Gln	Somatic		Capture	Illumina GAIIx	4	70269528	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444192	0.25987	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	T;T;T;T;T	0.62105	0.73;0.05;0.73;0.05;1.85	4.61	4.61	0.57282	.	0.176785	0.51477	D	0.000082	T	0.20861	0.0502	N	0.00230	-1.795	0.54753	D	0.999982	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.29941	-0.9995	10	0.09843	T	0.71	-9.18	7.5366	0.27714	0.1538:0.6024:0.2438:0.0	.	1508;1355;1508;1508	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Q	1508;1508;1508;1508;1476;253	ENSP00000333125:H1508Q;ENSP00000363215:H1508Q;ENSP00000363193:H1508Q;ENSP00000414203:H1476Q;ENSP00000408388:H253Q	ENSP00000333125:H1508Q	H	+	3	2	MED12	70269528	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.403000	0.44530	2.279000	0.76181	0.476000	0.43555	CAC		0.522	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120		Missense_Mutation
LRRC7	57554	genome.wustl.edu	37	1	70518803	70518803	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:70518803T>A	ENST00000035383.5	+	21	4121	c.4091T>A	c.(4090-4092)gTa>gAa	p.V1364E	LRRC7_ENST00000310961.5_Missense_Mutation_p.V1322E|LRRC7_ENST00000415775.2_Missense_Mutation_p.V648E	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1364						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.V1364E(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGGCGGGATGTACCTCCGGAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	84.0	85.0					1																	70518803		2203	4300	6503	70291391	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.4091T>A	1.37:g.70518803T>A	ENSP00000035383:p.Val1364Glu	Somatic		Capture	Illumina GAIIx	4	70291391	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560227	0.86335	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.53857	0.6;0.81;1.92	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	L	0.29908	0.895	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.994;0.987	T	0.57676	-0.7770	10	0.49607	T	0.09	.	14.9102	0.70752	0.0:0.0:0.0:1.0	.	648;1317;1364	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	E	1322;1364;648;1140	ENSP00000309245:V1322E;ENSP00000035383:V1364E;ENSP00000394867:V648E	ENSP00000035383:V1364E	V	+	2	0	LRRC7	70291391	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.742000	0.74843	2.114000	0.64651	0.533000	0.62120	GTA		0.398	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		Missense_Mutation
PMFBP1	83449	genome.wustl.edu	37	16	72174374	72174374	+	Silent	SNP	C	C	T	rs267604630		TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:72174374C>T	ENST00000237353.10	-	6	1005	c.744G>A	c.(742-744)aaG>aaA	p.K248K	PMFBP1_ENST00000355636.6_Silent_p.K103K|PMFBP1_ENST00000537465.1_Silent_p.K248K	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	248						cytoplasm (GO:0005737)		p.K248K(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				GTTGAGAGACCTTTTGCCAGA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	16											281.0	267.0	272.0					16																	72174374		2198	4300	6498	70731875	SO:0001819	synonymous_variant	83449			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.744G>A	16.37:g.72174374C>T		Somatic		Capture	Illumina GAIIx	4	70731875	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	ENST00000237353.10	37	CCDS32483.1	SNP	24	WashU																																																																																				0.448	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293		Silent
DHCR7	1717	genome.wustl.edu	37	11	71153317	71153317	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:71153317G>A	ENST00000355527.3	-	5	680	c.404C>T	c.(403-405)aCt>aTt	p.T135I	DHCR7_ENST00000407721.2_Missense_Mutation_p.T135I	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	135					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)	p.T135I(1)		endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						ACCTGCAGGAGTCACGGCCCC	0.597									Smith-Lemli-Opitz syndrome																																							1	Substitution - Missense(1)	ovary(1)	11											70.0	68.0	69.0					11																	71153317		2200	4294	6494	70830965	SO:0001583	missense	1717	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.404C>T	11.37:g.71153317G>A	ENSP00000347717:p.Thr135Ile	Somatic		Capture	Illumina GAIIx	4	70830965	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	37	CCDS8200.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650474	0.47362	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000524694;ENST00000527316;ENST00000526780	D;D;D;D	0.98192	-4.5;-4.5;-4.5;-4.78	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	D	0.98604	0.9533	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98750	1.0720	10	0.48119	T	0.1	-21.3587	13.7437	0.62862	0.0:0.0:1.0:0.0	.	135	Q9UBM7	DHCR7_HUMAN	I	135;135;147;103;135	ENSP00000384739:T135I;ENSP00000347717:T135I;ENSP00000435047:T103I;ENSP00000435668:T135I	ENSP00000347717:T135I	T	-	2	0	DHCR7	70830965	1.000000	0.71417	0.229000	0.23960	0.110000	0.19582	7.887000	0.87295	1.872000	0.54250	0.448000	0.29417	ACT		0.597	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360		Missense_Mutation
FOLR1	2348	genome.wustl.edu	37	11	71907018	71907018	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:71907018G>A	ENST00000393679.1	+	5	1007	c.571G>A	c.(571-573)Gaa>Aaa	p.E191K	RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Missense_Mutation_p.E191K|FOLR1_ENST00000393676.3_Missense_Mutation_p.E191K|FOLR1_ENST00000312293.4_Missense_Mutation_p.E191K			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	191					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.E191K(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	TCTGTGCAATGAAATCTGGAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											101.0	94.0	96.0					11																	71907018		2200	4293	6493	71584666	SO:0001583	missense	2348			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.571G>A	11.37:g.71907018G>A	ENSP00000377284:p.Glu191Lys	Somatic		Capture	Illumina GAIIx	4	71584666	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Missense_Mutation	SNP	ENST00000393679.1	37	CCDS8211.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	g	0.948	-0.707191	0.03230	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	4.11	-0.108	0.13588	Folate receptor-like (1);	0.544875	0.20145	N	0.098295	T	0.48390	0.1497	N	0.12527	0.23	0.28755	N	0.901239	B	0.06786	0.001	B	0.14023	0.01	T	0.38993	-0.9635	10	0.02654	T	1	-29.4964	3.711	0.08420	0.4091:0.188:0.4029:0.0	.	191	P15328	FOLR1_HUMAN	K	191	ENSP00000308137:E191K;ENSP00000377286:E191K;ENSP00000377284:E191K;ENSP00000377281:E191K	ENSP00000308137:E191K	E	+	1	0	FOLR1	71584666	0.252000	0.23972	0.785000	0.31869	0.479000	0.33129	0.181000	0.16880	0.098000	0.17522	0.563000	0.77884	GAA		0.552	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725		Missense_Mutation
ZNF236	7776	genome.wustl.edu	37	18	74580656	74580656	+	Nonsense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:74580656G>T	ENST00000253159.8	+	4	571	c.373G>T	c.(373-375)Gag>Tag	p.E125*	ZNF236_ENST00000320610.9_Nonsense_Mutation_p.E127*|ZNF236_ENST00000583095.1_3'UTR	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	125					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CATCTGTTCTGAGTGTGGGGA	0.527																																																0			18											157.0	166.0	163.0					18																	74580656		2046	4219	6265	72709644	SO:0001587	stop_gained	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.373G>T	18.37:g.74580656G>T	ENSP00000253159:p.Glu125*	Somatic		Capture	Illumina GAIIx	4	72709644	B2RTX9|Q9UL37	Nonsense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	39	7.664667	0.98419	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.6229	0.95667	0.0:0.0:1.0:0.0	.	.	.	.	X	125	.	ENSP00000253159:E125X	E	+	1	0	ZNF236	72709644	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	9.496000	0.97967	2.628000	0.89032	0.655000	0.94253	GAG		0.527	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			Nonsense_Mutation
KCNQ5	56479	genome.wustl.edu	37	6	73821052	73821052	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:73821052G>C	ENST00000370398.1	+	7	1160	c.1051G>C	c.(1051-1053)Gca>Cca	p.A351P	KCNQ5_ENST00000355635.3_Missense_Mutation_p.A351P|KCNQ5_ENST00000355194.4_Missense_Mutation_p.A351P|KCNQ5_ENST00000414165.2_Missense_Mutation_p.A351P|KCNQ5_ENST00000370392.1_Missense_Mutation_p.A351P|KCNQ5_ENST00000403813.2_Missense_Mutation_p.A351P|KCNQ5_ENST00000402622.2_Missense_Mutation_p.A351P|KCNQ5_ENST00000342056.2_Missense_Mutation_p.A351P	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	351					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.A351P(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CTCAGGTTTTGCATTAAAAGT	0.348																																					GBM(142;1375 1859 14391 23261 44706)											1	Substitution - Missense(1)	ovary(1)	6											158.0	149.0	152.0					6																	73821052		2203	4300	6503	73877773	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1051G>C	6.37:g.73821052G>C	ENSP00000359425:p.Ala351Pro	Somatic		Capture	Illumina GAIIx	4	73877773	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.060555	0.93846	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44;-4.44	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.98305	0.9438	M	0.78637	2.42	0.80722	D	1	D;P;D;D;P;D	0.76494	0.999;0.95;0.969;0.982;0.917;0.995	D;P;P;D;B;D	0.78314	0.988;0.618;0.75;0.948;0.414;0.991	D	0.99349	1.0914	10	0.87932	D	0	.	18.9561	0.92659	0.0:0.0:1.0:0.0	.	351;351;351;351;351;351	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	P	351	ENSP00000345055:A351P;ENSP00000347326:A351P;ENSP00000359425:A351P;ENSP00000359419:A351P;ENSP00000385501:A351P;ENSP00000347853:A351P;ENSP00000384453:A351P;ENSP00000409861:A351P	ENSP00000345055:A351P	A	+	1	0	KCNQ5	73877773	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.697000	0.98697	2.552000	0.86080	0.561000	0.74099	GCA		0.348	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842		Missense_Mutation
MTO1	25821	genome.wustl.edu	37	6	74183286	74183286	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:74183286A>G	ENST00000370300.4	+	4	824	c.734A>G	c.(733-735)aAa>aGa	p.K245R	MTO1_ENST00000415954.2_Missense_Mutation_p.K245R|MTO1_ENST00000498286.1_Missense_Mutation_p.K245R|MTO1_ENST00000370305.1_Missense_Mutation_p.K171R	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	245					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)	p.K245R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						CGAATTGCCAAAGAGTCCATT	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											123.0	114.0	117.0					6																	74183286		2203	4300	6503	74240007	SO:0001583	missense	25821			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.734A>G	6.37:g.74183286A>G	ENSP00000359323:p.Lys245Arg	Somatic		Capture	Illumina GAIIx	4	74240007	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	ENST00000370300.4	37	CCDS4979.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	16.67	3.186637	0.57909	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000370305;ENST00000370300	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.7	4.53	0.55603	.	0.048245	0.85682	D	0.000000	T	0.64249	0.2581	L	0.38733	1.17	0.54753	D	0.999988	B;B;B	0.29481	0.245;0.086;0.179	B;B;B	0.40477	0.222;0.162;0.33	T	0.69892	-0.5022	10	0.59425	D	0.04	-23.446	10.54	0.45026	0.9252:0.0:0.0748:0.0	.	245;245;245	Q9Y2Z2-6;Q9Y2Z2-4;Q9Y2Z2	.;.;MTO1_HUMAN	R	245;245;171;245	ENSP00000402038:K245R;ENSP00000419561:K245R;ENSP00000359328:K171R;ENSP00000359323:K245R	ENSP00000359323:K245R	K	+	2	0	MTO1	74240007	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	4.570000	0.60872	2.165000	0.68154	0.496000	0.49642	AAA		0.438	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	NM_012123		Missense_Mutation
COL12A1	1303	genome.wustl.edu	37	6	75843691	75843691	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:75843691G>C	ENST00000322507.8	-	33	5856	c.5547C>G	c.(5545-5547)aaC>aaG	p.N1849K	COL12A1_ENST00000416123.2_Missense_Mutation_p.N1849K|COL12A1_ENST00000483888.2_Missense_Mutation_p.N1849K|COL12A1_ENST00000345356.6_Missense_Mutation_p.N685K	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1849	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.N1849K(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACACTCTCAGGTTCCTTACAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	100.0	103.0					6																	75843691		1960	4157	6117	75900411	SO:0001583	missense	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5547C>G	6.37:g.75843691G>C	ENSP00000325146:p.Asn1849Lys	Somatic		Capture	Illumina GAIIx	4	75900411	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	SNP	44	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.85|18.85	3.711465|3.711465	0.68730|0.68730	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	T;T;T;T|.	0.61274|.	0.12;0.12;0.12;0.12|.	5.95|5.95	4.17|4.17	0.49024|0.49024	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67487|0.67487	0.2898|0.2898	M|M	0.87038|0.87038	2.855|2.855	0.47819|0.47819	D|D	0.999528|0.999528	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	T|T	0.71090|0.71090	-0.4693|-0.4693	10|5	0.87932|.	D|.	0|.	.|.	9.269|9.269	0.37659|0.37659	0.2191:0.0:0.7809:0.0|0.2191:0.0:0.7809:0.0	.|.	685;1849|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	K|A	1849;1849;685;1849;1849|584	ENSP00000325146:N1849K;ENSP00000305147:N685K;ENSP00000412864:N1849K;ENSP00000421216:N1849K|.	ENSP00000325146:N1849K|.	N|P	-|-	3|1	2|0	COL12A1|COL12A1	75900411|75900411	1.000000|1.000000	0.71417|0.71417	0.751000|0.751000	0.31187|0.31187	0.918000|0.918000	0.54935|0.54935	3.919000|3.919000	0.56439|0.56439	0.844000|0.844000	0.35094|0.35094	-0.136000|-0.136000	0.14681|0.14681	AAC|CCT		0.458	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		Missense_Mutation
FRAS1	80144	genome.wustl.edu	37	4	79295373	79295373	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:79295373A>T	ENST00000325942.6	+	25	3559	c.3119A>T	c.(3118-3120)tAc>tTc	p.Y1040F	FRAS1_ENST00000264895.6_Missense_Mutation_p.Y1040F	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1040					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.Y1040F(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GGGAAGGGGTACTTTGCAGAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	4											123.0	122.0	123.0					4																	79295373		1952	4166	6118	79514397	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.3119A>T	4.37:g.79295373A>T	ENSP00000326330:p.Tyr1040Phe	Somatic		Capture	Illumina GAIIx	4	79514397	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	8.100	0.776506	0.16120	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	D;D	0.89270	-2.49;-2.49	5.94	2.23	0.28157	.	0.274565	0.36591	N	0.002502	T	0.81927	0.4926	L	0.52364	1.645	0.80722	D	1	B;B	0.14805	0.011;0.002	B;B	0.14578	0.011;0.006	T	0.69957	-0.5004	10	0.22109	T	0.4	.	5.8504	0.18689	0.7392:0.0:0.1362:0.1246	.	1040;1040	E9PHH6;A2RRR8	.;.	F	1040	ENSP00000326330:Y1040F;ENSP00000264895:Y1040F	ENSP00000264895:Y1040F	Y	+	2	0	FRAS1	79514397	1.000000	0.71417	0.807000	0.32361	0.002000	0.02628	5.310000	0.65780	0.490000	0.27771	0.528000	0.53228	TAC		0.507	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2			Missense_Mutation
BTBD1	53339	genome.wustl.edu	37	15	83725179	83725179	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:83725179G>C	ENST00000261721.4	-	2	722	c.520C>G	c.(520-522)Cat>Gat	p.H174D	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.H174D|RP11-382A20.6_ENST00000568441.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	174					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)		p.H174D(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		GCCCTAAGATGTTTGGTGAGA	0.363																																																1	Substitution - Missense(1)	ovary(1)	15											115.0	100.0	105.0					15																	83725179		2203	4300	6503	81516183	SO:0001583	missense	53339			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.520C>G	15.37:g.83725179G>C	ENSP00000261721:p.His174Asp	Somatic		Capture	Illumina GAIIx	4	81516183	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	ENST00000261721.4	37	CCDS10322.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972820	0.34848	.	.	ENSG00000064726	ENST00000261721;ENST00000379403	T;T	0.66815	-0.23;-0.23	5.92	5.92	0.95590	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	N	0.14661	0.345	0.58432	D	0.999997	B;B	0.19445	0.036;0.036	B;B	0.29440	0.102;0.102	T	0.51092	-0.8749	10	0.41790	T	0.15	-20.3638	20.3172	0.98658	0.0:0.0:1.0:0.0	.	174;174	A6NMI8;Q9H0C5	.;BTBD1_HUMAN	D	174	ENSP00000261721:H174D;ENSP00000368713:H174D	ENSP00000261721:H174D	H	-	1	0	BTBD1	81516183	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.020000	0.70826	2.801000	0.96364	0.650000	0.86243	CAT		0.363	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1			Missense_Mutation
