#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DOCK8	81704	genome.wustl.edu	37	9	372251	372251	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr9:372251A>T	ENST00000453981.1	+	18	2186	c.2074A>T	c.(2074-2076)Aaa>Taa	p.K692*	DOCK8_ENST00000469391.1_Nonsense_Mutation_p.K624*|DOCK8_ENST00000382329.1_Nonsense_Mutation_p.K159*|DOCK8_ENST00000382331.1_5'UTR|DOCK8_ENST00000432829.2_Nonsense_Mutation_p.K624*			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	692	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.K624*(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TGCCTTGGAAAAATTGCCACC	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	9											126.0	114.0	118.0					9																	372251		2203	4300	6503	362251	SO:0001587	stop_gained	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2074A>T	9.37:g.372251A>T	ENSP00000408464:p.Lys692*	Somatic		Capture	Illumina GAIIx	4	362251	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Nonsense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	43	10.161787	0.99350	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	.	.	.	5.63	5.63	0.86233	.	0.054605	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1339	0.81465	1.0:0.0:0.0:0.0	.	.	.	.	X	692;692;624;624;159	.	ENSP00000287364:K692X	K	+	1	0	DOCK8	362251	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.223000	0.58587	2.271000	0.75665	0.533000	0.62120	AAA		0.448	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307		Nonsense_Mutation
ABCA3	21	genome.wustl.edu	37	16	2329009	2329009	+	Silent	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr16:2329009G>A	ENST00000301732.5	-	29	5182	c.4482C>T	c.(4480-4482)tgC>tgT	p.C1494C	ABCA3_ENST00000382381.3_Silent_p.C1436C	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1494	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.C1494C(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TGTTCTCCACGCAGGCCCCGA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	16											66.0	68.0	67.0					16																	2329009		2198	4300	6498	2269010	SO:0001819	synonymous_variant	21			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4482C>T	16.37:g.2329009G>A		Somatic		Capture	Illumina GAIIx	4	2269010	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1	SNP	38	WashU																																																																																				0.657	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		Silent
TGM6	343641	genome.wustl.edu	37	20	2384442	2384442	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0755-01	TCGA-13-0755-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr20:2384442A>G	ENST00000202625.2	+	9	1370	c.1309A>G	c.(1309-1311)Atc>Gtc	p.I437V	TGM6_ENST00000381423.1_Missense_Mutation_p.I437V	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	437					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I437V(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CCGCGTGGACATCACTGACCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											117.0	113.0	115.0					20																	2384442		2203	4300	6503	2332442	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1309A>G	20.37:g.2384442A>G	ENSP00000202625:p.Ile437Val	Somatic		Capture	Illumina GAIIx	4	2332442	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	5.556	0.287480	0.10513	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.97529	-4.42;-4.42	4.97	4.97	0.65823	.	0.102372	0.64402	D	0.000004	D	0.94666	0.8280	L	0.49640	1.575	0.30941	N	0.725773	B;B	0.17667	0.023;0.015	B;B	0.23150	0.044;0.009	D	0.90997	0.4839	10	0.23302	T	0.38	-26.8912	12.9715	0.58515	1.0:0.0:0.0:0.0	.	437;437	O95932-2;O95932	.;TGM3L_HUMAN	V	437	ENSP00000202625:I437V;ENSP00000370831:I437V	ENSP00000202625:I437V	I	+	1	0	TGM6	2332442	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	2.055000	0.41345	2.234000	0.73211	0.524000	0.50904	ATC		0.587	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		Missense_Mutation
