#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACTR1B	10120	hgsc.bcm.edu	37	2	98275813	98275813	+	Splice_Site	SNP	A	A	G			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:98275813A>G	ENST00000289228.5	-	4	532		c.e4+1			NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.?(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						CAGCCGCCACACCTCCTCCGA	0.607																																																1	Unknown(1)	ovary(1)	2											136.0	106.0	116.0					2																	98275813		2203	4300	6503	97642245	SO:0001630	splice_region_variant	10120			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.315+1T>C	2.37:g.98275813A>G		Somatic		Capture	SOLID	Phase_IV	97642245	D3DVH2|Q53SK5|Q9BRB7	Splice_Site_SNP	SNP	ENST00000289228.5	37	CCDS2033.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.01	1.809104	0.31961	.	.	ENSG00000115073	ENST00000289228	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1602	0.59540	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ACTR1B	97642245	1.000000	0.71417	0.941000	0.38009	0.190000	0.23558	8.933000	0.92911	2.010000	0.58986	0.454000	0.30748	.		0.607	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	Intron	Splice_Site_SNP
ADCY5	111	hgsc.bcm.edu	37	3	123005609	123005609	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:123005609G>T	ENST00000462833.1	-	20	4792	c.3580C>A	c.(3580-3582)Cct>Act	p.P1194T	ADCY5_ENST00000309879.5_Missense_Mutation_p.P844T|RP11-797D24.4_ENST00000608436.1_RNA|ADCY5_ENST00000491190.1_Missense_Mutation_p.P852T	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1194	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P1194S(1)|p.P1194T(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		TCGTACTGAGGCTTTCGTGCC	0.622											OREG0015741	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				2	Substitution - Missense(2)	ovary(1)|lung(1)	3											167.0	114.0	132.0					3																	123005609		2203	4300	6503	124488299	SO:0001583	missense	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3580C>A	3.37:g.123005609G>T	ENSP00000419361:p.Pro1194Thr	Somatic	1523	Capture	SOLID	Phase_IV	124488299	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	34	5.365308	0.95877	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;T	0.33438	1.41;1.41;1.41	4.99	4.99	0.66335	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000001	T	0.73636	0.3612	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	D	0.85369	0.1112	10	0.72032	D	0.01	.	18.4657	0.90753	0.0:0.0:1.0:0.0	.	1194;852	O95622;B3KWA8	ADCY5_HUMAN;.	T	1194;852;844	ENSP00000419361:P1194T;ENSP00000418537:P852T;ENSP00000308685:P844T	ENSP00000308685:P844T	P	-	1	0	ADCY5	124488299	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.657000	0.98554	2.595000	0.87683	0.563000	0.77884	CCT		0.622	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		Missense_Mutation
ATG9B	285973	hgsc.bcm.edu	37	7	150721217	150721218	+	Frame_Shift_Ins	INS	-	-	G			TCGA-10-0938-01	TCGA-10-0938-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr7:150721217_150721218insG	ENST00000377974.2	-	1	368_369	c.293_294insC	c.(292-294)ccafs	p.P98fs	ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605952.1_Frame_Shift_Ins_p.P98fs|ATG9B_ENST00000444312.1_5'UTR|ATG9B_ENST00000605938.1_Frame_Shift_Ins_p.P98fs			Q674R7	ATG9B_HUMAN	autophagy related 9B	98	Pro-rich.				autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)		p.T99fs*50(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGCCTGTGTTGGGGGGGTGGC	0.649																																																1	Insertion - Frameshift(1)	ovary(1)	7								29,3739		0,29,1855						1.5	0.0			19	21,7909		0,21,3944	no	frameshift	ATG9B	NM_173681.5		0,50,5799	A1A1,A1R,RR		0.2648,0.7696,0.4274				50,11648				150352151	SO:0001589	frameshift_variant	285973			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.294dupC	7.37:g.150721224_150721224dupG	ENSP00000475005:p.Pro98fs	Somatic		Capture	SOLID	Phase_IV	150352150	A1A5D3|Q6JRW5|Q8N8I8	Frame_Shift_Ins	INS	ENST00000377974.2	37		INS	63	Baylor																																																																																				0.649	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681		Frame_Shift_Ins
RPF2	84154	hgsc.bcm.edu	37	6	111320914	111320914	+	Splice_Site	SNP	G	G	T			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr6:111320914G>T	ENST00000441448.2	+	6	409	c.317G>T	c.(316-318)gGt>gTt	p.G106V		NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	106	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G106V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						TTCCTTCCAGGTCGTATGTAT	0.343																																																1	Substitution - Missense(1)	ovary(1)	6											154.0	148.0	150.0					6																	111320914		2203	4300	6503	111427607	SO:0001630	splice_region_variant	84154			AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.317-1G>T	6.37:g.111320914G>T		Somatic		Capture	SOLID	Phase_IV	111427607	Q5VXN1|Q8N4A1	Missense_Mutation	SNP	ENST00000441448.2	37	CCDS5088.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	g	20.5	4.000862	0.74818	.	.	ENSG00000197498	ENST00000441448;ENST00000368864;ENST00000425871	T;T;T	0.23754	1.89;1.89;1.89	4.98	4.98	0.66077	Brix domain (3);	0.049369	0.85682	D	0.000000	T	0.39358	0.1075	L	0.58510	1.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.05289	-1.0894	9	.	.	.	.	17.1854	0.86865	0.0:0.0:1.0:0.0	.	106;106	A8K800;Q9H7B2	.;RPF2_HUMAN	V	106;67;73	ENSP00000402338:G106V;ENSP00000357857:G67V;ENSP00000414026:G73V	.	G	+	2	0	RPF2	111427607	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.372000	0.79612	2.599000	0.87857	0.655000	0.94253	GGT		0.343	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041813.2	NM_032194	Missense_Mutation	Missense_Mutation
C10orf71	118461	hgsc.bcm.edu	37	10	50532316	50532316	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr10:50532316C>A	ENST00000374144.3	+	3	2014	c.1726C>A	c.(1726-1728)Cct>Act	p.P576T	C10orf71_ENST00000323868.4_Missense_Mutation_p.P576T			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	576								p.P576T(1)		endometrium(1)	1						CCAGAAGGACCCTACAGCTGA	0.552																																																1	Substitution - Missense(1)	ovary(1)	10											44.0	45.0	45.0					10																	50532316		1993	4175	6168	50202322	SO:0001583	missense	118461			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1726C>A	10.37:g.50532316C>A	ENSP00000363259:p.Pro576Thr	Somatic		Capture	SOLID	Phase_IV	50202322	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825097	0.50739	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.13901	2.55;3.68	5.48	4.52	0.55395	.	0.224852	0.22812	N	0.055339	T	0.14356	0.0347	L	0.51422	1.61	0.09310	N	1	P	0.47910	0.902	B	0.44133	0.442	T	0.14337	-1.0476	10	0.18710	T	0.47	.	10.9343	0.47237	0.2693:0.7307:0.0:0.0	.	576	Q711Q0-3	.	T	576	ENSP00000318713:P576T;ENSP00000363259:P576T	ENSP00000318713:P576T	P	+	1	0	C10orf71	50202322	0.006000	0.16342	0.104000	0.21259	0.046000	0.14306	1.017000	0.29989	2.587000	0.87381	0.591000	0.81541	CCT		0.552	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459		Missense_Mutation
CDA	978	hgsc.bcm.edu	37	1	20931489	20931489	+	Missense_Mutation	SNP	G	G	A	rs373566343		TCGA-10-0938-01	TCGA-10-0938-11	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:20931489G>A	ENST00000375071.3	+	2	405	c.223G>A	c.(223-225)Gtc>Atc	p.V75I	CDA_ENST00000461985.1_3'UTR	NM_001785.2	NP_001776.1	P32320	CDD_HUMAN	cytidine deaminase	75	CMP/dCMP deaminase zinc-binding.				cell surface receptor signaling pathway (GO:0007166)|cytidine deamination (GO:0009972)|cytosine metabolic process (GO:0019858)|negative regulation of cell growth (GO:0030308)|negative regulation of nucleotide metabolic process (GO:0045980)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine-containing compound salvage (GO:0008655)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	cytidine deaminase activity (GO:0004126)|nucleoside binding (GO:0001882)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.V75I(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	CCAGAAGGCCGTCTCAGAAGG	0.502																																					Pancreas(74;49 1356 2772 27818 40529)											1	Substitution - Missense(1)	ovary(1)	1						G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	100.0	88.0	92.0		223	-0.6	1.0	1		92	0,8600		0,0,4300	no	missense	CDA	NM_001785.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	75/147	20931489	1,13005	2203	4300	6503	20804076	SO:0001583	missense	978			BC054036	CCDS210.1	1p36.2-p35	2008-02-05			ENSG00000158825	ENSG00000158825	3.5.4.5		1712	protein-coding gene	gene with protein product		123920				8422236, 9878810	Standard	NM_001785		Approved	CDD	uc001bdk.3	P32320	OTTHUMG00000002845	ENST00000375071.3:c.223G>A	1.37:g.20931489G>A	ENSP00000364212:p.Val75Ile	Somatic		Capture	SOLID	Phase_IV	20804076		Missense_Mutation	SNP	ENST00000375071.3	37	CCDS210.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277759	0.40294	2.27E-4	0.0	ENSG00000158825	ENST00000375071	T	0.44482	0.92	5.74	-0.637	0.11504	APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.235598	0.44097	N	0.000486	T	0.26991	0.0661	L	0.35414	1.06	0.31936	N	0.611602	B	0.20261	0.043	B	0.19391	0.025	T	0.18555	-1.0333	10	0.27785	T	0.31	.	9.1543	0.36983	0.6065:0.0:0.3935:0.0	.	75	P32320	CDD_HUMAN	I	75	ENSP00000364212:V75I	ENSP00000364212:V75I	V	+	1	0	CDA	20804076	0.999000	0.42202	0.988000	0.46212	0.970000	0.65996	1.017000	0.29989	-0.374000	0.07967	-0.263000	0.10527	GTC		0.502	CDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007965.1	NM_001785		Missense_Mutation
CLCA2	9635	hgsc.bcm.edu	37	1	86890084	86890084	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:86890084C>A	ENST00000370565.4	+	1	316	c.154C>A	c.(154-156)Cct>Act	p.P52T		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	52					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.P52T(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TCCTCAGGTACCTGAGAATCA	0.413																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)											1	Substitution - Missense(1)	ovary(1)	1											78.0	70.0	73.0					1																	86890084		2203	4300	6503	86662672	SO:0001583	missense	9635				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.154C>A	1.37:g.86890084C>A	ENSP00000359596:p.Pro52Thr	Somatic		Capture	SOLID	Phase_IV	86662672	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967570	0.34754	.	.	ENSG00000137975	ENST00000370565;ENST00000439777	T	0.15718	2.4	5.87	2.61	0.31194	Chloride channel calcium-activated (1);	0.470541	0.21791	N	0.069061	T	0.06371	0.0164	M	0.70275	2.135	0.29583	N	0.849007	B	0.32653	0.379	B	0.28385	0.089	T	0.20438	-1.0275	10	0.62326	D	0.03	-2.3825	3.2469	0.06801	0.0:0.3113:0.2178:0.4708	.	52	Q9UQC9	CLCA2_HUMAN	T	52	ENSP00000359596:P52T	ENSP00000359596:P52T	P	+	1	0	CLCA2	86662672	0.025000	0.19082	0.768000	0.31515	0.766000	0.43426	0.715000	0.25822	0.626000	0.30322	0.650000	0.86243	CCT		0.413	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536		Missense_Mutation
C1orf27	54953	hgsc.bcm.edu	37	1	186355164	186355164	+	Silent	SNP	T	T	C			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:186355164T>C	ENST00000287859.6	+	4	404	c.279T>C	c.(277-279)ttT>ttC	p.F93F	C1orf27_ENST00000367470.3_Silent_p.F93F|C1orf27_ENST00000432021.3_Silent_p.F93F|C1orf27_ENST00000419367.3_Intron	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	93						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.F93F(1)		endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TTGGAGTATTTATTATTACTA	0.294																																																1	Substitution - coding silent(1)	ovary(1)	1											55.0	52.0	53.0					1																	186355164		1784	4061	5845	184621787	SO:0001819	synonymous_variant	54953			BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.279T>C	1.37:g.186355164T>C		Somatic		Capture	SOLID	Phase_IV	184621787	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Silent	SNP	ENST00000287859.6	37	CCDS53448.1	SNP	61	Baylor																																																																																				0.294	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847		Silent
