#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCD2	225	hgsc.bcm.edu	37	12	39997787	39997787	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0720-01	TCGA-13-0720-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr12:39997787T>C	ENST00000308666.3	-	5	1562	c.1427A>G	c.(1426-1428)cAc>cGc	p.H476R		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	476					fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.H476R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						AATAATTCCGTGATCCACATC	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											98.0	99.0	99.0					12																	39997787		2203	4300	6503	38284054	SO:0001583	missense	225			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1427A>G	12.37:g.39997787T>C	ENSP00000310688:p.His476Arg	Somatic		Capture	SOLID	Phase_IV	38284054	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.911	0.958758	0.18507	.	.	ENSG00000173208	ENST00000308666	D	0.99841	-7.09	5.08	3.9	0.45041	.	0.311951	0.30809	N	0.008840	D	0.98369	0.9458	N	0.13098	0.295	0.40075	D	0.976063	B	0.02656	0.0	B	0.04013	0.001	D	0.99965	1.1835	9	.	.	.	-17.8259	10.8843	0.46957	0.0:0.0754:0.0:0.9246	.	476	Q9UBJ2	ABCD2_HUMAN	R	476	ENSP00000310688:H476R	.	H	-	2	0	ABCD2	38284054	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.707000	0.54838	0.756000	0.33013	0.460000	0.39030	CAC		0.318	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		Missense_Mutation
ADAMTS12	81792	hgsc.bcm.edu	37	5	33596148	33596148	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr5:33596148C>T	ENST00000504830.1	-	17	2880	c.2545G>A	c.(2545-2547)Gcc>Acc	p.A849T	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.A764T	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	849	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A849T(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ATGCAATGGGCAGTTTGGCGG	0.517										HNSCC(64;0.19)																																						1	Substitution - Missense(1)	ovary(1)	5											133.0	122.0	126.0					5																	33596148		2203	4300	6503	33631905	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2545G>A	5.37:g.33596148C>T	ENSP00000422554:p.Ala849Thr	Somatic		Capture	SOLID	Phase_IV	33631905	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.068293	0.93950	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.51325	0.71;0.71	5.77	5.77	0.91146	.	0.221099	0.47093	D	0.000252	T	0.66790	0.2825	M	0.78456	2.415	0.80722	D	1	D;P	0.76494	0.999;0.947	D;P	0.63033	0.91;0.867	T	0.59825	-0.7381	10	0.11182	T	0.66	.	20.3559	0.98840	0.0:1.0:0.0:0.0	.	764;849	P58397-3;P58397	.;ATS12_HUMAN	T	849;764	ENSP00000422554:A849T;ENSP00000344847:A764T	ENSP00000344847:A764T	A	-	1	0	ADAMTS12	33631905	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.669000	0.46825	2.890000	0.99128	0.585000	0.79938	GCC		0.517	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955		Missense_Mutation
ADAMTS20	80070	hgsc.bcm.edu	37	12	43896143	43896154	+	In_Frame_Del	DEL	CATTAAGATCTT	CATTAAGATCTT	-			TCGA-13-0720-01	TCGA-13-0720-10	CATTAAGATCTT	CATTAAGATCTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr12:43896143_43896154delCATTAAGATCTT	ENST00000389420.3	-	4	667_678	c.668_679delAAGATCTTAATG	c.(667-681)gaagatcttaatgta>gta	p.EDLN223del	ADAMTS20_ENST00000553158.1_In_Frame_Del_p.EDLN223del	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	223					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E223_N226del(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTTTCATTACATTAAGATCTTCATTCATGTT	0.316																																																1	Deletion - In frame(1)	ovary(1)	12																																								42182421	SO:0001651	inframe_deletion	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.668_679delAAGATCTTAATG	12.37:g.43896143_43896154delCATTAAGATCTT	ENSP00000374071:p.Glu223_Asn226del	Somatic		Capture	SOLID	Phase_IV	42182410	A6NNC9|J3QT00	In_Frame_Del	DEL	ENST00000389420.3	37	CCDS31778.2	DEL	17	Baylor																																																																																				0.316	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		In_Frame_Del
AFTPH	54812	hgsc.bcm.edu	37	2	64778885	64778885	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:64778885A>G	ENST00000422803.1	+	2	591	c.277A>G	c.(277-279)Act>Gct	p.T93A	AFTPH_ENST00000409183.1_5'Flank|AFTPH_ENST00000238855.7_Missense_Mutation_p.T93A|AFTPH_ENST00000409933.1_Missense_Mutation_p.T93A|AFTPH_ENST00000238856.4_Missense_Mutation_p.T93A			Q6ULP2	AFTIN_HUMAN	aftiphilin	93					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)	p.T93A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						TAAGGACATCACTGCTGAACT	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	56.0	57.0					2																	64778885		2203	4299	6502	64632389	SO:0001583	missense	54812			AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.277A>G	2.37:g.64778885A>G	ENSP00000397726:p.Thr93Ala	Somatic		Capture	SOLID	Phase_IV	64632389	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	37		SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	7.203	0.593894	0.13875	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	5.63	4.47	0.54385	.	0.270600	0.32231	N	0.006397	T	0.17577	0.0422	L	0.44542	1.39	0.29730	N	0.837932	B;B;B;B	0.25850	0.005;0.005;0.136;0.136	B;B;B;B	0.24394	0.007;0.007;0.053;0.053	T	0.10337	-1.0634	10	0.26408	T	0.33	-2.2162	10.5873	0.45290	0.9269:0.0:0.0731:0.0	.	93;93;93;93	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	A	93	ENSP00000238856:T93A;ENSP00000397726:T93A;ENSP00000238855:T93A;ENSP00000387071:T93A	ENSP00000238855:T93A	T	+	1	0	AFTPH	64632389	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.564000	0.36375	1.073000	0.40885	-0.290000	0.09829	ACT		0.348	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657		Missense_Mutation
ATF6	22926	hgsc.bcm.edu	37	1	161821600	161821600	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:161821600C>G	ENST00000367942.3	+	11	1475	c.1408C>G	c.(1408-1410)Cta>Gta	p.L470V	ATF6_ENST00000476437.1_3'UTR	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	470	Interaction with THBS4.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.L470V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	TTGTCAGCCCCTAATTAACAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											228.0	207.0	214.0					1																	161821600		2203	4300	6503	160088224	SO:0001583	missense	22926			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1408C>G	1.37:g.161821600C>G	ENSP00000356919:p.Leu470Val	Somatic		Capture	SOLID	Phase_IV	160088224	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	ENST00000367942.3	37	CCDS1235.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627182	0.28978	.	.	ENSG00000118217	ENST00000367942	T	0.14640	2.49	5.73	3.71	0.42584	.	0.329429	0.33419	N	0.004923	T	0.03915	0.0110	L	0.43152	1.355	0.36556	D	0.872161	B;B	0.30406	0.141;0.278	B;B	0.26614	0.071;0.034	T	0.29792	-1.0000	9	0.16896	T	0.51	-12.2887	8.2534	0.31739	0.1671:0.7459:0.0:0.087	.	470;471	P18850;Q59H30	ATF6A_HUMAN;.	V	470	ENSP00000356919:L470V	ENSP00000356919:L470V	L	+	1	2	ATF6	160088224	0.036000	0.19791	0.991000	0.47740	0.955000	0.61496	0.953000	0.29162	2.708000	0.92522	0.563000	0.77884	CTA		0.403	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348		Missense_Mutation
ATP13A5	344905	hgsc.bcm.edu	37	3	193096507	193096507	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr3:193096507T>C	ENST00000342358.4	-	1	125	c.8A>G	c.(7-9)gAg>gGg	p.E3G		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	3						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.E3G(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CTTACTGTTCTCTTCCATCTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											161.0	146.0	151.0					3																	193096507		2203	4300	6503	194579201	SO:0001583	missense	344905			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.8A>G	3.37:g.193096507T>C	ENSP00000341942:p.Glu3Gly	Somatic		Capture	SOLID	Phase_IV	194579201	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399488	0.42512	.	.	ENSG00000187527	ENST00000342358;ENST00000446087	D;T	0.84873	-1.91;0.65	4.72	3.56	0.40772	.	0.456078	0.19920	N	0.103112	T	0.67822	0.2934	N	0.08118	0	0.09310	N	1	P	0.36282	0.546	B	0.32980	0.156	T	0.62329	-0.6877	10	0.72032	D	0.01	-0.8928	7.3762	0.26829	0.0:0.1028:0.0:0.8972	.	3	Q4VNC0	AT135_HUMAN	G	3	ENSP00000341942:E3G;ENSP00000389416:E3G	ENSP00000341942:E3G	E	-	2	0	ATP13A5	194579201	0.969000	0.33509	0.045000	0.18777	0.110000	0.19582	1.498000	0.35660	0.917000	0.36895	0.528000	0.53228	GAG		0.468	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505		Missense_Mutation
AWAT1	158833	hgsc.bcm.edu	37	X	69459756	69459756	+	Silent	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chrX:69459756G>A	ENST00000374521.3	+	6	845	c.804G>A	c.(802-804)ctG>ctA	p.L268L		NM_001013579.2	NP_001013597.1	Q58HT5	AWAT1_HUMAN	acyl-CoA wax alcohol acyltransferase 1	268					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)	p.L348L(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(3)|ovary(4)|skin(1)	15						CTGGGCTCCTGCCATACTCCA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	X											75.0	68.0	70.0					X																	69459756		2203	4300	6503	69376481	SO:0001819	synonymous_variant	158833			BC039181	CCDS35321.1	Xq13.1	2010-01-25	2009-02-23	2009-02-23	ENSG00000204195	ENSG00000204195			23252	protein-coding gene	gene with protein product		300924	"""diacylglycerol O-acyltransferase 2-like 3"""	DGAT2L3		14970677, 15671038	Standard	NM_001013579		Approved		uc004dxy.3	Q58HT5	OTTHUMG00000021773	ENST00000374521.3:c.804G>A	X.37:g.69459756G>A		Somatic		Capture	SOLID	Phase_IV	69376481	Q5JT21|Q6IEE4	Silent	SNP	ENST00000374521.3	37	CCDS35321.1	SNP	46	Baylor																																																																																				0.542	AWAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057066.3	NM_001013579		Silent
NADK2	133686	hgsc.bcm.edu	37	5	36219718	36219720	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-13-0720-01	TCGA-13-0720-10	CTT	CTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr5:36219718_36219720delCTT	ENST00000381937.4	-	5	621_623	c.622_624delAAG	c.(622-624)aagdel	p.K208del	NADK2_ENST00000397338.1_In_Frame_Del_p.K45del|NADK2_ENST00000506945.1_In_Frame_Del_p.K45del|NADK2_ENST00000514504.1_In_Frame_Del_p.K208del|NADK2-AS1_ENST00000501794.2_RNA|NADK2_ENST00000282512.3_In_Frame_Del_p.K45del	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	208					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.K45*(1)|p.K45delK(1)									CACGATAGAACTTCTGTAAGGCT	0.355																																																2	Substitution - Nonsense(1)|Deletion - In frame(1)	ovary(2)	5																																								36255477	SO:0001651	inframe_deletion	133686			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.622_624delAAG	5.37:g.36219718_36219720delCTT	ENSP00000371362:p.Lys208del	Somatic		Capture	SOLID	Phase_IV	36255475	B5MC93|Q6UTX5|Q96NM0	In_Frame_Del	DEL	ENST00000381937.4	37	CCDS47197.1	DEL	20	Baylor																																																																																				0.355	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013		In_Frame_Del