ZNF200	7752	genome.wustl.edu	37	16	3274441	3274441	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr16:3274441C>A	ENST00000431561.3	-	5	1251	c.639G>T	c.(637-639)agG>agT	p.R213S	ZNF200_ENST00000414144.2_Missense_Mutation_p.R213S|ZNF200_ENST00000396871.4_Missense_Mutation_p.R212S|ZNF200_ENST00000396870.4_Missense_Mutation_p.R212S|ZNF200_ENST00000396868.3_Missense_Mutation_p.R212S|AJ003147.9_ENST00000576468.1_RNA|ZNF200_ENST00000575948.1_Missense_Mutation_p.R212S	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	213					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						TTCTCATTTTCCTTTTTTGTG	0.388																																																0			16											124.0	118.0	120.0					16																	3274441		2197	4300	6497	3214442	SO:0001583	missense	7752			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.639G>T	16.37:g.3274441C>A	ENSP00000395723:p.Arg213Ser	Somatic		Capture	Illumina GAIIx	4	3214442	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	ENST00000431561.3	37	CCDS10497.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	7.154	0.584277	0.13749	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T	0.06528	3.31;3.29;3.35	5.7	2.7	0.31948	.	0.144600	0.32301	N	0.006290	T	0.03434	0.0099	N	0.24115	0.695	0.21652	N	0.999601	B;B;P	0.35272	0.361;0.361;0.493	B;B;B	0.28011	0.039;0.039;0.085	T	0.46190	-0.9209	10	0.16420	T	0.52	-23.9506	7.9118	0.29796	0.0:0.7417:0.0:0.2583	.	212;213;212	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	S	213;212;212;212;213	ENSP00000380077:R212S;ENSP00000380080:R212S;ENSP00000395723:R213S	ENSP00000380077:R212S	R	-	3	2	ZNF200	3214442	0.000000	0.05858	0.871000	0.34182	0.335000	0.28730	-0.044000	0.12023	0.345000	0.23873	0.455000	0.32223	AGG		0.388	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000437545.1			Missense_Mutation
OTOP1	133060	genome.wustl.edu	37	4	4199452	4199452	+	Missense_Mutation	SNP	C	C	T	rs374014211		TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr4:4199452C>T	ENST00000296358.4	-	5	1133	c.1109G>A	c.(1108-1110)cGg>cAg	p.R370Q		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	370					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.R370Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTGTAAATCCGGATTCCAGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	4						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	39.0	44.0	42.0		1109	1.0	0.0	4		42	0,8600		0,0,4300	no	missense	OTOP1	NM_177998.1	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	370/613	4199452	1,13005	2203	4300	6503	4250353	SO:0001583	missense	133060			BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1109G>A	4.37:g.4199452C>T	ENSP00000296358:p.Arg370Gln	Somatic		Capture	Illumina GAIIx	4	4250353	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	4.812	0.151037	0.09185	2.27E-4	0.0	ENSG00000163982	ENST00000296358	T	0.08193	3.12	4.8	0.958	0.19619	.	0.850416	0.10371	N	0.682800	T	0.07683	0.0193	L	0.44542	1.39	0.09310	N	1	B	0.23854	0.092	B	0.17979	0.02	T	0.34354	-0.9832	10	0.49607	T	0.09	-3.6484	6.2777	0.20989	0.5295:0.3167:0.0:0.1537	.	370	Q7RTM1	OTOP1_HUMAN	Q	370	ENSP00000296358:R370Q	ENSP00000296358:R370Q	R	-	2	0	OTOP1	4250353	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	1.011000	0.29911	-0.070000	0.12908	0.404000	0.27445	CGG		0.582	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7579312	7579312	+	Splice_Site	SNP	C	C	A	rs55863639		TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr17:7579312C>A	ENST00000269305.4	-	4	564	c.375G>T	c.(373-375)acG>acT	p.T125T	TP53_ENST00000420246.2_Splice_Site_p.T125T|TP53_ENST00000445888.2_Splice_Site_p.T125T|TP53_ENST00000455263.2_Splice_Site_p.T125T|TP53_ENST00000359597.4_Splice_Site_p.T125T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site_p.T125T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	125	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.0?(8)|p.?(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAACTGACCGTGCAAGTCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Substitution - coding silent(51)|Whole gene deletion(8)|Deletion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Insertion - In frame(1)	lung(21)|haematopoietic_and_lymphoid_tissue(14)|large_intestine(8)|upper_aerodigestive_tract(7)|bone(4)|central_nervous_system(3)|biliary_tract(3)|stomach(1)|liver(1)|urinary_tract(1)|kidney(1)|ovary(1)|pancreas(1)	17	GRCh37	CS004351|CS011573|CS971913	TP53	S	rs55863639						66.0	61.0	63.0					17																	7579312		2203	4300	6503	7520037	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579312C>A		Somatic		Capture	Illumina GAIIx	4	7520037	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	WashU																																																																																				0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Silent	Silent