CNTNAP5	129684	hgsc.bcm.edu	37	2	125175107	125175107	+	Silent	SNP	C	C	T			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:125175107C>T	ENST00000431078.1	+	4	833	c.469C>T	c.(469-471)Ctg>Ttg	p.L157L		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	157	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.L157L(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTTTGTGCCCCTGGAATGGAA	0.488																																																1	Substitution - coding silent(1)	ovary(1)	2											94.0	98.0	97.0					2																	125175107		1977	4166	6143	124891577	SO:0001819	synonymous_variant	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.469C>T	2.37:g.125175107C>T		Somatic		Capture	SOLID	Phase_IV	124891577	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1	SNP	24	Baylor																																																																																				0.488	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			Silent
DCHS1	8642	hgsc.bcm.edu	37	11	6652624	6652624	+	Silent	SNP	C	C	G			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr11:6652624C>G	ENST00000299441.3	-	8	4101	c.3690G>C	c.(3688-3690)gtG>gtC	p.V1230V	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1230	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCCCGGAGGCACGCGGTCTG	0.552																																																0			11											153.0	129.0	137.0					11																	6652624		2201	4296	6497	6609200	SO:0001819	synonymous_variant	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3690G>C	11.37:g.6652624C>G		Somatic		Capture	SOLID	Phase_IV	6609200	O15098	Silent	SNP	ENST00000299441.3	37	CCDS7771.1	SNP	25	Baylor																																																																																				0.552	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Silent
DHX15	1665	hgsc.bcm.edu	37	4	24543633	24543633	+	Nonsense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr4:24543633G>A	ENST00000336812.4	-	8	1504	c.1348C>T	c.(1348-1350)Cga>Tga	p.R450*	DHX15_ENST00000508032.1_5'Flank	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	450	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.R450*(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				ACTCTGATTCGAGGATTGTAG	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	4											80.0	79.0	79.0					4																	24543633		2203	4300	6503	24152731	SO:0001587	stop_gained	1665			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.1348C>T	4.37:g.24543633G>A	ENSP00000336741:p.Arg450*	Somatic		Capture	SOLID	Phase_IV	24152731	Q9NQT7	Nonsense_Mutation	SNP	ENST00000336812.4	37	CCDS33966.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	40	8.176183	0.98691	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	.	.	.	6.16	2.3	0.28687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9299	10.1851	0.42993	0.0613:0.0:0.5866:0.3521	.	.	.	.	X	450;439	.	ENSP00000336741:R450X	R	-	1	2	DHX15	24152731	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.306000	0.72810	0.402000	0.25451	0.650000	0.86243	CGA		0.423	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358		Nonsense_Mutation
DNAH5	1767	hgsc.bcm.edu	37	5	13714612	13714612	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr5:13714612C>T	ENST00000265104.4	-	75	13131	c.13027G>A	c.(13027-13029)Gac>Aac	p.D4343N		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4343					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D4343N(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CCAGAGGTGTCCTTGGGTTGG	0.607									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											95.0	85.0	89.0					5																	13714612		2203	4300	6503	13767612	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13027G>A	5.37:g.13714612C>T	ENSP00000265104:p.Asp4343Asn	Somatic		Capture	SOLID	Phase_IV	13767612	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	35	5.455864	0.96223	.	.	ENSG00000039139	ENST00000265104	T	0.08546	3.08	5.22	5.22	0.72569	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	M	0.82132	2.575	0.80722	D	1	D	0.63880	0.993	D	0.66497	0.944	T	0.02471	-1.1154	10	0.42905	T	0.14	.	18.7863	0.91955	0.0:1.0:0.0:0.0	.	4343	Q8TE73	DYH5_HUMAN	N	4343	ENSP00000265104:D4343N	ENSP00000265104:D4343N	D	-	1	0	DNAH5	13767612	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.798000	0.85924	2.446000	0.82766	0.655000	0.94253	GAC		0.607	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
DNAJC14	85406	hgsc.bcm.edu	37	12	56215819	56215819	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr12:56215819G>A	ENST00000357606.3	-	8	2340	c.2051C>T	c.(2050-2052)cCc>cTc	p.P684L	DNAJC14_ENST00000317287.5_Missense_Mutation_p.P684L|RP11-762I7.5_ENST00000546837.1_Silent_p.T313T|RP11-762I7.5_ENST00000552719.1_5'UTR|DNAJC14_ENST00000317269.3_Missense_Mutation_p.P684L			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	684					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P684L(1)		breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						TTCTCCCTTGGGTACTGTGCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	12											139.0	129.0	133.0					12																	56215819		2203	4300	6503	54502086	SO:0001583	missense	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.2051C>T	12.37:g.56215819G>A	ENSP00000350223:p.Pro684Leu	Somatic		Capture	SOLID	Phase_IV	54502086	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	SNP	43	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.82|17.82	3.482373|3.482373	0.63962|0.63962	.|.	.|.	ENSG00000135392|ENSG00000135392	ENST00000357606;ENST00000317269;ENST00000537962;ENST00000317287|ENST00000540330	T;T;T|.	0.37915|.	1.17;1.17;1.17|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.061993|0.061993	0.64402|0.64402	D|D	0.000003|0.000003	T|T	0.53706|0.53706	0.1813|0.1813	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	D;D|.	0.53619|.	0.961;0.961|.	P;P|.	0.49637|.	0.617;0.617|.	T|T	0.43180|0.43180	-0.9407|-0.9407	10|7	0.87932|0.20519	D|T	0|0.43	-3.3897|-3.3897	17.5705|17.5705	0.87933|0.87933	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	684;684|.	Q6Y2X3;A8K5A7|.	DJC14_HUMAN;.|.	L|S	684;684;394;684|180	ENSP00000350223:P684L;ENSP00000316240:P684L;ENSP00000317500:P684L|.	ENSP00000316240:P684L|ENSP00000441495:P180S	P|P	-|-	2|1	0|0	DNAJC14|DNAJC14	54502086|54502086	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	4.733000|4.733000	0.62036|0.62036	2.835000|2.835000	0.97688|0.97688	0.591000|0.591000	0.81541|0.81541	CCC|CCA		0.552	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364		Missense_Mutation
DPPA2	151871	hgsc.bcm.edu	37	3	109033361	109033361	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:109033361T>C	ENST00000478945.1	-	2	275	c.29A>G	c.(28-30)aAg>aGg	p.K10R		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	10					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)	p.K10R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACTTACCTTCTTGCTGCTATC	0.383																																																1	Substitution - Missense(1)	ovary(1)	3											138.0	128.0	131.0					3																	109033361		2203	4300	6503	110516051	SO:0001583	missense	151871			AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.29A>G	3.37:g.109033361T>C	ENSP00000417710:p.Lys10Arg	Somatic		Capture	SOLID	Phase_IV	110516051	Q8WVF0	Missense_Mutation	SNP	ENST00000478945.1	37	CCDS2956.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	5.324	0.245154	0.10077	.	.	ENSG00000163530	ENST00000478945	T	0.41758	0.99	3.69	1.32	0.21799	.	1.868930	0.02900	N	0.135273	T	0.28101	0.0693	N	0.22421	0.69	0.09310	N	1	B	0.25105	0.118	B	0.17098	0.017	T	0.12293	-1.0553	10	0.22109	T	0.4	-1.021	5.2171	0.15348	0.0:0.2421:0.0:0.7579	.	10	Q7Z7J5	DPPA2_HUMAN	R	10	ENSP00000417710:K10R	ENSP00000417710:K10R	K	-	2	0	DPPA2	110516051	0.001000	0.12720	0.017000	0.16124	0.044000	0.14063	0.150000	0.16263	0.292000	0.22492	0.459000	0.35465	AAG		0.383	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815		Missense_Mutation
DST	667	hgsc.bcm.edu	37	6	56483632	56483632	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr6:56483632G>T	ENST00000370765.6	-	23	5307	c.5200C>A	c.(5200-5202)Cac>Aac	p.H1734N	DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	3810					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.H1734N(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCTTTCTGTGGGTCATCTGC	0.383																																																1	Substitution - Missense(1)	ovary(1)	6											143.0	151.0	148.0					6																	56483632		2203	4300	6503	56591591	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.5200C>A	6.37:g.56483632G>T	ENSP00000359801:p.His1734Asn	Somatic		Capture	SOLID	Phase_IV	56591591	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.133	1.011986	0.19277	.	.	ENSG00000151914	ENST00000370765	T	0.77358	-1.09	5.34	3.57	0.40892	.	.	.	.	.	T	0.43411	0.1246	.	.	.	0.19575	N	0.999962	B	0.16396	0.017	B	0.12837	0.008	T	0.08391	-1.0724	7	0.13470	T	0.59	.	11.884	0.52592	0.1418:0.0:0.8582:0.0	.	1734	Q03001-3	.	N	1734	ENSP00000359801:H1734N	ENSP00000359801:H1734N	H	-	1	0	DST	56591591	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.180000	0.58296	0.739000	0.32628	0.650000	0.86243	CAC		0.383	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723		Missense_Mutation
EEF2K	29904	hgsc.bcm.edu	37	16	22278032	22278032	+	Nonsense_Mutation	SNP	C	C	G			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr16:22278032C>G	ENST00000263026.5	+	15	2073	c.1599C>G	c.(1597-1599)taC>taG	p.Y533*		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	533					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		TGGTGCGCTACCACGAGGGTG	0.682																																					NSCLC(195;1411 2157 20319 27471 51856)											0			16											46.0	43.0	44.0					16																	22278032		2197	4300	6497	22185533	SO:0001587	stop_gained	29904			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1599C>G	16.37:g.22278032C>G	ENSP00000263026:p.Tyr533*	Somatic		Capture	SOLID	Phase_IV	22185533	Q8N588	Nonsense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	43	9.998432	0.99314	.	.	ENSG00000103319	ENST00000263026	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7621	11.7336	0.51752	0.0:0.8649:0.0:0.1351	.	.	.	.	X	533	.	ENSP00000263026:Y533X	Y	+	3	2	EEF2K	22185533	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.508000	0.45450	2.861000	0.98227	0.655000	0.94253	TAC		0.682	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302		Nonsense_Mutation
EPHB3	2049	hgsc.bcm.edu	37	3	184290716	184290716	+	Frame_Shift_Del	DEL	T	T	-			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:184290716delT	ENST00000330394.2	+	3	1060	c.608delT	c.(607-609)atcfs	p.I203fs	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	203	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)	p.I203fs*144(1)		breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			ATGTCGCTCATCTCCGTGCGC	0.632																																																1	Deletion - Frameshift(1)	ovary(1)	3											54.0	54.0	54.0					3																	184290716		2203	4300	6503	185773410	SO:0001589	frameshift_variant	2049			X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.608delT	3.37:g.184290716delT	ENSP00000332118:p.Ile203fs	Somatic		Capture	SOLID	Phase_IV	185773410	Q7Z740	Frame_Shift_Del	DEL	ENST00000330394.2	37	CCDS3268.1	DEL	50	Baylor																																																																																				0.632	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443		Frame_Shift_Del