PDE8A	5151	genome.wustl.edu	37	15	85610364	85610364	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:85610364G>A	ENST00000310298.4	+	4	615	c.363G>A	c.(361-363)ctG>ctA	p.L121L	PDE8A_ENST00000394553.1_Silent_p.L121L|PDE8A_ENST00000557819.2_3'UTR|PDE8A_ENST00000557957.1_Silent_p.L49L|PDE8A_ENST00000339708.5_Silent_p.L121L			O60658	PDE8A_HUMAN	phosphodiesterase 8A	121					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.L121L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	CCTGTTTCCTGGACAAACATC	0.468																																																1	Substitution - coding silent(1)	ovary(1)	15											159.0	133.0	142.0					15																	85610364		2203	4299	6502	83411368	SO:0001819	synonymous_variant	5151			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.363G>A	15.37:g.85610364G>A		Somatic		Capture	Illumina GAIIx	4	83411368	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	ENST00000310298.4	37	CCDS10336.1	SNP	47	WashU																																																																																				0.468	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605		Silent
SNAP91	9892	genome.wustl.edu	37	6	84270597	84270597	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:84270597C>A	ENST00000439399.2	-	27	2828	c.2512G>T	c.(2512-2514)Gca>Tca	p.A838S	SNAP91_ENST00000520213.1_Missense_Mutation_p.A531S|SNAP91_ENST00000521485.1_Missense_Mutation_p.A833S|SNAP91_ENST00000428679.2_Missense_Mutation_p.A838S|SNAP91_ENST00000437520.1_Missense_Mutation_p.A531S|SNAP91_ENST00000520302.1_Missense_Mutation_p.A808S|SNAP91_ENST00000195649.6_Missense_Mutation_p.A833S|SNAP91_ENST00000369694.2_Missense_Mutation_p.A838S|SNAP91_ENST00000521743.1_Missense_Mutation_p.A838S	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	838	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)	p.A838S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		CCAAATCCTGCTCCAGGTTGT	0.418																																																1	Substitution - Missense(1)	ovary(1)	6											45.0	45.0	45.0					6																	84270597		1936	4142	6078	84327316	SO:0001583	missense	9892			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2512G>T	6.37:g.84270597C>A	ENSP00000400459:p.Ala838Ser	Somatic		Capture	Illumina GAIIx	4	84327316	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	37	CCDS47455.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293232	0.23564	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	T;T;T;T;T;T;T;T;T;T	0.24908	2.38;2.38;2.38;2.38;2.38;2.39;2.38;2.38;2.39;1.83	5.64	-2.81	0.05805	.	0.515863	0.23404	N	0.048547	T	0.08133	0.0203	L	0.54323	1.7	0.21355	N	0.999718	B;P;P;P;P	0.45715	0.005;0.865;0.787;0.787;0.787	B;B;B;B;B	0.43754	0.007;0.43;0.351;0.404;0.332	T	0.41998	-0.9477	10	0.15952	T	0.53	0.0343	7.7292	0.28777	0.0:0.4159:0.1866:0.3975	.	714;531;808;838;836	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	S	833;838;838;833;838;531;808;838;531;179	ENSP00000429776:A833S;ENSP00000358708:A838S;ENSP00000400459:A838S;ENSP00000195649:A833S;ENSP00000412492:A838S;ENSP00000413277:A531S;ENSP00000428511:A808S;ENSP00000428215:A838S;ENSP00000428026:A531S;ENSP00000430255:A179S	ENSP00000195649:A833S	A	-	1	0	SNAP91	84327316	0.748000	0.28294	0.949000	0.38748	0.175000	0.22909	-0.422000	0.07043	-0.474000	0.06862	-0.315000	0.08773	GCA		0.418	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1			Missense_Mutation
CEP290	80184	genome.wustl.edu	37	12	88454656	88454656	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:88454656A>G	ENST00000552810.1	-	47	6816	c.6473T>C	c.(6472-6474)tTg>tCg	p.L2158S	CEP290_ENST00000309041.7_Missense_Mutation_p.L2160S|CEP290_ENST00000547691.2_Missense_Mutation_p.L1218S|CEP290_ENST00000397838.3_Missense_Mutation_p.L1218S	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	2158					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.L2160S(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTCACTAGTCAATATTCCTGA	0.289																																																1	Substitution - Missense(1)	ovary(1)	12											87.0	70.0	75.0					12																	88454656		1776	4045	5821	86978787	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.6473T>C	12.37:g.88454656A>G	ENSP00000448012:p.Leu2158Ser	Somatic		Capture	Illumina GAIIx	4	86978787	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669278	0.47677	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.65364	0.43;-0.15;-0.15;0.43	6.03	6.03	0.97812	.	0.382752	0.25968	N	0.027151	T	0.51024	0.1650	L	0.44542	1.39	0.28085	N	0.932025	P	0.43352	0.804	B	0.36464	0.225	T	0.51671	-0.8676	10	0.09084	T	0.74	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	2158	O15078	CE290_HUMAN	S	1218;2158;2160;1218	ENSP00000446905:L1218S;ENSP00000448012:L2158S;ENSP00000308021:L2160S;ENSP00000380938:L1218S	ENSP00000308021:L2160S	L	-	2	0	CEP290	86978787	0.937000	0.31787	0.998000	0.56505	0.995000	0.86356	3.390000	0.52523	2.308000	0.77769	0.533000	0.62120	TTG		0.289	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114		Missense_Mutation
LDB3	11155	genome.wustl.edu	37	10	88451686	88451686	+	Silent	SNP	C	C	T	rs200580597		TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:88451686C>T	ENST00000361373.4	+	5	744	c.723C>T	c.(721-723)agC>agT	p.S241S	LDB3_ENST00000310944.6_Silent_p.S241S|LDB3_ENST00000429277.2_Silent_p.S309S|LDB3_ENST00000542786.1_3'UTR|LDB3_ENST00000263066.6_Silent_p.S194S|LDB3_ENST00000458213.2_Silent_p.S194S|LDB3_ENST00000372066.3_Silent_p.S194S|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000372056.4_Silent_p.S309S	NM_007078.2	NP_009009.1			LIM domain binding 3									p.S241S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						CCGTAGACAGCGCCTCTCCCG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	10						C	,,,,,	0,4406		0,0,2203	135.0	125.0	129.0		582,723,582,927,927,723	-2.8	0.9	10		129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LDB3	NM_001080114.1,NM_001080115.1,NM_001080116.1,NM_001171610.1,NM_001171611.1,NM_007078.2	,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	194/618,241/331,194/284,309/733,309/399,241/728	88451686	1,13005	2203	4300	6503	88441666	SO:0001819	synonymous_variant	11155			AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.723C>T	10.37:g.88451686C>T		Somatic		Capture	Illumina GAIIx	4	88441666		Silent	SNP	ENST00000361373.4	37	CCDS7377.1	SNP	27	WashU																																																																																				0.612	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2			Silent
MAN2A2	4122	genome.wustl.edu	37	15	91450062	91450062	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:91450062C>G	ENST00000559717.1	+	7	1387	c.928C>G	c.(928-930)Ctg>Gtg	p.L310V	MAN2A2_ENST00000360468.3_Missense_Mutation_p.L310V|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	310					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.L310V(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CACCAGCATGCTGATTCAGAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											86.0	76.0	79.0					15																	91450062		2198	4298	6496	89251066	SO:0001583	missense	4122			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.928C>G	15.37:g.91450062C>G	ENSP00000452948:p.Leu310Val	Somatic		Capture	Illumina GAIIx	4	89251066	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640501	0.47153	.	.	ENSG00000196547	ENST00000360468	T	0.21191	2.02	5.65	2.3	0.28687	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.065425	0.64402	D	0.000014	T	0.18923	0.0454	N	0.25789	0.76	0.80722	D	1	B;B	0.31680	0.258;0.335	B;B	0.43838	0.21;0.433	T	0.07673	-1.0760	10	0.27082	T	0.32	-21.2889	9.0409	0.36316	0.0:0.6766:0.1113:0.2121	.	310;310	P49641-1;P49641	.;MA2A2_HUMAN	V	310	ENSP00000353655:L310V	ENSP00000353655:L310V	L	+	1	2	MAN2A2	89251066	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.564000	0.45931	0.760000	0.33108	0.442000	0.29010	CTG		0.597	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122		Missense_Mutation
IGKV2-28	28921	genome.wustl.edu	37	2	89521419	89521419	+	RNA	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:89521419G>T	ENST00000482769.1	-	0	149									immunoglobulin kappa variable 2-28																		TGCAGGAGATGGAGGCCGGCT	0.507																																																0			2											2.0	2.0	2.0					2																	89521419		871	1945	2816	89302534						X63397		2p11.2	2012-02-08			ENSG00000244116	ENSG00000244116		"""Immunoglobulins / IGK locus"""	5783	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151652		2.37:g.89521419G>T		Somatic		Capture	Illumina GAIIx	4	89302534		Silent	SNP	ENST00000482769.1	37		SNP	47	WashU																																																																																				0.507	IGKV2-28-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323401.1	NG_000834		Silent
PTEN	5728	genome.wustl.edu	37	10	89711905	89711905	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:89711905G>T	ENST00000371953.3	+	6	1880	c.523G>T	c.(523-525)Gtg>Ttg	p.V175L		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	175	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.V166fs*17(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)|p.V175L(1)|p.R172fs*5(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAGGCGCTATGTGTATTATTA	0.353		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	57	Whole gene deletion(37)|Deletion - Frameshift(11)|Unknown(4)|Complex - frameshift(3)|Deletion - In frame(1)|Substitution - Missense(1)	prostate(16)|central_nervous_system(13)|skin(8)|lung(4)|ovary(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|soft_tissue(1)|urinary_tract(1)|kidney(1)	10											135.0	138.0	137.0					10																	89711905		2203	4300	6503	89701885	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.523G>T	10.37:g.89711905G>T	ENSP00000361021:p.Val175Leu	Somatic		Capture	Illumina GAIIx	4	89701885	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	34	5.387647	0.95988	.	.	ENSG00000171862	ENST00000371953	D	0.97114	-4.25	5.74	5.74	0.90152	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.97823	0.9285	L	0.49571	1.57	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.97400	0.9995	9	.	.	.	-2.4965	19.9308	0.97118	0.0:0.0:1.0:0.0	.	175	P60484	PTEN_HUMAN	L	175	ENSP00000361021:V175L	.	V	+	1	0	PTEN	89701885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.370000	0.97159	2.722000	0.93159	0.591000	0.81541	GTG		0.353	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314		Missense_Mutation
KRIT1	889	genome.wustl.edu	37	7	91843286	91843286	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:91843286T>C	ENST00000340022.2	-	16	2756	c.1738A>G	c.(1738-1740)Aat>Gat	p.N580D	KRIT1_ENST00000394503.2_Missense_Mutation_p.N532D|KRIT1_ENST00000394507.1_Missense_Mutation_p.N580D|KRIT1_ENST00000394505.2_Missense_Mutation_p.N580D|KRIT1_ENST00000412043.2_Missense_Mutation_p.N580D	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	580	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.N580D(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GATTTTAGATTTTCTTCACTG	0.338																																																1	Substitution - Missense(1)	ovary(1)	7											170.0	157.0	162.0					7																	91843286		2203	4300	6503	91681222	SO:0001583	missense	889			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1738A>G	7.37:g.91843286T>C	ENSP00000344668:p.Asn580Asp	Somatic		Capture	Illumina GAIIx	4	91681222	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	ENST00000340022.2	37	CCDS5624.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	26.0	4.695881	0.88830	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503	T;T;T;T;D	0.81908	-1.05;-1.05;-1.05;-1.05;-1.55	5.67	5.67	0.87782	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.052357	0.85682	D	0.000000	T	0.81197	0.4772	L	0.39633	1.23	0.80722	D	1	B;P;B	0.38745	0.296;0.645;0.296	B;P;B	0.44623	0.226;0.455;0.226	T	0.78573	-0.2152	10	0.25751	T	0.34	-0.2027	15.9272	0.79628	0.0:0.0:0.0:1.0	.	580;532;580	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	D	580;580;580;580;532	ENSP00000378015:N580D;ENSP00000344668:N580D;ENSP00000410909:N580D;ENSP00000378013:N580D;ENSP00000378011:N532D	ENSP00000344668:N580D	N	-	1	0	KRIT1	91681222	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.015000	0.88690	2.153000	0.67306	0.533000	0.62120	AAT		0.338	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1			Missense_Mutation
SNRPD2P1	119358	genome.wustl.edu	37	10	91738529	91738529	+	IGR	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:91738529G>A								RP11-478K7.2 (21399 upstream) : RN7SKP143 (184878 downstream)														p.R19Q(1)									CTGCAGAAGCGAGAGGAGGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	10																																								91728509	SO:0001628	intergenic_variant	119358																															10.37:g.91738529G>A		Somatic		Capture	Illumina GAIIx	4	91728509		Missense_Mutation	SNP		37		SNP	37	WashU																																																																																			0	0.522									Missense_Mutation
TGFBR3	7049	genome.wustl.edu	37	1	92163675	92163675	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:92163675C>G	ENST00000525962.1	-	14	2361	c.2300G>C	c.(2299-2301)aGc>aCc	p.S767T	TGFBR3_ENST00000212355.4_Missense_Mutation_p.S767T|TGFBR3_ENST00000370399.2_Missense_Mutation_p.S766T			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	767					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S767T(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TTCCTTCATGCTTGGACCTTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	139.0	139.0					1																	92163675		2203	4300	6503	91936263	SO:0001583	missense	7049			L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.2300G>C	1.37:g.92163675C>G	ENSP00000436127:p.Ser767Thr	Somatic		Capture	Illumina GAIIx	4	91936263	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	CCDS30770.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	0.245	-1.010840	0.02095	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.03	-0.618	0.11576	.	0.937473	0.09223	N	0.831683	T	0.07369	0.0186	L	0.44542	1.39	0.20196	N	0.999929	B;B;B	0.25007	0.116;0.095;0.116	B;B;B	0.22386	0.039;0.037;0.036	T	0.35226	-0.9797	10	0.29301	T	0.29	-9.3108	1.8996	0.03264	0.1492:0.3905:0.2918:0.1685	.	767;766;767	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	T	767;766;767;766	ENSP00000212355:S767T;ENSP00000359426:S766T;ENSP00000436127:S767T;ENSP00000432638:S766T	ENSP00000212355:S767T	S	-	2	0	TGFBR3	91936263	0.057000	0.20700	0.498000	0.27564	0.030000	0.12068	0.010000	0.13242	0.211000	0.20683	-0.165000	0.13383	AGC		0.368	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243		Missense_Mutation
CYP2C9	1559	genome.wustl.edu	37	10	96731980	96731980	+	Silent	SNP	G	G	A	rs375193036		TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:96731980G>A	ENST00000260682.6	+	6	951	c.939G>A	c.(937-939)ctG>ctA	p.L313L		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	313					arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)	p.L313L(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCCTTCTCCTGCTGAAGCACC	0.428																																					Ovarian(54;1266 1406 16072 35076)											1	Substitution - coding silent(1)	ovary(1)	10											161.0	150.0	154.0					10																	96731980		2203	4300	6503	96721970	SO:0001819	synonymous_variant	1559			M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.939G>A	10.37:g.96731980G>A		Somatic		Capture	Illumina GAIIx	4	96721970	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Silent	SNP	ENST00000260682.6	37	CCDS7437.1	SNP	46	WashU																																																																																				0.428	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	NM_000771		Silent
EPHA6	285220	genome.wustl.edu	37	3	96706221	96706221	+	Silent	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:96706221A>G	ENST00000389672.5	+	3	536	c.498A>G	c.(496-498)acA>acG	p.T166T	EPHA6_ENST00000542517.1_Silent_p.T72T|EPHA6_ENST00000470610.2_Silent_p.T166T	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	72	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.T72T(2)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CCATTCACACATACCAGGTAT	0.373																																																2	Substitution - coding silent(2)	ovary(2)	3											108.0	104.0	105.0					3																	96706221		1880	4110	5990	98188911	SO:0001819	synonymous_variant	285220			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.498A>G	3.37:g.96706221A>G		Somatic		Capture	Illumina GAIIx	4	98188911	D6RAL5	Silent	SNP	ENST00000389672.5	37	CCDS46876.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	7.841	0.721906	0.15372	.	.	ENSG00000080224	ENST00000506569	.	.	.	5.74	-11.5	0.00074	.	.	.	.	.	T	0.31606	0.0802	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44375	-0.9332	4	.	.	.	.	2.1468	0.03789	0.1294:0.2234:0.343:0.3042	.	.	.	.	V	111	.	.	I	+	1	0	EPHA6	98188911	0.000000	0.05858	0.886000	0.34754	0.949000	0.60115	-3.245000	0.00542	-1.295000	0.02357	-1.074000	0.02243	ATA		0.373	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		Silent