TMEM186	25880	genome.wustl.edu	37	16	8889849	8889849	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr16:8889849C>T	ENST00000333050.6	-	2	635	c.602G>A	c.(601-603)cGt>cAt	p.R201H	PMM2_ENST00000566983.1_Intron|PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000268261.4_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000569958.1_5'Flank	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	201						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.R201H(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						CTGTGTGAAACGCTCTCTGTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	16											165.0	142.0	150.0					16																	8889849		2197	4300	6497	8797350	SO:0001583	missense	25880			BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.602G>A	16.37:g.8889849C>T	ENSP00000331640:p.Arg201His	Somatic		Capture	Illumina GAIIx	4	8797350	B2RAY0|Q9Y4T4	Missense_Mutation	SNP	ENST00000333050.6	37	CCDS10535.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849628	0.32699	.	.	ENSG00000184857	ENST00000333050	T	0.41758	0.99	5.41	4.47	0.54385	.	0.244211	0.21323	N	0.076430	T	0.38188	0.1031	M	0.68317	2.08	0.09310	N	0.999998	B	0.29805	0.257	B	0.25759	0.063	T	0.40664	-0.9551	10	0.59425	D	0.04	-15.942	7.4152	0.27040	0.0:0.7476:0.0:0.2524	.	201	Q96B77	TM186_HUMAN	H	201	ENSP00000331640:R201H	ENSP00000331640:R201H	R	-	2	0	TMEM186	8797350	0.597000	0.26874	0.052000	0.19188	0.116000	0.19942	1.485000	0.35519	1.295000	0.44724	0.591000	0.81541	CGT		0.552	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	NM_015421		Missense_Mutation
MUC16	94025	genome.wustl.edu	37	19	8993503	8993503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:8993503G>T	ENST00000397910.4	-	66	41789	c.41586C>A	c.(41584-41586)tgC>tgA	p.C13862*	MUC16_ENST00000380951.5_Nonsense_Mutation_p.C503*	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13865	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.?(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGCGGTGGGTGCAGATGGCAT	0.592																																																1	Unknown(1)	ovary(1)	19											68.0	66.0	67.0					19																	8993503		1964	4151	6115	8854503	SO:0001587	stop_gained	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41586C>A	19.37:g.8993503G>T	ENSP00000381008:p.Cys13862*	Somatic		Capture	Illumina GAIIx	4	8854503	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	46	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	20.1|20.1	3.936602|3.936602	0.73442|0.73442	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|.	.|.	.|.	3.47|3.47	-3.32|-3.32	0.04973|0.04973	.|.	.|0.468148	.|0.15994	.|U	.|0.234659	T|.	0.37945|.	0.1022|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.47142|.	-0.9140|.	3|.	.|.	.|.	.|.	.|.	8.6105|8.6105	0.33800|0.33800	0.725:0.0:0.275:0.0|0.725:0.0:0.275:0.0	.|.	.|.	.|.	.|.	E|X	702|13862;503	.|.	.|.	A|C	-|-	2|3	0|2	MUC16|MUC16	8854503|8854503	0.043000|0.043000	0.20138|0.20138	0.014000|0.014000	0.15608|0.15608	0.017000|0.017000	0.09413|0.09413	-0.043000|-0.043000	0.12043|0.12043	-0.449000|-0.449000	0.07117|0.07117	-0.484000|-0.484000	0.04775|0.04775	GCA|TGC		0.592	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Nonsense_Mutation
GRIN2A	2903	genome.wustl.edu	37	16	9934560	9934560	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr16:9934560C>T	ENST00000396573.2	-	8	1904	c.1595G>A	c.(1594-1596)gGa>gAa	p.G532E	GRIN2A_ENST00000535259.1_Missense_Mutation_p.G375E|GRIN2A_ENST00000404927.2_Missense_Mutation_p.G532E|GRIN2A_ENST00000396575.2_Missense_Mutation_p.G532E|GRIN2A_ENST00000562109.1_Missense_Mutation_p.G532E|GRIN2A_ENST00000330684.3_Missense_Mutation_p.G532E	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	532					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G532E(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GACACTGATTCCCGTTTCCAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	16											137.0	109.0	118.0					16																	9934560		2197	4300	6497	9842061	SO:0001583	missense	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1595G>A	16.37:g.9934560C>T	ENSP00000379818:p.Gly532Glu	Somatic		Capture	Illumina GAIIx	4	9842061	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662720	0.88251	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36	5.3	4.34	0.51931	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.79598	0.4473	H	0.95679	3.705	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.711	D;D;P	0.97110	1.0;1.0;0.447	D	0.85144	0.0982	9	.	