FAM13C	220965	hgsc.bcm.edu	37	10	61014175	61014175	+	Missense_Mutation	SNP	T	T	C			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr10:61014175T>C	ENST00000373868.2	-	11	1352	c.1265A>G	c.(1264-1266)aAg>aGg	p.K422R	FAM13C_ENST00000422313.2_Missense_Mutation_p.K422R|FAM13C_ENST00000435852.2_Missense_Mutation_p.K422R|FAM13C_ENST00000442566.3_Missense_Mutation_p.K443R|FAM13C_ENST00000277705.6_Missense_Mutation_p.K443R|FAM13C_ENST00000468840.2_Missense_Mutation_p.K339R|FAM13C_ENST00000373867.3_Missense_Mutation_p.K339R|FAM13C_ENST00000419214.2_Missense_Mutation_p.K324R	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	422										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ATAAAGCGGCTTTATGAGGTT	0.348																																																0			10											263.0	255.0	258.0					10																	61014175		2203	4300	6503	60684181	SO:0001583	missense	220965			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1265A>G	10.37:g.61014175T>C	ENSP00000362975:p.Lys422Arg	Somatic		Capture	SOLID	Phase_IV	60684181	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.60	3.658101	0.67586	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T	0.77358	0.91;-1.09;0.75;0.8;-1.09;0.7;0.49	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.82986	0.5156	L	0.43598	1.365	0.47905	D	0.999542	P;P;P;D;P	0.71674	0.886;0.9;0.672;0.998;0.886	P;P;P;D;P	0.78314	0.54;0.823;0.48;0.991;0.54	T	0.80223	-0.1471	10	0.23891	T	0.37	-18.8301	15.6273	0.76870	0.0:0.0:0.0:1.0	.	422;339;422;324;422	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	R	339;422;443;443;324;339;422;422	ENSP00000362975:K422R;ENSP00000395661:K443R;ENSP00000277705:K443R;ENSP00000391993:K324R;ENSP00000423896:K339R;ENSP00000392302:K422R;ENSP00000400241:K422R	ENSP00000277705:K443R	K	-	2	0	FAM13C	60684181	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	7.481000	0.81124	2.092000	0.63282	0.454000	0.30748	AAG		0.348	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2			Missense_Mutation
GABRA4	2557	hgsc.bcm.edu	37	4	46973172	46973172	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr4:46973172T>A	ENST00000264318.3	-	7	1784	c.802A>T	c.(802-804)Att>Ttt	p.I268F		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	268					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.I268F(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ACTGTCATAATGCACGGAATA	0.373																																					Ovarian(6;283 369 8234 12290 33402)											1	Substitution - Missense(1)	ovary(1)	4											82.0	79.0	80.0					4																	46973172		2203	4300	6503	46667929	SO:0001583	missense	2557				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.802A>T	4.37:g.46973172T>A	ENSP00000264318:p.Ile268Phe	Somatic		Capture	SOLID	Phase_IV	46667929	Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.3	4.996271	0.93167	.	.	ENSG00000109158	ENST00000264318	D	0.87491	-2.26	5.42	5.42	0.78866	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90734	0.7092	L	0.45228	1.405	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91590	0.5286	10	0.72032	D	0.01	.	14.7995	0.69903	0.0:0.0:0.0:1.0	.	268	P48169	GBRA4_HUMAN	F	268	ENSP00000264318:I268F	ENSP00000264318:I268F	I	-	1	0	GABRA4	46667929	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.868000	0.87116	2.276000	0.75962	0.528000	0.53228	ATT		0.373	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1			Missense_Mutation
GDA	9615	hgsc.bcm.edu	37	9	74840652	74840652	+	Silent	SNP	T	T	C			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr9:74840652T>C	ENST00000358399.3	+	8	867	c.774T>C	c.(772-774)taT>taC	p.Y258Y	GDA_ENST00000376989.3_Silent_p.Y197Y|GDA_ENST00000376986.1_Silent_p.Y180Y|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000238018.4_Silent_p.Y258Y|GDA_ENST00000545168.1_Silent_p.Y184Y	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	258					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)	p.Y258Y(1)		central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		ACCCCAGTTATAAAAACTACA	0.274																																																1	Substitution - coding silent(1)	ovary(1)	9											79.0	91.0	87.0					9																	74840652		2201	4291	6492	74030472	SO:0001819	synonymous_variant	9615			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.774T>C	9.37:g.74840652T>C		Somatic		Capture	SOLID	Phase_IV	74030472	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Silent	SNP	ENST00000358399.3	37	CCDS6641.1	SNP	49	Baylor																																																																																				0.274	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1			Silent
GLI2	2736	hgsc.bcm.edu	37	2	121732623	121732624	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-10-0938-01	TCGA-10-0938-11	GA	GA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:121732623_121732624delGA	ENST00000452319.1	+	9	1366_1367	c.1306_1307delGA	c.(1306-1308)gagfs	p.E436fs	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Frame_Shift_Del_p.E436fs|GLI2_ENST00000314490.11_Frame_Shift_Del_p.E108fs					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GGTCATCTATGAGACCAACTGC	0.589																																																0			2																																								121449094	SO:0001589	frameshift_variant	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1306_1307delGA	2.37:g.121732625_121732626delGA	ENSP00000390436:p.Glu436fs	Somatic		Capture	SOLID	Phase_IV	121449093		Frame_Shift_Del	DEL	ENST00000452319.1	37	CCDS33283.1	DEL	45	Baylor																																																																																				0.589	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		Frame_Shift_Del
GLI2	2736	hgsc.bcm.edu	37	2	121732626	121732626	+	Missense_Mutation	SNP	A	A	C			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:121732626A>C	ENST00000452319.1	+	9	1369	c.1309A>C	c.(1309-1311)Acc>Ccc	p.T437P	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Missense_Mutation_p.T437P|GLI2_ENST00000314490.11_Missense_Mutation_p.T109P					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CATCTATGAGACCAACTGCCA	0.597																																																0			2											80.0	71.0	74.0					2																	121732626		2203	4300	6503	121449096	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1309A>C	2.37:g.121732626A>C	ENSP00000390436:p.Thr437Pro	Somatic		Capture	SOLID	Phase_IV	121449096		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790610	0.90367	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.92595	-3.07;-3.07;-3.07	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);	0.110420	0.64402	D	0.000009	D	0.96734	0.8934	M	0.92026	3.265	0.80722	D	1	D;D;D;D;P	0.71674	0.997;0.978;0.998;0.997;0.936	D;P;D;D;D	0.77557	0.985;0.672;0.99;0.978;0.923	D	0.97637	1.0146	10	0.87932	D	0	.	15.2333	0.73407	1.0:0.0:0.0:0.0	.	437;420;92;92;109	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	P	437;437;109	ENSP00000390436:T437P;ENSP00000354586:T437P;ENSP00000312694:T109P	ENSP00000312694:T109P	T	+	1	0	GLI2	121449096	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.087000	0.94110	2.189000	0.69895	0.533000	0.62120	ACC		0.597	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270		Missense_Mutation
GLT6D1	360203	hgsc.bcm.edu	37	9	138516111	138516111	+	Silent	SNP	T	T	C	rs200214074	byFrequency	TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr9:138516111T>C	ENST00000371763.1	-	5	916	c.663A>G	c.(661-663)ggA>ggG	p.G221G		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	221					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)	p.G221G(1)		endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		AATCTCCCTGTCCAAACGGGA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	9											109.0	108.0	108.0					9																	138516111		1917	4128	6045	137655932	SO:0001819	synonymous_variant	360203			AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.663A>G	9.37:g.138516111T>C		Somatic		Capture	SOLID	Phase_IV	137655932		Silent	SNP	ENST00000371763.1	37	CCDS43900.1	SNP	58	Baylor																																																																																				0.478	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055005.2	NM_182974		Silent
GPR123	84435	hgsc.bcm.edu	37	10	134912173	134912173	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr10:134912173A>T	ENST00000392607.3	+	4	597	c.161A>T	c.(160-162)cAc>cTc	p.H54L	GPR123_ENST00000607359.1_Missense_Mutation_p.H774L	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	54					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AAGGGCCGGCACACGCTCCTG	0.642																																																0			10											71.0	64.0	67.0					10																	134912173		2203	4300	6503	134762163	SO:0001583	missense	84435			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.161A>T	10.37:g.134912173A>T	ENSP00000376384:p.His54Leu	Somatic		Capture	SOLID	Phase_IV	134762163	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	37	CCDS41580.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.61	3.661332	0.67700	.	.	ENSG00000197177	ENST00000368577;ENST00000392609;ENST00000392607	T	0.57595	0.39	4.35	4.35	0.52113	GPCR, family 2-like (1);	0.217217	0.30320	N	0.009882	T	0.76083	0.3938	M	0.91459	3.21	0.80722	D	1	P;D	0.76494	0.732;0.999	P;D	0.78314	0.606;0.991	T	0.81525	-0.0893	10	0.87932	D	0	-37.9019	11.7929	0.52080	1.0:0.0:0.0:0.0	.	54;774	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	L	774;774;54	ENSP00000376384:H54L	ENSP00000357566:H774L	H	+	2	0	GPR123	134762163	1.000000	0.71417	0.986000	0.45419	0.357000	0.29423	6.516000	0.73755	1.740000	0.51718	0.533000	0.62120	CAC		0.642	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2			Missense_Mutation
GPR98	84059	hgsc.bcm.edu	37	5	89949495	89949495	+	Silent	SNP	T	T	C			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr5:89949495T>C	ENST00000405460.2	+	20	4200	c.4104T>C	c.(4102-4104)aaT>aaC	p.N1368N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1368					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.N1368N(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCAATACGAATGGATTCATTA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	5											109.0	99.0	102.0					5																	89949495		1903	4133	6036	89985251	SO:0001819	synonymous_variant	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4104T>C	5.37:g.89949495T>C		Somatic		Capture	SOLID	Phase_IV	89985251	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	7.923	0.738899	0.15642	.	.	ENSG00000164199	ENST00000504142	.	.	.	5.38	2.99	0.34606	.	.	.	.	.	T	0.53850	0.1822	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44329	-0.9335	4	.	.	.	.	5.3177	0.15864	0.1214:0.2095:0.0:0.6692	.	.	.	.	R	957	.	.	W	+	1	0	GPR98	89985251	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	1.171000	0.31896	0.447000	0.26695	0.528000	0.53228	TGG		0.393	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Silent
GRIN2B	2904	hgsc.bcm.edu	37	12	13722835	13722835	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr12:13722835C>A	ENST00000609686.1	-	11	2497	c.2288G>T	c.(2287-2289)gGc>gTc	p.G763V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	763					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G763V(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GATGGCAATGCCATAGCCAGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											80.0	65.0	70.0					12																	13722835		2203	4300	6503	13614102	SO:0001583	missense	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2288G>T	12.37:g.13722835C>A	ENSP00000477455:p.Gly763Val	Somatic		Capture	SOLID	Phase_IV	13614102	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819425	0.90873	.	.	ENSG00000150086	ENST00000279593	T	0.60040	0.22	5.55	5.55	0.83447	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.056868	0.64402	D	0.000001	T	0.82135	0.4971	M	0.92268	3.29	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	D	0.86319	0.1691	10	0.87932	D	0	.	19.5042	0.95108	0.0:1.0:0.0:0.0	.	763	Q13224	NMDE2_HUMAN	V	763	ENSP00000279593:G763V	ENSP00000279593:G763V	G	-	2	0	GRIN2B	13614102	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.771000	0.85420	2.590000	0.87494	0.655000	0.94253	GGC		0.507	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			Missense_Mutation