SLIT1	6585	genome.wustl.edu	37	10	98824632	98824632	+	Splice_Site	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:98824632G>C	ENST00000266058.4	-	6	732	c.487C>G	c.(487-489)Cag>Gag	p.Q163E	SLIT1_ENST00000371070.4_Splice_Site_p.Q163E|SLIT1_ENST00000371041.3_Splice_Site_p.Q163E|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	163				Q -> R (in Ref. 1; BAA35184). {ECO:0000305}.	axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.Q163E(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		TTGTCCAGCTGTCTGTGAAGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	10											154.0	136.0	142.0					10																	98824632		2203	4300	6503	98814622	SO:0001630	splice_region_variant	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.486-1C>G	10.37:g.98824632G>C		Somatic		Capture	Illumina GAIIx	4	98814622	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943654	0.92593	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371054;ENST00000371070;ENST00000314867;ENST00000456008;ENST00000371041	T;T;T;T	0.57752	0.38;0.38;1.89;0.38	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	N	0.16066	0.365	0.80722	D	1	D;D	0.71674	0.998;0.994	D;P	0.67231	0.95;0.9	T	0.65578	-0.6134	10	0.87932	D	0	.	18.1864	0.89795	0.0:0.0:1.0:0.0	.	163;163	E7EWQ8;O75093	.;SLIT1_HUMAN	E	163;163;139;163;146;139;163	ENSP00000266058:Q163E;ENSP00000360109:Q163E;ENSP00000315005:Q146E;ENSP00000360080:Q163E	ENSP00000266058:Q163E	Q	-	1	0	SLIT1	98814622	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.657000	0.98554	2.537000	0.85549	0.491000	0.48974	CAG		0.527	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	Missense_Mutation	Missense_Mutation
BHLHB9	80823	genome.wustl.edu	37	X	102004627	102004627	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:102004627C>G	ENST00000372735.1	+	4	1289	c.704C>G	c.(703-705)tCc>tGc	p.S235C	BHLHB9_ENST00000448867.1_Missense_Mutation_p.S235C|BHLHB9_ENST00000457056.1_Missense_Mutation_p.S235C|BHLHB9_ENST00000447531.1_Missense_Mutation_p.S235C|BHLHB9_ENST00000361229.4_Missense_Mutation_p.S235C			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	235					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.S235*(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGATTTAGATCCCAGGCACCA	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	X											82.0	77.0	79.0					X																	102004627		2203	4300	6503	101891283	SO:0001583	missense	80823			AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.704C>G	X.37:g.102004627C>G	ENSP00000361820:p.Ser235Cys	Somatic		Capture	Illumina GAIIx	4	101891283	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617346	0.46736	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47	4.5	3.63	0.41609	.	0.476584	0.17988	N	0.155296	T	0.20251	0.0487	N	0.14661	0.345	0.24268	N	0.995253	D	0.89917	1.0	D	0.68765	0.96	T	0.07558	-1.0766	9	.	.	.	-6.1363	8.8899	0.35427	0.2209:0.7791:0.0:0.0	.	235	Q6PI77	BHLH9_HUMAN	C	235	ENSP00000403226:S235C;ENSP00000354675:S235C;ENSP00000405893:S235C;ENSP00000391722:S235C;ENSP00000361820:S235C	.	S	+	2	0	BHLHB9	101891283	0.917000	0.31117	0.986000	0.45419	0.900000	0.52787	0.815000	0.27253	1.228000	0.43614	0.597000	0.82753	TCC		0.488	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		Missense_Mutation
MMP8	4317	genome.wustl.edu	37	11	102587060	102587060	+	Missense_Mutation	SNP	C	C	A	rs559647290		TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:102587060C>A	ENST00000236826.3	-	6	973	c.875G>T	c.(874-876)cGt>cTt	p.R292L		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	292					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.R292L(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	TATTTCTCCACGGAGTGTGGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											113.0	118.0	116.0					11																	102587060		2203	4299	6502	102092270	SO:0001583	missense	4317			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.875G>T	11.37:g.102587060C>A	ENSP00000236826:p.Arg292Leu	Somatic		Capture	Illumina GAIIx	4	102092270	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678442	0.88542	.	.	ENSG00000118113	ENST00000236826;ENST00000544383;ENST00000534942	T	0.16897	2.31	5.03	5.03	0.67393	Hemopexin/matrixin (2);	0.000000	0.51477	D	0.000082	T	0.49795	0.1578	M	0.90019	3.08	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.996	T	0.60611	-0.7229	10	0.87932	D	0	.	15.2723	0.73712	0.0:1.0:0.0:0.0	.	292;227;292	A8K9E4;F5GXB5;P22894	.;.;MMP8_HUMAN	L	292;269;227	ENSP00000236826:R292L	ENSP00000236826:R292L	R	-	2	0	MMP8	102092270	0.998000	0.40836	0.963000	0.40424	0.990000	0.78478	5.347000	0.65998	2.326000	0.78906	0.563000	0.77884	CGT		0.383	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424		Missense_Mutation
ZNF189	7743	genome.wustl.edu	37	9	104170971	104170971	+	Silent	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr9:104170971A>G	ENST00000339664.2	+	3	1050	c.921A>G	c.(919-921)caA>caG	p.Q307Q	ZNF189_ENST00000259395.4_Silent_p.Q265Q|ZNF189_ENST00000374861.3_Silent_p.Q293Q	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	307					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q307Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TTGAGCATCAAAGAATTCACA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	9											116.0	120.0	119.0					9																	104170971		2203	4300	6503	103210792	SO:0001819	synonymous_variant	7743			AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.921A>G	9.37:g.104170971A>G		Somatic		Capture	Illumina GAIIx	4	103210792	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Silent	SNP	ENST00000339664.2	37	CCDS6754.1	SNP	1	WashU																																																																																				0.398	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452		Silent
NFKB1	4790	genome.wustl.edu	37	4	103459065	103459065	+	Silent	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:103459065A>G	ENST00000505458.1	+	5	484	c.207A>G	c.(205-207)ctA>ctG	p.L69L	NFKB1_ENST00000226574.4_Silent_p.L70L|NFKB1_ENST00000394820.4_Silent_p.L69L			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	69	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.L70L(1)		biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	ATGGTGGACTACCTGGTGCCT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	4											162.0	153.0	156.0					4																	103459065		2203	4300	6503	103678093	SO:0001819	synonymous_variant	4790			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.207A>G	4.37:g.103459065A>G		Somatic		Capture	Illumina GAIIx	4	103678093	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Silent	SNP	ENST00000505458.1	37	CCDS54783.1	SNP	14	WashU																																																																																				0.393	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1			Silent
TAF5	6877	genome.wustl.edu	37	10	105143003	105143003	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:105143003C>G	ENST00000369839.3	+	7	1566	c.1543C>G	c.(1543-1545)Ctt>Gtt	p.L515V	TAF5_ENST00000351396.4_Missense_Mutation_p.L515V	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	515					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.L515V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGATCTTAGTCTTATAGACAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	10											51.0	51.0	51.0					10																	105143003		2203	4300	6503	105132993	SO:0001583	missense	6877			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1543C>G	10.37:g.105143003C>G	ENSP00000358854:p.Leu515Val	Somatic		Capture	Illumina GAIIx	4	105132993	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379539	0.24944	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	T;D	0.82255	0.59;-1.59	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.127949	0.53938	D	0.000049	T	0.74481	0.3722	L	0.29908	0.895	0.54753	D	0.999984	B;B	0.28291	0.206;0.146	B;B	0.24269	0.052;0.023	T	0.71810	-0.4480	10	0.41790	T	0.15	-8.6212	14.6161	0.68549	0.1457:0.8543:0.0:0.0	.	515;515	Q15542-2;Q15542	.;TAF5_HUMAN	V	515	ENSP00000358854:L515V;ENSP00000311024:L515V	ENSP00000311024:L515V	L	+	1	0	TAF5	105132993	1.000000	0.71417	0.999000	0.59377	0.866000	0.49608	2.267000	0.43329	2.683000	0.91414	0.555000	0.69702	CTT		0.333	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1			Missense_Mutation
PREP	5550	genome.wustl.edu	37	6	105771645	105771645	+	Splice_Site	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:105771645T>G	ENST00000369110.3	-	10	1406		c.e10-2			NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.?(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	AAATGATACCTAAAAAGTAGA	0.443																																																1	Unknown(1)	ovary(1)	6											108.0	106.0	107.0					6																	105771645		2203	4300	6503	105878338	SO:0001630	splice_region_variant	5550				CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1214-2A>C	6.37:g.105771645T>G		Somatic		Capture	Illumina GAIIx	4	105878338	Q8N6D4	Splice_Site_SNP	SNP	ENST00000369110.3	37	CCDS5053.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	17.41	3.383790	0.61845	.	.	ENSG00000085377	ENST00000369110	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3514	0.83213	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PREP	105878338	1.000000	0.71417	0.983000	0.44433	0.790000	0.44656	7.669000	0.83911	2.252000	0.74401	0.533000	0.62120	.		0.443	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		Intron	Splice_Site_SNP
FRMPD3	84443	genome.wustl.edu	37	X	106769888	106769888	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:106769888G>A	ENST00000276185.4	+	3	169	c.169G>A	c.(169-171)Gtt>Att	p.V57I	FRMPD3-AS1_ENST00000415252.1_RNA			Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	57	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoskeleton (GO:0005856)		p.V67I(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						ACAAGTGACCGTTCACCGAGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											125.0	109.0	114.0					X																	106769888		876	1991	2867	106656544	SO:0001583	missense	84443			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.169G>A	X.37:g.106769888G>A	ENSP00000276185:p.Val57Ile	Somatic		Capture	Illumina GAIIx	4	106656544	Q96JK8	Missense_Mutation	SNP	ENST00000276185.4	37		SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	1.278	-0.611277	0.03690	.	.	ENSG00000147234	ENST00000276185;ENST00000439554	T;T	0.53423	2.79;0.62	4.68	3.42	0.39159	.	0.120195	0.52532	N	0.000068	T	0.14270	0.0345	N	0.00793	-1.18	0.24696	N	0.993284	.	.	.	.	.	.	T	0.22068	-1.0227	8	0.13853	T	0.58	.	7.3181	0.26511	0.8028:0.0:0.1972:0.0	.	.	.	.	I	57;5	ENSP00000276185:V57I;ENSP00000398668:V5I	ENSP00000276185:V57I	V	+	1	0	FRMPD3	106656544	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	2.314000	0.43743	0.693000	0.31634	-0.354000	0.07668	GTT		0.547	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_042978		Missense_Mutation
COL4A5	1287	genome.wustl.edu	37	X	107939571	107939571	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:107939571G>A	ENST00000361603.2	+	51	5265	c.5021G>A	c.(5020-5022)cGa>cAa	p.R1674Q	COL4A5_ENST00000328300.6_Missense_Mutation_p.R1680Q	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1674	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.		Missing (in APSX). {ECO:0000269|PubMed:7853788}.		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.R1674Q(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TTGAGGACACGAATTAGCCGA	0.338									Alport syndrome with Diffuse Leiomyomatosis																																							2	Substitution - Missense(2)	ovary(1)|kidney(1)	X											113.0	100.0	105.0					X																	107939571		2203	4300	6503	107826227	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.5021G>A	X.37:g.107939571G>A	ENSP00000354505:p.Arg1674Gln	Somatic		Capture	Illumina GAIIx	4	107826227	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809871	0.90707	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94330	-3.4;-3.4	5.83	5.83	0.93111	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.95053	0.8398	M	0.66506	2.035	0.80722	D	1	P;P	0.47034	0.889;0.889	P;P	0.52217	0.693;0.693	D	0.94642	0.7831	10	0.49607	T	0.09	.	19.0749	0.93156	0.0:0.0:1.0:0.0	.	1677;1674	E7EVY4;P29400	.;CO4A5_HUMAN	Q	1680;1674;1680	ENSP00000331902:R1680Q;ENSP00000354505:R1674Q	ENSP00000331902:R1680Q	R	+	2	0	COL4A5	107826227	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.789000	0.75110	2.455000	0.83008	0.538000	0.68166	CGA		0.338	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			Missense_Mutation
ACACB	32	genome.wustl.edu	37	12	109654455	109654455	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:109654455C>G	ENST00000338432.7	+	23	3502	c.3383C>G	c.(3382-3384)aCa>aGa	p.T1128R	ACACB_ENST00000377854.5_Intron|ACACB_ENST00000377848.3_Missense_Mutation_p.T1128R			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1128					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.T1128R(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TATATGAAAACAGTGGTGTTG	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											102.0	99.0	100.0					12																	109654455		2203	4300	6503	108138838	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3383C>G	12.37:g.109654455C>G	ENSP00000341044:p.Thr1128Arg	Somatic		Capture	Illumina GAIIx	4	108138838	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883967	0.33255	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000390027	T;T	0.40756	1.02;1.02	5.33	3.51	0.40186	Acetyl-CoA carboxylase, central domain (1);	0.453783	0.24686	N	0.036440	T	0.34279	0.0892	N	0.19112	0.55	0.80722	D	1	B	0.29671	0.254	B	0.41236	0.351	T	0.07770	-1.0755	10	0.21540	T	0.41	.	12.4332	0.55584	0.0:0.8627:0.0:0.1373	.	1128	O00763	ACACB_HUMAN	R	1128;1128;359	ENSP00000341044:T1128R;ENSP00000367079:T1128R	ENSP00000341044:T1128R	T	+	2	0	ACACB	108138838	0.322000	0.24634	0.003000	0.11579	0.881000	0.50899	4.554000	0.60760	0.758000	0.33059	0.650000	0.86243	ACA		0.502	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		Missense_Mutation
LRIF1	55791	genome.wustl.edu	37	1	111490745	111490745	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:111490745G>C	ENST00000369763.4	-	4	2536	c.2146C>G	c.(2146-2148)Caa>Gaa	p.Q716E	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Missense_Mutation_p.Q180E|LRIF1_ENST00000485275.2_Missense_Mutation_p.Q180E	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)		p.Q716E(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						AAATGACTTTGTTCATAAGCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	1											140.0	141.0	141.0					1																	111490745		2203	4300	6503	111292268	SO:0001583	missense	55791			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.2146C>G	1.37:g.111490745G>C	ENSP00000358778:p.Gln716Glu	Somatic		Capture	Illumina GAIIx	4	111292268	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	37	CCDS30800.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678880	0.47886	.	.	ENSG00000121931	ENST00000369763;ENST00000494675;ENST00000485275	T;T;T	0.31769	1.91;1.48;1.48	5.71	4.77	0.60923	.	0.435503	0.22130	N	0.064207	T	0.11281	0.0275	L	0.50333	1.59	0.35855	D	0.827094	B;B	0.19073	0.033;0.008	B;B	0.19946	0.027;0.011	T	0.07309	-1.0779	10	0.07325	T	0.83	-2.8079	12.3592	0.55192	0.0:0.1698:0.8302:0.0	.	180;716	Q5T3J3-2;Q5T3J3	.;LRIF1_HUMAN	E	716;180;180	ENSP00000358778:Q716E;ENSP00000435259:Q180E;ENSP00000432290:Q180E	ENSP00000358778:Q716E	Q	-	1	0	LRIF1	111292268	0.799000	0.28903	0.998000	0.56505	0.958000	0.62258	1.388000	0.34442	1.353000	0.45828	0.591000	0.81541	CAA		0.358	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372		Missense_Mutation
PALM2	114299	genome.wustl.edu	37	9	112705412	112705412	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr9:112705412A>G	ENST00000374531.2	+	7	921	c.847A>G	c.(847-849)Atg>Gtg	p.M283V	AKAP2_ENST00000555236.1_Intron|PALM2_ENST00000483909.1_Missense_Mutation_p.M281V|PALM2-AKAP2_ENST00000374530.3_Intron|PALM2_ENST00000314527.4_Missense_Mutation_p.M315V|PALM2-AKAP2_ENST00000302798.7_Intron|AKAP2_ENST00000510514.5_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.M317V	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	283					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)		p.M283V(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						CATGATTTTTATGGGCTACCA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											100.0	94.0	96.0					9																	112705412		2203	4300	6503	111745233	SO:0001583	missense	114299			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.847A>G	9.37:g.112705412A>G	ENSP00000363656:p.Met283Val	Somatic		Capture	Illumina GAIIx	4	111745233	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	CCDS35099.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	11.70	1.718052	0.30503	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	6.16	6.16	0.99307	.	.	.	.	.	T	0.36026	0.0952	M	0.77486	2.375	0.80722	D	1	B;B	0.25563	0.129;0.053	B;B	0.30251	0.113;0.053	T	0.09930	-1.0652	9	0.40728	T	0.16	.	15.9872	0.80168	1.0:0.0:0.0:0.0	.	283;317	Q8IXS6;D3YTA4	PALM2_HUMAN;.	V	283;317;281;315;315	ENSP00000363656:M283V;ENSP00000400206:M317V;ENSP00000417525:M281V;ENSP00000323805:M315V;ENSP00000397839:M315V	ENSP00000397839:M315V	M	+	1	0	PALM2-AKAP2;PALM2	111745233	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.038000	0.70964	2.367000	0.80283	0.528000	0.53228	ATG		0.512	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293		Missense_Mutation