.	.	.	12.9421	0.58350	0.0:0.9223:0.0:0.0777	.	375;532;532	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	E	532;532;375;532;532	ENSP00000379818:G532E;ENSP00000385872:G532E;ENSP00000441572:G375E;ENSP00000332549:G532E;ENSP00000379820:G532E	.	G	-	2	0	GRIN2A	9842061	1.000000	0.71417	0.843000	0.33291	0.974000	0.67602	7.684000	0.84104	1.222000	0.43521	0.655000	0.94253	GGA		0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3			Missense_Mutation
KRI1	65095	genome.wustl.edu	37	19	10670330	10670330	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:10670330T>C	ENST00000312962.6	-	11	1019	c.1000A>G	c.(1000-1002)Aga>Gga	p.R334G	KRI1_ENST00000537964.1_5'Flank|KRI1_ENST00000361821.5_Missense_Mutation_p.R330G	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	328	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.R334G(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TTCTCCTTTCTGCGCTCATCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	19											95.0	94.0	95.0					19																	10670330		2203	4300	6503	10531330	SO:0001583	missense	65095				CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.1000A>G	19.37:g.10670330T>C	ENSP00000320917:p.Arg334Gly	Somatic		Capture	Illumina GAIIx	4	10531330	Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Missense_Mutation	SNP	ENST00000312962.6	37	CCDS12242.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887740	0.72410	.	.	ENSG00000129347	ENST00000312962;ENST00000361821;ENST00000541101	T;T	0.36340	1.56;1.26	5.1	2.89	0.33648	.	0.103755	0.64402	D	0.000009	T	0.63165	0.2488	M	0.91140	3.18	0.46823	D	0.999217	D;D	0.71674	0.998;0.998	D;P	0.64687	0.928;0.905	T	0.68002	-0.5524	10	0.87932	D	0	-45.5729	11.4352	0.50064	0.0:0.0:0.4395:0.5605	.	334;330	Q8N9T8;D3YTE0	KRI1_HUMAN;.	G	334;330;334	ENSP00000320917:R334G;ENSP00000355366:R330G	ENSP00000320917:R334G	R	-	1	2	KRI1	10531330	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.016000	0.40971	0.223000	0.20920	0.477000	0.44152	AGA		0.617	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	NM_023008		Missense_Mutation
SLC9B1P1	100128190	genome.wustl.edu	37	Y	13500742	13500742	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chrY:13500742G>A	ENST00000331172.6	-	5	579	c.580C>T	c.(580-582)Cga>Tga	p.R194*				A6NJY1	SL9P1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1 pseudogene 1	179						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.R194*(1)									TTTAAAATTCGAACACATAAT	0.323																																																1	Substitution - Nonsense(1)	ovary(1)	Y																																								11960742	SO:0001587	stop_gained	0					Yq11.21	2013-07-15	2012-03-22	2011-07-26	ENSG00000183704	ENSG00000183704		"""Solute carriers"""	37492	pseudogene	pseudogene			"""Na+/H+ exchanger domain containing 1 pseudogene 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1 pseudogene 1"""	NHEDC1P1			Standard	NG_023008		Approved			A6NJY1		ENST00000331172.6:c.580C>T	Y.37:g.13500742G>A	ENSP00000331938:p.Arg194*	Somatic		Capture	Illumina GAIIx	4	11960742		Nonsense_Mutation	SNP	ENST00000331172.6	37		SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	N	8.971	0.972936	0.18736	.	.	ENSG00000183704	ENST00000331172	.	.	.	1.4	0.402	0.16344	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.7024	.	.	.	.	.	.	.	X	194	.	.	R	-	1	2	AC134882.1	11960742	0.988000	0.35896	0.010000	0.14722	0.056000	0.15407	1.997000	0.40786	0.121000	0.18284	0.184000	0.17185	CGA		0.323	SLC9B1P1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NG_023008		Nonsense_Mutation