NADK2	133686	hgsc.bcm.edu	37	5	36219720	36219720	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr5:36219720T>A	ENST00000381937.4	-	5	621	c.622A>T	c.(622-624)Aag>Tag	p.K208*	NADK2_ENST00000397338.1_Nonsense_Mutation_p.K45*|NADK2_ENST00000506945.1_Nonsense_Mutation_p.K45*|NADK2_ENST00000514504.1_Nonsense_Mutation_p.K208*|NADK2-AS1_ENST00000501794.2_RNA|NADK2_ENST00000282512.3_Nonsense_Mutation_p.K45*	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	208					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.K45*(1)|p.K45delK(1)									CGATAGAACTTCTGTAAGGCT	0.353																																																2	Substitution - Nonsense(1)|Deletion - In frame(1)	ovary(2)	5											114.0	110.0	112.0					5																	36219720		2203	4300	6503	36255477	SO:0001587	stop_gained	133686			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.622A>T	5.37:g.36219720T>A	ENSP00000371362:p.Lys208*	Somatic		Capture	SOLID	Phase_IV	36255477	B5MC93|Q6UTX5|Q96NM0	Nonsense_Mutation	SNP	ENST00000381937.4	37	CCDS47197.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	38	6.761155	0.97817	.	.	ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504;ENST00000511088	.	.	.	5.77	5.77	0.91146	.	0.133059	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6788	15.0723	0.72046	0.0:0.0:0.0:1.0	.	.	.	.	X	45;45;208;45;208;45	.	ENSP00000282512:K45X	K	-	1	0	NADKD1	36255477	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.018000	0.64054	2.187000	0.69744	0.528000	0.53228	AAG		0.353	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013		Nonsense_Mutation
CCDC18	343099	hgsc.bcm.edu	37	1	93680443	93680443	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:93680443G>A	ENST00000343253.7	+	12	2138	c.1636G>A	c.(1636-1638)Gct>Act	p.A546T	CCDC18_ENST00000338949.4_Missense_Mutation_p.A346T|CCDC18_ENST00000557479.1_Missense_Mutation_p.A665T|CCDC18_ENST00000401026.3_Missense_Mutation_p.A547T|CCDC18_ENST00000334652.5_5'UTR			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	546								p.A665T(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GGTTAACATGGCTCACAGAAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	49.0	50.0					1																	93680443		1844	4098	5942	93453031	SO:0001583	missense	343099					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1636G>A	1.37:g.93680443G>A	ENSP00000343377:p.Ala546Thr	Somatic		Capture	SOLID	Phase_IV	93453031	Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	37		SNP	42	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.35|14.35	2.508447|2.508447	0.44660|0.44660	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267|ENST00000370276	T;T;T;T;T|.	0.17691|.	2.26;2.26;2.26;2.26;2.26|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	0.196285|.	0.42548|.	D|.	0.000694|.	T|.	0.49949|.	0.1587|.	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	P;P|.	0.45715|.	0.461;0.865|.	B;B|.	0.39503|.	0.225;0.301|.	T|.	0.48811|.	-0.9002|.	10|.	0.31617|.	T|.	0.26|.	.|.	13.0106|13.0106	0.58729|0.58729	0.0777:0.0:0.9223:0.0|0.0777:0.0:0.9223:0.0	.|.	546;665|.	Q5T9S5;G3V388|.	CCD18_HUMAN;.|.	T|X	546;547;665;346;266|599	ENSP00000343377:A546T;ENSP00000383808:A547T;ENSP00000451099:A665T;ENSP00000344380:A346T;ENSP00000391151:A266T|.	ENSP00000344380:A346T|.	A|W	+|+	1|3	0|0	CCDC18|CCDC18	93453031|93453031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.057000|3.057000	0.49931|0.49931	2.373000|2.373000	0.80994|0.80994	0.655000|0.655000	0.94253|0.94253	GCT|TGG		0.383	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886		Missense_Mutation
CCT5	22948	hgsc.bcm.edu	37	5	10262704	10262704	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0720-01	TCGA-13-0720-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr5:10262704C>G	ENST00000280326.4	+	9	1711	c.1291C>G	c.(1291-1293)Ctg>Gtg	p.L431V	CCT5_ENST00000506600.1_Missense_Mutation_p.L338V|CCT5_ENST00000515676.1_Missense_Mutation_p.L393V|CCT5_ENST00000503026.1_Missense_Mutation_p.L410V|CCT5_ENST00000515390.1_Missense_Mutation_p.L376V|CTD-2256P15.4_ENST00000606194.1_RNA	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	431					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)	p.L431V(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						ATCCTGTGCCCTGGCAGTTAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											158.0	131.0	141.0					5																	10262704		2203	4300	6503	10315704	SO:0001583	missense	22948			D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1291C>G	5.37:g.10262704C>G	ENSP00000280326:p.Leu431Val	Somatic		Capture	SOLID	Phase_IV	10315704	A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	ENST00000280326.4	37	CCDS3877.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177394	0.38413	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	5.09	-4.92	0.03075	.	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	L	0.37897	1.145	0.40823	D	0.983529	B;B;B;B;B	0.19200	0.034;0.031;0.015;0.015;0.015	B;B;B;B;B	0.35688	0.103;0.126;0.208;0.208;0.208	T	0.51818	-0.8657	10	0.33141	T	0.24	-17.9864	14.9867	0.71353	0.0:0.169:0.0:0.831	.	338;376;429;431;431	B4DYD8;E7ENZ3;Q9BU08;A8K2X8;P48643	.;.;.;.;TCPE_HUMAN	V	431;410;376;404;393;338	ENSP00000280326:L431V;ENSP00000423318:L410V;ENSP00000426923:L376V;ENSP00000427297:L393V;ENSP00000423052:L338V	ENSP00000280326:L431V	L	+	1	2	CCT5	10315704	0.030000	0.19436	0.003000	0.11579	0.977000	0.68977	0.274000	0.18680	-0.901000	0.03891	0.558000	0.71614	CTG		0.542	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2			Missense_Mutation
CD3EAP	10849	hgsc.bcm.edu	37	19	45912180	45912180	+	Silent	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr19:45912180G>A	ENST00000309424.3	+	3	1442	c.954G>A	c.(952-954)ctG>ctA	p.L318L	ERCC1_ENST00000588738.1_5'Flank|CD3EAP_ENST00000589804.1_Silent_p.L320L|ERCC1_ENST00000300853.3_3'UTR|PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000423698.2_3'UTR	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	318					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)	p.L318L(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGGAGCCACTGGAGGAAGCCA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	19											98.0	101.0	100.0					19																	45912180		2203	4300	6503	50604020	SO:0001819	synonymous_variant	10849			U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.954G>A	19.37:g.45912180G>A		Somatic		Capture	SOLID	Phase_IV	50604020	Q32N11|Q7Z5U2|Q9UPF6	Silent	SNP	ENST00000309424.3	37	CCDS12661.1	SNP	47	Baylor																																																																																				0.577	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099		Silent
CDH7	1005	hgsc.bcm.edu	37	18	63527046	63527054	+	In_Frame_Del	DEL	TTGAAAGAT	TTGAAAGAT	-	rs375501555		TCGA-13-0720-01	TCGA-13-0720-10	TTGAAAGAT	TTGAAAGAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr18:63527046_63527054delTTGAAAGAT	ENST00000397968.2	+	10	2023_2031	c.1597_1605delTTGAAAGAT	c.(1597-1605)ttgaaagatdel	p.LKD533del	CDH7_ENST00000536984.2_In_Frame_Del_p.LKD533del|CDH7_ENST00000323011.3_In_Frame_Del_p.LKD533del	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	533	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D535Y(4)|p.L533_D535del(1)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CAACTTTTCATTGAAAGATAACAAAGGTA	0.364																																																5	Substitution - Missense(4)|Deletion - In frame(1)	lung(4)|ovary(1)	18																																								61678034	SO:0001651	inframe_deletion	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1597_1605delTTGAAAGAT	18.37:g.63527046_63527054delTTGAAAGAT	ENSP00000381058:p.Leu533_Asp535del	Somatic		Capture	SOLID	Phase_IV	61678026	Q9H157	In_Frame_Del	DEL	ENST00000397968.2	37	CCDS11993.1	DEL	52	Baylor																																																																																				0.364	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646		In_Frame_Del
CELSR3	1951	hgsc.bcm.edu	37	3	48680318	48680318	+	Splice_Site	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr3:48680318C>T	ENST00000164024.4	-	30	8687		c.e30-1		CELSR3_ENST00000544264.1_Splice_Site|MIR4793_ENST00000577502.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3						axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.?(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCCCAGGTCCCTGGGGGTGGT	0.622																																																1	Unknown(1)	ovary(1)	3											63.0	75.0	71.0					3																	48680318		2203	4299	6502	48655322	SO:0001630	splice_region_variant	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.8407-1G>A	3.37:g.48680318C>T		Somatic		Capture	SOLID	Phase_IV	48655322	O75092	Splice_Site_SNP	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899178	0.52227	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7607	0.96316	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CELSR3	48655322	1.000000	0.71417	0.991000	0.47740	0.344000	0.29017	6.784000	0.75084	2.686000	0.91538	0.561000	0.74099	.		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	Intron	Splice_Site_SNP
CHMP2B	25978	hgsc.bcm.edu	37	3	87294929	87294929	+	Silent	SNP	A	A	G	rs148750997	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr3:87294929A>G	ENST00000263780.4	+	3	430	c.192A>G	c.(190-192)caA>caG	p.Q64Q	CHMP2B_ENST00000471660.1_Silent_p.Q23Q|CHMP2B_ENST00000472024.1_3'UTR|CHMP2B_ENST00000494980.1_Silent_p.Q64Q	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	64					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)	p.Q64Q(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TAGCCAAACAACTTGTGCATC	0.318													A|||	8	0.00159744	0.0	0.0	5008	,	,		15769	0.005		0.0	False		,,,				2504	0.0031															1	Substitution - coding silent(1)	ovary(1)	3						A		6,4400	11.4+/-27.6	0,6,2197	77.0	81.0	79.0		192	-1.9	1.0	3	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	CHMP2B	NM_014043.3		0,6,6497	GG,GA,AA		0.0,0.1362,0.0461		64/214	87294929	6,13000	2203	4300	6503	87377619	SO:0001819	synonymous_variant	25978			BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.192A>G	3.37:g.87294929A>G		Somatic		Capture	SOLID	Phase_IV	87377619	B4DJG8|Q53HC7|Q9Y4U6	Silent	SNP	ENST00000263780.4	37	CCDS2918.1	SNP	2	Baylor																																																																																				0.318	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352779.2	NM_014043		Silent
DDOST	1650	hgsc.bcm.edu	37	1	20981953	20981953	+	Silent	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:20981953G>A	ENST00000375048.3	-	5	687	c.582C>T	c.(580-582)ccC>ccT	p.P194P	DDOST_ENST00000415136.2_Silent_p.P157P|DDOST_ENST00000602624.2_Silent_p.P177P	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	194					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.P194P(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GAAAGAGGATGGGATTTAGAG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	97.0	98.0					1																	20981953		2203	4300	6503	20854540	SO:0001819	synonymous_variant	1650			D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.582C>T	1.37:g.20981953G>A		Somatic		Capture	SOLID	Phase_IV	20854540	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Silent	SNP	ENST00000375048.3	37	CCDS212.1	SNP	47	Baylor																																																																																				0.502	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216		Silent