SLC9C1	285335	genome.wustl.edu	37	3	111988838	111988838	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:111988838T>A	ENST00000305815.5	-	7	952	c.700A>T	c.(700-702)Atg>Ttg	p.M234L	SLC9C1_ENST00000487372.1_Missense_Mutation_p.M234L	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	234					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.M234L(1)									ACAGTTGACATCCAAAATTGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											68.0	73.0	72.0					3																	111988838		2203	4295	6498	113471528	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.700A>T	3.37:g.111988838T>A	ENSP00000306627:p.Met234Leu	Somatic		Capture	Illumina GAIIx	4	113471528	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	0.576	-0.839010	0.02692	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.09538	2.97;2.97	5.9	4.79	0.61399	Cation/H+ exchanger (1);	0.307176	0.30940	N	0.008575	T	0.05686	0.0149	N	0.20530	0.585	0.22468	N	0.999071	B;B	0.17852	0.024;0.021	B;B	0.15870	0.005;0.014	T	0.40979	-0.9534	10	0.02654	T	1	-16.2819	9.1526	0.36973	0.0:0.0:0.2365:0.7635	.	234;234	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	L	234	ENSP00000306627:M234L;ENSP00000420688:M234L	ENSP00000306627:M234L	M	-	1	0	SLC9A10	113471528	0.998000	0.40836	0.961000	0.40146	0.387000	0.30353	0.915000	0.28638	2.258000	0.74832	0.413000	0.27773	ATG		0.338	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061		Missense_Mutation
CCDC80	151887	genome.wustl.edu	37	3	112349029	112349029	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:112349029T>G	ENST00000206423.3	-	3	2919	c.1966A>C	c.(1966-1968)Aaa>Caa	p.K656Q	CCDC80_ENST00000439685.2_Missense_Mutation_p.K656Q	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	656					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.K656Q(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						ACAGAGATTTTCCTGGTAGCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											147.0	135.0	139.0					3																	112349029		2203	4300	6503	113831719	SO:0001583	missense	151887			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1966A>C	3.37:g.112349029T>G	ENSP00000206423:p.Lys656Gln	Somatic		Capture	Illumina GAIIx	4	113831719	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	SNP	62	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.86|18.86	3.712509|3.712509	0.68730|0.68730	.|.	.|.	ENSG00000091986|ENSG00000091986	ENST00000461431|ENST00000206423;ENST00000439685;ENST00000444594	.|T;T	.|0.43294	.|0.95;0.95	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.192248	.|0.53938	.|D	.|0.000042	T|T	0.58395|0.58395	0.2119|0.2119	M|M	0.67953|0.67953	2.075|2.075	0.51012|0.51012	D|D	0.999905|0.999905	.|P;D;D	.|0.53745	.|0.953;0.962;0.962	.|P;P;P	.|0.57846	.|0.736;0.828;0.828	T|T	0.60229|0.60229	-0.7304|-0.7304	5|10	.|0.49607	.|T	.|0.09	-9.031|-9.031	15.5543|15.5543	0.76180|0.76180	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|667;656;656	.|Q76M96-2;A3KC71;Q76M96	.|.;.;CCD80_HUMAN	A|Q	53|656;656;284	.|ENSP00000206423:K656Q;ENSP00000411814:K656Q	.|ENSP00000206423:K656Q	E|K	-|-	2|1	0|0	CCDC80|CCDC80	113831719|113831719	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.934000|0.934000	0.57294|0.57294	7.622000|7.622000	0.83099|0.83099	2.135000|2.135000	0.66039|0.66039	0.377000|0.377000	0.23210|0.23210	GAA|AAA		0.423	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511		Missense_Mutation
LVRN	206338	genome.wustl.edu	37	5	115298443	115298443	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr5:115298443C>T	ENST00000357872.4	+	1	253	c.129C>T	c.(127-129)gtC>gtT	p.V43V	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		43						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V43V(1)									GCGAGCGCGTCCCACCGTCGG	0.697																																																1	Substitution - coding silent(1)	ovary(1)	5											17.0	20.0	19.0					5																	115298443		2168	4256	6424	115326342	SO:0001819	synonymous_variant	206338																														ENST00000357872.4:c.129C>T	5.37:g.115298443C>T		Somatic		Capture	Illumina GAIIx	4	115326342	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1	SNP	30	WashU																																																																																				0.697	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1			Silent
MARCO	8685	genome.wustl.edu	37	2	119729103	119729103	+	Silent	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:119729103C>G	ENST00000327097.4	+	4	588	c.453C>G	c.(451-453)ggC>ggG	p.G151G	MARCO_ENST00000541757.1_Silent_p.G73G	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	151	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.G151G(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GTGAACAAGGCGCCCCAGGTA	0.582																																					GBM(8;18 374 7467 11269 32796)											1	Substitution - coding silent(1)	ovary(1)	2											143.0	134.0	137.0					2																	119729103		2203	4300	6503	119445573	SO:0001819	synonymous_variant	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.453C>G	2.37:g.119729103C>G		Somatic		Capture	Illumina GAIIx	4	119445573	B4DW79|Q9Y5S3	Silent	SNP	ENST00000327097.4	37	CCDS2124.1	SNP	27	WashU																																																																																				0.582	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770		Silent
MAL2	114569	genome.wustl.edu	37	8	120252479	120252479	+	Silent	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr8:120252479G>C	ENST00000276681.6	+	4	480	c.378G>C	c.(376-378)ctG>ctC	p.L126L	MAL2_ENST00000521748.1_3'UTR|RP11-4K16.2_ENST00000522828.1_lincRNA	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	126	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCACATCCCTGCATGATTTGC	0.398																																																0			8											81.0	78.0	79.0					8																	120252479		1895	4116	6011	120321660	SO:0001819	synonymous_variant	114569			AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.378G>C	8.37:g.120252479G>C		Somatic		Capture	Illumina GAIIx	4	120321660	B2R520|Q6ZMD9	Missense_Mutation	SNP	ENST00000276681.6	37		SNP	46	WashU																																																																																				0.398	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886		Missense_Mutation
POGLUT1	56983	genome.wustl.edu	37	3	119205679	119205679	+	Splice_Site	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:119205679G>C	ENST00000295588.4	+	7	722		c.e7-1			NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1						cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)	p.?(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						TTCTTTTATAGGACAAGTCCA	0.423																																																1	Unknown(1)	ovary(1)	3											166.0	165.0	165.0					3																	119205679		2203	4300	6503	120688369	SO:0001630	splice_region_variant	56983			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.639-1G>C	3.37:g.119205679G>C		Somatic		Capture	Illumina GAIIx	4	120688369	B2RD13|Q53GJ4|Q8N2T1	Splice_Site_SNP	SNP	ENST00000295588.4	37	CCDS2988.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089873	0.76756	.	.	ENSG00000163389	ENST00000295588	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0879	0.64971	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POGLUT1	120688369	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.222000	0.95196	2.781000	0.95711	0.591000	0.81541	.		0.423	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355034.2	NM_152305	Intron	Splice_Site_SNP
TBC1D32	221322	genome.wustl.edu	37	6	121401919	121401919	+	Nonstop_Mutation	SNP	A	A	T			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:121401919A>T	ENST00000398212.2	-	32	3821	c.3772T>A	c.(3772-3774)Tag>Aag	p.*1258K	TBC1D32_ENST00000275159.6_Nonstop_Mutation_p.*1299K|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	0					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)	p.*1258K(1)									CTCATGATCTATGTGCTCTGC	0.373																																																1	Nonstop extension(1)	ovary(1)	6											108.0	100.0	103.0					6																	121401919		1884	4139	6023	121443618	SO:0001578	stop_lost	221322			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.3772T>A	6.37:g.121401919A>T		Somatic		Capture	Illumina GAIIx	4	121443618	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Nonstop_Mutation	SNP	ENST00000398212.2	37	CCDS43501.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	16.53	3.148147	0.57151	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	.	.	.	5.55	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8614	0.41116	0.9222:0.0:0.0778:0.0	.	.	.	.	K	1299;1258	.	.	X	-	1	0	C6orf170	121443618	0.998000	0.40836	0.017000	0.16124	0.006000	0.05464	4.724000	0.61972	1.033000	0.39918	-0.274000	0.10170	TAG		0.373	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		Nonstop_Mutation
KNTC1	9735	genome.wustl.edu	37	12	123052819	123052819	+	Missense_Mutation	SNP	G	G	T	rs199501312		TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:123052819G>T	ENST00000333479.7	+	21	1793	c.1616G>T	c.(1615-1617)tGg>tTg	p.W539L	KNTC1_ENST00000450485.2_Missense_Mutation_p.W502L	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	539					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.W539L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GGCAGTTCTTGGATTGAATTT	0.294																																																1	Substitution - Missense(1)	ovary(1)	12											90.0	92.0	91.0					12																	123052819		1795	4063	5858	121618772	SO:0001583	missense	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1616G>T	12.37:g.123052819G>T	ENSP00000328236:p.Trp539Leu	Somatic		Capture	Illumina GAIIx	4	121618772	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502251	0.64298	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.54479	0.57;0.89	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.73305	0.3570	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.75825	-0.3181	10	0.72032	D	0.01	-8.3108	19.0977	0.93260	0.0:0.0:1.0:0.0	.	502;539	E7ES84;P50748	.;KNTC1_HUMAN	L	502;539	ENSP00000397992:W502L;ENSP00000328236:W539L	ENSP00000328236:W539L	W	+	2	0	KNTC1	121618772	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	8.843000	0.92142	2.516000	0.84829	0.460000	0.39030	TGG		0.294	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Missense_Mutation
BRI3BP	140707	genome.wustl.edu	37	12	125497110	125497110	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:125497110C>A	ENST00000341446.8	+	2	335	c.244C>A	c.(244-246)Ctg>Atg	p.L82M		NM_080626.5	NP_542193.3			BRI3 binding protein									p.L82M(1)		large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		GAGATTTGTGCTGGGAGTGGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											374.0	338.0	351.0					12																	125497110		2203	4300	6503	124063063	SO:0001583	missense	140707			AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.244C>A	12.37:g.125497110C>A	ENSP00000340761:p.Leu82Met	Somatic		Capture	Illumina GAIIx	4	124063063		Missense_Mutation	SNP	ENST00000341446.8	37	CCDS9262.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	8.094	0.775218	0.16051	.	.	ENSG00000184992	ENST00000341446	.	.	.	4.95	-4.82	0.03171	.	0.388120	0.28624	N	0.014683	T	0.24044	0.0582	L	0.29908	0.895	0.09310	N	1	P	0.39624	0.681	P	0.45138	0.471	T	0.25187	-1.0139	9	0.34782	T	0.22	-15.1284	7.3974	0.26944	0.1372:0.3092:0.0:0.5536	.	82	Q8WY22	BRI3B_HUMAN	M	82	.	ENSP00000340761:L82M	L	+	1	2	BRI3BP	124063063	0.851000	0.29673	0.578000	0.28575	0.044000	0.14063	-0.034000	0.12225	-0.488000	0.06726	-1.855000	0.00564	CTG		0.502	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400200.2	NM_080626		Missense_Mutation
GAPVD1	26130	genome.wustl.edu	37	9	128083728	128083728	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr9:128083728T>G	ENST00000495955.1	+	10	1909	c.1619T>G	c.(1618-1620)cTt>cGt	p.L540R	GAPVD1_ENST00000394083.2_Missense_Mutation_p.L540R|GAPVD1_ENST00000394105.2_Missense_Mutation_p.L540R|GAPVD1_ENST00000265956.4_Missense_Mutation_p.L540R|GAPVD1_ENST00000312123.9_Missense_Mutation_p.L540R|GAPVD1_ENST00000297933.6_Missense_Mutation_p.L540R|GAPVD1_ENST00000394104.2_Missense_Mutation_p.L540R|GAPVD1_ENST00000470056.1_Missense_Mutation_p.L540R			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	540					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L540R(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AACATGCAGCTTTCGGATGGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	9											125.0	117.0	120.0					9																	128083728		2203	4300	6503	127123549	SO:0001583	missense	26130				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1619T>G	9.37:g.128083728T>G	ENSP00000419063:p.Leu540Arg	Somatic		Capture	Illumina GAIIx	4	127123549	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		SNP	56	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.31|19.31	3.802135|3.802135	0.70682|0.70682	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|T;T;T;T;T;T;T;T;T	.|0.13420	.|2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59;2.59	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.181563	.|0.45867	.|D	.|0.000327	T|T	0.18759|0.18759	0.0450|0.0450	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;P;P;P;D	.|0.61080	.|0.948;0.914;0.911;0.95;0.95;0.989	.|P;P;P;P;P;P	.|0.56042	.|0.718;0.526;0.474;0.474;0.474;0.79	T|T	0.02009|0.02009	-1.1230|-1.1230	5|10	.|0.59425	.|D	.|0.04	.|.	14.8313|14.8313	0.70151|0.70151	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|540;540;540;540;540;540	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	.|.;GAPD1_HUMAN;.;.;.;.	V|R	403|540	.|ENSP00000419767:L540R;ENSP00000377665:L540R;ENSP00000377664:L540R;ENSP00000265956:L540R;ENSP00000377645:L540R;ENSP00000419063:L540R;ENSP00000418747:L540R;ENSP00000297933:L540R;ENSP00000309582:L540R	.|ENSP00000265956:L540R	F|L	+|+	1|2	0|0	GAPVD1|GAPVD1	127123549|127123549	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.621000|0.621000	0.37620|0.37620	7.480000|7.480000	0.81109|0.81109	2.104000|2.104000	0.64026|0.64026	0.460000|0.460000	0.39030|0.39030	TTT|CTT		0.373	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1			Missense_Mutation
TSGA13	114960	genome.wustl.edu	37	7	130368492	130368492	+	Silent	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:130368492T>G	ENST00000456951.1	-	4	893	c.42A>C	c.(40-42)tcA>tcC	p.S14S	TSGA13_ENST00000356588.3_Silent_p.S14S			Q96PP4	TSG13_HUMAN	testis specific, 13	14								p.S14S(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					CTGAAGTCTTTGATTTGCCAT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											171.0	149.0	157.0					7																	130368492		2203	4300	6503	130019032	SO:0001819	synonymous_variant	114960			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.42A>C	7.37:g.130368492T>G		Somatic		Capture	Illumina GAIIx	4	130019032	B3KSC9	Silent	SNP	ENST00000456951.1	37	CCDS5824.1	SNP	63	WashU																																																																																				0.398	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337997.1	NM_052933		Silent
RALGDS	5900	genome.wustl.edu	37	9	135985878	135985878	+	Splice_Site	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr9:135985878T>C	ENST00000372050.3	-	3	316		c.e3-2		RALGDS_ENST00000469972.1_5'Flank|RALGDS_ENST00000372062.3_Splice_Site|RALGDS_ENST00000393160.3_Splice_Site|RALGDS_ENST00000542690.1_Splice_Site|RALGDS_ENST00000372047.3_Splice_Site|RALGDS_ENST00000393157.3_Splice_Site	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator						neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)	p.?(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		ATTCTCATACTGGGGTGGGAC	0.602			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																Melanoma(189;762 2088 15384 21931 52515)		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	1	Unknown(1)	ovary(1)	9											47.0	42.0	44.0					9																	135985878		2202	4300	6502	134975699	SO:0001630	splice_region_variant	5900			AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.295-2A>G	9.37:g.135985878T>C		Somatic		Capture	Illumina GAIIx	4	134975699	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Splice_Site_SNP	SNP	ENST00000372050.3	37	CCDS6959.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	13.99	2.400556	0.42613	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000393157;ENST00000542690;ENST00000372062	.	.	.	4.95	2.51	0.30379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4702	0.27344	0.347:0.0:0.0:0.653	.	.	.	.	.	-1	.	.	.	-	.	.	RALGDS	134975699	1.000000	0.71417	0.350000	0.25708	0.844000	0.47949	6.262000	0.72514	0.323000	0.23307	0.533000	0.62120	.		0.602	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266	Intron	Splice_Site_SNP
KY	339855	genome.wustl.edu	37	3	134322972	134322972	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:134322972G>A	ENST00000423778.2	-	11	1496	c.1435C>T	c.(1435-1437)Cgc>Tgc	p.R479C	KY_ENST00000508956.1_Missense_Mutation_p.R458C|KY_ENST00000503669.1_3'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	479					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.R479C(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						ATGGAGCAGCGCCCGTCGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	3											24.0	26.0	25.0					3																	134322972		2066	4195	6261	135805662	SO:0001583	missense	339855			AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1435C>T	3.37:g.134322972G>A	ENSP00000397598:p.Arg479Cys	Somatic		Capture	Illumina GAIIx	4	135805662	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	ENST00000423778.2	37	CCDS46920.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219757	0.39201	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000310263	.	.	.	5.63	5.63	0.86233	.	0.068899	0.53938	D	0.000042	T	0.33381	0.0861	N	0.17674	0.51	0.80722	D	1	B;P	0.39131	0.289;0.661	B;B	0.28385	0.03;0.089	T	0.25082	-1.0142	9	0.44086	T	0.13	-15.1437	12.9449	0.58367	0.074:0.0:0.926:0.0	.	458;479	Q8NBH2-3;Q8NBH2-4	.;.	C	458;479;479	.	ENSP00000309520:R479C	R	-	1	0	KY	135805662	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.352000	0.59404	2.659000	0.90383	0.561000	0.74099	CGC		0.622	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554		Missense_Mutation