PROM1	8842	genome.wustl.edu	37	4	16020132	16020132	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr4:16020132G>T	ENST00000510224.1	-	9	1064	c.816C>A	c.(814-816)aaC>aaA	p.N272K	PROM1_ENST00000508167.1_Missense_Mutation_p.N263K|PROM1_ENST00000505450.1_Missense_Mutation_p.N263K|PROM1_ENST00000502943.1_5'UTR|PROM1_ENST00000539194.1_Missense_Mutation_p.N272K|PROM1_ENST00000543373.1_Missense_Mutation_p.N263K|PROM1_ENST00000447510.2_Missense_Mutation_p.N272K|PROM1_ENST00000540805.1_Missense_Mutation_p.N272K			O43490	PROM1_HUMAN	prominin 1	272					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)	p.N271K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						TGCTGTTCATGTTCTCCAACG	0.493																																																1	Substitution - Missense(1)	ovary(1)	4											117.0	112.0	114.0					4																	16020132		2084	4211	6295	15629230	SO:0001583	missense	8842			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.816C>A	4.37:g.16020132G>T	ENSP00000426809:p.Asn272Lys	Somatic		Capture	Illumina GAIIx	4	15629230	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	37	CCDS47029.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	13.51	2.257718	0.39896	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.39	-1.66	0.08265	.	0.430329	0.27486	N	0.019156	T	0.29556	0.0737	M	0.73962	2.25	0.09310	N	1	B;B;B;B;B;B	0.31227	0.314;0.314;0.314;0.314;0.052;0.198	B;B;B;B;B;B	0.34931	0.17;0.17;0.118;0.17;0.018;0.192	T	0.33904	-0.9850	10	0.05833	T	0.94	-7.3092	0.5124	0.00597	0.2244:0.3136:0.1745:0.2875	.	263;272;263;272;263;272	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	K	272;272;272;263;263;272;263	ENSP00000415481:N272K;ENSP00000438045:N272K;ENSP00000443620:N272K;ENSP00000426090:N263K;ENSP00000427346:N263K;ENSP00000426809:N272K;ENSP00000445526:N263K	ENSP00000415481:N272K	N	-	3	2	PROM1	15629230	0.000000	0.05858	0.001000	0.08648	0.079000	0.17450	-0.906000	0.04071	-0.237000	0.09739	0.557000	0.71058	AAC		0.493	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017		Missense_Mutation
USHBP1	83878	genome.wustl.edu	37	19	17367458	17367458	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:17367458C>T	ENST00000252597.3	-	9	1465	c.1292G>A	c.(1291-1293)cGt>cAt	p.R431H	AC010646.3_ENST00000594059.1_5'Flank|USHBP1_ENST00000431146.2_Missense_Mutation_p.R367H	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.R431H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						CTCCTGGAGACGCTGGACATA	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	66.0	66.0					19																	17367458		2203	4300	6503	17228458	SO:0001583	missense	83878			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1292G>A	19.37:g.17367458C>T	ENSP00000252597:p.Arg431His	Somatic		Capture	Illumina GAIIx	4	17228458		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489396	0.26686	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.21191	2.04;2.02	4.9	1.63	0.23807	.	0.619580	0.15415	N	0.263540	T	0.14743	0.0356	L	0.42245	1.32	0.50467	D	0.999873	B;B	0.25850	0.072;0.136	B;B	0.18871	0.015;0.023	T	0.07233	-1.0783	10	0.35671	T	0.21	-4.2264	5.6189	0.17446	0.0:0.6523:0.0:0.3477	.	367;431	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	H	431;367	ENSP00000252597:R431H;ENSP00000407902:R367H	ENSP00000252597:R431H	R	-	2	0	USHBP1	17228458	0.562000	0.26586	0.996000	0.52242	0.631000	0.37964	-0.023000	0.12456	0.473000	0.27368	0.655000	0.94253	CGT		0.577	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941		Missense_Mutation
ZNF70	7621	genome.wustl.edu	37	22	24086469	24086469	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr22:24086469T>C	ENST00000341976.3	-	2	1319	c.859A>G	c.(859-861)Aaa>Gaa	p.K287E		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K287E(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						CAAAAGGCTTTCCCACAGAGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	22											90.0	83.0	85.0					22																	24086469		2203	4300	6503	22416469	SO:0001583	missense	7621			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.859A>G	22.37:g.24086469T>C	ENSP00000339314:p.Lys287Glu	Somatic		Capture	Illumina GAIIx	4	22416469		Missense_Mutation	SNP	ENST00000341976.3	37	CCDS13812.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	18.48	3.633370	0.67015	.	.	ENSG00000187792	ENST00000341976	T	0.07567	3.18	3.34	3.34	0.38264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17280	0.0415	M	0.64170	1.965	0.29756	N	0.83596	D	0.63046	0.992	P	0.53224	0.721	T	0.02743	-1.1116	9	0.72032	D	0.01	-18.9521	10.3795	0.44104	0.0:0.0:0.0:1.0	.	287	Q9UC06	ZNF70_HUMAN	E	287	ENSP00000339314:K287E	ENSP00000339314:K287E	K	-	1	0	ZNF70	22416469	0.991000	0.36638	0.998000	0.56505	0.982000	0.71751	2.235000	0.43044	1.765000	0.52091	0.374000	0.22700	AAA		0.532	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916		Missense_Mutation