COL11A1	1301	hgsc.bcm.edu	37	1	103488342	103488342	+	Missense_Mutation	SNP	A	A	C	rs141817156	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:103488342A>C	ENST00000370096.3	-	8	1513	c.1201T>G	c.(1201-1203)Ttt>Gtt	p.F401V	COL11A1_ENST00000358392.2_Missense_Mutation_p.F413V|COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000353414.4_Missense_Mutation_p.F362V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	401	Nonhelical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.F413V(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGGACCAAATTCTTCATTA	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											97.0	97.0	97.0					1																	103488342		2203	4299	6502	103260930	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1201T>G	1.37:g.103488342A>C	ENSP00000359114:p.Phe401Val	Somatic		Capture	SOLID	Phase_IV	103260930	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.14	2.148208	0.37923	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000427239	D;T;D;T	0.87029	-2.14;-0.53;-2.2;-0.51	5.41	5.41	0.78517	.	0.198918	0.44483	D	0.000457	T	0.76118	0.3943	L	0.57536	1.79	0.42869	D	0.994131	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.14578	0.006;0.011;0.003	T	0.72991	-0.4123	10	0.17369	T	0.5	.	14.0148	0.64517	1.0:0.0:0.0:0.0	.	362;413;401	P12107-3;P12107-2;P12107	.;.;COBA1_HUMAN	V	401;413;362;413	ENSP00000359114:F401V;ENSP00000351163:F413V;ENSP00000302551:F362V;ENSP00000408640:F413V	ENSP00000302551:F362V	F	-	1	0	COL11A1	103260930	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	3.814000	0.55643	2.038000	0.60285	0.523000	0.50628	TTT		0.348	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		Missense_Mutation
DTNB	1838	hgsc.bcm.edu	37	2	25678315	25678315	+	Silent	SNP	C	C	A	rs576226520		TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:25678315C>A	ENST00000406818.3	-	11	1377	c.1128G>T	c.(1126-1128)gcG>gcT	p.A376A	DTNB_ENST00000404103.3_Silent_p.A376A|DTNB_ENST00000545439.1_Silent_p.A172A|DTNB_ENST00000407186.1_Intron|DTNB_ENST00000407038.3_Intron|DTNB_ENST00000405222.1_Intron|DTNB_ENST00000496972.2_Silent_p.A319A|DTNB_ENST00000407661.3_Silent_p.A376A|DTNB_ENST00000288642.8_Silent_p.A376A	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	376						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.A376A(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGCTATCAGCGCATGCTCAT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	2											52.0	53.0	52.0					2																	25678315		2088	4229	6317	25531819	SO:0001819	synonymous_variant	1838			AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1128G>T	2.37:g.25678315C>A		Somatic		Capture	SOLID	Phase_IV	25531819	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Silent	SNP	ENST00000406818.3	37	CCDS46237.1	SNP	27	Baylor																																																																																				0.552	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147		Silent
DNAJC10	54431	hgsc.bcm.edu	37	2	183593684	183593684	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:183593684A>G	ENST00000264065.7	+	7	1011	c.596A>G	c.(595-597)aAc>aGc	p.N199S	DNAJC10_ENST00000537515.1_Missense_Mutation_p.N199S	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	199	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)	p.N199S(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AAAGGAGTCAACAGCTATCCC	0.378																																					Pancreas(56;860 1183 25669 35822 48585)											1	Substitution - Missense(1)	ovary(1)	2											151.0	143.0	146.0					2																	183593684		2203	4300	6503	183301929	SO:0001583	missense	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.596A>G	2.37:g.183593684A>G	ENSP00000264065:p.Asn199Ser	Somatic		Capture	SOLID	Phase_IV	183301929	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	CCDS33345.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.60	2.882145	0.51908	.	.	ENSG00000077232	ENST00000264065;ENST00000392392;ENST00000537515	T;T	0.03004	4.08;4.08	6.17	3.83	0.44106	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.183346	0.64402	D	0.000020	T	0.02848	0.0085	N	0.21373	0.66	0.53005	D	0.999961	B;B	0.17268	0.003;0.021	B;B	0.10450	0.001;0.005	T	0.48843	-0.8999	10	0.13470	T	0.59	.	10.4574	0.44559	0.87:0.0:0.13:0.0	.	199;199	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	S	199	ENSP00000264065:N199S;ENSP00000441560:N199S	ENSP00000264065:N199S	N	+	2	0	DNAJC10	183301929	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.735000	0.38176	0.575000	0.29434	0.533000	0.62120	AAC		0.378	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981		Missense_Mutation
DUSP13	51207	hgsc.bcm.edu	37	10	76863775	76863775	+	Silent	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr10:76863775C>T	ENST00000491677.2	-	4	710	c.168G>A	c.(166-168)ctG>ctA	p.L56L	DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000607131.1_Silent_p.L20L|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000372702.3_3'UTR	NM_001007271.1	NP_001007272.1	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	159					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L56L(1)		large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCGCCTGGGCCAGAGCCTCCA	0.632																																					NSCLC(174;1655 2059 12324 40663 42963)											1	Substitution - coding silent(1)	ovary(1)	10											28.0	29.0	29.0					10																	76863775		2196	4297	6493	76533781	SO:0001819	synonymous_variant	51207			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000491677.2:c.168G>A	10.37:g.76863775C>T		Somatic		Capture	SOLID	Phase_IV	76533781	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Silent	SNP	ENST00000491677.2	37		SNP	21	Baylor																																																																																				0.632	DUSP13-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				Silent
EXD2	55218	hgsc.bcm.edu	37	14	69695625	69695625	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0720-01	TCGA-13-0720-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr14:69695625C>G	ENST00000409018.3	+	3	554	c.426C>G	c.(424-426)atC>atG	p.I142M	EXD2_ENST00000449989.1_Missense_Mutation_p.I17M|EXD2_ENST00000409242.1_Missense_Mutation_p.I17M|EXD2_ENST00000409949.1_Missense_Mutation_p.I17M|EXD2_ENST00000409675.1_Missense_Mutation_p.I17M|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409014.1_Missense_Mutation_p.I17M|EXD2_ENST00000312994.5_Missense_Mutation_p.I142M	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	142							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)	p.I17M(1)		breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						CCAAGCTAATCTGTGGAGGAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	14											109.0	103.0	105.0					14																	69695625		2203	4300	6503	68765378	SO:0001583	missense	55218			AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.426C>G	14.37:g.69695625C>G	ENSP00000387331:p.Ile142Met	Somatic		Capture	SOLID	Phase_IV	68765378	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	ENST00000409018.3	37	CCDS53902.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605966	0.28623	.	.	ENSG00000081177	ENST00000409018;ENST00000193422;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000413191;ENST00000449989	T;T;T;T;T;T;T;T	0.63744	-0.02;-0.06;-0.06;-0.06;-0.06;-0.02;-0.06;-0.06	5.74	3.83	0.44106	Ribonuclease H-like (1);	0.564835	0.21759	N	0.069553	T	0.52805	0.1757	L	0.36672	1.1	0.20821	N	0.999842	B;B	0.28760	0.221;0.006	B;B	0.39771	0.309;0.011	T	0.46898	-0.9158	10	0.34782	T	0.22	-0.8965	4.4882	0.11801	0.2841:0.5082:0.1304:0.0773	.	142;17	G5E947;Q9NVH0	.;EXD2_HUMAN	M	142;142;17;17;17;17;142;17;17	ENSP00000387331:I142M;ENSP00000386915:I17M;ENSP00000386762:I17M;ENSP00000386632:I17M;ENSP00000386839:I17M;ENSP00000313140:I142M;ENSP00000409089:I17M;ENSP00000392177:I17M	ENSP00000193422:I142M	I	+	3	3	EXD2	68765378	0.242000	0.23868	0.979000	0.43373	0.897000	0.52465	0.572000	0.23684	0.696000	0.31696	0.563000	0.77884	ATC		0.483	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000335504.1			Missense_Mutation
FCRL4	83417	hgsc.bcm.edu	37	1	157559005	157559005	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0720-01	TCGA-13-0720-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:157559005A>C	ENST00000271532.1	-	3	431	c.296T>G	c.(295-297)cTc>cGc	p.L99R	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	99					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L99R(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TGAAGAAAAGAGCAAGCGCAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	1											63.0	68.0	66.0					1																	157559005		2203	4300	6503	155825629	SO:0001583	missense	83417			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.296T>G	1.37:g.157559005A>C	ENSP00000271532:p.Leu99Arg	Somatic		Capture	SOLID	Phase_IV	155825629	Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	CCDS1166.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	4.814	0.151394	0.09185	.	.	ENSG00000163518	ENST00000271532	T	0.18657	2.2	4.2	-8.41	0.00961	Immunoglobulin subtype (1);	4.121640	0.01047	N	0.004417	T	0.03739	0.0106	L	0.47716	1.5	0.09310	N	1	B	0.19200	0.034	B	0.19666	0.026	T	0.32268	-0.9913	10	0.16420	T	0.52	.	1.5384	0.02550	0.1751:0.115:0.3146:0.3954	.	99	Q96PJ5	FCRL4_HUMAN	R	99	ENSP00000271532:L99R	ENSP00000271532:L99R	L	-	2	0	FCRL4	155825629	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-2.190000	0.01247	-1.651000	0.01504	-0.410000	0.06199	CTC		0.493	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282		Missense_Mutation
FSCN3	29999	hgsc.bcm.edu	37	7	127235527	127235527	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr7:127235527A>T	ENST00000265825.5	+	2	530	c.311A>T	c.(310-312)aAg>aTg	p.K104M	GCC1_ENST00000497650.1_5'Flank|FSCN3_ENST00000420086.2_5'UTR	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	104						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.K104M(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						CGGAACAGCAAGTGGACCCTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											155.0	116.0	129.0					7																	127235527		2203	4300	6503	127022763	SO:0001583	missense	29999				CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.311A>T	7.37:g.127235527A>T	ENSP00000265825:p.Lys104Met	Somatic		Capture	SOLID	Phase_IV	127022763	A4D0Z2|A6NLL7|B2RA62|B4DU68	Missense_Mutation	SNP	ENST00000265825.5	37	CCDS34746.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674701	0.67928	.	.	ENSG00000106328	ENST00000265825	T	0.25085	1.82	5.59	5.59	0.84812	Fascin domain (1);Actin cross-linking (1);	0.087565	0.49916	D	0.000132	T	0.44286	0.1286	L	0.57536	1.79	0.80722	D	1	D	0.63046	0.992	D	0.64321	0.924	T	0.38735	-0.9647	10	0.87932	D	0	-42.6881	12.4511	0.55677	1.0:0.0:0.0:0.0	.	104	Q9NQT6	FSCN3_HUMAN	M	104	ENSP00000265825:K104M	ENSP00000265825:K104M	K	+	2	0	FSCN3	127022763	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	1.710000	0.37920	2.254000	0.74563	0.533000	0.62120	AAG		0.557	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059256.2	NM_020369		Missense_Mutation