EGR1	1958	genome.wustl.edu	37	5	137803097	137803097	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr5:137803097G>A	ENST00000239938.4	+	2	1231	c.959G>A	c.(958-960)cGc>cAc	p.R320H		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	320					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.R320H(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AAACCCAGCCGCATGCGCAAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	108.0	105.0					5																	137803097		2203	4300	6503	137830996	SO:0001583	missense	1958			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.959G>A	5.37:g.137803097G>A	ENSP00000239938:p.Arg320His	Somatic		Capture	Illumina GAIIx	4	137830996		Missense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889874	0.72524	.	.	ENSG00000120738	ENST00000239938	T	0.10960	2.82	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.39860	0.1094	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.50676	-0.8800	10	0.87932	D	0	-17.9847	16.2894	0.82739	0.0:0.0:1.0:0.0	.	320	P18146	EGR1_HUMAN	H	320	ENSP00000239938:R320H	ENSP00000239938:R320H	R	+	2	0	EGR1	137830996	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.315000	0.78130	0.557000	0.71058	CGC		0.622	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964		Missense_Mutation
LRP1B	53353	genome.wustl.edu	37	2	141081489	141081490	+	Missense_Mutation	DNP	TC	TC	CT			TCGA-10-0930-01	TCGA-10-0930-11	TC	TC	TC	CT	TC	TC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:141081489_141081490TC>CT	ENST00000389484.3	-	81	13457_13458	c.12486_12487GA>AG	c.(12484-12489)ttGAta>ttAGta	p.I4163V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4163					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGATGAGATATCAAAACACCTT	0.267										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											0			2																																								140797960	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12486_12487delinsCT	2.37:g.141081489_141081490delinsCT	ENSP00000374135:p.Ile4163Val	Somatic		Capture	Illumina GAIIx	4	140797959	Q8WY29|Q8WY30|Q8WY31	Missense	DNP	ENST00000389484.3	37	CCDS2182.1	DNP	50	WashU																																																																																				0.267	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense
CTAGE15	441294	genome.wustl.edu	37	7	143270356	143270356	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:143270356A>C	ENST00000420911.2	+	1	1463	c.1446A>C	c.(1444-1446)gaA>gaC	p.E482D	RNU6-162P_ENST00000516228.1_RNA	NM_001008747.1	NP_001008747.1	A4D2H0	CTGEF_HUMAN	CTAGE family, member 15	482						integral component of membrane (GO:0016021)											TAAGGAAAGAAAATGCTCACA	0.338																																																0			7											3.0	4.0	4.0					7																	143270356		827	1855	2682	142980478	SO:0001583	missense	441294				CCDS64788.1	7q35	2013-02-25	2013-02-25	2013-02-25	ENSG00000176227	ENSG00000271079			37295	protein-coding gene	gene with protein product			"""CTAGE family, member 15, pseudogene"""	CTAGE15P			Standard	NM_001008747		Approved		uc011kth.3	A4D2H0	OTTHUMG00000153233	ENST00000420911.2:c.1446A>C	7.37:g.143270356A>C	ENSP00000474204:p.Glu482Asp	Somatic		Capture	Illumina GAIIx	4	142980478	A6H8Z8	Missense_Mutation	SNP	ENST00000420911.2	37		SNP	1	WashU																																																																																				0.338	CTAGE15-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330280.2	NM_001008747		Missense_Mutation
PLEC	5339	genome.wustl.edu	37	8	144994084	144994084	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr8:144994084C>A	ENST00000322810.4	-	32	10485	c.10316G>T	c.(10315-10317)aGg>aTg	p.R3439M	PLEC_ENST00000527096.1_Missense_Mutation_p.R3325M|PLEC_ENST00000354958.2_Missense_Mutation_p.R3280M|PLEC_ENST00000436759.2_Missense_Mutation_p.R3329M|PLEC_ENST00000356346.3_Missense_Mutation_p.R3288M|PLEC_ENST00000398774.2_Missense_Mutation_p.R3270M|PLEC_ENST00000357649.2_Missense_Mutation_p.R3306M|PLEC_ENST00000354589.3_Missense_Mutation_p.R3302M|PLEC_ENST00000345136.3_Missense_Mutation_p.R3302M	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3439	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.R3439M(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GAAGGACAGCCTCTCCTGCCG	0.627																																																1	Substitution - Missense(1)	ovary(1)	8											47.0	55.0	52.0					8																	144994084		2144	4241	6385	145066072	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10316G>T	8.37:g.144994084C>A	ENSP00000323856:p.Arg3439Met	Somatic		Capture	Illumina GAIIx	4	145066072	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	7.705	0.693891	0.15039	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78126	-1.12;-1.12;-1.15;-1.15;-1.14;-1.12;-1.12;-1.12;-1.12	4.81	1.74	0.24563	.	0.434585	0.19706	U	0.107923	T	0.72104	0.3419	L	0.43152	1.355	0.20074	N	0.999933	P;P;P;P;P;P;P;P	0.42620	0.785;0.785;0.785;0.679;0.785;0.785;0.785;0.785	B;B;B;B;B;P;B;B	0.44946	0.346;0.346;0.346;0.275;0.346;0.465;0.346;0.346	T	0.64024	-0.6504	10	0.62326	D	0.03	.	9.6699	0.40006	0.0:0.7261:0.0:0.2739	.	3329;3288;3280;3439;3270;3302;3306;3302	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	M	3302;3306;3302;3270;3439;3280;3288;3329;3325	ENSP00000344848:R3302M;ENSP00000350277:R3306M;ENSP00000346602:R3302M;ENSP00000381756:R3270M;ENSP00000323856:R3439M;ENSP00000347044:R3280M;ENSP00000348702:R3288M;ENSP00000388180:R3329M;ENSP00000434583:R3325M	ENSP00000323856:R3439M	R	-	2	0	PLEC	145066072	0.000000	0.05858	0.839000	0.33178	0.989000	0.77384	0.283000	0.18846	0.470000	0.27294	0.448000	0.29417	AGG		0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445		Missense_Mutation
OTUD4	54726	genome.wustl.edu	37	4	146058812	146058812	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:146058812A>C	ENST00000447906.2	-	21	3302	c.3115T>G	c.(3115-3117)Tcc>Gcc	p.S1039A	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Missense_Mutation_p.S974A			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	1039					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.S973A(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AACTGCTTGGATCTACCACTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	4											193.0	196.0	195.0					4																	146058812		2203	4300	6503	146278262	SO:0001583	missense	54726				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.3115T>G	4.37:g.146058812A>C	ENSP00000395487:p.Ser1039Ala	Somatic		Capture	Illumina GAIIx	4	146278262	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37		SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587394	0.46110	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.38560	1.15;1.13	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.55673	0.1935	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.994	D;D	0.77557	0.99;0.978	T	0.58053	-0.7704	10	0.87932	D	0	-11.6297	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1039;1038	G3V0I6;Q01804	.;OTUD4_HUMAN	A	974;1039	ENSP00000409279:S974A;ENSP00000395487:S1039A	ENSP00000395487:S1039A	S	-	1	0	OTUD4	146278262	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.651000	0.46674	2.371000	0.80710	0.533000	0.62120	TCC		0.423	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		Missense_Mutation
FCGR1A	2209	genome.wustl.edu	37	1	149761783	149761783	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:149761783T>C	ENST00000369168.4	+	5	787	c.733T>C	c.(733-735)Tac>Cac	p.Y245H	RP11-196G18.3_ENST00000428289.1_RNA|HIST2H2BF_ENST00000545683.1_Intron|RP11-196G18.21_ENST00000420462.1_RNA	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	245	Ig-like C2-type 3.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)	p.Y245H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ATCCTCTGAATACCAAATACT	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											8.0	8.0	8.0					1																	149761783		2053	4167	6220	148028407	SO:0001583	missense	2209			BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.733T>C	1.37:g.149761783T>C	ENSP00000358165:p.Tyr245His	Somatic		Capture	Illumina GAIIx	4	148028407	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	ENST00000369168.4	37	CCDS933.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	9.772	1.173042	0.21704	.	.	ENSG00000150337	ENST00000444948;ENST00000369168	T;T	0.03413	3.94;3.94	3.36	2.22	0.28083	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	13.557000	0.00166	N	0.000000	T	0.04092	0.0114	M	0.77712	2.385	0.54753	D	0.999987	P	0.50066	0.931	P	0.46917	0.531	T	0.47799	-0.9089	10	0.42905	T	0.14	.	5.3687	0.16127	0.0:0.1325:0.0:0.8675	.	245	P12314	FCGR1_HUMAN	H	153;245	ENSP00000394279:Y153H;ENSP00000358165:Y245H	ENSP00000358165:Y245H	Y	+	1	0	FCGR1A	148028407	0.975000	0.34042	0.683000	0.30040	0.289000	0.27227	2.178000	0.42519	0.657000	0.30906	0.496000	0.49642	TAC		0.502	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566		Missense_Mutation
MTMR11	10903	genome.wustl.edu	37	1	149907594	149907594	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:149907594C>G	ENST00000439741.2	-	3	397	c.147G>C	c.(145-147)gaG>gaC	p.E49D	MTMR11_ENST00000406732.3_Missense_Mutation_p.E21D|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000361405.6_Missense_Mutation_p.E49D|MTMR11_ENST00000369140.3_Intron	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	49							phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CTAGGATCTGCTCCCCTAAAG	0.547																																																0			1											48.0	45.0	46.0					1																	149907594		692	1591	2283	148174218	SO:0001583	missense	10903			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.147G>C	1.37:g.149907594C>G	ENSP00000391668:p.Glu49Asp	Somatic		Capture	Illumina GAIIx	4	148174218	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	ENST00000439741.2	37	CCDS53360.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806317	0.50421	.	.	ENSG00000014914	ENST00000439741;ENST00000361405;ENST00000406732	D;D;D	0.89485	-2.52;-2.52;-2.52	4.68	0.478	0.16789	.	.	.	.	.	T	0.79311	0.4424	M	0.76574	2.34	0.27482	N	0.952539	P;B	0.35348	0.496;0.235	B;B	0.38264	0.269;0.098	T	0.69573	-0.5109	8	.	.	.	.	6.1694	0.20408	0.0:0.5468:0.0:0.4532	.	21;49	A4FU01-6;A4FU01	.;MTMRB_HUMAN	D	49;49;21	ENSP00000391668:E49D;ENSP00000354941:E49D;ENSP00000383948:E21D	.	E	-	3	2	MTMR11	148174218	0.988000	0.35896	0.998000	0.56505	0.987000	0.75469	0.044000	0.13992	0.224000	0.20940	-0.145000	0.13849	GAG		0.547	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873		Missense_Mutation
GIMAP6	474344	genome.wustl.edu	37	7	150325052	150325052	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:150325052G>T	ENST00000328902.5	-	3	850	c.634C>A	c.(634-636)Ctg>Atg	p.L212M	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	212	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)	p.L212M(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCTCTCGCAGTTGGGCCTCC	0.532																																																1	Substitution - Missense(1)	ovary(1)	7											130.0	135.0	133.0					7																	150325052		2203	4300	6503	149955985	SO:0001583	missense	474344			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.634C>A	7.37:g.150325052G>T	ENSP00000330374:p.Leu212Met	Somatic		Capture	Illumina GAIIx	4	149955985	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673637	0.29693	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.06218	3.33	4.33	-1.53	0.08611	AIG1 (1);	0.250164	0.31897	N	0.006899	T	0.15609	0.0376	M	0.73430	2.235	0.25655	N	0.986065	P;D	0.67145	0.947;0.996	P;D	0.64410	0.837;0.925	T	0.02893	-1.1097	10	0.66056	D	0.02	.	5.857	0.18724	0.2024:0.4693:0.3284:0.0	.	212;132	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	M	212;273	ENSP00000330374:L212M	ENSP00000330374:L212M	L	-	1	2	GIMAP6	149955985	0.986000	0.35501	0.182000	0.23118	0.005000	0.04900	0.685000	0.25378	-0.148000	0.11234	-0.176000	0.13171	CTG		0.532	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711		Missense_Mutation
FAM50A	9130	genome.wustl.edu	37	X	153674898	153674898	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:153674898G>A	ENST00000393600.3	+	4	542	c.432G>A	c.(430-432)atG>atA	p.M144I		NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A	144					spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.M144I(1)		breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGAGGAGATGGAAAGGGAAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	48.0	57.0					X																	153674898		2194	4291	6485	153328092	SO:0001583	missense	9130			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.432G>A	X.37:g.153674898G>A	ENSP00000377225:p.Met144Ile	Somatic		Capture	Illumina GAIIx	4	153328092	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Missense_Mutation	SNP	ENST00000393600.3	37	CCDS14751.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297335	0.40694	.	.	ENSG00000071859	ENST00000393600;ENST00000158526	.	.	.	5.27	3.48	0.39840	.	1.246750	0.05468	N	0.552468	T	0.31796	0.0808	N	0.22421	0.69	0.24426	N	0.994595	B	0.02656	0.0	B	0.01281	0.0	T	0.21280	-1.0250	9	0.37606	T	0.19	-3.0724	8.6317	0.33924	0.1911:0.0:0.8089:0.0	.	144	Q14320	FA50A_HUMAN	I	144;104	.	ENSP00000158526:M104I	M	+	3	0	FAM50A	153328092	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	2.151000	0.42263	0.995000	0.38917	0.529000	0.55759	ATG		0.627	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081643.2	NM_004699		Missense_Mutation
GON4L	54856	genome.wustl.edu	37	1	155726842	155726842	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:155726842C>T	ENST00000368331.1	-	27	5472	c.5424G>A	c.(5422-5424)ctG>ctA	p.L1808L	GON4L_ENST00000437809.1_Silent_p.L1808L|GON4L_ENST00000271883.5_Silent_p.L1808L	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1808					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.L1808L(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCACATCAGGCAGGGCCACTT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											89.0	85.0	87.0					1																	155726842		1931	4119	6050	153993466	SO:0001819	synonymous_variant	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5424G>A	1.37:g.155726842C>T		Somatic		Capture	Illumina GAIIx	4	153993466	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37		SNP	25	WashU																																																																																				0.502	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		Silent
NAF1	92345	genome.wustl.edu	37	4	164050415	164050415	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:164050415G>C	ENST00000274054.2	-	8	1312	c.1119C>G	c.(1117-1119)ttC>ttG	p.F373L	NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	373					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.F373L(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ATCCTCGTGTGAATTCTCTGT	0.448																																																1	Substitution - Missense(1)	ovary(1)	4											104.0	110.0	108.0					4																	164050415		2203	4300	6503	164269865	SO:0001583	missense	92345				CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1119C>G	4.37:g.164050415G>C	ENSP00000274054:p.Phe373Leu	Somatic		Capture	Illumina GAIIx	4	164269865	D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	CCDS3803.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126172	0.37533	.	.	ENSG00000145414	ENST00000274054	T	0.41400	1.0	4.71	-0.0115	0.13992	.	0.451775	0.24328	N	0.039486	T	0.38639	0.1048	L	0.36672	1.1	0.29159	N	0.87786	D	0.67145	0.996	P	0.57425	0.82	T	0.40459	-0.9562	10	0.11485	T	0.65	-13.2421	8.4474	0.32849	0.4146:0.0:0.5853:0.0	.	373	Q96HR8	NAF1_HUMAN	L	373	ENSP00000274054:F373L	ENSP00000274054:F373L	F	-	3	2	NAF1	164269865	0.975000	0.34042	0.111000	0.21465	0.006000	0.05464	0.835000	0.27531	-0.168000	0.10853	-0.229000	0.12294	TTC		0.448	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386		Missense_Mutation
IRF2	3660	genome.wustl.edu	37	4	185340638	185340638	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:185340638A>G	ENST00000393593.3	-	3	379	c.172T>C	c.(172-174)Tgg>Cgg	p.W58R	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	58				W -> R (in Ref. 1; CAA34073). {ECO:0000305}.	blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W58R(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		TGGATTGCCCAGTTTCTAAAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											137.0	139.0	138.0					4																	185340638		2203	4300	6503	185577632	SO:0001583	missense	3660				CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.172T>C	4.37:g.185340638A>G	ENSP00000377218:p.Trp58Arg	Somatic		Capture	Illumina GAIIx	4	185577632	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165431	0.78339	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.99413	-5.86;-5.86;-5.86;-5.86	4.99	4.99	0.66335	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97705	1.0187	10	0.87932	D	0	-12.1334	14.8642	0.70401	1.0:0.0:0.0:0.0	.	58	P14316	IRF2_HUMAN	R	58	ENSP00000377218:W58R;ENSP00000427204:W58R;ENSP00000424552:W58R;ENSP00000422860:W58R	ENSP00000377218:W58R	W	-	1	0	IRF2	185577632	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.128000	0.94424	2.088000	0.63022	0.533000	0.62120	TGG		0.403	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1			Missense_Mutation