STK31	56164	genome.wustl.edu	37	7	23775221	23775221	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:23775221C>G	ENST00000355870.3	+	7	667	c.548C>G	c.(547-549)tCt>tGt	p.S183C	STK31_ENST00000354639.3_Missense_Mutation_p.S160C|STK31_ENST00000433467.2_Missense_Mutation_p.S183C|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000428484.1_Missense_Mutation_p.S160C	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	183						acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)	p.S183C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AAAGCAACCTCTGAAGATGGA	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											123.0	118.0	120.0					7																	23775221		2203	4300	6503	23741746	SO:0001583	missense	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.548C>G	7.37:g.23775221C>G	ENSP00000348132:p.Ser183Cys	Somatic		Capture	Illumina GAIIx	4	23741746	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	14.50	2.554705	0.45487	.	.	ENSG00000196335	ENST00000355870;ENST00000422637;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T;T	0.32023	1.5;1.47;1.5;1.5;1.5	5.25	1.49	0.22878	.	0.585203	0.17607	N	0.168240	T	0.14184	0.0343	N	0.08118	0	0.21325	N	0.999727	B;B	0.10296	0.001;0.003	B;B	0.04013	0.001;0.001	T	0.20338	-1.0278	10	0.36615	T	0.2	-0.9262	7.9993	0.30286	0.5139:0.4114:0.0747:0.0	.	183;183	B4DZ06;Q9BXU1	.;STK31_HUMAN	C	183;139;183;160;160	ENSP00000348132:S183C;ENSP00000414087:S139C;ENSP00000411852:S183C;ENSP00000346660:S160C;ENSP00000406146:S160C	ENSP00000346660:S160C	S	+	2	0	STK31	23741746	0.021000	0.18746	0.992000	0.48379	0.947000	0.59692	0.946000	0.29069	0.065000	0.16485	-0.499000	0.04595	TCT		0.403	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414		Missense_Mutation
HIST1H3A	8350	genome.wustl.edu	37	6	26020777	26020777	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr6:26020777G>T	ENST00000357647.3	+	1	60	c.60G>T	c.(58-60)caG>caT	p.Q20H	HIST1H4A_ENST00000359907.3_5'Flank|HIST1H1A_ENST00000244573.3_5'Flank	NM_003529.2	NP_003520.1	P68431	H31_HUMAN	histone cluster 1, H3a	20					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.Q20H(1)		endometrium(1)|lung(3)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						CACGCAAACAGTTGGCCACTA	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											57.0	58.0	58.0					6																	26020777		2203	4300	6503	26128756	SO:0001583	missense	8350			Z46261	CCDS4570.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000198366	ENSG00000275714		"""Histones / Replication-dependent"""	4766	protein-coding gene	gene with protein product		602810	"""H3 histone family, member A"", ""histone 1, H3a"""	H3FA		9119399, 12408966	Standard	NM_003529		Approved	H3/A	uc003nfp.1	P68431	OTTHUMG00000014418	ENST00000357647.3:c.60G>T	6.37:g.26020777G>T	ENSP00000350275:p.Gln20His	Somatic		Capture	Illumina GAIIx	4	26128756	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000357647.3	37	CCDS4570.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	g	7.439	0.640280	0.14386	.	.	ENSG00000198366	ENST00000357647	T	0.46451	0.87	3.64	2.77	0.32553	Histone-fold (2);	.	.	.	.	T	0.22666	0.0547	L	0.54863	1.705	0.38713	D	0.953273	B	0.02656	0.0	B	0.04013	0.001	T	0.20773	-1.0265	9	0.72032	D	0.01	.	10.8502	0.46765	0.0944:0.0:0.9056:0.0	.	20	P68431	H31_HUMAN	H	20	ENSP00000350275:Q20H	ENSP00000350275:Q20H	Q	+	3	2	HIST1H3A	26128756	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	4.605000	0.61119	1.118000	0.41863	0.650000	0.86243	CAG		0.632	HIST1H3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040080.1	NM_003529		Missense_Mutation
SEC14L3	266629	genome.wustl.edu	37	22	30857550	30857550	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr22:30857550G>C	ENST00000215812.4	-	10	993	c.903C>G	c.