GDPD3	79153	hgsc.bcm.edu	37	16	30119702	30119702	+	Silent	SNP	A	A	T			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr16:30119702A>T	ENST00000406256.3	-	8	1136	c.759T>A	c.(757-759)gtT>gtA	p.V253V	RP11-455F5.4_ENST00000566190.1_RNA	NM_024307.2	NP_077283.2	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain containing 3	253	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)	11						ACCATTTCGAAACCACAGCCA	0.567																																																0			16											176.0	157.0	164.0					16																	30119702		2197	4300	6497	30027203	SO:0001819	synonymous_variant	79153			AK026256	CCDS10671.2	16p11.2	2008-02-05			ENSG00000102886	ENSG00000102886			28638	protein-coding gene	gene with protein product							Standard	NM_024307		Approved	MGC4171	uc002dwp.3	Q7L5L3	OTTHUMG00000132106	ENST00000406256.3:c.759T>A	16.37:g.30119702A>T		Somatic		Capture	SOLID	Phase_IV	30027203	Q9H652	Silent	SNP	ENST00000406256.3	37	CCDS10671.2	SNP	1	Baylor																																																																																				0.567	GDPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255144.1	NM_024307		Silent
GNL2	29889	hgsc.bcm.edu	37	1	38061393	38061393	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:38061393T>G	ENST00000373062.3	-	1	129	c.31A>C	c.(31-33)Acc>Ccc	p.T11P		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	11					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.T11P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				GGGTTGATGGTGCTCCGTCCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	112.0	122.0					1																	38061393		2203	4300	6503	37833980	SO:0001583	missense	29889			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.31A>C	1.37:g.38061393T>G	ENSP00000362153:p.Thr11Pro	Somatic		Capture	SOLID	Phase_IV	37833980	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580140	0.65992	.	.	ENSG00000134697	ENST00000373062	T	0.23754	1.89	5.01	1.06	0.20224	.	0.328929	0.36665	N	0.002479	T	0.23249	0.0562	L	0.48642	1.525	0.52099	D	0.999945	P;P	0.42248	0.774;0.774	B;B	0.44044	0.439;0.439	T	0.02015	-1.1229	10	0.40728	T	0.16	-4.9878	8.0294	0.30457	0.2964:0.0:0.1013:0.6022	.	11;11	Q5T0F3;Q13823	.;NOG2_HUMAN	P	11	ENSP00000362153:T11P	ENSP00000362153:T11P	T	-	1	0	GNL2	37833980	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.193000	0.32162	0.365000	0.24400	0.533000	0.62120	ACC		0.582	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285		Missense_Mutation
HHAT	55733	hgsc.bcm.edu	37	1	210560897	210560897	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:210560897C>G	ENST00000367010.1	+	4	472	c.245C>G	c.(244-246)tCt>tGt	p.S82C	HHAT_ENST00000545781.1_Missense_Mutation_p.S19C|HHAT_ENST00000308852.6_Missense_Mutation_p.S37C|HHAT_ENST00000541565.1_Missense_Mutation_p.S82C|HHAT_ENST00000537898.1_Missense_Mutation_p.S82C|HHAT_ENST00000261458.3_Missense_Mutation_p.S82C|HHAT_ENST00000391905.3_Missense_Mutation_p.S82C|HHAT_ENST00000545154.1_Missense_Mutation_p.S83C|HHAT_ENST00000413764.2_Missense_Mutation_p.S82C	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	82					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		ATGGTAGTGTCTCAAATGGCC	0.453																																																0			1											102.0	88.0	93.0					1																	210560897		2203	4300	6503	208627520	SO:0001583	missense	55733			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.245C>G	1.37:g.210560897C>G	ENSP00000355977:p.Ser82Cys	Somatic		Capture	SOLID	Phase_IV	208627520	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	CCDS1495.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931666	0.73442	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968	T;T;T;T;T;T;T;T;T;T	0.73258	2.09;0.74;2.08;-0.73;2.08;2.12;2.09;2.1;2.09;-0.73	5.11	5.11	0.69529	.	0.060836	0.64402	D	0.000002	D	0.83092	0.5179	M	0.76328	2.33	0.42055	D	0.991135	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.998;0.998;0.999	T	0.82888	-0.0234	10	0.39692	T	0.17	-17.656	15.8074	0.78524	0.0:1.0:0.0:0.0	.	37;83;82;82;82	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	C	82;82;83;82;82;19;82;37;82;19	ENSP00000416845:S82C;ENSP00000444995:S82C;ENSP00000438468:S83C;ENSP00000442625:S82C;ENSP00000375773:S82C;ENSP00000439229:S19C;ENSP00000261458:S82C;ENSP00000308628:S37C;ENSP00000355977:S82C;ENSP00000413399:S19C	ENSP00000261458:S82C	S	+	2	0	HHAT	208627520	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.202000	0.58446	2.514000	0.84764	0.655000	0.94253	TCT		0.453	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194		Missense_Mutation
HIST4H4	121504	hgsc.bcm.edu	37	12	14923910	14923910	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr12:14923910G>A	ENST00000539745.1	-	1	155	c.109C>T	c.(109-111)Cgt>Tgt	p.R37C	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	37					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R37C(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						CGGGCGAGACGGCGAATCGCC	0.617											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	12											54.0	55.0	55.0					12																	14923910		2203	4300	6503	14815177	SO:0001583	missense	121504			AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.109C>T	12.37:g.14923910G>A	ENSP00000443017:p.Arg37Cys	Somatic	698	Capture	SOLID	Phase_IV	14815177	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000539745.1	37	CCDS8665.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438689	0.43326	.	.	ENSG00000197837	ENST00000539745	D	0.85339	-1.97	4.18	3.27	0.37495	.	0.000000	0.56097	U	0.000036	D	0.88507	0.6455	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.88661	0.3189	7	0.66056	D	0.02	.	11.255	0.49048	0.0:0.0:0.816:0.184	.	.	.	.	C	37	ENSP00000443017:R37C	ENSP00000350767:R37C	R	-	1	0	HIST4H4	14815177	1.000000	0.71417	0.154000	0.22540	0.049000	0.14656	5.781000	0.68964	1.088000	0.41272	0.650000	0.86243	CGT		0.617	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400844.1	NM_175054		Missense_Mutation
HOXD10	3236	hgsc.bcm.edu	37	2	176983838	176983838	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:176983838A>C	ENST00000249501.4	+	2	1157	c.902A>C	c.(901-903)aAg>aCg	p.K301T	HOXD-AS2_ENST00000440016.2_RNA|HOXD10_ENST00000490088.2_3'UTR	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	301					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K301T(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GAGATCAGTAAGAGCGTTAAC	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	99.0	96.0					2																	176983838		2203	4300	6503	176692084	SO:0001583	missense	3236				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.902A>C	2.37:g.176983838A>C	ENSP00000249501:p.Lys301Thr	Somatic		Capture	SOLID	Phase_IV	176692084	Q6NT10	Missense_Mutation	SNP	ENST00000249501.4	37	CCDS2266.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464664	0.63513	.	.	ENSG00000128710	ENST00000249501	D	0.96365	-3.99	5.94	5.94	0.96194	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.132226	0.64402	D	0.000002	D	0.96222	0.8768	N	0.21508	0.67	0.53688	D	0.99997	D	0.60575	0.988	D	0.69654	0.965	D	0.97373	0.9977	10	0.87932	D	0	.	16.0682	0.80903	1.0:0.0:0.0:0.0	.	301	P28358	HXD10_HUMAN	T	301	ENSP00000249501:K301T	ENSP00000249501:K301T	K	+	2	0	HOXD10	176692084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.483000	0.60264	2.272000	0.75746	0.459000	0.35465	AAG		0.488	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			Missense_Mutation
HOXD10	3236	hgsc.bcm.edu	37	2	176983842	176983842	+	Silent	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:176983842C>T	ENST00000249501.4	+	2	1161	c.906C>T	c.(904-906)agC>agT	p.S302S	HOXD-AS2_ENST00000440016.2_RNA|HOXD10_ENST00000490088.2_3'UTR	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	302					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TCAGTAAGAGCGTTAACCTCA	0.498																																																0			2											91.0	98.0	95.0					2																	176983842		2203	4300	6503	176692088	SO:0001819	synonymous_variant	3236				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.906C>T	2.37:g.176983842C>T		Somatic		Capture	SOLID	Phase_IV	176692088	Q6NT10	Silent	SNP	ENST00000249501.4	37	CCDS2266.1	SNP	27	Baylor																																																																																				0.498	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			Silent
IL17F	112744	hgsc.bcm.edu	37	6	52101943	52101943	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr6:52101943T>A	ENST00000336123.4	-	3	385	c.278A>T	c.(277-279)tAc>tTc	p.Y93F		NM_052872.3	NP_443104.1	Q96PD4	IL17F_HUMAN	interleukin 17F	93					cartilage development (GO:0051216)|cytokine biosynthetic process (GO:0042089)|inflammatory response (GO:0006954)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045423)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of interleukin-8 biosynthetic process (GO:0045414)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine binding (GO:0019955)|protein homodimerization activity (GO:0042803)	p.Y93F(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)	14	Lung NSC(77;0.116)					TTCCGAGGGGTACCGGTTGGG	0.552																																																1	Substitution - Missense(1)	ovary(1)	6											50.0	47.0	48.0					6																	52101943		2203	4300	6503	52209902	SO:0001583	missense	112744			AF384857	CCDS4938.1	6p12	2014-09-17			ENSG00000112116	ENSG00000112116		"""Interleukins and interleukin receptors"""	16404	protein-coding gene	gene with protein product		606496				11591732, 11591768	Standard	NM_052872		Approved	IL-17F, ML-1, ML1	uc003pam.1	Q96PD4	OTTHUMG00000014845	ENST00000336123.4:c.278A>T	6.37:g.52101943T>A	ENSP00000337432:p.Tyr93Phe	Somatic		Capture	SOLID	Phase_IV	52209902	Q6NSI0|Q7Z6P4|Q96PI8|Q9NUE6	Missense_Mutation	SNP	ENST00000336123.4	37	CCDS4938.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.629899	0.00813	.	.	ENSG00000112116	ENST00000336123	T	0.57752	0.38	5.54	3.09	0.35607	.	0.311416	0.35772	N	0.002991	T	0.06508	0.0167	N	0.01771	-0.73	0.26938	N	0.966306	B	0.12630	0.006	B	0.20767	0.031	T	0.43442	-0.9391	10	0.02654	T	1	-23.2798	9.3228	0.37975	0.7078:0.0:0.0:0.2922	.	93	Q96PD4	IL17F_HUMAN	F	93	ENSP00000337432:Y93F	ENSP00000337432:Y93F	Y	-	2	0	IL17F	52209902	0.998000	0.40836	0.992000	0.48379	0.043000	0.13939	2.038000	0.41184	0.372000	0.24591	-1.407000	0.01130	TAC		0.552	IL17F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040901.3	NM_052872		Missense_Mutation
ITIH4	3700	hgsc.bcm.edu	37	3	52848038	52848038	+	Silent	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr3:52848038G>A	ENST00000266041.4	-	23	2772	c.2676C>T	c.(2674-2676)gaC>gaT	p.D892D	RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000485816.1_Silent_p.D897D|ITIH4_ENST00000346281.5_Silent_p.D876D|ITIH4_ENST00000406595.1_Silent_p.D862D	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	892					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.D892D(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TGCGTCTGCCGTCATCTGATG	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											55.0	45.0	48.0					3																	52848038		2203	4300	6503	52823078	SO:0001819	synonymous_variant	3700			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2676C>T	3.37:g.52848038G>A		Somatic		Capture	SOLID	Phase_IV	52823078	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Silent	SNP	ENST00000266041.4	37	CCDS2865.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.270	-0.367311	0.05069	.	.	ENSG00000055955	ENST00000441637	.	.	.	5.07	1.0	0.19881	.	.	.	.	.	T	0.23330	0.0564	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.22103	-1.0226	4	.	.	.	-17.1561	3.3201	0.07047	0.2975:0.0:0.5204:0.1821	.	.	.	.	W	681	.	.	R	-	1	2	ITIH4	52823078	0.059000	0.20769	0.004000	0.12327	0.005000	0.04900	0.746000	0.26275	0.391000	0.25143	-0.126000	0.14955	CGG		0.602	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218		Silent