GYS1	2997	hgsc.bcm.edu	37	19	49485525	49485525	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr19:49485525T>G	ENST00000323798.3	-	7	1245	c.1049A>C	c.(1048-1050)aAc>aCc	p.N350T	GYS1_ENST00000541188.1_Missense_Mutation_p.N270T|GYS1_ENST00000544287.1_5'UTR|GYS1_ENST00000540532.1_Missense_Mutation_p.T231P|GYS1_ENST00000263276.6_Missense_Mutation_p.N286T	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	350					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)	p.N350T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GAGCAGATAGTTGAGCCGAGC	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	90.0	92.0					19																	49485525		2203	4300	6503	54177337	SO:0001583	missense	2997				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1049A>C	19.37:g.49485525T>G	ENSP00000317904:p.Asn350Thr	Somatic		Capture	SOLID	Phase_IV	54177337	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	SNP	60	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.67|14.67	2.605231|2.605231	0.46423|0.46423	.|.	.|.	ENSG00000104812|ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188|ENST00000540532	T;T;T|T	0.71103|0.25579	-0.54;-0.54;-0.54|1.79	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53318|0.53318	0.1789|0.1789	M|M	0.89904|0.89904	3.07|3.07	0.33343|0.33343	D|D	0.57005|0.57005	D;D;D|.	0.76494|.	0.999;0.971;0.999|.	D;P;D|.	0.91635|.	0.999;0.689;0.999|.	T|T	0.72093|0.72093	-0.4394|-0.4394	10|7	0.62326|0.59425	D|D	0.03|0.04	-41.101|-41.101	13.3635|13.3635	0.60669|0.60669	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	270;286;350|.	B7Z806;Q9BTT9;P13807|.	.;.;GYS1_HUMAN|.	T|P	350;286;270|231	ENSP00000317904:N350T;ENSP00000263276:N286T;ENSP00000437922:N270T|ENSP00000445197:T231P	ENSP00000263276:N286T|ENSP00000445197:T231P	N|T	-|-	2|1	0|0	GYS1|GYS1	54177337|54177337	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.265000|7.265000	0.78442|0.78442	2.113000|2.113000	0.64589|0.64589	0.528000|0.528000	0.53228|0.53228	AAC|ACT		0.537	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103		Missense_Mutation
MROH2B	133558	hgsc.bcm.edu	37	5	41061678	41061678	+	Silent	SNP	G	G	T			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr5:41061678G>T	ENST00000399564.4	-	6	1059	c.609C>A	c.(607-609)ccC>ccA	p.P203P		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	203								p.P203P(1)									TCACCTGCATGGGTGAGGCCA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	5											174.0	168.0	170.0					5																	41061678		1926	4129	6055	41097435	SO:0001819	synonymous_variant	133558				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.609C>A	5.37:g.41061678G>T		Somatic		Capture	SOLID	Phase_IV	41097435	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1	SNP	47	Baylor																																																																																				0.478	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489		Silent
HMCN1	83872	hgsc.bcm.edu	37	1	186043908	186043908	+	Silent	SNP	G	G	A	rs371338513		TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:186043908G>A	ENST00000271588.4	+	53	8404	c.8175G>A	c.(8173-8175)gcG>gcA	p.A2725A	HMCN1_ENST00000367492.2_Silent_p.A2725A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2725	Ig-like C2-type 25.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A2725A(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATATTGCTGCGAATGGACACA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	1						G		1,4405	2.1+/-5.4	0,1,2202	126.0	121.0	123.0		8175	-10.3	0.1	1		123	0,8600		0,0,4300	no	coding-synonymous	HMCN1	NM_031935.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		2725/5636	186043908	1,13005	2203	4300	6503	184310531	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8175G>A	1.37:g.186043908G>A		Somatic		Capture	SOLID	Phase_IV	184310531	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	37	Baylor																																																																																				0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Silent
INTU	27152	hgsc.bcm.edu	37	4	128564711	128564711	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr4:128564711A>G	ENST00000335251.6	+	2	285	c.182A>G	c.(181-183)aAa>aGa	p.K61R	INTU_ENST00000296461.5_Missense_Mutation_p.K61R	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	61					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.K61R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AGTGTGCAGAAAAATGGAGAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	4											158.0	173.0	168.0					4																	128564711		2203	4300	6503	128784161	SO:0001583	missense	27152			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.182A>G	4.37:g.128564711A>G	ENSP00000334003:p.Lys61Arg	Somatic		Capture	SOLID	Phase_IV	128784161	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	CCDS34061.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.43	2.532761	0.45073	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.50813	0.73	5.1	2.62	0.31277	.	0.101136	0.64402	N	0.000003	T	0.35480	0.0933	L	0.39397	1.21	0.48452	D	0.999657	B	0.25048	0.117	B	0.22601	0.04	T	0.09058	-1.0692	10	0.33940	T	0.23	-8.8202	9.5795	0.39479	0.8569:0.0:0.1431:0.0	.	61	Q9ULD6	PDZD6_HUMAN	R	42;61;61	ENSP00000296461:K61R	ENSP00000296461:K61R	K	+	2	0	INTU	128784161	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	5.323000	0.65858	0.397000	0.25310	-0.250000	0.11733	AAA		0.398	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707		Missense_Mutation
ITPA	3704	hgsc.bcm.edu	37	20	3194676	3194676	+	Missense_Mutation	SNP	G	G	T			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr20:3194676G>T	ENST00000380113.3	+	4	427	c.235G>T	c.(235-237)Gcc>Tcc	p.A79S	ITPA_ENST00000399838.3_Missense_Mutation_p.A38S|ITPA_ENST00000455664.2_Missense_Mutation_p.A62S|ITPA_ENST00000483354.1_3'UTR	NM_033453.3|NM_181493.2	NP_258412.1|NP_852470.1			inosine triphosphatase (nucleoside triphosphate pyrophosphatase)									p.A79S(1)		autonomic_ganglia(1)|large_intestine(3)|ovary(1)|stomach(1)	6						GTGCTTCAATGCCCTTGGAGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	20											160.0	126.0	138.0					20																	3194676		2203	4300	6503	3142676	SO:0001583	missense	3704			AF026816	CCDS13051.1, CCDS46576.1, CCDS58762.1	20p	2002-02-01			ENSG00000125877	ENSG00000125877	3.6.1.19		6176	protein-coding gene	gene with protein product		147520		C20orf37		11278832	Standard	NM_033453		Approved	HLC14-06-P, dJ794I6.3	uc002wid.4	Q9BY32	OTTHUMG00000031738	ENST00000380113.3:c.235G>T	20.37:g.3194676G>T	ENSP00000369456:p.Ala79Ser	Somatic		Capture	SOLID	Phase_IV	3142676		Missense_Mutation	SNP	ENST00000380113.3	37	CCDS13051.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378102	0.82682	.	.	ENSG00000125877	ENST00000380113;ENST00000455664;ENST00000399838	.	.	.	5.32	4.38	0.52667	.	0.000000	0.85682	D	0.000000	D	0.83294	0.5223	M	0.91717	3.235	0.58432	D	0.999997	P;P	0.44734	0.743;0.842	D;P	0.64877	0.93;0.846	D	0.84890	0.0836	9	0.66056	D	0.02	.	9.9332	0.41534	0.0942:0.0:0.9058:0.0	.	62;79	B2BCH7;Q9BY32	.;ITPA_HUMAN	S	79;62;38	.	ENSP00000369456:A79S	A	+	1	0	ITPA	3142676	1.000000	0.71417	0.924000	0.36721	0.729000	0.41735	7.546000	0.82137	1.249000	0.43950	0.655000	0.94253	GCC		0.572	ITPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077719.2			Missense_Mutation
ITPR3	3710	hgsc.bcm.edu	37	6	33662828	33662828	+	Missense_Mutation	SNP	A	A	G			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr6:33662828A>G	ENST00000374316.5	+	58	8973	c.7913A>G	c.(7912-7914)cAc>cGc	p.H2638R	ITPR3_ENST00000605930.1_Missense_Mutation_p.H2638R			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2638					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.H2638R(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CTGGTGTCCCACCTCACTGCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	6											95.0	65.0	75.0					6																	33662828		2203	4300	6503	33770806	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7913A>G	6.37:g.33662828A>G	ENSP00000363435:p.His2638Arg	Somatic		Capture	SOLID	Phase_IV	33770806	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.17	2.755464	0.49362	.	.	ENSG00000096433	ENST00000374316	T	0.39229	1.09	5.67	5.67	0.87782	.	0.157744	0.56097	D	0.000026	T	0.13756	0.0333	N	0.08118	0	0.40372	D	0.979357	B	0.29936	0.262	B	0.27380	0.079	T	0.07751	-1.0756	10	0.40728	T	0.16	-41.3018	15.9154	0.79512	1.0:0.0:0.0:0.0	.	2638	Q14573	ITPR3_HUMAN	R	2638	ENSP00000363435:H2638R	ENSP00000363435:H2638R	H	+	2	0	ITPR3	33770806	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	4.225000	0.58600	2.178000	0.69098	0.533000	0.62120	CAC		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224		Missense_Mutation
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651120	1651120	+	Missense_Mutation	SNP	G	G	T	rs66665994		TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr11:1651120G>T	ENST00000399676.2	+	1	88	c.50G>T	c.(49-51)cGt>cTt	p.R17L		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	17				R -> L (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.R17L(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		tgtggaggccgtggctccggc	0.697																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											49.0	62.0	58.0					11																	1651120		2185	4288	6473	1607696	SO:0001583	missense	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.50G>T	11.37:g.1651120G>T	ENSP00000382584:p.Arg17Leu	Somatic		Capture	SOLID	Phase_IV	1607696	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	SNP	40	Baylor	1029	0.47115384615384615	280	0.5691056910569106	162	0.44751381215469616	221	0.38636363636363635	366	0.48284960422163586	G	7.595	0.671480	0.14776	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01005	5.45	2.63	2.63	0.31362	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.49389	P	2.1099999999996122E-4	B	0.24963	0.115	B	0.14023	0.01	T	0.01504	-1.1338	8	0.44086	T	0.13	.	9.323	0.37975	0.0:0.0:1.0:0.0	.	17	Q701N2	KRA55_HUMAN	L	17;15	ENSP00000382584:R17L	ENSP00000382584:R17L	R	+	2	0	KRTAP5-5	1607696	1.000000	0.71417	0.817000	0.32601	0.004000	0.04260	3.925000	0.56484	1.420000	0.47138	0.442000	0.29010	CGT		0.697	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1			Missense_Mutation
LINGO1	84894	hgsc.bcm.edu	37	15	77907845	77907845	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr15:77907845G>A	ENST00000355300.6	-	2	578	c.404C>T	c.(403-405)cCg>cTg	p.P135L	LINGO1_ENST00000561030.1_Missense_Mutation_p.P129L	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	135					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P129L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GACGCCTAGCGGGATGAGCTT	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											71.0	76.0	74.0					15																	77907845		2105	4223	6328	75694900	SO:0001583	missense	84894			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.404C>T	15.37:g.77907845G>A	ENSP00000347451:p.Pro135Leu	Somatic		Capture	SOLID	Phase_IV	75694900	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.71	3.877696	0.72294	.	.	ENSG00000169783	ENST00000355300	T	0.59906	0.23	5.63	5.63	0.86233	.	0.062472	0.64402	D	0.000002	T	0.70107	0.3186	M	0.62209	1.925	0.80722	D	1	D	0.59357	0.985	P	0.54706	0.759	T	0.72478	-0.4281	10	0.72032	D	0.01	.	19.6703	0.95910	0.0:0.0:1.0:0.0	.	135	Q96FE5	LIGO1_HUMAN	L	135	ENSP00000347451:P135L	ENSP00000347451:P135L	P	-	2	0	LINGO1	75694900	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	7.071000	0.76770	2.659000	0.90383	0.561000	0.74099	CCG		0.572	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1	NM_032808		Missense_Mutation