(901-903)tgC>tgG	p.C301W	SEC14L3_ENST00000402286.1_Missense_Mutation_p.C224W|SEC14L3_ENST00000401751.1_Missense_Mutation_p.C242W|SEC14L3_ENST00000415957.2_Missense_Mutation_p.C242W|SEC14L3_ENST00000403066.1_Missense_Mutation_p.C242W|SEC14L3_ENST00000539629.1_Missense_Mutation_p.C242W|SEC14L3_ENST00000540910.1_Missense_Mutation_p.C224W	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	301	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.C301W(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	ACCTGAGAACGCAGCCTGGAA	0.587																																					Esophageal Squamous(108;290 1516 3584 23771 37333)											1	Substitution - Missense(1)	ovary(1)	22											82.0	70.0	74.0					22																	30857550		2203	4300	6503	29187550	SO:0001583	missense	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.903C>G	22.37:g.30857550G>C	ENSP00000215812:p.Cys301Trp	Somatic		Capture	Illumina GAIIx	4	29187550	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220349	0.58560	.	.	ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.86	-2.64	0.06114	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.991	T	0.66689	-0.5860	10	0.87932	D	0	-15.9341	13.6576	0.62348	0.4437:0.0:0.5563:0.0	.	224;301	E9PE57;Q9UDX4	.;S14L3_HUMAN	W	242;242;301;224;242;242;224	ENSP00000385941:C242W;ENSP00000401864:C242W;ENSP00000215812:C301W;ENSP00000385004:C224W;ENSP00000383896:C242W;ENSP00000444691:C242W;ENSP00000439752:C224W	ENSP00000215812:C301W	C	-	3	2	SEC14L3	29187550	0.539000	0.26402	0.992000	0.48379	0.886000	0.51366	-0.074000	0.11450	-0.342000	0.08363	-0.946000	0.02672	TGC		0.587	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975		Missense_Mutation
OR12D3	81797	genome.wustl.edu	37	6	29342736	29342736	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr6:29342736G>A	ENST00000396806.3	-	1	332	c.329C>T	c.(328-330)gCc>gTc	p.A110V	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A110V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CAGTAAAATGGCCTCTGTGCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	58.0	57.0					6																	29342736		1511	2709	4220	29450715	SO:0001583	missense	81797				CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.329C>T	6.37:g.29342736G>A	ENSP00000380023:p.Ala110Val	Somatic		Capture	Illumina GAIIx	4	29450715	A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	ENST00000396806.3	37	CCDS4658.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	2.373	-0.343880	0.05208	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.01379	4.96	4.18	1.11	0.20524	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00384	0.0012	N	0.25245	0.725	0.09310	N	1	B	0.24043	0.096	B	0.24974	0.057	T	0.42882	-0.9425	9	0.27082	T	0.32	-2.5023	3.3494	0.07147	0.0866:0.3678:0.2901:0.2556	.	110	Q9UGF7	O12D3_HUMAN	V	110	ENSP00000380023:A110V	ENSP00000366348:A110V	A	-	2	0	OR12D3	29450715	0.000000	0.05858	0.020000	0.16555	0.174000	0.22865	-0.650000	0.05378	0.332000	0.23536	0.195000	0.17529	GCC		0.493	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3			Missense_Mutation
SPOCD1	90853	genome.wustl.edu	37	1	32263869	32263869	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:32263869A>C	ENST00000360482.2	-	9	2213	c.2084T>G	c.(2083-2085)aTg>aGg	p.M695R	SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000257100.3_Missense_Mutation_p.M188R|SPOCD1_ENST00000533231.1_Missense_Mutation_p.M695R	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	695	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.M695R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CATCGAGCTCATCCGCACCAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	72.0	69.0					1																	32263869		2203	4300	6503	32036456	SO:0001583	missense	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.2084T>G	1.37:g.32263869A>C	ENSP00000353670:p.Met695Arg	Somatic		Capture	Illumina GAIIx	4	32036456	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	SNP	8	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.74|16.74	3.207634|3.207634	0.58343|0.58343	.|.	.|.	ENSG00000134668|ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000294514;ENST00000452755;ENST00000533231;ENST00000449266|ENST00000528579	T;T;T;T|.	0.56275|.	0.47;0.47;0.47;0.47|.	5.08|5.08	3.87|3.87	0.44632|0.44632	Transcription elongation factor S-II, central domain (4);|.	.|.	.|.	.|.	.|.	T|.	0.80391|.	0.4614|.	H|H	0.94306|0.94306	3.52|3.52	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.982;0.998;0.996;0.999|.	P;D;D;D|.	0.77557|.	0.761;0.983;0.978;0.99|.	T|.	0.83339|.	-0.0009|.	9|.	0.72032|.	D|.	0.01|.	-26.2474|-26.2474	7.7184|7.7184	0.28719|0.28719	0.8131:0.0:0.0:0.1869|0.8131:0.0:0.0:0.1869	.|.	39;695;132;695|.	Q6ZMY3-4;Q6ZMY3-2;E9PPM7;Q6ZMY3|.	.;.;.;SPOC1_HUMAN|.	R|G	188;695;93;132;695;80|111	ENSP00000257100:M188R;ENSP00000353670:M695R;ENSP00000399778:M132R;ENSP00000435851:M695R|.	ENSP00000257100:M188R|.	M|X	-|-	2|1	0|0	SPOCD1|SPOCD1	32036456|32036456	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.496000|0.496000	0.33645|0.33645	3.915000|3.915000	0.56409|0.56409	2.041000|2.041000	0.60428|0.60428	0.528000|0.528000	0.53228|0.53228	ATG|TGA		0.632	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569		Missense_Mutation