KCNQ2	3785	hgsc.bcm.edu	37	20	62071043	62071043	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr20:62071043C>T	ENST00000359125.2	-	6	1009	c.835G>A	c.(835-837)Ggc>Agc	p.G279S	KCNQ2_ENST00000370224.1_Missense_Mutation_p.G279S|KCNQ2_ENST00000344462.4_Missense_Mutation_p.G279S|KCNQ2_ENST00000344425.5_Missense_Mutation_p.G279S|KCNQ2_ENST00000359689.1_Missense_Mutation_p.G279S|KCNQ2_ENST00000360480.3_Missense_Mutation_p.G279S|KCNQ2_ENST00000357249.2_Missense_Mutation_p.G279S|KCNQ2_ENST00000354587.3_Missense_Mutation_p.G279S	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	279					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.G279S(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCCCCGTAGCCAATGGTGGTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	20											196.0	142.0	160.0					20																	62071043		2203	4300	6503	61541487	SO:0001583	missense	3785			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.835G>A	20.37:g.62071043C>T	ENSP00000352035:p.Gly279Ser	Somatic		Capture	SOLID	Phase_IV	61541487	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924555	0.92319	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.99886	-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52;-7.52	4.01	4.01	0.46588	Ion transport (1);	0.063133	0.64402	D	0.000007	D	0.99923	0.9964	H	0.97214	3.96	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.91635	0.999;0.999;0.968;0.968;0.968;0.981	D	0.95706	0.8753	10	0.87932	D	0	-18.4709	16.4798	0.84155	0.0:1.0:0.0:0.0	.	279;279;279;279;279;279	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	S	279	ENSP00000349789:G279S;ENSP00000352035:G279S;ENSP00000359246:G279S;ENSP00000346601:G279S;ENSP00000352718:G279S;ENSP00000399612:G279S;ENSP00000353668:G279S;ENSP00000339611:G279S;ENSP00000359244:G279S;ENSP00000359242:G279S;ENSP00000359241:G279S;ENSP00000345523:G279S	ENSP00000345523:G279S	G	-	1	0	KCNQ2	61541487	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	5.854000	0.69503	1.908000	0.55244	0.561000	0.74099	GGC		0.647	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109		Missense_Mutation
KNDC1	85442	hgsc.bcm.edu	37	10	135020391	135020391	+	Silent	SNP	G	G	T			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr10:135020391G>T	ENST00000304613.3	+	19	3534	c.3513G>T	c.(3511-3513)ctG>ctT	p.L1171L	KNDC1_ENST00000368571.2_Silent_p.L1106L|KNDC1_ENST00000368572.2_Silent_p.L1173L			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1171					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.L1171L(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TGTCCAAGCTGAAAGGGCAGC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	10											112.0	116.0	115.0					10																	135020391		2203	4300	6503	134870381	SO:0001819	synonymous_variant	85442			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3513G>T	10.37:g.135020391G>T		Somatic		Capture	SOLID	Phase_IV	134870381	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1	SNP	45	Baylor																																																																																				0.617	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643		Silent
LRP1B	53353	hgsc.bcm.edu	37	2	141460057	141460057	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0720-01	TCGA-13-0720-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:141460057T>C	ENST00000389484.3	-	38	7060	c.6089A>G	c.(6088-6090)gAg>gGg	p.E2030G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2030					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E2030G(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GACAACCTTCTCTGAGCCATC	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											109.0	100.0	103.0					2																	141460057		2203	4300	6503	141176527	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6089A>G	2.37:g.141460057T>C	ENSP00000374135:p.Glu2030Gly	Somatic		Capture	SOLID	Phase_IV	141176527	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839029	0.71373	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96136	-3.92	5.16	5.16	0.70880	Six-bladed beta-propeller, TolB-like (1);	0.399340	0.23624	U	0.046216	D	0.92325	0.7565	N	0.21508	0.67	0.42882	D	0.994172	P	0.47484	0.896	P	0.46510	0.519	D	0.91406	0.5147	10	0.25751	T	0.34	.	15.2922	0.73875	0.0:0.0:0.0:1.0	.	2030	Q9NZR2	LRP1B_HUMAN	G	2030;1968	ENSP00000374135:E2030G	ENSP00000374135:E2030G	E	-	2	0	LRP1B	141176527	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.929000	0.87595	2.065000	0.61736	0.455000	0.32223	GAG		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557		Missense_Mutation
MIA3	375056	hgsc.bcm.edu	37	1	222802459	222802459	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:222802459T>C	ENST00000344922.5	+	4	1922	c.1897T>C	c.(1897-1899)Tcc>Ccc	p.S633P	MIA3_ENST00000344507.1_Intron|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344441.6_Missense_Mutation_p.S633P	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	633					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.S633P(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		ACCTAGATTCTCCTCTCCAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											109.0	108.0	109.0					1																	222802459		1866	4111	5977	220869082	SO:0001583	missense	375056				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.1897T>C	1.37:g.222802459T>C	ENSP00000340900:p.Ser633Pro	Somatic		Capture	SOLID	Phase_IV	220869082	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	SNP	54	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.415569|4.415569	0.83449|0.83449	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000354906|ENST00000344922;ENST00000344441;ENST00000320831	.|T;T	.|0.10668	.|2.85;2.85	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	.|.	.|.	.|.	.|.	T|T	0.26738|0.26738	0.0654|0.0654	L|L	0.61218|0.61218	1.895|1.895	0.09310|0.09310	N|N	1|1	.|D;B	.|0.61697	.|0.99;0.049	.|P;B	.|0.58266	.|0.836;0.026	T|T	0.04467|0.04467	-1.0949|-1.0949	5|9	.|0.87932	.|D	.|0	.|.	14.3157|14.3157	0.66450|0.66450	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|633;633	.|Q5JRA6-2;Q5JRA6	.|.;MIA3_HUMAN	P|P	215|633	.|ENSP00000340900:S633P;ENSP00000340587:S633P	.|ENSP00000325973:S633P	L|S	+|+	2|1	0|0	MIA3|MIA3	220869082|220869082	0.045000|0.045000	0.20229|0.20229	0.071000|0.071000	0.20095|0.20095	0.762000|0.762000	0.43233|0.43233	1.300000|1.300000	0.33436|0.33436	1.843000|1.843000	0.53566|0.53566	0.254000|0.254000	0.18369|0.18369	CTC|TCC		0.453	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		Missense_Mutation
MS4A14	84689	hgsc.bcm.edu	37	11	60170525	60170525	+	Silent	SNP	T	T	C			TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr11:60170525T>C	ENST00000300187.6	+	4	736	c.459T>C	c.(457-459)acT>acC	p.T153T	MS4A14_ENST00000395005.2_Silent_p.T136T|MS4A14_ENST00000531783.1_Silent_p.T153T|MS4A14_ENST00000395001.1_Silent_p.T41T|MS4A14_ENST00000531787.1_Silent_p.T41T	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	153						integral component of membrane (GO:0016021)		p.T153T(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						TCAGTAGAACTCTTTTCATTG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	11											199.0	182.0	187.0					11																	60170525		2203	4300	6503	59927101	SO:0001819	synonymous_variant	84689			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.459T>C	11.37:g.60170525T>C		Somatic		Capture	SOLID	Phase_IV	59927101	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Silent	SNP	ENST00000300187.6	37	CCDS31569.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	3.340	-0.134717	0.06711	.	.	ENSG00000166928	ENST00000534688	.	.	.	4.77	-2.55	0.06288	.	.	.	.	.	T	0.17534	0.0421	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24799	-1.0150	4	.	.	.	-3.1196	0.3649	0.00370	0.2352:0.173:0.2942:0.2977	.	.	.	.	P	112	.	.	L	+	2	0	MS4A14	59927101	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.031000	0.03578	-0.294000	0.08973	-0.340000	0.08031	CTC		0.343	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2			Silent
NOBOX	135935	hgsc.bcm.edu	37	7	144098311	144098311	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr7:144098311G>C	ENST00000467773.1	-	4	671	c.672C>G	c.(670-672)aaC>aaG	p.N224K	NOBOX_ENST00000223140.5_Missense_Mutation_p.N139K|NOBOX_ENST00000483238.1_Missense_Mutation_p.N224K	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	224					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.N224K(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CACGGGCTGAGTTAGGGGCAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	7											32.0	33.0	33.0					7																	144098311		1956	4134	6090	143729244	SO:0001583	missense	135935					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.672C>G	7.37:g.144098311G>C	ENSP00000419457:p.Asn224Lys	Somatic		Capture	SOLID	Phase_IV	143729244	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37		SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.81	1.454984	0.26161	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.92699	-2.82;-3.09;-2.79	4.8	2.92	0.33932	.	.	.	.	.	D	0.82458	0.5041	N	0.19112	0.55	0.09310	N	1	B	0.17038	0.02	B	0.19946	0.027	T	0.65088	-0.6253	9	0.07644	T	0.81	-1.4104	7.6137	0.28145	0.0:0.1823:0.6286:0.189	.	224	O60393	NOBOX_HUMAN	K	224;224;139;13	ENSP00000419565:N224K;ENSP00000419457:N224K;ENSP00000223140:N139K	ENSP00000223140:N139K	N	-	3	2	NOBOX	143729244	0.017000	0.18338	0.003000	0.11579	0.002000	0.02628	0.346000	0.19997	0.578000	0.29487	0.555000	0.69702	AAC		0.592	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420		Missense_Mutation
PIK3R4	30849	hgsc.bcm.edu	37	3	130422625	130422625	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr3:130422625C>A	ENST00000356763.3	-	13	3597	c.3040G>T	c.(3040-3042)Gat>Tat	p.D1014Y		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1014					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D1014Y(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						ACTGTGCCATCATTTGAACAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											233.0	206.0	215.0					3																	130422625		2203	4300	6503	131905315	SO:0001583	missense	30849			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.3040G>T	3.37:g.130422625C>A	ENSP00000349205:p.Asp1014Tyr	Somatic		Capture	SOLID	Phase_IV	131905315	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771763	0.90108	.	.	ENSG00000196455	ENST00000356763	D	0.89415	-2.51	5.32	5.32	0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96821	0.8962	H	0.97540	4.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98221	1.0478	10	0.87932	D	0	-30.4476	18.9862	0.92771	0.0:1.0:0.0:0.0	.	1014	Q99570	PI3R4_HUMAN	Y	1014	ENSP00000349205:D1014Y	ENSP00000349205:D1014Y	D	-	1	0	PIK3R4	131905315	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.779000	0.85648	2.476000	0.83614	0.591000	0.81541	GAT		0.408	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602		Missense_Mutation