MAPRE2	10982	hgsc.bcm.edu	37	18	32650251	32650251	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr18:32650251C>A	ENST00000300249.5	+	2	395	c.215C>A	c.(214-216)tCt>tAt	p.S72Y	MAPRE2_ENST00000413393.1_Missense_Mutation_p.S29Y|MAPRE2_ENST00000436190.2_Missense_Mutation_p.S60Y|MAPRE2_ENST00000589699.1_Missense_Mutation_p.S29Y|MAPRE2_ENST00000538170.2_Intron|MAPRE2_ENST00000588910.1_Missense_Mutation_p.S72Y	NM_014268.3	NP_055083.1	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family, member 2	72	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)		p.S72Y(2)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9						GACATAGTATCTTTAAACTAC	0.358																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	18											126.0	116.0	119.0					18																	32650251		2203	4300	6503	30904249	SO:0001583	missense	10982			X94232	CCDS11910.1, CCDS45850.1, CCDS45851.1, CCDS58619.1	18q12.1	2013-01-17			ENSG00000166974	ENSG00000166974			6891	protein-coding gene	gene with protein product	"""APC-binding protein EB1"""	605789				9233623, 12475954	Standard	NM_001143826		Approved	RP1, EB1, EB2	uc010xcc.3	Q15555	OTTHUMG00000132551	ENST00000300249.5:c.215C>A	18.37:g.32650251C>A	ENSP00000300249:p.Ser72Tyr	Somatic		Capture	SOLID	Phase_IV	30904249	B2RE21|B3KR39|B4DJV4|B7Z2L3|E9PHR3|F5H1V8|G5E9I6|Q9UQ33	Missense_Mutation	SNP	ENST00000300249.5	37	CCDS11910.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673869	0.67928	.	.	ENSG00000166974	ENST00000413393;ENST00000436190;ENST00000300249	T;T;T	0.44482	0.92;0.92;0.92	5.48	5.48	0.80851	Calponin homology domain (4);	0.173838	0.52532	D	0.000070	T	0.48607	0.1509	L	0.57536	1.79	0.32445	N	0.546182	B;P;B	0.37688	0.445;0.605;0.231	P;P;B	0.44422	0.449;0.449;0.242	T	0.63589	-0.6603	10	0.72032	D	0.01	-9.7368	14.2038	0.65721	0.1495:0.8505:0.0:0.0	.	60;72;72	E9PHR3;Q15555;Q15555-2	.;MARE2_HUMAN;.	Y	29;60;72	ENSP00000396074:S29Y;ENSP00000407723:S60Y;ENSP00000300249:S72Y	ENSP00000300249:S72Y	S	+	2	0	MAPRE2	30904249	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.277000	0.58939	2.548000	0.85928	0.655000	0.94253	TCT		0.358	MAPRE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255753.2	NM_014268		Missense_Mutation
NUP98	4928	hgsc.bcm.edu	37	11	3752738	3752738	+	Missense_Mutation	SNP	C	C	T	rs201892076		TCGA-10-0938-01	TCGA-10-0938-11	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr11:3752738C>T	ENST00000324932.7	-	14	2033	c.1613G>A	c.(1612-1614)cGc>cAc	p.R538H	NUP98_ENST00000397004.4_Missense_Mutation_p.R538H|NUP98_ENST00000355260.3_Missense_Mutation_p.R538H|NUP98_ENST00000359171.4_Missense_Mutation_p.R538H|NUP98_ENST00000397007.4_Missense_Mutation_p.R555H	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	555					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.R538H(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AGTGGCAGGGCGGGGTGTCAG	0.458			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	1	Substitution - Missense(1)	ovary(1)	11											168.0	180.0	176.0					11																	3752738		2201	4298	6499	3709314	SO:0001583	missense	4928			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1613G>A	11.37:g.3752738C>T	ENSP00000316032:p.Arg538His	Somatic		Capture	SOLID	Phase_IV	3709314	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	CCDS7746.1	SNP	27	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.316156|5.316156	0.95655|0.95655	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000529379|ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.|.	.|.	.|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77791|0.77791	0.4183|0.4183	M|M	0.75777|0.75777	2.31|2.31	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.998;0.997;0.999;0.999	T|T	0.72676|0.72676	-0.4221|-0.4221	5|9	.|0.14252	.|T	.|0.57	.|.	18.3204|18.3204	0.90236|0.90236	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|555;538;538;538	.|P52948-3;P52948-4;P52948-2;P52948-5	.|.;.;.;.	T|H	140|538;538;538;538;555	.|.	.|ENSP00000316032:R538H	A|R	-|-	1|2	0|0	NUP98|NUP98	3709314|3709314	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.959000|0.959000	0.62525|0.62525	7.487000|7.487000	0.81328|0.81328	2.569000|2.569000	0.86673|0.86673	0.467000|0.467000	0.42956|0.42956	GCC|CGC		0.458	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320		Missense_Mutation
OPN1LW	5956	hgsc.bcm.edu	37	X	153418460	153418460	+	Missense_Mutation	SNP	C	C	A	rs713		TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chrX:153418460C>A	ENST00000369951.4	+	3	517	c.457C>A	c.(457-459)Ctg>Atg	p.L153M	OPN1LW_ENST00000463296.1_3'UTR	NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	153			L -> M (in dbSNP:rs713).		phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.L153M(1)		endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGAGAGGTGGCTGGTGGTGTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	X											237.0	178.0	200.0					X																	153418460		2101	3699	5800	153071654	SO:0001583	missense	5956			Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.457C>A	X.37:g.153418460C>A	ENSP00000358967:p.Leu153Met	Somatic		Capture	SOLID	Phase_IV	153071654		Missense_Mutation	SNP	ENST00000369951.4	37	CCDS14742.1	SNP	28	Baylor	73	0.044002411091018684	9	0.018367346938775512	6	0.016574585635359115	49	0.08687943262411348	16	0.02127659574468085	C	9.490	1.100410	0.20552	.	.	ENSG00000102076	ENST00000369951;ENST00000442922	T;T	0.46451	0.87;0.87	4.57	-0.904	0.10530	GPCR, rhodopsin-like superfamily (1);	0.628146	0.16437	N	0.214448	T	0.00724	0.0024	N	0.17474	0.49	0.26194	N	0.979544	B	0.22211	0.066	B	0.29267	0.1	T	0.10019	-1.0648	10	0.27082	T	0.32	.	1.9237	0.03313	0.4113:0.316:0.1259:0.1468	.	153	P04000	OPSR_HUMAN	M	153;16	ENSP00000358967:L153M;ENSP00000402493:L16M	ENSP00000358967:L153M	L	+	1	2	OPN1LW	153071654	0.000000	0.05858	0.999000	0.59377	0.887000	0.51463	-2.202000	0.01235	0.012000	0.14892	-0.498000	0.04607	CTG		0.567	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061		Missense_Mutation
PAQR8	85315	hgsc.bcm.edu	37	6	52269046	52269046	+	Silent	SNP	C	C	T	rs3799274	byFrequency	TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr6:52269046C>T	ENST00000442253.2	+	2	1209	c.1035C>T	c.(1033-1035)gtC>gtT	p.V345V	PAQR8_ENST00000360726.3_Silent_p.V345V	NM_133367.4	NP_588608.1	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member VIII	345					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(2)	17	Lung NSC(77;0.0875)					GGCACAAAGTCAAGGCCAGAC	0.547																																																0			6											20.0	19.0	19.0					6																	52269046		2203	4300	6503	52377005	SO:0001819	synonymous_variant	85315			AF347029	CCDS4941.1	6p12	2012-08-10	2005-05-20	2005-05-20	ENSG00000170915	ENSG00000170915			15708	protein-coding gene	gene with protein product		607780	"""chromosome 6 open reading frame 33"""	C6orf33		11676489, 12574519	Standard	NM_133367		Approved	LMPB1, MPRB	uc003pao.4	Q8TEZ7	OTTHUMG00000014846	ENST00000442253.2:c.1035C>T	6.37:g.52269046C>T		Somatic		Capture	SOLID	Phase_IV	52377005	B2RCF6|Q86WL0|Q8N6D3|Q9HD02	Silent	SNP	ENST00000442253.2	37	CCDS4941.1	SNP	29	Baylor																																																																																				0.547	PAQR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040903.2	NM_133367		Silent
PGLYRP2	114770	hgsc.bcm.edu	37	19	15582817	15582817	+	Silent	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr19:15582817C>A	ENST00000340880.4	-	3	1707	c.1227G>T	c.(1225-1227)gtG>gtT	p.V409V	PGLYRP2_ENST00000292609.4_Silent_p.V409V	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	409					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.V409V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						AGGTGTGATGCACGTACAAGA	0.677																																																1	Substitution - coding silent(1)	ovary(1)	19											59.0	50.0	53.0					19																	15582817		2203	4300	6503	15443817	SO:0001819	synonymous_variant	114770			AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1227G>T	19.37:g.15582817C>A		Somatic		Capture	SOLID	Phase_IV	15443817	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Silent	SNP	ENST00000340880.4	37	CCDS12330.2	SNP	25	Baylor																																																																																				0.677	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890		Silent
PLXDC1	57125	hgsc.bcm.edu	37	17	37235379	37235379	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr17:37235379A>T	ENST00000315392.4	-	10	1239	c.1028T>A	c.(1027-1029)aTg>aAg	p.M343K	AC091178.1_ENST00000410562.1_RNA|PLXDC1_ENST00000444911.2_Missense_Mutation_p.M303K|CTD-2206N4.4_ENST00000583447.1_RNA|PLXDC1_ENST00000539608.1_3'UTR|PLXDC1_ENST00000493200.1_5'UTR	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	343					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCCATAGTCCATCCACTCCTG	0.557																																																0			17											106.0	94.0	98.0					17																	37235379		2203	4300	6503	34488905	SO:0001583	missense	57125			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.1028T>A	17.37:g.37235379A>T	ENSP00000323927:p.Met343Lys	Somatic		Capture	SOLID	Phase_IV	34488905	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	CCDS11333.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.71	1.426837	0.25726	.	.	ENSG00000161381	ENST00000315392;ENST00000444911	T;T	0.29917	1.55;1.55	5.32	5.32	0.75619	.	0.492677	0.19794	N	0.105901	T	0.20981	0.0505	N	0.14661	0.345	0.80722	D	1	B;B	0.19817	0.001;0.039	B;B	0.26310	0.001;0.068	T	0.05784	-1.0864	10	0.51188	T	0.08	-11.6799	11.5833	0.50904	1.0:0.0:0.0:0.0	.	303;343	B4E173;Q8IUK5	.;PXDC1_HUMAN	K	343;303	ENSP00000323927:M343K;ENSP00000409687:M303K	ENSP00000323927:M343K	M	-	2	0	PLXDC1	34488905	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	6.496000	0.73670	2.235000	0.73313	0.459000	0.35465	ATG		0.557	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405		Missense_Mutation
POGK	57645	hgsc.bcm.edu	37	1	166818327	166818327	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:166818327T>A	ENST00000367875.1	+	5	871	c.511T>A	c.(511-513)Tac>Aac	p.Y171N	POGK_ENST00000536514.1_Missense_Mutation_p.Y86N|POGK_ENST00000537173.1_Missense_Mutation_p.Y53N|POGK_ENST00000367876.4_Missense_Mutation_p.Y171N			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	171					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Y171N(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						GTACCCCTTCTACATGGCCAT	0.587																																					GBM(76;192 1530 30153 48742)											1	Substitution - Missense(1)	large_intestine(1)	1											97.0	86.0	90.0					1																	166818327		2203	4300	6503	165084951	SO:0001583	missense	57645			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.511T>A	1.37:g.166818327T>A	ENSP00000356849:p.Tyr171Asn	Somatic		Capture	SOLID	Phase_IV	165084951	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	SNP	53	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.35	2.210615	0.39102	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000449930;ENST00000367876;ENST00000367875	T;T;T;T;T	0.37058	1.28;1.22;4.38;4.59;4.59	5.39	4.23	0.50019	.	0.165905	0.28964	N	0.013573	T	0.12008	0.0292	N	0.24115	0.695	0.34210	D	0.674214	B;B;B	0.23650	0.018;0.089;0.089	B;B;B	0.26517	0.059;0.044;0.07	T	0.06110	-1.0845	9	0.87932	D	0	-7.7248	9.1341	0.36863	0.0:0.0:0.184:0.816	.	53;86;171	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	N	53;86;171;171;171	ENSP00000442763:Y53N;ENSP00000441187:Y86N;ENSP00000404402:Y171N;ENSP00000356850:Y171N;ENSP00000356849:Y171N	ENSP00000356849:Y171N	Y	+	1	0	POGK	165084951	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.334000	0.52097	1.014000	0.39417	0.533000	0.62120	TAC		0.587	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542		Missense_Mutation
POLN	353497	hgsc.bcm.edu	37	4	2209783	2209783	+	Silent	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr4:2209783G>A	ENST00000511885.2	-	5	998	c.645C>T	c.(643-645)ctC>ctT	p.L215L	POLN_ENST00000515357.1_5'UTR|POLN_ENST00000382865.1_Silent_p.L215L			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	215					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.L215L(1)		kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CTGCCTGTTTGAGCATTTCAA	0.418								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	4											103.0	100.0	101.0					4																	2209783		2203	4300	6503	2179581	SO:0001819	synonymous_variant	353497			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.645C>T	4.37:g.2209783G>A		Somatic		Capture	SOLID	Phase_IV	2179581	A2A336|B4E158|Q4TTW4|Q6ZNF4	Silent	SNP	ENST00000511885.2	37	CCDS3360.1	SNP	45	Baylor																																																																																				0.418	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808		Silent