FAT1	2195	genome.wustl.edu	37	4	187510335	187510335	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:187510335G>T	ENST00000441802.2	-	27	13387	c.13178C>A	c.(13177-13179)cCt>cAt	p.P4393H		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	4393					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P4393H(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTCCGGCAGAGGAACGCTTGG	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											141.0	138.0	139.0					4																	187510335		2013	4171	6184	187747329	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.13178C>A	4.37:g.187510335G>T	ENSP00000406229:p.Pro4393His	Somatic		Capture	Illumina GAIIx	4	187747329		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382275	0.42207	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509927	T;T	0.35789	1.29;1.29	5.38	5.38	0.77491	.	0.054165	0.85682	D	0.000000	T	0.30792	0.0776	L	0.39898	1.24	0.46458	D	0.999056	P	0.52316	0.952	P	0.45167	0.472	T	0.01795	-1.1272	10	0.14252	T	0.57	.	12.0017	0.53235	0.0:0.0:0.7132:0.2868	.	4393	Q14517	FAT1_HUMAN	H	4393;4395;83	ENSP00000406229:P4393H;ENSP00000420869:P83H	ENSP00000260147:P4395H	P	-	2	0	FAT1	187747329	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	6.468000	0.73551	2.804000	0.96469	0.462000	0.41574	CCT		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245		Missense_Mutation
COL6A3	1293	genome.wustl.edu	37	2	238274340	238274340	+	Splice_Site	SNP	C	C	A			TCGA-10-0930-01	TCGA-10-0930-11	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:238274340C>A	ENST00000295550.4	-	12	6291		c.e12+1		COL6A3_ENST00000472056.1_Splice_Site|COL6A3_ENST00000347401.3_Splice_Site|COL6A3_ENST00000409809.1_Splice_Site|COL6A3_ENST00000353578.4_Splice_Site|COL6A3_ENST00000346358.4_Splice_Site	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.?(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCCACAGACCTTCACGCTG	0.537																																																1	Unknown(1)	ovary(1)	2											58.0	57.0	57.0					2																	238274340		2203	4300	6503	237939079	SO:0001630	splice_region_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5838+1G>T	2.37:g.238274340C>A		Somatic		Capture	Illumina GAIIx	4	237939079	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Splice_Site_SNP	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287556	0.40494	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0589	0.86541	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL6A3	237939079	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	6.486000	0.73629	2.545000	0.85829	0.650000	0.86243	.		0.537	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	Intron	Splice_Site_SNP
ZNF518B	85460	genome.wustl.edu	37	4	10444765	10444783	+	Frame_Shift_Del	DEL	GTTGCTTCTATCAAATGCC	GTTGCTTCTATCAAATGCC	-	rs534874977|rs368988904|rs200802146		TCGA-10-0930-01	TCGA-10-0930-11	GTTGCTTCTATCAAATGCC	GTTGCTTCTATCAAATGCC	GTTGCTTCTATCAAATGCC	-	GTTGCTTCTATCAAATGCC	GTTGCTTCTATCAAATGCC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr4:10444765_10444783delGTTGCTTCTATCAAATGCC	ENST00000326756.3	-	3	3608_3626	c.3170_3188delGGCATTTGATAGAAGCAAC	c.(3169-3189)cggcatttgatagaagcaactfs	p.RHLIEAT1057fs		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	1057					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R1057fs>12(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CCAATCTCTAGTTGCTTCTATCAAATGCCGTTGGCCATG	0.425																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								10053881	SO:0001589	frameshift_variant	85460			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.3170_3188delGGCATTTGATAGAAGCAAC	4.37:g.10444765_10444783delGTTGCTTCTATCAAATGCC	ENSP00000317614:p.Arg1057fs	Somatic		Capture	Illumina GAIIx	4	10053863	Q96LN8	Frame_Shift_Del	DEL	ENST00000326756.3	37	CCDS33960.1	DEL	36	WashU																																																																																				0.425	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042		Frame_Shift_Del
MGA	23269	genome.wustl.edu	37	15	42041416	42041417	+	Frame_Shift_Ins	INS	-	-	A			TCGA-10-0930-01	TCGA-10-0930-11	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr15:42041416_42041417insA	ENST00000570161.1	+	16	5611_5612	c.5611_5612insA	c.(5611-5613)gttfs	p.V1871fs	MGA_ENST00000389936.4_Frame_Shift_Ins_p.V1832fs|MGA_ENST00000545763.1_Frame_Shift_Ins_p.V1662fs|MGA_ENST00000566586.1_Frame_Shift_Ins_p.V1662fs|MGA_ENST00000219905.7_Frame_Shift_Ins_p.V1871fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.V1920fs*22(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AATTCAAGCTGTTGGGTCTTCT	0.485																																																1	Insertion - Frameshift(1)	ovary(1)	15																																								39828709	SO:0001589	frameshift_variant	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		Exception_encountered	15.37:g.42041416_42041417insA	ENSP00000457035:p.Val1871fs	Somatic		Capture	Illumina GAIIx	4	39828708	Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Ins	INS	ENST00000570161.1	37	CCDS55959.1	INS	48	WashU																																																																																				0.485	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1		Frame_Shift_Ins
MAGEE2	139599	genome.wustl.edu	37	X	75003492	75003503	+	In_Frame_Del	DEL	AAGCTCATATTC	AAGCTCATATTC	-			TCGA-10-0930-01	TCGA-10-0930-11	AAGCTCATATTC	AAGCTCATATTC	AAGCTCATATTC	-	AAGCTCATATTC	AAGCTCATATTC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chrX:75003492_75003503delAAGCTCATATTC	ENST00000373359.2	-	1	1576_1587	c.1384_1395delGAATATGAGCTT	c.(1384-1395)gaatatgagcttdel	p.EYEL462del		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	462	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.E462_L465del(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GACCCCATAGAAGCTCATATTCAACTGGATTA	0.467																																																1	Deletion - In frame(1)	ovary(1)	X																																								74920228	SO:0001651	inframe_deletion	139599			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.1384_1395delGAATATGAGCTT	X.37:g.75003492_75003503delAAGCTCATATTC	ENSP00000362457:p.Glu462_Leu465del	Somatic		Capture	Illumina GAIIx	4	74920217	Q5JSI5	In_Frame_Del	DEL	ENST00000373359.2	37	CCDS14431.1	DEL	9	WashU																																																																																				0.467	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		In_Frame_Del
LZTS2	84445	genome.wustl.edu	37	10	102763681	102763683	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-10-0930-01	TCGA-10-0930-11	TCC	TCC	TCC	-	TCC	TCC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:102763681_102763683delTCC	ENST00000370220.1	+	2	3889_3891	c.826_828delTCC	c.(826-828)tccdel	p.S279del	LZTS2_ENST00000370223.3_In_Frame_Del_p.S279del					leucine zipper, putative tumor suppressor 2									p.S139del(1)|p.S276del(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CAGTGGCCGGTCCTCCTCCAGCA	0.709																																					Esophageal Squamous(8;38 437 13604 19902 37640)											2	Deletion - In frame(2)	ovary(2)	10								0,4240		0,0,2120						-10.0	0.3			29	4,8236		1,2,4117	no	coding	LZTS2	NM_032429.2		1,2,6237	A1A1,A1R,RR		0.0485,0.0,0.0321				4,12476				102753673	SO:0001651	inframe_deletion	84445			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.826_828delTCC	10.37:g.102763687_102763689delTCC	ENSP00000359240:p.Ser279del	Somatic		Capture	Illumina GAIIx	4	102753671		In_Frame_Del	DEL	ENST00000370220.1	37	CCDS7507.1	DEL	58	WashU																																																																																				0.709	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743		In_Frame_Del
SLC6A17	388662	genome.wustl.edu	37	1	110738246	110738257	+	In_Frame_Del	DEL	TTCGTCCAGCGC	TTCGTCCAGCGC	-	rs188284006	byFrequency	TCGA-10-0930-01	TCGA-10-0930-11	TTCGTCCAGCGC	TTCGTCCAGCGC	TTCGTCCAGCGC	-	TTCGTCCAGCGC	TTCGTCCAGCGC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:110738246_110738257delTTCGTCCAGCGC	ENST00000331565.4	+	10	2016_2027	c.1531_1542delTTCGTCCAGCGC	c.(1531-1542)ttcgtccagcgcdel	p.FVQR511del		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	511					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.F511_R514del(1)|p.R514C(1)|p.R514R(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GGGGCTGTTGTTCGTCCAGCGCTCCGGAAACT	0.59																																																3	Substitution - Missense(1)|Substitution - coding silent(1)|Deletion - In frame(1)	ovary(1)|breast(1)|large_intestine(1)	1																																								110539780	SO:0001651	inframe_deletion	388662				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1531_1542delTTCGTCCAGCGC	1.37:g.110738246_110738257delTTCGTCCAGCGC	ENSP00000330199:p.Phe511_Arg514del	Somatic		Capture	Illumina GAIIx	4	110539769	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	In_Frame_Del	DEL	ENST00000331565.4	37	CCDS30799.1	DEL	60	WashU																																																																																				0.590	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280		In_Frame_Del
RPF2	84154	genome.wustl.edu	37	6	111329322	111329330	+	In_Frame_Del	DEL	CTAAAAAGT	CTAAAAAGT	-	rs146951817		TCGA-10-0930-01	TCGA-10-0930-11	CTAAAAAGT	CTAAAAAGT	CTAAAAAGT	-	CTAAAAAGT	CTAAAAAGT	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:111329322_111329330delCTAAAAAGT	ENST00000441448.2	+	7	567_575	c.475_483delCTAAAAAGT	c.(475-483)ctaaaaagtdel	p.LKS159del	RNU6-906P_ENST00000384700.1_RNA	NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	159	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L159_S161del(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						TTATAGAAGACTAAAAAGTCTTCTTATTG	0.344																																																1	Deletion - In frame(1)	ovary(1)	6																																								111436023	SO:0001651	inframe_deletion	84154			AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.475_483delCTAAAAAGT	6.37:g.111329322_111329330delCTAAAAAGT	ENSP00000402338:p.Leu159_Ser161del	Somatic		Capture	Illumina GAIIx	4	111436015	Q5VXN1|Q8N4A1	In_Frame_Del	DEL	ENST00000441448.2	37	CCDS5088.1	DEL	20	WashU																																																																																				0.344	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041813.2	NM_032194		In_Frame_Del
UBN2	254048	genome.wustl.edu	37	7	138946183	138946184	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-10-0930-01	TCGA-10-0930-11	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:138946183_138946184delCA	ENST00000473989.3	+	6	1091_1092	c.1091_1092delCA	c.(1090-1092)gcafs	p.A364fs	UBN2_ENST00000288561.8_Frame_Shift_Del_p.A281fs	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	364						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L282fs*3(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GCTGCTGCAGCACTGGGGAATG	0.475																																																1	Deletion - Frameshift(1)	ovary(1)	7																																								138596724	SO:0001589	frameshift_variant	254048			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.1091_1092delCA	7.37:g.138946183_138946184delCA	ENSP00000418648:p.Ala364fs	Somatic		Capture	Illumina GAIIx	4	138596723	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Frame_Shift_Del	DEL	ENST00000473989.3	37	CCDS43655.2	DEL	25	WashU																																																																																				0.475	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		Frame_Shift_Del
TP53	7157	genome.wustl.edu	37	17	7579307	7579307	+	Intron	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:7579307C>G	ENST00000269305.4	-	4	565				TP53_ENST00000455263.2_Intron|TP53_ENST00000445888.2_Intron|TP53_ENST00000420246.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Intron|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCAGGGCAACTGACCGTGCA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	20	Whole gene deletion(8)|Unknown(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(6)|bone(4)|large_intestine(2)|central_nervous_system(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	17											65.0	61.0	62.0					17																	7579307		2203	4300	6503	7520032	SO:0001627	intron_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+4G>C	17.37:g.7579307C>G		Somatic		PCR	ABI 3730xl	Phase_III	7520032	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	20	WashU																																																																																				0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Splice_Site_SNP
LRRC71	149499	genome.wustl.edu	37	1	156897421	156897421	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr1:156897421G>A	ENST00000337428.7	+	7	950	c.796G>A	c.(796-798)Gac>Aac	p.D266N	LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	266								p.D266N(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						CCACATCGGTGACGAGGGCGC	0.706											OREG0013892	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											16.0	19.0	18.0					1																	156897421		2065	4190	6255	155164045	SO:0001583	missense	149499			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.796G>A	1.37:g.156897421G>A	ENSP00000336661:p.Asp266Asn	Somatic	1782	Capture	Illumina GAIIx	4	155164045	Q96M24	Missense_Mutation	SNP	ENST00000337428.7	37	CCDS44249.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532646	0.85812	.	.	ENSG00000160838	ENST00000337428	T	0.70399	-0.48	4.28	4.28	0.50868	.	0.000000	0.46442	D	0.000298	T	0.71888	0.3393	L	0.56340	1.77	0.43622	D	0.996	D;P	0.60160	0.987;0.954	P;P	0.59357	0.856;0.752	T	0.75476	-0.3304	10	0.62326	D	0.03	-33.5838	13.7263	0.62761	0.0:0.0:1.0:0.0	.	266;51	Q8N4P6;Q8N4P6-2	LRC71_HUMAN;.	N	266	ENSP00000336661:D266N	ENSP00000336661:D266N	D	+	1	0	LRRC71	155164045	1.000000	0.71417	0.997000	0.53966	0.677000	0.39632	7.096000	0.76960	2.220000	0.72140	0.455000	0.32223	GAC		0.706	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098961.1	NM_144702		Missense_Mutation
CALHM1	255022	genome.wustl.edu	37	10	105218165	105218165	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr10:105218165A>C	ENST00000329905.5	-	1	480	c.344T>G	c.(343-345)gTg>gGg	p.V115G	RP11-225H22.4_ENST00000411906.1_RNA	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	115					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)	p.V115G(1)		large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						CGTGACGGCCACCCAGACGAC	0.687																																																1	Substitution - Missense(1)	ovary(1)	10											30.0	28.0	29.0					10																	105218165		2202	4298	6500	105208155	SO:0001583	missense	255022			BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.344T>G	10.37:g.105218165A>C	ENSP00000329926:p.Val115Gly	Somatic		Capture	Illumina GAIIx	PhaseIII	105208155	Q5W091	Missense_Mutation	SNP	ENST00000329905.5	37	CCDS7550.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	23.9	4.466762	0.84425	.	.	ENSG00000185933	ENST00000329905	T	0.20200	2.09	5.52	5.52	0.82312	.	0.132065	0.52532	D	0.000072	T	0.34716	0.0907	L	0.44542	1.39	0.80722	D	1	D	0.57257	0.979	P	0.58454	0.839	T	0.06373	-1.0830	10	0.87932	D	0	-41.1267	14.816	0.70034	1.0:0.0:0.0:0.0	.	115	Q8IU99	CAHM1_HUMAN	G	115	ENSP00000329926:V115G	ENSP00000329926:V115G	V	-	2	0	CALHM1	105208155	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	8.731000	0.91529	2.104000	0.64026	0.402000	0.26972	GTG		0.687	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412		Missense_Mutation
OR52B1P	81274	genome.wustl.edu	37	11	6173522	6173522	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:6173522G>A	ENST00000316506.1	-	1	296	c.297C>T	c.(295-297)caC>caT	p.H99H	RP11-290F24.3_ENST00000529961.1_RNA					olfactory receptor, family 52, subfamily B, member 1 pseudogene									p.H99H(1)									TCTCCCCAGCGTGGACCCAGA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	11																																								6130098	SO:0001819	synonymous_variant						11p15.4	2013-09-24			ENSG00000180909	ENSG00000180909		"""GPCR / Class A : Olfactory receptors"""	15206	pseudogene	pseudogene							Standard	NG_004225		Approved					ENST00000316506.1:c.297C>T	11.37:g.6173522G>A		Somatic		Capture	Illumina GAIIx	4	6130098		Silent	SNP	ENST00000316506.1	37		SNP	40	WashU																																																																																				0.517	OR52B1P-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				Silent
CREB3L1	90993	genome.wustl.edu	37	11	46337937	46337937	+	Splice_Site	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:46337937G>T	ENST00000529193.1	+	9	1582		c.e9+1		CREB3L1_ENST00000288400.3_Splice_Site|CREB3L1_ENST00000534616.1_Intron			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1						regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.?(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CTGCCTCATGGTAGGTGTGGC	0.567			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	1	Unknown(1)	ovary(1)	11											21.0	23.0	22.0					11																	46337937		2010	4159	6169	46294513	SO:0001630	splice_region_variant	90993				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.1131+1G>T	11.37:g.46337937G>T		Somatic		Capture	Illumina GAIIx	4	46294513	Q8N2D5|Q96CP0	Splice_Site_SNP	SNP	ENST00000529193.1	37	CCDS53620.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641389	0.87859	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7859	0.96437	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L1	46294513	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.515000	0.98015	2.746000	0.94184	0.655000	0.94253	.		0.567	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	Intron	Splice_Site_SNP