PLAUR	5329	hgsc.bcm.edu	37	19	44159723	44159723	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr19:44159723G>A	ENST00000340093.3	-	5	704	c.475C>T	c.(475-477)Cgt>Tgt	p.R159C	PLAUR_ENST00000221264.4_Intron|PLAUR_ENST00000601723.1_Missense_Mutation_p.R159C|PLAUR_ENST00000339082.3_Missense_Mutation_p.R159C	NM_002659.3	NP_002650.1	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	159	UPAR/Ly6 2.				attachment of GPI anchor to protein (GO:0016255)|blood coagulation (GO:0007596)|C-terminal protein lipidation (GO:0006501)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chemotaxis (GO:0006935)|fibrinolysis (GO:0042730)|post-translational protein modification (GO:0043687)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|urokinase plasminogen activator signaling pathway (GO:0038195)	anchored component of membrane (GO:0031225)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)|urokinase plasminogen activator receptor activity (GO:0030377)	p.R159C(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|urinary_tract(3)	20		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TCCTTTGGACGCCCTATGGGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	19											56.0	49.0	51.0					19																	44159723		2203	4300	6503	48851563	SO:0001583	missense	5329				CCDS12628.1, CCDS33041.1, CCDS33042.1, CCDS74386.1	19q13	2012-03-15			ENSG00000011422	ENSG00000011422		"""CD molecules"""	9053	protein-coding gene	gene with protein product	"""urokinase-type plasminogen activator (uPA) receptor"", ""urokinase plasminogen activator surface receptor"""	173391					Standard	NM_002659		Approved	URKR, UPAR, CD87	uc002oxf.2	Q03405		ENST00000340093.3:c.475C>T	19.37:g.44159723G>A	ENSP00000339328:p.Arg159Cys	Somatic		Capture	SOLID	Phase_IV	48851563	A8K409|Q12876|Q15845|Q16887|Q6IB52|Q9BWT0|Q9NYC8|Q9UD69|Q9UEA6|Q9UM92|Q9UMV0	Missense_Mutation	SNP	ENST00000340093.3	37	CCDS12628.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.23	2.173843	0.38413	.	.	ENSG00000011422	ENST00000339082;ENST00000340093	T;T	0.31247	1.5;1.5	4.79	-1.14	0.09741	Ly-6 antigen / uPA receptor -like (1);CD59 antigen, conserved site (1);CD59 antigen (1);	5.773980	0.01394	N	0.013347	T	0.24392	0.0591	N	0.08118	0	0.09310	N	1	D;D;D	0.69078	0.985;0.985;0.997	P;P;P	0.51806	0.648;0.648;0.68	T	0.13361	-1.0512	10	0.59425	D	0.04	-1.8863	5.4088	0.16336	0.0:0.371:0.164:0.465	.	159;159;159	Q03405;Q9UPI5;Q03405-2	UPAR_HUMAN;.;.	C	159	ENSP00000342049:R159C;ENSP00000339328:R159C	ENSP00000342049:R159C	R	-	1	0	PLAUR	48851563	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.120000	0.15647	-0.198000	0.10333	-1.083000	0.02208	CGT		0.547	PLAUR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463571.1	NM_002659		Missense_Mutation
PRDM2	7799	hgsc.bcm.edu	37	1	14106984	14106984	+	Silent	SNP	C	C	T	rs200576369	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr1:14106984C>T	ENST00000235372.7	+	8	3550	c.2694C>T	c.(2692-2694)ggC>ggT	p.G898G	PRDM2_ENST00000413440.1_Silent_p.G697G|PRDM2_ENST00000343137.4_Silent_p.G697G|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000311066.5_Silent_p.G898G|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	898					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G898G(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AATATAATGGCATCGATTTAC	0.483													C|||	4	0.000798722	0.0	0.0058	5008	,	,		19794	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											76.0	73.0	74.0					1																	14106984		2203	4300	6503	13979571	SO:0001819	synonymous_variant	7799			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.2694C>T	1.37:g.14106984C>T		Somatic		Capture	SOLID	Phase_IV	13979571	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Silent	SNP	ENST00000235372.7	37	CCDS150.1	SNP	25	Baylor																																																																																				0.483	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231		Silent
SMARCB1	6598	hgsc.bcm.edu	37	22	24175875	24175875	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr22:24175875A>G	ENST00000263121.7	+	8	1299	c.1103A>G	c.(1102-1104)cAg>cGg	p.Q368R	DERL3_ENST00000464023.1_5'Flank|SMARCB1_ENST00000407082.3_Missense_Mutation_p.Q322R|SMARCB1_ENST00000344921.6_Missense_Mutation_p.Q377R|SMARCB1_ENST00000407422.3_Missense_Mutation_p.Q359R	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	368					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.L266_*386del(1)|p.Q368R(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				ATCCGCGACCAGGACAGGAAC	0.622			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	4	Unknown(2)|Substitution - Missense(1)|Deletion - In frame(1)	central_nervous_system(3)|ovary(1)	22											120.0	103.0	109.0					22																	24175875		2203	4300	6503	22505875	SO:0001583	missense	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.1103A>G	22.37:g.24175875A>G	ENSP00000263121:p.Gln368Arg	Somatic		Capture	SOLID	Phase_IV	22505875	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	CCDS13817.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	23.0	4.364456	0.82463	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	4.76	4.76	0.60689	.	0.108664	0.64402	D	0.000004	T	0.78629	0.4313	L	0.37750	1.13	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.74858	-0.3521	10	0.21540	T	0.41	-31.4772	13.8309	0.63380	1.0:0.0:0.0:0.0	.	377;359;368	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	R	377;368;359;322	ENSP00000340883:Q377R;ENSP00000263121:Q368R;ENSP00000383984:Q359R;ENSP00000385226:Q322R	ENSP00000263121:Q368R	Q	+	2	0	SMARCB1	22505875	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.040000	0.93783	1.934000	0.56057	0.444000	0.29173	CAG		0.622	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073		Missense_Mutation
SYNE2	23224	hgsc.bcm.edu	37	14	64516480	64516481	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-0720-01	TCGA-13-0720-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr14:64516480_64516481insT	ENST00000344113.4	+	47	7741_7742	c.7529_7530insT	c.(7528-7533)actttgfs	p.L2511fs	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Frame_Shift_Ins_p.L2511fs|SYNE2_ENST00000554584.1_Frame_Shift_Ins_p.L2544fs	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2511					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.L2511fs*23(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCACTTATTACTTTGAAGAAAA	0.391																																																1	Insertion - Frameshift(1)	ovary(1)	14																																								63586234	SO:0001589	frameshift_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7532dupT	14.37:g.64516483_64516483dupT	ENSP00000341781:p.Leu2511fs	Somatic		Capture	SOLID	Phase_IV	63586233	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Ins	INS	ENST00000344113.4	37	CCDS41963.1	INS	20	Baylor																																																																																				0.391	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		Frame_Shift_Ins
TIGD6	81789	hgsc.bcm.edu	37	5	149374880	149374880	+	Silent	SNP	T	T	C	rs397756704|rs3832324|rs201139146	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr5:149374880T>C	ENST00000296736.3	-	2	1806	c.1032A>G	c.(1030-1032)caA>caG	p.Q344Q	TIGD6_ENST00000515406.2_Silent_p.Q344Q	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	344	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCACCTCTTCTTGATCCTCAC	0.502																																																0			5											98.0	51.0	67.0					5																	149374880		2168	4015	6183	149355073	SO:0001819	synonymous_variant	81789			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.1032A>G	5.37:g.149374880T>C		Somatic		Capture	SOLID	Phase_IV	149355073	B3KTZ8|Q96MQ4|Q9H0X7	Silent	SNP	ENST00000296736.3	37	CCDS4301.1	SNP	56	Baylor																																																																																				0.502	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953		Silent
TMEM131	23505	hgsc.bcm.edu	37	2	98413916	98413916	+	Silent	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:98413916G>A	ENST00000186436.5	-	26	3010	c.2782C>T	c.(2782-2784)Cta>Tta	p.L928L		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	928						integral component of membrane (GO:0016021)		p.L815L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TTTAAAATTAGGTTTAAAATT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	2											92.0	91.0	91.0					2																	98413916		1799	4058	5857	97780348	SO:0001819	synonymous_variant	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.2782C>T	2.37:g.98413916G>A		Somatic		Capture	SOLID	Phase_IV	97780348		Silent	SNP	ENST00000186436.5	37	CCDS46368.1	SNP	35	Baylor																																																																																				0.378	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542		Silent
TMPRSS11D	9407	hgsc.bcm.edu	37	4	68693234	68693234	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0720-01	TCGA-13-0720-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr4:68693234A>T	ENST00000283916.6	-	8	795	c.697T>A	c.(697-699)Tct>Act	p.S233T	TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.S116T|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	233	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.S233T(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CGAGGATTAGAGTTGCTAAAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	4											33.0	32.0	32.0					4																	68693234		2203	4298	6501	68375829	SO:0001583	missense	9407			AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.697T>A	4.37:g.68693234A>T	ENSP00000283916:p.Ser233Thr	Somatic		Capture	SOLID	Phase_IV	68375829	Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	37	CCDS3518.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125247	0.37533	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	D;D	0.89123	-2.47;-2.47	5.58	-6.41	0.01938	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.787785	0.11414	N	0.566497	T	0.74435	0.3716	N	0.21282	0.65	0.09310	N	1	B	0.25850	0.136	B	0.21151	0.033	T	0.61387	-0.7073	10	0.16420	T	0.52	.	9.095	0.36634	0.3059:0.0:0.5629:0.1312	.	233	O60235	TM11D_HUMAN	T	233;116	ENSP00000283916:S233T;ENSP00000442045:S116T	ENSP00000283916:S233T	S	-	1	0	TMPRSS11D	68375829	0.002000	0.14202	0.000000	0.03702	0.019000	0.09904	-0.228000	0.09114	-0.667000	0.05303	0.533000	0.62120	TCT		0.313	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262		Missense_Mutation
TMPRSS11F	389208	hgsc.bcm.edu	37	4	68964726	68964726	+	Silent	SNP	T	T	A	rs146311461	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr4:68964726T>A	ENST00000356291.2	-	2	101	c.42A>T	c.(40-42)tcA>tcT	p.S14S		NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	14						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.S14S(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						ATTCAGCTCGTGAGAATTCAG	0.333																																																1	Substitution - coding silent(1)	ovary(1)	4											79.0	77.0	77.0					4																	68964726		2203	4300	6503	68647321	SO:0001819	synonymous_variant	389208			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.42A>T	4.37:g.68964726T>A		Somatic		Capture	SOLID	Phase_IV	68647321	A8MXX2	Silent	SNP	ENST00000356291.2	37	CCDS3520.1	SNP	59	Baylor																																																																																				0.333	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407		Silent