PRKAR2A	5576	hgsc.bcm.edu	37	3	48789616	48789616	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:48789616T>G	ENST00000265563.8	-	10	1323	c.1074A>C	c.(1072-1074)aaA>aaC	p.K358N	PRKAR2A_ENST00000454963.1_Missense_Mutation_p.K358N|PRKAR2A_ENST00000296446.8_Missense_Mutation_p.K336N	NM_004157.2	NP_004148.1	P13861	KAP2_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, alpha	358					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)	p.K358N(1)	SLC26A6/PRKAR2A(2)	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		TACCTAAGCATTTGACATCTC	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	77.0	79.0					3																	48789616		2203	4300	6503	48764620	SO:0001583	missense	5576				CCDS2778.1	3p21.3-p21.2	2009-07-10			ENSG00000114302	ENSG00000114302	2.7.11.1		9391	protein-coding gene	gene with protein product		176910		PRKAR2		9676433	Standard	NM_004157		Approved		uc003cux.1	P13861	OTTHUMG00000133540	ENST00000265563.8:c.1074A>C	3.37:g.48789616T>G	ENSP00000265563:p.Lys358Asn	Somatic		Capture	SOLID	Phase_IV	48764620	Q16823|Q9BUB1	Missense_Mutation	SNP	ENST00000265563.8	37	CCDS2778.1	SNP	52	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.95|19.95	3.922403|3.922403	0.73213|0.73213	.|.	.|.	ENSG00000114302|ENSG00000114302	ENST00000265563;ENST00000454963;ENST00000296446|ENST00000457914	D;D;D|.	0.92911|.	-3.13;-3.13;-3.13|.	5.11|5.11	2.68|2.68	0.31781|0.31781	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);|.	0.054080|.	0.64402|.	D|.	0.000001|.	T|T	0.75547|0.75547	0.3864|0.3864	M|M	0.91090|0.91090	3.175|3.175	0.80722|0.80722	D|D	1|1	D;P|.	0.65815|.	0.995;0.956|.	P;P|.	0.60789|.	0.879;0.733|.	T|T	0.73895|0.73895	-0.3838|-0.3838	10|5	0.87932|.	D|.	0|.	0.403|0.403	5.4251|5.4251	0.16421|0.16421	0.0:0.1482:0.1486:0.7031|0.0:0.1482:0.1486:0.7031	.|.	336;358|.	Q9BUB1;P13861|.	.;KAP2_HUMAN|.	N|L	358;358;336|46	ENSP00000265563:K358N;ENSP00000394041:K358N;ENSP00000296446:K336N|.	ENSP00000265563:K358N|.	K|M	-|-	3|1	2|0	PRKAR2A|PRKAR2A	48764620|48764620	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.572000|0.572000	0.23684|0.23684	0.492000|0.492000	0.27815|0.27815	0.533000|0.533000	0.62120|0.62120	AAA|ATG		0.418	PRKAR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257518.1			Missense_Mutation
PTPRN	5798	hgsc.bcm.edu	37	2	220162006	220162006	+	Silent	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:220162006G>A	ENST00000295718.2	-	14	2277	c.2037C>T	c.(2035-2037)tgC>tgT	p.C679C	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.C589C|PTPRN_ENST00000409251.3_Silent_p.C650C|PTPRN_ENST00000497977.1_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	679					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.C679C(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CCGGCTCCTCGCACCAGGACG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	2											50.0	48.0	49.0					2																	220162006		2203	4300	6503	219870250	SO:0001819	synonymous_variant	5798				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2037C>T	2.37:g.220162006G>A		Somatic		Capture	SOLID	Phase_IV	219870250	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	ENST00000295718.2	37	CCDS2440.1	SNP	38	Baylor																																																																																				0.652	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2			Silent
PTPRZ1	5803	hgsc.bcm.edu	37	7	121608023	121608023	+	Missense_Mutation	SNP	A	A	T			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr7:121608023A>T	ENST00000393386.2	+	3	554	c.143A>T	c.(142-144)aAt>aTt	p.N48I	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.N48I	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	48	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.N48I(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AATCAAAAAAATTGGGGAAAG	0.279																																																1	Substitution - Missense(1)	ovary(1)	7											50.0	53.0	52.0					7																	121608023		2203	4296	6499	121395259	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.143A>T	7.37:g.121608023A>T	ENSP00000377047:p.Asn48Ile	Somatic		Capture	SOLID	Phase_IV	121395259	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	21.0	4.087790	0.76642	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.67865	-0.29;-0.29	5.53	5.53	0.82687	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.073237	0.56097	D	0.000032	T	0.80308	0.4599	M	0.87682	2.9	0.36418	D	0.864127	D;D	0.71674	0.989;0.998	P;P	0.59056	0.851;0.851	D	0.86917	0.2064	10	0.87932	D	0	.	11.0763	0.48034	0.9277:0.0:0.0722:0.0	.	48;48	C9JFM0;P23471	.;PTPRZ_HUMAN	I	48	ENSP00000377047:N48I;ENSP00000410000:N48I	ENSP00000377047:N48I	N	+	2	0	PTPRZ1	121395259	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.806000	0.75195	2.227000	0.72691	0.528000	0.53228	AAT		0.279	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		Missense_Mutation
RGS16	6004	hgsc.bcm.edu	37	1	182571206	182571206	+	Silent	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr1:182571206G>A	ENST00000367558.5	-	4	430	c.282C>T	c.(280-282)ttC>ttT	p.F94F		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	94	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.F94F(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						AGGCCAGCCAGAACTCCAGGT	0.542											OREG0014036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	1											97.0	104.0	102.0					1																	182571206		2203	4300	6503	180837829	SO:0001819	synonymous_variant	6004			U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.282C>T	1.37:g.182571206G>A		Somatic	1977	Capture	SOLID	Phase_IV	180837829	B2R4M4|Q5VYN9|Q99701	Silent	SNP	ENST00000367558.5	37	CCDS1348.1	SNP	33	Baylor																																																																																				0.542	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928		Silent
RIPK3	11035	hgsc.bcm.edu	37	14	24806668	24806668	+	Splice_Site	SNP	T	T	A			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr14:24806668T>A	ENST00000216274.5	-	8	1119		c.e8-2		ADCY4_ENST00000396747.3_5'Flank|ADCY4_ENST00000310677.4_5'Flank|RP11-934B9.3_ENST00000555591.1_5'Flank|RIPK3_ENST00000554338.1_5'Flank|ADCY4_ENST00000418030.2_5'Flank|ADCY4_ENST00000558563.1_5'Flank|ADCY4_ENST00000554068.2_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3						activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)	p.?(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		ATCCTTTACCTGCAGGGATGG	0.507																																					Pancreas(58;918 1191 4668 13304 15331)											1	Unknown(1)	ovary(1)	14											136.0	144.0	141.0					14																	24806668		2202	4300	6502	23876508	SO:0001630	splice_region_variant	11035			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.901-2A>T	14.37:g.24806668T>A		Somatic		Capture	SOLID	Phase_IV	23876508	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Splice_Site_SNP	SNP	ENST00000216274.5	37	CCDS9628.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.98	3.272394	0.59649	.	.	ENSG00000129465	ENST00000216274	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5184	0.44903	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RIPK3	23876508	1.000000	0.71417	0.993000	0.49108	0.527000	0.34593	3.045000	0.49838	2.259000	0.74868	0.533000	0.62120	.		0.507	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	Intron	Splice_Site_SNP
RNF157	114804	hgsc.bcm.edu	37	17	74152377	74152377	+	Frame_Shift_Del	DEL	T	T	-			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr17:74152377delT	ENST00000269391.6	-	14	1571	c.1439delA	c.(1438-1440)gagfs	p.E480fs	RNF157-AS1_ENST00000586627.1_RNA|RNF157-AS1_ENST00000586661.1_RNA|RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000592748.1_RNA|RNF157-AS1_ENST00000585542.1_RNA|RNF157_ENST00000319945.6_Frame_Shift_Del_p.E480fs	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	480	Ser-rich.						zinc ion binding (GO:0008270)	p.E1083fs*114(1)		breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			GGTGAGATTCTCACTTTCTGG	0.562																																					GBM(186;507 2120 27388 27773 52994)											1	Deletion - Frameshift(1)	ovary(1)	17											109.0	95.0	100.0					17																	74152377		2203	4300	6503	71663972	SO:0001589	frameshift_variant	114804			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1439delA	17.37:g.74152377delT	ENSP00000269391:p.Glu480fs	Somatic		Capture	SOLID	Phase_IV	71663972	Q8NB72|Q96N56	Frame_Shift_Del	DEL	ENST00000269391.6	37	CCDS32740.1	DEL	54	Baylor																																																																																				0.562	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732		Frame_Shift_Del
RTN2	6253	hgsc.bcm.edu	37	19	45992121	45992121	+	Silent	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr19:45992121G>A	ENST00000245923.4	-	7	1600	c.1365C>T	c.(1363-1365)ctC>ctT	p.L455L	PPM1N_ENST00000401705.1_5'UTR|RTN2_ENST00000344680.4_Silent_p.L382L|RTN2_ENST00000430715.2_Silent_p.L115L|RTN2_ENST00000590526.1_Silent_p.L181L	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	455	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)		p.L455L(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGGAATCCACGAGGTCTTCTA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											22.0	22.0	22.0					19																	45992121		2203	4298	6501	50683961	SO:0001819	synonymous_variant	6253			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.1365C>T	19.37:g.45992121G>A		Somatic		Capture	SOLID	Phase_IV	50683961	O60509|Q7RTM6|Q7RTN1|Q7RTN2	Silent	SNP	ENST00000245923.4	37	CCDS12665.1	SNP	37	Baylor																																																																																				0.627	RTN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459574.1	NM_005619		Silent
RTTN	25914	hgsc.bcm.edu	37	18	67795701	67795701	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr18:67795701C>A	ENST00000255674.6	-	24	3322	c.3036G>T	c.(3034-3036)ttG>ttT	p.L1012F	RTTN_ENST00000454359.1_3'UTR|RTTN_ENST00000437017.1_Missense_Mutation_p.L1012F	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1012					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.L1012F(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GCTTCAAGGCCAAACAATCAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	18											87.0	84.0	85.0					18																	67795701		2054	4219	6273	65946681	SO:0001583	missense	25914			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.3036G>T	18.37:g.67795701C>A	ENSP00000255674:p.Leu1012Phe	Somatic		Capture	SOLID	Phase_IV	65946681	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	ENST00000255674.6	37	CCDS42443.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278763	0.80692	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.25749	1.78;1.78	5.81	5.81	0.92471	.	0.073718	0.56097	D	0.000028	T	0.47563	0.1452	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.44483	-0.9325	10	0.72032	D	0.01	.	13.3054	0.60349	0.0:0.9281:0.0:0.0719	.	1012	Q86VV8	RTTN_HUMAN	F	1012	ENSP00000255674:L1012F;ENSP00000399520:L1012F	ENSP00000255674:L1012F	L	-	3	2	RTTN	65946681	0.992000	0.36948	0.999000	0.59377	0.992000	0.81027	3.576000	0.53878	2.741000	0.93983	0.650000	0.86243	TTG		0.408	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		Missense_Mutation