SLC22A11	55867	genome.wustl.edu	37	11	64323798	64323798	+	Silent	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr11:64323798C>T	ENST00000301891.4	+	1	701	c.327C>T	c.(325-327)gaC>gaT	p.D109D	SLC22A11_ENST00000377585.3_Silent_p.D109D|SLC22A11_ENST00000377581.3_Silent_p.D109D|SLC22A11_ENST00000490834.1_3'UTR	NM_018484.2	NP_060954.1	Q9NSA0	S22AB_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 11	109					organic anion transport (GO:0015711)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.D109D(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23					Aminohippurate(DB00345)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Estradiol(DB00783)|Furosemide(DB00695)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Novobiocin(DB01051)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Salicylic acid(DB00936)|Tetracycline(DB00759)|Zidovudine(DB00495)	GCGAAGCTGACACGGAGCCGT	0.682																																																1	Substitution - coding silent(1)	ovary(1)	11											46.0	51.0	49.0					11																	64323798		2201	4297	6498	64080374	SO:0001819	synonymous_variant	55867			AB026116	CCDS8074.1	11q13.3	2013-05-22	2008-01-11		ENSG00000168065	ENSG00000168065		"""Solute carriers"""	18120	protein-coding gene	gene with protein product		607097				10660625, 15576633, 17229912	Standard	NM_018484		Approved	OAT4	uc001oai.3	Q9NSA0	OTTHUMG00000045142	ENST00000301891.4:c.327C>T	11.37:g.64323798C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	64080374	A8K426|Q53GR2|Q6ZP72|Q8NBU4	Silent	SNP	ENST00000301891.4	37	CCDS8074.1	SNP	17	WashU																																																																																				0.682	SLC22A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104886.4	NM_018484		Silent
PPFIA2	8499	genome.wustl.edu	37	12	81747071	81747071	+	Silent	SNP	T	T	A			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:81747071T>A	ENST00000549396.1	-	17	1981	c.1821A>T	c.(1819-1821)ggA>ggT	p.G607G	PPFIA2_ENST00000550584.2_Silent_p.G607G|PPFIA2_ENST00000548586.1_Silent_p.G607G|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000552948.1_Silent_p.G607G|PPFIA2_ENST00000550359.2_Silent_p.G454G|PPFIA2_ENST00000333447.7_Silent_p.G589G|PPFIA2_ENST00000443686.3_Silent_p.G508G|PPFIA2_ENST00000407050.4_Silent_p.G533G|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000549325.1_Silent_p.G589G|PPFIA2_ENST00000541570.2_Silent_p.G174G	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	607					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.G607G(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGCTTAGTACTCCAATCTGTT	0.363																																																1	Substitution - coding silent(1)	ovary(1)	12											137.0	131.0	133.0					12																	81747071		1889	4124	6013	80271202	SO:0001819	synonymous_variant	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1821A>T	12.37:g.81747071T>A		Somatic		Capture	Illumina GAIIx	4	80271202	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Silent	SNP	ENST00000549396.1	37	CCDS55857.1	SNP	54	WashU																																																																																				0.363	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1			Silent
SH2B3	10019	genome.wustl.edu	37	12	111885191	111885191	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr12:111885191C>G	ENST00000341259.2	+	6	1436	c.1079C>G	c.(1078-1080)tCc>tGc	p.S360C	SH2B3_ENST00000538307.1_Missense_Mutation_p.S158C	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	360					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)	p.S360C(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CATTTCCTGTCCTGCTACCCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	78.0	77.0					12																	111885191		2203	4300	6503	110369574	SO:0001583	missense	10019			AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1079C>G	12.37:g.111885191C>G	ENSP00000345492:p.Ser360Cys	Somatic		Capture	Illumina GAIIx	4	110369574	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	37	CCDS9153.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823444	0.71143	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.64260	-0.09;-0.09	5.0	5.0	0.66597	SH2 motif (1);	0.103470	0.64402	D	0.000002	T	0.77232	0.4100	M	0.66939	2.045	0.47476	D	0.999436	D;D;D	0.76494	0.999;0.997;0.999	D;P;D	0.65010	0.931;0.854;0.931	T	0.80086	-0.1529	10	0.87932	D	0	-16.7114	18.6561	0.91455	0.0:1.0:0.0:0.0	.	158;224;360	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	C	360;170;158	ENSP00000345492:S360C;ENSP00000440597:S158C	ENSP00000345492:S360C	S	+	2	0	SH2B3	110369574	0.994000	0.37717	1.000000	0.80357	0.983000	0.72400	2.310000	0.43708	2.482000	0.83794	0.462000	0.41574	TCC		0.612	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475		Missense_Mutation
TPTE2	93492	genome.wustl.edu	37	13	20056660	20056660	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr13:20056660T>G	ENST00000400230.2	-	4	191	c.147A>C	c.(145-147)gaA>gaC	p.E49D	TPTE2_ENST00000382975.4_Missense_Mutation_p.E49D|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382977.4_Missense_Mutation_p.E49D|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382978.1_Missense_Mutation_p.E49D|TPTE2_ENST00000457266.2_Missense_Mutation_p.E49D|TPTE2_ENST00000400103.2_Missense_Mutation_p.E49D			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	49					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CATCTTCAACTTCAAACTTGG	0.328																																																0			13											53.0	52.0	53.0					13																	20056660		2201	4299	6500	18954660	SO:0001583	missense	93492			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.147A>C	13.37:g.20056660T>G	ENSP00000383089:p.Glu49Asp	Somatic		Capture	Illumina GAIIx	4	18954660	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	2.926	-0.222039	0.06061	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.96365	-3.64;-3.99;-3.48;-3.48;-3.64;-3.99	0.235	0.235	0.15431	.	0.398507	0.24165	U	0.040957	D	0.92021	0.7472	L	0.50333	1.59	0.09310	N	1	B;B	0.16166	0.009;0.016	B;B	0.12156	0.005;0.007	T	0.82210	-0.0570	8	.	.	.	-0.0187	.	.	.	.	49;49	A8MX64;Q6XPS3	.;TPTE2_HUMAN	D	49	ENSP00000372438:E49D;ENSP00000382974:E49D;ENSP00000383089:E49D;ENSP00000372437:E49D;ENSP00000372435:E49D;ENSP00000442218:E49D	.	E	-	3	2	TPTE2	18954660	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.419000	0.02460	0.263000	0.21812	0.260000	0.18958	GAA		0.328	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254		Missense_Mutation
RFXAP	5994	genome.wustl.edu	37	13	37394092	37394092	+	Nonsense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr13:37394092G>T	ENST00000255476.2	+	1	732	c.598G>T	c.(598-600)Gag>Tag	p.E200*		NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	200					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.E200*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		CGTCAAACTCGAGGTATCAGA	0.542																																																1	Substitution - Nonsense(1)	ovary(1)	13											43.0	44.0	43.0					13																	37394092		2203	4300	6503	36292092	SO:0001587	stop_gained	5994			Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.598G>T	13.37:g.37394092G>T	ENSP00000255476:p.Glu200*	Somatic		Capture	Illumina GAIIx	PhaseIII	36292092	B2R9T8|Q5VZM6|Q8TC40	Nonsense_Mutation	SNP	ENST00000255476.2	37	CCDS9359.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	36	5.824135	0.96989	.	.	ENSG00000133111	ENST00000255476	.	.	.	4.93	4.93	0.64822	.	0.053706	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-12.3859	13.6305	0.62191	0.0:0.0:1.0:0.0	.	.	.	.	X	200	.	ENSP00000255476:E200X	E	+	1	0	RFXAP	36292092	1.000000	0.71417	0.999000	0.59377	0.365000	0.29674	4.233000	0.58651	2.286000	0.76751	0.655000	0.94253	GAG		0.542	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044521.1	NM_000538		Nonsense_Mutation
CLEC14A	161198	genome.wustl.edu	37	14	38723783	38723783	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr14:38723783T>C	ENST00000342213.2	-	1	1791	c.1445A>G	c.(1444-1446)gAg>gGg	p.E482G		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	482						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.E482G(1)		breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		AAGAGGGGACTCCGCCAGCAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	14											70.0	72.0	71.0					14																	38723783		2203	4300	6503	37793534	SO:0001583	missense	161198				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1445A>G	14.37:g.38723783T>C	ENSP00000353013:p.Glu482Gly	Somatic		Capture	Illumina GAIIx	4	37793534	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	37	CCDS9667.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	2.606	-0.291862	0.05568	.	.	ENSG00000176435	ENST00000342213	T	0.73258	-0.73	4.64	-4.6	0.03390	.	1.895300	0.03486	N	0.215908	T	0.43765	0.1262	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47799	-0.9089	10	0.07482	T	0.82	-3.2284	11.8667	0.52496	0.0:0.2657:0.0:0.7343	.	482	Q86T13	CLC14_HUMAN	G	482	ENSP00000353013:E482G	ENSP00000353013:E482G	E	-	2	0	CLEC14A	37793534	0.000000	0.05858	0.008000	0.14137	0.123000	0.20343	-1.247000	0.02893	-0.835000	0.04234	-0.313000	0.08912	GAG		0.542	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060		Missense_Mutation
SALL1	6299	genome.wustl.edu	37	16	51174403	51174403	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr16:51174403G>T	ENST00000251020.4	-	2	1763	c.1730C>A	c.(1729-1731)cCc>cAc	p.P577H	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.P480H|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	577					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P577H(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GATGGGGATGGGGGCTGGCTC	0.612																																					GBM(103;1352 1446 1855 4775 8890)											1	Substitution - Missense(1)	ovary(1)	16											39.0	45.0	43.0					16																	51174403		2198	4300	6498	49731904	SO:0001583	missense	6299			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1730C>A	16.37:g.51174403G>T	ENSP00000251020:p.Pro577His	Somatic		Capture	Illumina GAIIx	PhaseIII	49731904	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907035	0.52333	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09255	3.01;3.0	5.32	5.32	0.75619	.	0.054759	0.85682	D	0.000000	T	0.21267	0.0512	L	0.44542	1.39	0.43579	D	0.995913	D	0.69078	0.997	P	0.55667	0.781	T	0.00514	-1.1695	10	0.33141	T	0.24	.	18.9957	0.92812	0.0:0.0:1.0:0.0	.	577	Q9NSC2	SALL1_HUMAN	H	577;480;541	ENSP00000251020:P577H;ENSP00000407914:P480H	ENSP00000251020:P577H	P	-	2	0	SALL1	49731904	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.080000	0.64437	2.475000	0.83589	0.557000	0.71058	CCC		0.612	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		Missense_Mutation
KIF18B	146909	genome.wustl.edu	37	17	43011389	43011389	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr17:43011389T>C	ENST00000593135.1	-	7	1061	c.964A>G	c.(964-966)Aca>Gca	p.T322A	KIF18B_ENST00000438933.2_Missense_Mutation_p.T322A|KIF18B_ENST00000339151.4_Missense_Mutation_p.T322A|KIF18B_ENST00000590129.1_Missense_Mutation_p.T331A|KIF18B_ENST00000587309.1_Missense_Mutation_p.T322A	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	331	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.T322A(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				ATCATCACTGTGCGGCAGTTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	17											45.0	48.0	47.0					17																	43011389		2142	4276	6418	40366915	SO:0001583	missense	146909				CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.964A>G	17.37:g.43011389T>C	ENSP00000465992:p.Thr322Ala	Somatic		Capture	Illumina GAIIx	4	40366915	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Missense_Mutation	SNP	ENST00000593135.1	37	CCDS45709.2	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	31	5.079300	0.94050	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	T;T	0.76968	-1.06;-1.06	5.5	5.5	0.81552	Kinesin, motor domain (4);	0.000000	0.36591	N	0.002503	D	0.90079	0.6901	M	0.90595	3.13	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.92165	0.5739	10	0.87932	D	0	.	15.6238	0.76833	0.0:0.0:0.0:1.0	.	331;331;331	Q86Y91;Q86Y91-3;Q86Y91-2	KI18B_HUMAN;.;.	A	322	ENSP00000412798:T322A;ENSP00000341466:T322A	ENSP00000341466:T322A	T	-	1	0	KIF18B	40366915	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.131000	0.64751	2.099000	0.63709	0.528000	0.53228	ACA		0.622	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	NM_001080443		Missense_Mutation
PLCD4	84812	genome.wustl.edu	37	2	219496889	219496889	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:219496889A>G	ENST00000450993.2	+	10	1642	c.1303A>G	c.(1303-1305)Aag>Gag	p.K435E	PLCD4_ENST00000432688.1_Missense_Mutation_p.K435E|PLCD4_ENST00000417849.1_Missense_Mutation_p.K435E|RP11-548H3.1_ENST00000607946.1_RNA	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	435	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.K435E(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGTGAAGGGGAAGAAGTTAAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											39.0	40.0	40.0					2																	219496889		1922	4124	6046	219205133	SO:0001583	missense	84812			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1303A>G	2.37:g.219496889A>G	ENSP00000388631:p.Lys435Glu	Somatic		Capture	Illumina GAIIx	4	219205133	Q53FS8	Missense_Mutation	SNP	ENST00000450993.2	37	CCDS46516.1	SNP	9	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	32|32	5.148990|5.148990	0.94645|0.94645	.|.	.|.	ENSG00000115556|ENSG00000115556	ENST00000457426|ENST00000450993;ENST00000251959;ENST00000417849;ENST00000432688	.|T;T;T	.|0.72282	.|-0.64;-0.64;-0.64	5.46|5.46	5.46|5.46	0.80206|0.80206	.|PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	.|0.150308	.|0.56097	.|D	.|0.000029	D|D	0.90930|0.90930	0.7149|0.7149	H|H	0.99156|0.99156	4.45|4.45	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.94555|0.94555	0.7757|0.7757	6|10	0.37606|0.87932	T|D	0.19|0	.|.	15.3824|15.3824	0.74669|0.74669	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|435	.|Q9BRC7	.|PLCD4_HUMAN	G|E	268|435	.|ENSP00000388631:K435E;ENSP00000396942:K435E;ENSP00000396185:K435E	ENSP00000396411:E268G|ENSP00000251959:K435E	E|K	+|+	2|1	0|0	PLCD4|PLCD4	219205133|219205133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	7.944000|7.944000	0.87722|0.87722	2.291000|2.291000	0.77112|0.77112	0.533000|0.533000	0.62120|0.62120	GAA|AAG		0.507	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1			Missense_Mutation
MLPH	79083	genome.wustl.edu	37	2	238449122	238449122	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr2:238449122G>C	ENST00000264605.3	+	10	1530	c.1236G>C	c.(1234-1236)aaG>aaC	p.K412N	MLPH_ENST00000445024.2_Missense_Mutation_p.K412N|MLPH_ENST00000338530.4_Missense_Mutation_p.K384N|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000410032.1_Missense_Mutation_p.K269N|MLPH_ENST00000409373.1_Missense_Mutation_p.K344N	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	412					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)	p.K412N(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		AGGACGAAAAGGCAGAGCCCA	0.612																																																1	Substitution - Missense(1)	ovary(1)	2											76.0	75.0	75.0					2																	238449122		2202	4299	6501	238113861	SO:0001583	missense	79083			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.1236G>C	2.37:g.238449122G>C	ENSP00000264605:p.Lys412Asn	Somatic		Capture	Illumina GAIIx	PhaseIII	238113861	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	ENST00000264605.3	37	CCDS2518.1	SNP	35	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	8.584|8.584|8.584	0.882963|0.882963|0.882963	0.17467|0.17467|0.17467	.|.|.	.|.|.	ENSG00000115648|ENSG00000115648|ENSG00000115648	ENST00000415753|ENST00000410032;ENST00000264605;ENST00000445024;ENST00000338530;ENST00000409373;ENST00000437893|ENST00000436965	.|T;T;T;T;T;T|.	.|0.27256|.	.|1.72;1.99;1.72;1.81;1.68;1.74|.	4.96|4.96|4.96	3.0|3.0|3.0	0.34707|0.34707|0.34707	.|.|.	.|3.323010|.	.|0.00916|.	.|N|.	.|0.002529|.	T|T|T	0.36276|0.36276|0.36276	0.0961|0.0961|0.0961	L|L|L	0.43152|0.43152|0.43152	1.355|1.355|1.355	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;P;P;B;P;P;P|.	.|0.43094|.	.|0.118;0.167;0.495;0.698;0.372;0.799;0.514;0.73|.	.|B;B;B;B;B;B;B;B|.	.|0.41202|.	.|0.037;0.034;0.077;0.156;0.114;0.297;0.106;0.35|.	T|T|T	0.21449|0.21449|0.21449	-1.0245|-1.0245|-1.0245	5|10|5	.|0.20046|.	.|T|.	.|0.44|.	-0.3676|-0.3676|-0.3676	5.7153|5.7153|5.7153	0.17956|0.17956|0.17956	0.1082:0.0:0.7034:0.1883|0.1082:0.0:0.7034:0.1883|0.1082:0.0:0.7034:0.1883	.|.|.	.|73;412;268;384;344;384;412;269|.	.|Q53QV8;B4DKW7;Q6UWC1;A8KA64;B8ZZ97;Q9BV36-2;Q9BV36;G5E9G5|.	.|.;.;.;.;.;.;MELPH_HUMAN;.|.	R|N|T	100|269;412;412;384;344;172|133	.|ENSP00000386338:K269N;ENSP00000264605:K412N;ENSP00000414849:K412N;ENSP00000341845:K384N;ENSP00000386780:K344N;ENSP00000412438:K172N|.	.|ENSP00000264605:K412N|.	G|K|R	+|+|+	1|3|2	0|2|0	MLPH|MLPH|MLPH	238113861|238113861|238113861	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.002000|0.002000|0.002000	0.10522|0.10522|0.10522	0.047000|0.047000|0.047000	0.14425|0.14425|0.14425	0.025000|0.025000|0.025000	0.13577|0.13577|0.13577	1.043000|1.043000|1.043000	0.40175|0.40175|0.40175	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GGC|AAG|AGG		0.612	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101		Missense_Mutation