TP53	7157	hgsc.bcm.edu	37	17	7578454	7578454	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Biotage_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr17:7578454G>A	ENST00000269305.4	-	5	665	c.476C>T	c.(475-477)gCc>gTc	p.A159V	TP53_ENST00000359597.4_Missense_Mutation_p.A159V|TP53_ENST00000445888.2_Missense_Mutation_p.A159V|TP53_ENST00000455263.2_Missense_Mutation_p.A159V|TP53_ENST00000420246.2_Missense_Mutation_p.A159V|TP53_ENST00000413465.2_Missense_Mutation_p.A159V|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	159	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A159V(33)|p.0?(8)|p.A159D(7)|p.R158fs(6)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.R26fs(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.R158fs*11(1)|p.A66V(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.A27V(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.A159_Q167delAMAIYKQSQ(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGCCATGGCGCGGACGCG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	81	Substitution - Missense(42)|Deletion - In frame(12)|Complex(10)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - frameshift(2)	central_nervous_system(15)|large_intestine(13)|lung(13)|stomach(6)|breast(6)|ovary(6)|oesophagus(4)|bone(4)|liver(4)|haematopoietic_and_lymphoid_tissue(3)|pancreas(2)|upper_aerodigestive_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|prostate(1)	17											50.0	51.0	51.0					17																	7578454		2203	4300	6503	7519179	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.476C>T	17.37:g.7578454G>A	ENSP00000269305:p.Ala159Val	Somatic		Capture	SOLID	Phase_IV	7519179	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211949	0.58452	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99859	-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23;-7.23	5.59	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.053992	0.64402	D	0.000001	D	0.99594	0.9853	L	0.49513	1.565	0.50171	D	0.999855	D;P;B;D;P;P;D	0.67145	0.984;0.881;0.358;0.989;0.832;0.769;0.996	P;P;B;P;P;P;P	0.59703	0.774;0.616;0.255;0.741;0.814;0.632;0.862	D	0.98152	1.0442	10	0.87932	D	0	-9.0177	10.7596	0.46258	0.0:0.2672:0.5942:0.1386	.	120;159;159;66;159;159;159	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	V	159;159;159;159;159;159;148;66;27;66;27;159	ENSP00000410739:A159V;ENSP00000352610:A159V;ENSP00000269305:A159V;ENSP00000398846:A159V;ENSP00000391127:A159V;ENSP00000391478:A159V;ENSP00000425104:A27V;ENSP00000423862:A66V;ENSP00000424104:A159V	ENSP00000269305:A159V	A	-	2	0	TP53	7519179	1.000000	0.71417	0.377000	0.26055	0.171000	0.22731	7.969000	0.87988	0.364000	0.24374	-0.176000	0.13171	GCC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TP53BP1	7158	hgsc.bcm.edu	37	15	43771608	43771608	+	Missense_Mutation	SNP	G	G	A	rs535792451		TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr15:43771608G>A	ENST00000263801.3	-	7	1012	c.760C>T	c.(760-762)Cca>Tca	p.P254S	TP53BP1_ENST00000450115.2_Missense_Mutation_p.P259S|TP53BP1_ENST00000382039.3_Missense_Mutation_p.P259S|TP53BP1_ENST00000382044.4_Missense_Mutation_p.P259S	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	254					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.P254S(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GCAGGTGGTGGATTTTGCTCT	0.408								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	15											253.0	211.0	225.0					15																	43771608		2201	4298	6499	41558900	SO:0001583	missense	7158			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.760C>T	15.37:g.43771608G>A	ENSP00000263801:p.Pro254Ser	Somatic		Capture	SOLID	Phase_IV	41558900	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.330	0.826199	0.16749	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.09445	3.81;3.81;3.81;3.81;2.98	4.95	-6.2	0.02072	.	1.226040	0.05628	N	0.581147	T	0.04272	0.0118	N	0.16478	0.41	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.001;0.001	B;B;B;B	0.08055	0.001;0.001;0.003;0.003	T	0.41574	-0.9501	10	0.10636	T	0.68	4.568	1.6194	0.02710	0.4378:0.2355:0.1956:0.1311	.	259;254;259;259	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	S	254;259;259;259;259	ENSP00000263801:P254S;ENSP00000371475:P259S;ENSP00000371470:P259S;ENSP00000393497:P259S;ENSP00000388028:P259S	ENSP00000263801:P254S	P	-	1	0	TP53BP1	41558900	0.000000	0.05858	0.000000	0.03702	0.331000	0.28603	-0.600000	0.05693	-0.916000	0.03818	-0.237000	0.12165	CCA		0.408	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			Missense_Mutation
TRDMT1	1787	hgsc.bcm.edu	37	10	17201224	17201224	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr10:17201224C>A	ENST00000377799.3	-	7	511	c.464G>T	c.(463-465)gGc>gTc	p.G155V	TRDMT1_ENST00000377766.5_Missense_Mutation_p.W83C|TRDMT1_ENST00000351358.4_Missense_Mutation_p.G109V|TRDMT1_ENST00000457442.2_Missense_Mutation_p.G74V|TRDMT1_ENST00000412821.3_Missense_Mutation_p.G131V|TRDMT1_ENST00000488990.1_Intron|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000452380.2_5'UTR	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	155	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)	p.G155V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	ATTTGGAATGCCAAGCTGTAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	62.0	61.0					10																	17201224		2203	4300	6503	17241230	SO:0001583	missense	1787			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.464G>T	10.37:g.17201224C>A	ENSP00000367030:p.Gly155Val	Somatic		Capture	SOLID	Phase_IV	17241230	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	ENST00000377799.3	37	CCDS7114.1	SNP	26	Baylor	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.46|15.46|15.46	2.840929|2.840929|2.840929	0.51057|0.51057|0.51057	.|.|.	.|.|.	ENSG00000107614|ENSG00000107614|ENSG00000107614	ENST00000436968|ENST00000377799;ENST00000412821;ENST00000351358;ENST00000457442;ENST00000525762|ENST00000377766;ENST00000313936	.|T;T;T;T;T|.	.|0.75704|.	.|-0.96;-0.96;-0.96;-0.96;-0.96|.	5.64|5.64|5.64	4.74|4.74|4.74	0.60224|0.60224|0.60224	.|.|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	D|D|D	0.84902|0.84902|0.84902	0.5575|0.5575|0.5575	M|M|M	0.93197|0.93197|0.93197	3.39|3.39|3.39	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D|.	.|0.97110|.	.|1.0;0.999;1.0;0.999;1.0;1.0|.	D|D|D	0.88999|0.88999|0.88999	0.3420|0.3420|0.3420	5|10|5	.|0.87932|.	.|D|.	.|0|.	-12.4056|-12.4056|-12.4056	14.5118|14.5118|14.5118	0.67791|0.67791|0.67791	0.0:0.9283:0.0:0.0717|0.0:0.9283:0.0:0.0717|0.0:0.9283:0.0:0.0717	.|.|.	.|84;74;155;109;131;155|.	.|B7Z1Y7;E7EMI8;Q6ICS7;O14717-3;O14717-2;O14717|.	.|.;.;.;.;.;TRDMT_HUMAN|.	S|V|C	63|155;131;109;74;113|83;88	.|ENSP00000367030:G155V;ENSP00000409354:G131V;ENSP00000324328:G109V;ENSP00000412256:G74V;ENSP00000431476:G113V|.	.|ENSP00000324328:G109V|.	A|G|W	-|-|-	1|2|3	0|0|0	TRDMT1|TRDMT1|TRDMT1	17241230|17241230|17241230	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.982000|0.982000|0.982000	0.71751|0.71751|0.71751	7.058000|7.058000|7.058000	0.76676|0.76676|0.76676	1.373000|1.373000|1.373000	0.46208|0.46208|0.46208	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|GGC|TGG		0.363	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412		Missense_Mutation
TRIM54	57159	hgsc.bcm.edu	37	2	27521534	27521534	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr2:27521534C>T	ENST00000380075.2	+	2	608	c.268C>T	c.(268-270)Cac>Tac	p.H90Y	TRIM54_ENST00000296098.4_Missense_Mutation_p.H90Y	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	90					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.H74Y(1)		cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGGACAGACACGGTGTCTA	0.577																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	72.0	78.0					2																	27521534		2203	4300	6503	27375038	SO:0001583	missense	57159			AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.268C>T	2.37:g.27521534C>T	ENSP00000369415:p.His90Tyr	Somatic		Capture	SOLID	Phase_IV	27375038	A5D8T7|Q53SY4|Q9BYV3	Missense_Mutation	SNP	ENST00000380075.2	37	CCDS1746.2	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857334	0.71834	.	.	ENSG00000138100	ENST00000380075;ENST00000296098	T;T	0.40476	1.22;1.03	5.34	5.34	0.76211	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	M	0.82323	2.585	0.80722	D	1	B;B	0.25809	0.054;0.135	B;B	0.36335	0.021;0.222	T	0.59521	-0.7439	10	0.66056	D	0.02	-16.8942	16.528	0.84336	0.0:1.0:0.0:0.0	.	90;90	Q9BYV2;Q9BYV2-2	TRI54_HUMAN;.	Y	90	ENSP00000369415:H90Y;ENSP00000296098:H90Y	ENSP00000296098:H90Y	H	+	1	0	TRIM54	27375038	1.000000	0.71417	0.972000	0.41901	0.883000	0.51084	7.757000	0.85209	2.498000	0.84270	0.511000	0.50034	CAC		0.577	TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214199.2	NM_187841		Missense_Mutation
TRRAP	8295	hgsc.bcm.edu	37	7	98576481	98576481	+	Missense_Mutation	SNP	C	C	T	rs372599334		TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr7:98576481C>T	ENST00000359863.4	+	57	8776	c.8567C>T	c.(8566-8568)gCc>gTc	p.A2856V	TRRAP_ENST00000446306.3_Missense_Mutation_p.A2838V|TRRAP_ENST00000355540.3_Missense_Mutation_p.A2838V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2856	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.A2838V(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTGGAGTGCGCCTGGCGGGTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											71.0	74.0	73.0					7																	98576481		2203	4300	6503	98414417	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8567C>T	7.37:g.98576481C>T	ENSP00000352925:p.Ala2856Val	Somatic		Capture	SOLID	Phase_IV	98414417	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	SNP	26	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.060415|6.060415	0.97246|0.97246	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.75260|.	-0.92;-0.92|.	6.03|6.03	6.03|6.03	0.97812|0.97812	PIK-related kinase (1);PIK-related kinase, FAT (1);|.	0.055265|.	0.64402|.	D|.	0.000001|.	D|D	0.84777|0.84777	0.5547|0.5547	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	P;D;D|.	0.58620|.	0.956;0.983;0.983|.	P;P;P|.	0.56700|.	0.627;0.804;0.804|.	D|D	0.85066|0.85066	0.0937|0.0937	10|5	0.56958|.	D|.	0.05|.	.|.	20.5568|20.5568	0.99304|0.99304	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2838;2577;2856|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	V|S	2856;2838;2837|2578	ENSP00000352925:A2856V;ENSP00000347733:A2838V|.	ENSP00000347733:A2838V|.	A|P	+|+	2|1	0|0	TRRAP|TRRAP	98414417|98414417	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.991000|0.991000	0.79684|0.79684	7.818000|7.818000	0.86416|0.86416	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GCC|CCT		0.617	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		Missense_Mutation