SEPT4	5414	hgsc.bcm.edu	37	17	56598150	56598150	+	Missense_Mutation	SNP	C	C	A			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr17:56598150C>A	ENST00000317268.3	-	11	1507	c.1331G>T	c.(1330-1332)gGg>gTg	p.G444V	SEPT4_ENST00000457347.2_Missense_Mutation_p.G459V|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000393086.1_Missense_Mutation_p.G425V|SEPT4_ENST00000583114.1_Missense_Mutation_p.G297V|MTMR4_ENST00000323456.5_5'Flank|SEPT4_ENST00000579371.1_Splice_Site_p.K327N|SEPT4_ENST00000580844.1_Missense_Mutation_p.G345V|SEPT4_ENST00000317256.6_Missense_Mutation_p.G425V|MTMR4_ENST00000579925.1_5'Flank|SEPT4_ENST00000426861.1_3'UTR|SEPT4_ENST00000412945.3_Missense_Mutation_p.G436V	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	444					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGGATCTGTCCCTGGTGGGAC	0.537											OREG0024614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											170.0	168.0	169.0					17																	56598150		2203	4300	6503	53953149	SO:0001583	missense	5414			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.1331G>T	17.37:g.56598150C>A	ENSP00000321674:p.Gly444Val	Somatic	1016	Capture	SOLID	Phase_IV	53953149	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	37	CCDS11610.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.972	0.549413	0.13374	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086	T;T;T;T	0.52057	0.68;0.69;0.68;0.69	5.42	4.45	0.53987	.	0.142666	0.47455	D	0.000237	T	0.31167	0.0788	N	0.19112	0.55	0.58432	D	0.999993	B;B;B;B;B	0.23377	0.065;0.084;0.003;0.0;0.009	B;B;B;B;B	0.20577	0.03;0.028;0.02;0.003;0.013	T	0.10268	-1.0637	10	0.41790	T	0.15	.	9.5382	0.39235	0.161:0.6837:0.1553:0.0	.	436;459;425;297;444	O43236-3;O43236-4;O43236-2;O43236-5;O43236	.;.;.;.;SEPT4_HUMAN	V	436;458;425;444;425	ENSP00000414779:G436V;ENSP00000321071:G425V;ENSP00000321674:G444V;ENSP00000376801:G425V	ENSP00000321071:G425V	G	-	2	0	SEPT4	53953149	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.321000	0.19558	1.407000	0.46875	0.655000	0.94253	GGG		0.537	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417		Missense_Mutation
SLAIN1	122060	hgsc.bcm.edu	37	13	78335212	78335212	+	Missense_Mutation	SNP	T	T	G			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr13:78335212T>G	ENST00000466548.1	+	7	1624	c.1598T>G	c.(1597-1599)cTg>cGg	p.L533R	SLAIN1_ENST00000488699.1_Missense_Mutation_p.L391R|SLAIN1_ENST00000418532.1_Missense_Mutation_p.L314R|SLAIN1_ENST00000314070.5_Missense_Mutation_p.L156R|SLAIN1_ENST00000267219.8_Missense_Mutation_p.L314R|SLAIN1_ENST00000358679.3_Missense_Mutation_p.L270R|SLAIN1_ENST00000351546.3_Missense_Mutation_p.L270R	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	533								p.L314R(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		GGGAGTAACCTGCCTCGAAGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	13											73.0	66.0	69.0					13																	78335212		2203	4300	6503	77233213	SO:0001583	missense	122060			AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.1598T>G	13.37:g.78335212T>G	ENSP00000419730:p.Leu533Arg	Somatic		Capture	SOLID	Phase_IV	77233213	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Missense_Mutation	SNP	ENST00000466548.1	37		SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	21.0	4.086564	0.76642	.	.	ENSG00000139737	ENST00000466548;ENST00000389459;ENST00000418532;ENST00000488699;ENST00000267219;ENST00000351546;ENST00000314070;ENST00000358679	.	.	.	5.9	5.9	0.94986	.	0.498330	0.21991	N	0.066150	T	0.68997	0.3062	L	0.48642	1.525	0.35714	D	0.816618	P;D;P;D	0.64830	0.826;0.986;0.911;0.994	B;P;P;P	0.62298	0.341;0.858;0.461;0.9	T	0.76868	-0.2800	9	0.72032	D	0.01	-15.7098	16.3317	0.83023	0.0:0.0:0.0:1.0	.	269;391;156;533	B7Z326;B7Z209;Q8ND10;Q8ND83	.;.;.;SLAI1_HUMAN	R	533;533;314;391;314;270;156;270	.	ENSP00000267219:L314R	L	+	2	0	SLAIN1	77233213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.801000	0.55545	2.264000	0.75181	0.533000	0.62120	CTG		0.473	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000355018.1	NM_144595		Missense_Mutation
SMOC2	64094	hgsc.bcm.edu	37	6	169008864	169008864	+	Silent	SNP	G	G	A	rs137949063	byFrequency	TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr6:169008864G>A	ENST00000356284.2	+	9	1072	c.852G>A	c.(850-852)acG>acA	p.T284T	SMOC2_ENST00000354536.5_Silent_p.T295T	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	284					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GTGACAACACGGCCAGGGCCC	0.632																																																0			6											34.0	31.0	32.0					6																	169008864		2203	4299	6502	168750789	SO:0001819	synonymous_variant	64094			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.852G>A	6.37:g.169008864G>A		Somatic		Capture	SOLID	Phase_IV	168750789	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1	SNP	39	Baylor																																																																																				0.632	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			Silent
SND1	27044	hgsc.bcm.edu	37	7	127528015	127528015	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr7:127528015T>A	ENST00000354725.3	+	13	1598	c.1404T>A	c.(1402-1404)gaT>gaA	p.D468E		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	468	TNase-like 3. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.D468E(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						ACCGGCAGGATGATGACCAGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											107.0	79.0	89.0					7																	127528015		2203	4300	6503	127315251	SO:0001583	missense	27044				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.1404T>A	7.37:g.127528015T>A	ENSP00000346762:p.Asp468Glu	Somatic		Capture	SOLID	Phase_IV	127315251	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.77	3.693944	0.68386	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.30448	1.53;1.53	5.1	2.66	0.31614	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.047219	0.85682	D	0.000000	T	0.36358	0.0964	M	0.74881	2.28	0.58432	D	0.999996	P	0.35507	0.506	B	0.41374	0.355	T	0.12993	-1.0526	10	0.59425	D	0.04	-20.5936	8.2113	0.31486	0.0:0.1677:0.0:0.8323	.	468	Q7KZF4	SND1_HUMAN	E	468;458;17	ENSP00000346762:D468E;ENSP00000419327:D17E	ENSP00000346762:D468E	D	+	3	2	SND1	127315251	0.995000	0.38212	1.000000	0.80357	0.999000	0.98932	0.194000	0.17135	0.346000	0.23899	0.533000	0.62120	GAT		0.473	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390		Missense_Mutation
SRL	6345	hgsc.bcm.edu	37	16	4242768	4242768	+	Missense_Mutation	SNP	C	C	T			TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr16:4242768C>T	ENST00000399609.3	-	6	820	c.808G>A	c.(808-810)Ggg>Agg	p.G270R	SRL_ENST00000537996.1_Missense_Mutation_p.G228R	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	729	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G270R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						AAGAGGGCCCCGTAAACCCGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	16											80.0	84.0	83.0					16																	4242768		1887	4108	5995	4182769	SO:0001583	missense	6345			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.808G>A	16.37:g.4242768C>T	ENSP00000382518:p.Gly270Arg	Somatic		Capture	SOLID	Phase_IV	4182769		Missense_Mutation	SNP	ENST00000399609.3	37	CCDS42113.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369785	0.82573	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.95238	-3.65;-3.65	4.9	4.9	0.64082	.	0.065237	0.64402	U	0.000011	D	0.97359	0.9136	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98029	1.0375	10	0.87932	D	0	-19.658	17.8967	0.88891	0.0:1.0:0.0:0.0	.	270	Q86TD4-2	.	R	270;728;228	ENSP00000382518:G270R;ENSP00000440350:G228R	ENSP00000333285:G728R	G	-	1	0	SRL	4182769	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.651000	0.83577	2.538000	0.85594	0.655000	0.94253	GGG		0.557	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152		Missense_Mutation
STAC3	246329	hgsc.bcm.edu	37	12	57637954	57637954	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr12:57637954G>A	ENST00000332782.2	-	11	1114	c.913C>T	c.(913-915)Cgg>Tgg	p.R305W	STAC3_ENST00000546246.2_Missense_Mutation_p.R119W|STAC3_ENST00000554578.1_Missense_Mutation_p.R266W	NM_145064.1	NP_659501.1	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	305	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)|neuromuscular synaptic transmission (GO:0007274)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)		identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.R305W(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(2)|skin(1)	18						TCTCCAGCCCGGACCCGAATG	0.552											OREG0021942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											72.0	69.0	70.0					12																	57637954		2203	4300	6503	55924221	SO:0001583	missense	246329			AK057013	CCDS8936.1, CCDS66405.1, CCDS66406.1	12q13.3	2014-08-12			ENSG00000185482	ENSG00000185482			28423	protein-coding gene	gene with protein product		615521				12477932	Standard	NM_001286257		Approved	MGC2793	uc009zpl.2	Q96MF2	OTTHUMG00000171271	ENST00000332782.2:c.913C>T	12.37:g.57637954G>A	ENSP00000329200:p.Arg305Trp	Somatic	1024	Capture	SOLID	Phase_IV	55924221	B4DUK9|Q96HU5	Missense_Mutation	SNP	ENST00000332782.2	37	CCDS8936.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.171530	0.94807	.	.	ENSG00000185482	ENST00000554578;ENST00000332782;ENST00000546246	D;D;T	0.83335	-1.69;-1.71;-0.18	5.39	4.45	0.53987	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	D	0.90349	0.6980	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.91172	0.4969	10	0.72032	D	0.01	-32.0365	15.0885	0.72174	0.0:0.0:0.8584:0.1416	.	305	Q96MF2	STAC3_HUMAN	W	266;305;119	ENSP00000452068:R266W;ENSP00000329200:R305W;ENSP00000441515:R119W	ENSP00000329200:R305W	R	-	1	2	STAC3	55924221	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	5.224000	0.65288	2.710000	0.92621	0.655000	0.94253	CGG		0.552	STAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412724.2	NM_145064		Missense_Mutation
CCT6A	908	hgsc.bcm.edu	37	7	56132032	56132033	+	IGR	INS	-	-	AGT			TCGA-10-0938-01	TCGA-10-0938-11	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr7:56132032_56132033insAGT	ENST00000275603.4	+	0	2719				SUMF2_ENST00000342190.6_In_Frame_Ins_p.29_29P>QS|SUMF2_ENST00000413756.1_In_Frame_Ins_p.10_10P>QS|SUMF2_ENST00000437307.2_In_Frame_Ins_p.10_10P>QS|SUMF2_ENST00000395435.2_In_Frame_Ins_p.29_29P>QS|SUMF2_ENST00000434526.2_In_Frame_Ins_p.29_29P>QS|SUMF2_ENST00000395436.2_In_Frame_Ins_p.29_29P>QS|SUMF2_ENST00000275607.9_5'UTR	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)						'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.P10>QS(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACCGCTGCTGCCCCTGCTGTCG	0.723																																																1	Complex - insertion inframe(1)	ovary(1)	7																																								56099527	SO:0001628	intergenic_variant	25870			M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842		7.37:g.56132032_56132033insAGT		Somatic		Capture	SOLID	Phase_IV	56099526	A6NCD2|Q3KP28|Q75LP4|Q96S46	In_Frame_Ins	INS	ENST00000275603.4	37	CCDS5523.1	INS	26	Baylor																																																																																				0.723	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251526.2	NM_001762		In_Frame_Ins
TEKT4	150483	hgsc.bcm.edu	37	2	95540668	95540668	+	Silent	SNP	C	C	T	rs546744900		TCGA-10-0938-01	TCGA-10-0938-11	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr2:95540668C>T	ENST00000295201.4	+	4	998	c.861C>T	c.(859-861)gcC>gcT	p.A287A	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	287					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						AGTGCGACGCCGTGAACCTGG	0.697													.|||	1	0.000199681	0.0	0.0	5008	,	,		13304	0.0		0.0	False		,,,				2504	0.001															0			2											25.0	32.0	29.0					2																	95540668		2202	4298	6500	94904395	SO:0001819	synonymous_variant	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.861C>T	2.37:g.95540668C>T		Somatic		Capture	SOLID	Phase_IV	94904395		Silent	SNP	ENST00000295201.4	37	CCDS2005.1	SNP	23	Baylor																																																																																				0.697	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705		Silent