PARP9	83666	genome.wustl.edu	37	3	122277231	122277231	+	Silent	SNP	G	G	T			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:122277231G>T	ENST00000360356.2	-	3	326	c.99C>A	c.(97-99)atC>atA	p.I33I	PARP9_ENST00000462315.1_Intron|PARP9_ENST00000477522.2_Intron|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Intron	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	33					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.I33I(1)		endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		ACTGAGGAAAGATCTGAGCAA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	3											127.0	117.0	120.0					3																	122277231		2203	4300	6503	123759921	SO:0001819	synonymous_variant	83666			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.99C>A	3.37:g.122277231G>T		Somatic		Capture	Illumina GAIIx	PhaseIII	123759921	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	ENST00000360356.2	37	CCDS3014.1	SNP	33	WashU																																																																																				0.493	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458		Silent
MED12L	116931	genome.wustl.edu	37	3	151067973	151067973	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr3:151067973A>G	ENST00000474524.1	+	15	2310	c.2272A>G	c.(2272-2274)Aag>Gag	p.K758E	MED12L_ENST00000273432.4_Missense_Mutation_p.K618E|P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000491549.1_3'UTR	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	758						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.K758E(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTAAATAAGAAGAGCACCAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											99.0	103.0	102.0					3																	151067973		2203	4300	6503	152550663	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2272A>G	3.37:g.151067973A>G	ENSP00000417235:p.Lys758Glu	Somatic		Capture	Illumina GAIIx	4	152550663	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	28.3	4.909136	0.92107	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.69806	-0.25;-0.43	5.81	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.78704	0.4325	M	0.65975	2.015	0.80722	D	1	D;B	0.89917	1.0;0.384	D;B	0.87578	0.998;0.159	T	0.79787	-0.1656	10	0.87932	D	0	-31.5076	11.1202	0.48284	0.9279:0.0:0.0721:0.0	.	618;758	F8WAE6;Q86YW9	.;MD12L_HUMAN	E	758;618	ENSP00000417235:K758E;ENSP00000273432:K618E	ENSP00000273432:K618E	K	+	1	0	MED12L	152550663	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.474000	0.90413	1.051000	0.40369	0.455000	0.32223	AAG		0.443	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		Missense_Mutation
GFRA3	2676	genome.wustl.edu	37	5	137593528	137593528	+	Silent	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr5:137593528G>C	ENST00000274721.3	-	4	831	c.585C>G	c.(583-585)gtC>gtG	p.V195V	GFRA3_ENST00000378362.3_Silent_p.V164V	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	195					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)	p.V195V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCCTGAGGCAGACGTGGCGCT	0.672																																																1	Substitution - coding silent(1)	ovary(1)	5											25.0	26.0	26.0					5																	137593528		2203	4298	6501	137621427	SO:0001819	synonymous_variant	2676			AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.585C>G	5.37:g.137593528G>C		Somatic		Capture	Illumina GAIIx	PhaseIII	137621427	B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Silent	SNP	ENST00000274721.3	37	CCDS4201.1	SNP	33	WashU																																																																																				0.672	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251277.1	NM_001496		Silent
RUFY1	80230	genome.wustl.edu	37	5	179016625	179016625	+	Missense_Mutation	SNP	G	G	C			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr5:179016625G>C	ENST00000319449.4	+	9	1117	c.1105G>C	c.(1105-1107)Gaa>Caa	p.E369Q	RUFY1_ENST00000393438.2_Missense_Mutation_p.E261Q|RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Missense_Mutation_p.E261Q	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	369					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.E261Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATTAATTCGAGAAAGAAGTGA	0.383										HNSCC(44;0.11)																																						1	Substitution - Missense(1)	ovary(1)	5											102.0	101.0	101.0					5																	179016625		2203	4300	6503	178949231	SO:0001583	missense	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1105G>C	5.37:g.179016625G>C	ENSP00000325594:p.Glu369Gln	Somatic		Capture	Illumina GAIIx	4	178949231	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.04|12.04	1.818166|1.818166	0.32145|0.32145	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000508609|ENST00000319449;ENST00000437570;ENST00000393438	.|T;T;T	.|0.55234	.|0.53;0.56;0.56	5.47|5.47	3.64|3.64	0.41730|0.41730	.|.	0.094982|0.094982	0.64402|0.64402	D|N	0.000001|0.000001	T|T	0.36853|0.36853	0.0982|0.0982	L|L	0.28458|0.28458	0.855|0.855	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	T|T	0.09465|0.09465	-1.0673|-1.0673	6|10	.|0.23302	.|T	.|0.38	-14.673|-14.673	9.472|9.472	0.38849|0.38849	0.0711:0.2748:0.6542:0.0|0.0711:0.2748:0.6542:0.0	.|.	.|369	.|Q96T51	.|RUFY1_HUMAN	D|Q	157|369;261;261	.|ENSP00000325594:E369Q;ENSP00000390025:E261Q;ENSP00000377087:E261Q	.|ENSP00000325594:E369Q	E|E	+|+	3|1	2|0	RUFY1|RUFY1	178949231|178949231	1.000000|1.000000	0.71417|0.71417	0.699000|0.699000	0.30290|0.30290	0.982000|0.982000	0.71751|0.71751	3.223000|3.223000	0.51231|0.51231	0.651000|0.651000	0.30788|0.30788	0.549000|0.549000	0.68633|0.68633	GAG|GAA		0.383	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451		Missense_Mutation
RREB1	6239	genome.wustl.edu	37	6	7231751	7231751	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr6:7231751C>T	ENST00000349384.6	+	10	3733	c.3419C>T	c.(3418-3420)tCt>tTt	p.S1140F	RREB1_ENST00000334984.6_Missense_Mutation_p.S1140F|RREB1_ENST00000379933.3_Missense_Mutation_p.S1140F|RREB1_ENST00000379938.2_Missense_Mutation_p.S1140F	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1140					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S1140F(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GAGGCTGCCTCTCCCACCGAG	0.701																																																1	Substitution - Missense(1)	ovary(1)	6											8.0	11.0	10.0					6																	7231751		2161	4252	6413	7176750	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.3419C>T	6.37:g.7231751C>T	ENSP00000305560:p.Ser1140Phe	Somatic		Capture	Illumina GAIIx	4	7176750	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512916	0.27123	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.11385	2.93;2.91;2.93;2.78	5.73	4.85	0.62838	.	0.542866	0.16735	N	0.201692	T	0.09555	0.0235	L	0.60455	1.87	0.39057	D	0.960452	P;P;D	0.53462	0.859;0.933;0.96	B;B;P	0.46253	0.428;0.401;0.509	T	0.05338	-1.0891	10	0.46703	T	0.11	-16.3516	15.1726	0.72888	0.0:0.9313:0.0:0.0687	.	1140;1140;1140	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	F	1140	ENSP00000369265:S1140F;ENSP00000369270:S1140F;ENSP00000305560:S1140F;ENSP00000335574:S1140F	ENSP00000335574:S1140F	S	+	2	0	RREB1	7176750	0.001000	0.12720	0.025000	0.17156	0.041000	0.13682	0.668000	0.25127	1.384000	0.46424	0.655000	0.94253	TCT		0.701	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1			Missense_Mutation
CBX3	11335	genome.wustl.edu	37	7	26242620	26242620	+	Start_Codon_SNP	SNP	T	T	G			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:26242620T>G	ENST00000337620.4	+	2	430	c.2T>G	c.(1-3)aTg>aGg	p.M1R	CBX3_ENST00000497498.1_3'UTR|HNRNPA2B1_ENST00000354667.4_5'Flank|HNRNPA2B1_ENST00000356674.7_5'Flank|CBX3_ENST00000409747.1_Start_Codon_SNP_p.M1R|CBX3_ENST00000396386.2_Start_Codon_SNP_p.M1R	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	1					chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)	p.M1R(1)		endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						CAATAAAAAATGGCCTCCAAC	0.308																																																1	Substitution - Missense(1)	ovary(1)	7											100.0	103.0	102.0					7																	26242620		2203	4299	6502	26209145	SO:0001582	initiator_codon_variant	11335			U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.2T>G	7.37:g.26242620T>G	ENSP00000336687:p.Met1Arg	Somatic		Capture	Illumina GAIIx	4	26209145	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Missense_Mutation	SNP	ENST00000337620.4	37	CCDS5398.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	15.42	2.827758	0.50845	.	.	ENSG00000122565	ENST00000337620;ENST00000396386;ENST00000456948;ENST00000409747	T;T;T	0.52295	0.9;0.9;0.67	5.25	5.25	0.73442	.	0.165530	0.52532	D	0.000067	T	0.65801	0.2726	.	.	.	0.49130	D	0.999755	P;B	0.50156	0.932;0.042	P;B	0.60886	0.88;0.042	T	0.70230	-0.4929	9	0.87932	D	0	.	14.0217	0.64560	0.0:0.0:0.0:1.0	.	1;1	B8ZZ43;Q13185	.;CBX3_HUMAN	R	1	ENSP00000336687:M1R;ENSP00000379670:M1R;ENSP00000408672:M1R	ENSP00000336687:M1R	M	+	2	0	CBX3	26209145	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.892000	0.63193	2.093000	0.63338	0.459000	0.35465	ATG		0.308	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	Missense_Mutation	Missense_Mutation
GNB2	2783	genome.wustl.edu	37	7	100275154	100275154	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0930-01	TCGA-10-0930-11	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr7:100275154A>G	ENST00000303210.4	+	6	783	c.301A>G	c.(301-303)Atg>Gtg	p.M101V	GNB2_ENST00000419828.1_Start_Codon_SNP_p.M1V|GNB2_ENST00000393924.1_Missense_Mutation_p.M101V|GNB2_ENST00000427895.1_Start_Codon_SNP_p.M1V|GNB2_ENST00000424361.1_Missense_Mutation_p.M57V|GNB2_ENST00000393926.1_Missense_Mutation_p.M101V|GNB2_ENST00000436220.1_Missense_Mutation_p.M57V	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	101					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.M101V(1)		endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				CTCCTGGGTAATGACCTGTGC	0.677																																																1	Substitution - Missense(1)	ovary(1)	7											51.0	54.0	53.0					7																	100275154		2202	4300	6502	100113090	SO:0001583	missense	2783			M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.301A>G	7.37:g.100275154A>G	ENSP00000305260:p.Met101Val	Somatic		Capture	Illumina GAIIx	PhaseIII	100113090	B3KPU1|P11016|P54312	Missense_Mutation	SNP	ENST00000303210.4	37	CCDS5703.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	.	20.9	4.060640	0.76074	.	.	ENSG00000172354	ENST00000303210;ENST00000451587;ENST00000436220;ENST00000424361;ENST00000419828;ENST00000427895;ENST00000393926;ENST00000431068;ENST00000412215;ENST00000393924	T;T;T;T;T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.29;0.29;0.22;0.22;0.22;0.22	5.17	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.046925	0.85682	N	0.000000	T	0.69441	0.3111	M	0.86573	2.825	0.51233	D	0.99991	B	0.30236	0.274	P	0.44811	0.461	T	0.73965	-0.3816	10	0.87932	D	0	-1.6969	8.4296	0.32750	0.9072:0.0:0.0928:0.0	.	101	P62879	GBB2_HUMAN	V	101;101;57;57;1;1;101;101;101;101	ENSP00000305260:M101V;ENSP00000399904:M101V;ENSP00000401873:M57V;ENSP00000389391:M57V;ENSP00000390543:M1V;ENSP00000400286:M1V;ENSP00000377503:M101V;ENSP00000390077:M101V;ENSP00000413219:M101V;ENSP00000377501:M101V	ENSP00000305260:M101V	M	+	1	0	GNB2	100113090	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.531000	0.81973	1.958000	0.56883	0.379000	0.24179	ATG		0.677	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	NM_005273		Missense_Mutation
ALPK2	115701	genome.wustl.edu	37	18	56205396	56205396	+	Missense_Mutation	SNP	C	C	G			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr18:56205396C>G	ENST00000361673.3	-	5	2236	c.2023G>C	c.(2023-2025)Gag>Cag	p.E675Q	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	675						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E41Q(1)|p.E675Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CCAGCAGGCTCTGAGAAAGCT	0.458																																																2	Substitution - Missense(2)	ovary(2)	18											47.0	46.0	46.0					18																	56205396		2203	4294	6497	54356376	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2023G>C	18.37:g.56205396C>G	ENSP00000354991:p.Glu675Gln	Somatic		Capture	Illumina GAIIx	PhaseIII	54356376	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889929	0.72524	.	.	ENSG00000198796	ENST00000361673	T	0.52057	0.68	5.76	4.88	0.63580	.	2.593350	0.01338	N	0.011486	T	0.57272	0.2042	L	0.50333	1.59	0.09310	N	1	D;P	0.56035	0.974;0.807	P;B	0.49421	0.61;0.197	T	0.47355	-0.9124	10	0.36615	T	0.2	-4.604	12.9286	0.58275	0.0:0.8375:0.1625:0.0	.	675;675	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	Q	675	ENSP00000354991:E675Q	ENSP00000354991:E675Q	E	-	1	0	ALPK2	54356376	0.001000	0.12720	0.008000	0.14137	0.566000	0.35808	0.774000	0.26675	1.423000	0.47198	0.655000	0.94253	GAG		0.458	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		Missense_Mutation
ANO8	57719	genome.wustl.edu	37	19	17438567	17438567	+	Silent	SNP	G	G	A			TCGA-10-0930-01	TCGA-10-0930-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr19:17438567G>A	ENST00000159087.4	-	14	2507	c.2349C>T	c.(2347-2349)gaC>gaT	p.D783D		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	783					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.D783D(1)		autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GCTTGAAGGCGTCGCTGCGGA	0.647																																																1	Substitution - coding silent(1)	ovary(1)	19											80.0	77.0	78.0					19																	17438567		2203	4300	6503	17299567	SO:0001819	synonymous_variant	57719			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.2349C>T	19.37:g.17438567G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	17299567	A6NIJ0	Silent	SNP	ENST00000159087.4	37	CCDS32949.1	SNP	40	WashU																																																																																				0.647	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644		Silent
APCDD1L	164284	genome.wustl.edu	37	20	57045705	57045705	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0930-01	TCGA-10-0930-11	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr20:57045705T>C	ENST00000371149.3	-	2	378	c.148A>G	c.(148-150)Atc>Gtc	p.I50V	APCDD1L_ENST00000439429.1_Missense_Mutation_p.I61V	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	50						integral component of membrane (GO:0016021)		p.I50V(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GGAGGCAGGATCGCAGTGCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	20											58.0	46.0	50.0					20																	57045705		2201	4297	6498	56479111	SO:0001583	missense	164284			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.148A>G	20.37:g.57045705T>C	ENSP00000360191:p.Ile50Val	Somatic		Capture	Illumina GAIIx	PhaseIII	56479111		Missense_Mutation	SNP	ENST00000371149.3	37	CCDS13467.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	T	5.398	0.258675	0.10239	.	.	ENSG00000198768	ENST00000371149;ENST00000439429;ENST00000425773	T;T;T	0.29917	2.35;2.35;1.55	4.52	-1.61	0.08399	.	1.013520	0.07890	N	0.971044	T	0.12689	0.0308	N	0.03115	-0.41	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.04013	0.0;0.001	T	0.30995	-0.9959	10	0.28530	T	0.3	-11.4204	8.109	0.30903	0.0:0.3077:0.3755:0.3168	.	61;50	F5H6V6;Q8NCL9	.;APCDL_HUMAN	V	50;61;61	ENSP00000360191:I50V;ENSP00000413261:I61V;ENSP00000396856:I61V	ENSP00000360191:I50V	I	-	1	0	APCDD1L	56479111	0.001000	0.12720	0.002000	0.10522	0.006000	0.05464	0.787000	0.26858	0.097000	0.17492	-0.899000	0.02877	ATC		0.642	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360		Missense_Mutation
SGSM1	129049	genome.wustl.edu	37	22	25243735	25243735	+	Nonsense_Mutation	SNP	C	C	T			TCGA-10-0930-01	TCGA-10-0930-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-10-0930-01	TCGA-10-0930-11	g.chr22:25243735C>T	ENST00000400359.4	+	4	281	c.274C>T	c.(274-276)Caa>Taa	p.Q92*	SGSM1_ENST00000400358.4_Nonsense_Mutation_p.Q92*	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	92	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)	p.Q92*(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CCGCAAGGTGCAAGACCTGGA	0.607																																																1	Substitution - Nonsense(1)	ovary(1)	22											21.0	22.0	22.0					22																	25243735		2013	4194	6207	23573735	SO:0001587	stop_gained	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.274C>T	22.37:g.25243735C>T	ENSP00000383212:p.Gln92*	Somatic		Capture	Illumina GAIIx	PhaseIII	23573735	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Nonsense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.574848	0.96553	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	.	.	.	3.95	3.95	0.45737	.	0.109678	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-1.2255	15.5526	0.76164	0.0:1.0:0.0:0.0	.	.	.	.	X	67;92;92	.	ENSP00000383211:Q92X	Q	+	1	0	SGSM1	23573735	1.000000	0.71417	0.999000	0.59377	0.770000	0.43624	5.785000	0.68998	2.221000	0.72209	0.460000	0.39030	CAA		0.607	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318		Nonsense_Mutation