UBR5	51366	hgsc.bcm.edu	37	8	103323725	103323725	+	Splice_Site	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr8:103323725C>T	ENST00000520539.1	-	20	3025		c.e20-1		UBR5_ENST00000220959.4_Splice_Site|UBR5_ENST00000521922.1_Splice_Site	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5						cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TGGGAGATTCCTATAATAATG	0.353																																					Ovarian(131;96 1741 5634 7352 27489)											1	Unknown(1)	ovary(1)	8											66.0	69.0	68.0					8																	103323725		2203	4300	6503	103392901	SO:0001630	splice_region_variant	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2419-1G>A	8.37:g.103323725C>T		Somatic		Capture	SOLID	Phase_IV	103392901	B2RP24|J3KMW7|O94970|Q9NPL3	Splice_Site_SNP	SNP	ENST00000520539.1	37	CCDS34933.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496712	0.85069	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7693	0.96356	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBR5	103392901	1.000000	0.71417	0.997000	0.53966	0.848000	0.48234	7.663000	0.83820	2.669000	0.90835	0.561000	0.74099	.		0.353	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	Intron	Splice_Site_SNP
USP22	23326	hgsc.bcm.edu	37	17	20914546	20914547	+	Frame_Shift_Del	DEL	GG	GG	-	rs118038927	byFrequency	TCGA-13-0720-01	TCGA-13-0720-10	GG	GG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr17:20914546_20914547delGG	ENST00000261497.4	-	8	1223_1224	c.1020_1021delCC	c.(1018-1023)cccctgfs	p.L341fs	USP22_ENST00000455117.2_Intron|USP22_ENST00000537526.2_Frame_Shift_Del_p.L329fs	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	341	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.L563fs*47(1)		endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						CCTGGGCTCAGGGGCCAGAATG	0.629																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								20855139	SO:0001589	frameshift_variant	23326			AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.1020_1021delCC	17.37:g.20914548_20914549delGG	ENSP00000261497:p.Leu341fs	Somatic		Capture	SOLID	Phase_IV	20855138	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Frame_Shift_Del	DEL	ENST00000261497.4	37	CCDS42285.1	DEL	35	Baylor																																																																																				0.629	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1			Frame_Shift_Del
USP22	23326	hgsc.bcm.edu	37	17	20914549	20914549	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0720-01	TCGA-13-0720-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr17:20914549G>A	ENST00000261497.4	-	8	1221	c.1018C>T	c.(1018-1020)Ccc>Tcc	p.P340S	USP22_ENST00000455117.2_Intron|USP22_ENST00000537526.2_Missense_Mutation_p.P328S	NM_015276.1	NP_056091.1	Q9UPT9	UBP22_HUMAN	ubiquitin specific peptidase 22	340	USP.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|embryo development (GO:0009790)|histone deubiquitination (GO:0016578)|histone H4 acetylation (GO:0043967)|histone ubiquitination (GO:0016574)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deubiquitination (GO:0016579)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	SAGA complex (GO:0000124)	enzyme binding (GO:0019899)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|transcription coactivator activity (GO:0003713)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	15						GGGCTCAGGGGCCAGAATGGG	0.627																																																0			17											28.0	33.0	32.0					17																	20914549		2064	4203	6267	20855141	SO:0001583	missense	23326			AB028986	CCDS42285.1	17p11.2	2006-11-24	2005-08-08		ENSG00000124422	ENSG00000124422		"""Ubiquitin-specific peptidases"""	12621	protein-coding gene	gene with protein product		612116	"""ubiquitin specific protease 22"", ""ubiquitin specific peptidase 3-like"""	USP3L		12838346	Standard	NM_015276		Approved	KIAA1063	uc002gym.4	Q9UPT9	OTTHUMG00000133621	ENST00000261497.4:c.1018C>T	17.37:g.20914549G>A	ENSP00000261497:p.Pro340Ser	Somatic		Capture	SOLID	Phase_IV	20855141	A0JNS3|Q2NLE2|Q6MZY4|Q8TBS8|Q96IW5	Missense_Mutation	SNP	ENST00000261497.4	37	CCDS42285.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173191	0.57584	.	.	ENSG00000124422	ENST00000455117;ENST00000537526;ENST00000261497	T;T	0.08546	3.08;3.08	3.9	3.9	0.45041	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	N	0.05280	-0.08	0.58432	D	0.999999	B;B	0.20459	0.045;0.005	B;B	0.18561	0.022;0.014	T	0.21861	-1.0233	10	0.02654	T	1	.	16.2912	0.82752	0.0:0.0:1.0:0.0	.	328;340	Q9UPT9-2;Q9UPT9	.;UBP22_HUMAN	S	408;328;340	ENSP00000440950:P328S;ENSP00000261497:P340S	ENSP00000261497:P340S	P	-	1	0	USP22	20855141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.767000	0.91732	1.894000	0.54839	0.558000	0.71614	CCC		0.627	USP22-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444169.1			Missense_Mutation
XPNPEP1	7511	hgsc.bcm.edu	37	10	111630549	111630549	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr10:111630549C>A	ENST00000502935.1	-	18	1755	c.1636G>T	c.(1636-1638)Ggc>Tgc	p.G546C	XPNPEP1_ENST00000369680.4_Missense_Mutation_p.G503C|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.G432C|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.G522C|U4_ENST00000607255.1_RNA					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble									p.G503C(1)		endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TAACTGATGCCGCAAGGACCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											174.0	153.0	160.0					10																	111630549		2203	4300	6503	111620539	SO:0001583	missense	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.1636G>T	10.37:g.111630549C>A	ENSP00000421566:p.Gly546Cys	Somatic		Capture	SOLID	Phase_IV	111620539		Missense_Mutation	SNP	ENST00000502935.1	37	CCDS7560.2	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.5	4.921515	0.92249	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.66	5.66	0.87406	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.90410	0.6998	H	0.96080	3.765	0.80722	D	1	D;D	0.60160	0.987;0.958	P;P	0.56042	0.79;0.789	D	0.93185	0.6578	10	0.87932	D	0	-19.2426	17.9255	0.88982	0.0:1.0:0.0:0.0	.	546;503	G5E9Y2;Q9NQW7	.;XPP1_HUMAN	C	546;432;522;503	ENSP00000421566:G546C;ENSP00000358697:G432C;ENSP00000324011:G522C;ENSP00000358694:G503C	ENSP00000324011:G522C	G	-	1	0	XPNPEP1	111620539	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.639000	0.67868	2.677000	0.91161	0.591000	0.81541	GGC		0.498	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050264.2			Missense_Mutation
ZFYVE1	53349	hgsc.bcm.edu	37	14	73442336	73442336	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr14:73442336C>A	ENST00000556143.1	-	9	2449	c.1729G>T	c.(1729-1731)Gga>Tga	p.G577*	ZFYVE1_ENST00000394207.2_Nonsense_Mutation_p.G162*|ZFYVE1_ENST00000554145.1_5'UTR|ZFYVE1_ENST00000553891.1_Nonsense_Mutation_p.G577*|ZFYVE1_ENST00000318876.5_Nonsense_Mutation_p.G563*|ZFYVE1_ENST00000555072.1_Nonsense_Mutation_p.G162*	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	577					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)	p.G577*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TTGGTGGGTCCAAGGCTAAGC	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	14											126.0	103.0	111.0					14																	73442336		2203	4300	6503	72512089	SO:0001587	stop_gained	53349			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.1729G>T	14.37:g.73442336C>A	ENSP00000450742:p.Gly577*	Somatic		Capture	SOLID	Phase_IV	72512089	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Nonsense_Mutation	SNP	ENST00000556143.1	37	CCDS9811.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	45	11.671480	0.99589	.	.	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143;ENST00000394207;ENST00000555072	.	.	.	6.17	6.17	0.99709	.	0.150863	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-30.042	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	577;563;577;162;162	.	ENSP00000326921:G577X	G	-	1	0	ZFYVE1	72512089	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	4.742000	0.62103	2.941000	0.99782	0.655000	0.94253	GGA		0.567	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260		Nonsense_Mutation
ZNF222	7673	hgsc.bcm.edu	37	19	44536593	44536593	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0720-01	TCGA-13-0720-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr19:44536593C>T	ENST00000187879.8	+	4	928	c.766C>T	c.(766-768)Cca>Tca	p.P256S	ZNF223_ENST00000591793.1_Intron|ZNF222_ENST00000391960.3_Missense_Mutation_p.P296S	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P256S(1)		endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				TGGGGAGAAGCCATTCAAATG	0.393																																																1	Substitution - Missense(1)	ovary(1)	19											131.0	136.0	134.0					19																	44536593		2203	4300	6503	49228433	SO:0001583	missense	7673			AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.766C>T	19.37:g.44536593C>T	ENSP00000187879:p.Pro256Ser	Somatic		Capture	SOLID	Phase_IV	49228433	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	ENST00000187879.8	37	CCDS33045.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439738	0.63067	.	.	ENSG00000159885	ENST00000391960;ENST00000187879;ENST00000251272	T;T	0.16743	2.32;2.32	2.79	0.389	0.16269	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37046	0.0989	M	0.79011	2.435	0.29816	N	0.831248	D;D	0.89917	0.997;1.0	D;D	0.73380	0.934;0.98	T	0.23154	-1.0196	9	0.66056	D	0.02	.	7.6732	0.28470	0.1829:0.6394:0.1776:0.0	.	296;256	G5E9B9;Q9UK12	.;ZN222_HUMAN	S	296;256;202	ENSP00000375822:P296S;ENSP00000187879:P256S	ENSP00000187879:P256S	P	+	1	0	ZNF222	49228433	0.924000	0.31332	0.006000	0.13384	0.461000	0.32589	4.270000	0.58896	0.029000	0.15352	0.205000	0.17691	CCA		0.393	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2			Missense_Mutation
ZNF821	55565	hgsc.bcm.edu	37	16	71894523	71894523	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0720-01	TCGA-13-0720-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0720-01	TCGA-13-0720-10	g.chr16:71894523C>G	ENST00000565601.1	-	7	1044	c.637G>C	c.(637-639)Gag>Cag	p.E213Q	ZNF821_ENST00000446827.2_Missense_Mutation_p.E171Q|ZNF821_ENST00000425432.1_Missense_Mutation_p.E213Q|ZNF821_ENST00000564134.1_3'UTR|ZNF821_ENST00000313565.6_Missense_Mutation_p.E171Q|ATXN1L_ENST00000569119.1_Intron	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	213					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E171Q(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						GAGGGACCCTCATTGTGGACT	0.468																																																1	Substitution - Missense(1)	ovary(1)	16											84.0	80.0	81.0					16																	71894523		2198	4300	6498	70452024	SO:0001583	missense	55565			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.637G>C	16.37:g.71894523C>G	ENSP00000455648:p.Glu213Gln	Somatic		Capture	SOLID	Phase_IV	70452024	A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	ENST00000565601.1	37	CCDS56006.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.143	0.785600	0.16189	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01406	6.53;4.93;4.93	5.95	5.95	0.96441	.	0.241197	0.43919	D	0.000516	T	0.00998	0.0033	N	0.08118	0	0.37296	D	0.908481	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.62840	-0.6769	10	0.17832	T	0.49	-15.7473	10.6537	0.45663	0.0:0.798:0.1329:0.0691	.	213;171;213	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	Q	213;171;171	ENSP00000398089:E213Q;ENSP00000313822:E171Q;ENSP00000405908:E171Q	ENSP00000313822:E171Q	E	-	1	0	ZNF821	70452024	0.994000	0.37717	0.949000	0.38748	0.103000	0.19146	3.191000	0.50981	2.824000	0.97209	0.655000	0.94253	GAG		0.468	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434180.1	NM_017530		Missense_Mutation