TP53	7157	hgsc.bcm.edu	37	17	7576852	7576852	+	Splice_Site	SNP	C	C	A	rs11575997		TCGA-10-0938-01	TCGA-10-0938-11	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr17:7576852C>A	ENST00000269305.4	-	9	1183		c.e9+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(24)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGACTTAGTACCTGAAGGGTG	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Unknown(24)|Whole gene deletion(8)|Insertion - Frameshift(1)	ovary(8)|lung(4)|breast(4)|bone(4)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|NS(2)|pancreas(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|skin(1)	17	GRCh37	CD002536	TP53	D	rs11575997						115.0	108.0	111.0					17																	7576852		2203	4300	6503	7517577	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.993+1G>T	17.37:g.7576852C>A		Somatic		Capture	SOLID	Phase_IV	7517577	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301218	0.40694	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000419024	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6932	0.56988	0.0:1.0:0.0:0.0	rs11575997	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517577	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	2.315000	0.43752	2.462000	0.83206	0.561000	0.74099	.		0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
TRIM71	131405	hgsc.bcm.edu	37	3	32915464	32915464	+	Frame_Shift_Del	DEL	G	G	-			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:32915464delG	ENST00000383763.5	+	2	1070	c.1007delG	c.(1006-1008)cgafs	p.R336fs		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	336					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R336fs*6(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CAGCAGGGACGACAGGCAATC	0.617																																																1	Deletion - Frameshift(1)	ovary(1)	3											80.0	86.0	84.0					3																	32915464		2112	4227	6339	32890468	SO:0001589	frameshift_variant	131405				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1007delG	3.37:g.32915464delG	ENSP00000373272:p.Arg336fs	Somatic		Capture	SOLID	Phase_IV	32890468		Frame_Shift_Del	DEL	ENST00000383763.5	37	CCDS43060.1	DEL	37	Baylor																																																																																				0.617	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111		Frame_Shift_Del
ULK4	54986	hgsc.bcm.edu	37	3	41497016	41497016	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr3:41497016G>A	ENST00000301831.4	-	34	3926	c.3464C>T	c.(3463-3465)aCa>aTa	p.T1155I		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1155					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T307I(1)		breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AATCAGGTCTGTCAGAGGTCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	113.0	112.0					3																	41497016		1916	4133	6049	41472020	SO:0001583	missense	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3464C>T	3.37:g.41497016G>A	ENSP00000301831:p.Thr1155Ile	Somatic		Capture	SOLID	Phase_IV	41472020	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477656	0.44044	.	.	ENSG00000168038	ENST00000301831	T	0.65364	-0.15	5.37	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.140345	0.29066	U	0.013252	T	0.56108	0.1963	L	0.46157	1.445	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.54370	-0.8304	10	0.52906	T	0.07	.	14.0745	0.64882	0.0725:0.0:0.9275:0.0	.	1155	Q96C45	ULK4_HUMAN	I	1155	ENSP00000301831:T1155I	ENSP00000301831:T1155I	T	-	2	0	ULK4	41472020	1.000000	0.71417	0.853000	0.33588	0.764000	0.43329	3.498000	0.53302	1.287000	0.44583	0.655000	0.94253	ACA		0.478	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989		Missense_Mutation
WHSC1	7468	hgsc.bcm.edu	37	4	1902766	1902766	+	Frame_Shift_Del	DEL	A	A	-			TCGA-10-0938-01	TCGA-10-0938-11	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr4:1902766delA	ENST00000382895.3	+	4	816	c.385delA	c.(385-387)accfs	p.T129fs	WHSC1_ENST00000382892.2_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000420906.2_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000398261.1_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000503128.1_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000382891.5_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000514045.1_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000508803.1_Frame_Shift_Del_p.T129fs|WHSC1_ENST00000436793.1_Frame_Shift_Del_p.T129fs	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	129					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.T129fs*5(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GCTGAAAATCACCAAAACATA	0.433			T	IGH@	MM																																		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	1	Deletion - Frameshift(1)	ovary(1)	4											59.0	60.0	60.0					4																	1902766		2203	4300	6503	1872564	SO:0001589	frameshift_variant	7468			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.385delA	4.37:g.1902766delA	ENSP00000372351:p.Thr129fs	Somatic		Capture	SOLID	Phase_IV	1872564	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Frame_Shift_Del	DEL	ENST00000382895.3	37	CCDS33940.1	DEL	6	Baylor																																																																																				0.433	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330		Frame_Shift_Del
XIAP	331	hgsc.bcm.edu	37	X	123040922	123040922	+	Missense_Mutation	SNP	T	T	A			TCGA-10-0938-01	TCGA-10-0938-11	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chrX:123040922T>A	ENST00000371199.3	+	7	1684	c.1385T>A	c.(1384-1386)tTt>tAt	p.F462Y	XIAP_ENST00000468691.1_3'UTR|XIAP_ENST00000434753.3_Missense_Mutation_p.F462Y|XIAP_ENST00000355640.3_Missense_Mutation_p.F462Y	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	462					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F462Y(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GCTATCGTTTTTGTTCCTTGT	0.383									X-linked Lymphoproliferative syndrome																																							1	Substitution - Missense(1)	ovary(1)	X											84.0	76.0	79.0					X																	123040922		2203	4300	6503	122868603	SO:0001583	missense	331	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1385T>A	X.37:g.123040922T>A	ENSP00000360242:p.Phe462Tyr	Somatic		Capture	SOLID	Phase_IV	122868603	D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	37	CCDS14606.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	t	21.4	4.136713	0.77662	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.80566	-1.39;-1.39;-1.39	5.52	5.52	0.82312	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.077814	0.53938	D	0.000052	D	0.89444	0.6717	M	0.81341	2.54	0.50039	D	0.999841	D	0.89917	1.0	D	0.79784	0.993	D	0.90062	0.4157	9	.	.	.	-9.636	14.3202	0.66482	0.0:0.0:0.0:1.0	.	462	P98170	XIAP_HUMAN	Y	462	ENSP00000395230:F462Y;ENSP00000360242:F462Y;ENSP00000347858:F462Y	.	F	+	2	0	XIAP	122868603	1.000000	0.71417	0.867000	0.34043	0.893000	0.52053	7.526000	0.81920	1.841000	0.53522	0.437000	0.28790	TTT		0.383	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167		Missense_Mutation
YTHDF1	54915	hgsc.bcm.edu	37	20	61834199	61834199	+	Missense_Mutation	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr20:61834199G>A	ENST00000370339.3	-	4	1434	c.1093C>T	c.(1093-1095)Cac>Tac	p.H365Y	YTHDF1_ENST00000370333.4_Missense_Mutation_p.H315Y|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	365							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.H183Y(1)|p.H365Y(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						AGGACGGGGTGGGATTCGACG	0.552																																																2	Substitution - Missense(2)	ovary(2)	20											71.0	75.0	74.0					20																	61834199		2203	4300	6503	61304644	SO:0001583	missense	54915			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.1093C>T	20.37:g.61834199G>A	ENSP00000359364:p.His365Tyr	Somatic		Capture	SOLID	Phase_IV	61304644	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	CCDS13511.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657305	0.67586	.	.	ENSG00000149658	ENST00000370339;ENST00000370333;ENST00000342761	T;T	0.25085	1.82;1.83	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.49983	0.1589	M	0.75777	2.31	0.80722	D	1	D	0.60575	0.988	P	0.61201	0.885	T	0.56691	-0.7937	10	0.87932	D	0	-27.4511	18.0486	0.89341	0.0:0.0:1.0:0.0	.	365	Q9BYJ9	YTHD1_HUMAN	Y	365;315;181	ENSP00000359364:H365Y;ENSP00000359358:H315Y	ENSP00000339489:H181Y	H	-	1	0	YTHDF1	61304644	1.000000	0.71417	0.994000	0.49952	0.645000	0.38454	9.659000	0.98597	2.339000	0.79563	0.591000	0.81541	CAC		0.552	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798		Missense_Mutation
ZFP41	286128	hgsc.bcm.edu	37	8	144332451	144332451	+	Silent	SNP	G	G	A			TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr8:144332451G>A	ENST00000330701.4	+	2	807	c.438G>A	c.(436-438)ggG>ggA	p.G146G	ZFP41_ENST00000520584.1_Silent_p.G146G|ZFP41_ENST00000522452.1_Silent_p.G146G	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	146					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G146G(1)		breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			TCAAATGCGGGGAGTGCGGGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	8											112.0	112.0	112.0					8																	144332451		2203	4300	6503	144403826	SO:0001819	synonymous_variant	286128				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.438G>A	8.37:g.144332451G>A		Somatic		Capture	SOLID	Phase_IV	144403826	D3DWJ5	Silent	SNP	ENST00000330701.4	37	CCDS6397.1	SNP	43	Baylor																																																																																				0.582	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381114.2	NM_173832		Silent
ZNF85	7639	hgsc.bcm.edu	37	19	21131664	21131664	+	Missense_Mutation	SNP	G	G	T	rs56231962	byFrequency	TCGA-10-0938-01	TCGA-10-0938-11	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-10-0938-01	TCGA-10-0938-11	g.chr19:21131664G>T	ENST00000328178.8	+	4	457	c.344G>T	c.(343-345)aGa>aTa	p.R115I	ZNF85_ENST00000601023.1_Missense_Mutation_p.R56I|ZNF85_ENST00000345030.6_Missense_Mutation_p.R82I|ZNF85_ENST00000597314.1_3'UTR	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	115			R -> I (in dbSNP:rs56231962). {ECO:0000269|PubMed:2023909}.		transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R115I(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TTACCATTAAGAAAAGGCTGT	0.368													.|||	392	0.0782748	0.0492	0.0677	5008	,	,		17320	0.0288		0.1302	False		,,,				2504	0.1227															1	Substitution - Missense(1)	ovary(1)	19						G	ILE/ARG	317,4089		10,297,1896	59.0	60.0	60.0		344	-0.5	0.0	19	dbSNP_129	60	1072,7526		90,892,3317	yes	missense	ZNF85	NM_003429.4	97	100,1189,5213	TT,TG,GG		12.468,7.1947,10.6813	benign	115/596	21131664	1389,11615	2203	4299	6502	20923504	SO:0001583	missense	7639			U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.344G>T	19.37:g.21131664G>T	ENSP00000329793:p.Arg115Ile	Somatic		Capture	SOLID	Phase_IV	20923504	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	SNP	33	Baylor	174	0.07967032967032966	28	0.056910569105691054	25	0.06906077348066299	15	0.026223776223776224	106	0.13984168865435356	.	7.363	0.625230	0.14257	0.071947	0.12468	ENSG00000105750	ENST00000328178;ENST00000345030	T;T	0.06294	3.42;3.32	1.04	-0.511	0.11970	.	.	.	.	.	T	0.00073	0.0002	M	0.77712	2.385	0.58432	P	1.0000000000287557E-6	B;P;D	0.54964	0.079;0.697;0.969	B;B;P	0.45660	0.049;0.202;0.489	T	0.15780	-1.0425	8	0.51188	T	0.08	.	6.491	0.22115	0.0:0.3067:0.6933:0.0	rs56231962;rs61742656	82;56;115	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	I	115;82	ENSP00000329793:R115I;ENSP00000342340:R82I	ENSP00000329793:R115I	R	+	2	0	ZNF85	20923504	0.136000	0.22515	0.021000	0.16686	0.020000	0.10135	1.678000	0.37586	-0.490000	0.06707	-0.485000	0.04761	AGA		0.368	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429		Missense_Mutation