TOPORS	10210	genome.wustl.edu	37	9	32544141	32544141	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr9:32544141C>T	ENST00000360538.2	-	3	498	c.382G>A	c.(382-384)Gta>Ata	p.V128I	TOPORS_ENST00000379858.1_Missense_Mutation_p.V63I	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	128	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V128I(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CACTCCTGTACACAGCGAAAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	9											136.0	126.0	129.0					9																	32544141		2203	4300	6503	32534141	SO:0001583	missense	10210			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.382G>A	9.37:g.32544141C>T	ENSP00000353735:p.Val128Ile	Somatic		Capture	Illumina GAIIx	4	32534141	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440474	0.25900	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.60171	0.21;0.21	5.33	5.33	0.75918	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.43260	D	0.000600	T	0.23572	0.0570	N	0.01618	-0.8	0.36245	D	0.853547	B	0.20550	0.046	B	0.20767	0.031	T	0.38243	-0.9670	10	0.02654	T	1	-10.3232	8.575	0.33592	0.0:0.8351:0.0:0.1649	.	128	Q9NS56	TOPRS_HUMAN	I	128;63	ENSP00000353735:V128I;ENSP00000369187:V63I	ENSP00000353735:V128I	V	-	1	0	TOPORS	32534141	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	2.972000	0.49256	2.656000	0.90262	0.655000	0.94253	GTA		0.398	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802		Missense_Mutation
GSS	2937	genome.wustl.edu	37	20	33533841	33533841	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr20:33533841G>C	ENST00000216951.2	-	3	288	c.190C>G	c.(190-192)Caa>Gaa	p.Q64E	GSS_ENST00000541098.1_5'UTR|GSS_ENST00000451957.2_Missense_Mutation_p.Q64E	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	64					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.Q64E(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	GCATAGGCTTGCTCCAGCAGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											134.0	118.0	123.0					20																	33533841		2203	4300	6503	32997502	SO:0001583	missense	2937				CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.190C>G	20.37:g.33533841G>C	ENSP00000216951:p.Gln64Glu	Somatic		Capture	Illumina GAIIx	4	32997502	B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	ENST00000216951.2	37	CCDS13245.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	24.9	4.583242	0.86748	.	.	ENSG00000100983	ENST00000216951;ENST00000451957	D;D	0.90133	-2.62;-2.62	6.07	5.13	0.70059	Glutathione synthase, N-terminal, eukaryotic (1);	0.000000	0.85682	D	0.000000	D	0.92378	0.7581	L	0.50847	1.595	0.80722	D	1	D;D	0.67145	0.996;0.986	P;P	0.60012	0.867;0.669	D	0.91926	0.5551	10	0.42905	T	0.14	-3.5583	14.3146	0.66440	0.0719:0.0:0.9281:0.0	.	64;64	B6F210;P48637	.;GSHB_HUMAN	E	64	ENSP00000216951:Q64E;ENSP00000407517:Q64E	ENSP00000216951:Q64E	Q	-	1	0	GSS	32997502	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.381000	0.97205	1.583000	0.49898	0.655000	0.94253	CAA		0.567	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2			Missense_Mutation
CACNB1	782	genome.wustl.edu	37	17	37339981	37339981	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr17:37339981C>G	ENST00000394303.3	-	11	1242	c.1035G>C	c.(1033-1035)aaG>aaC	p.K345N	CACNB1_ENST00000344140.5_Missense_Mutation_p.K390N|CACNB1_ENST00000582877.1_5'Flank|CACNB1_ENST00000394310.3_Missense_Mutation_p.K345N	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	345					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.K390N(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAGGTGATCTTGATGTAAA	0.567																																					Esophageal Squamous(5;100 366 38393 41452 45827)											1	Substitution - Missense(1)	ovary(1)	17											40.0	33.0	35.0					17																	37339981		2203	4299	6502	34593507	SO:0001583	missense	782				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1035G>C	17.37:g.37339981C>G	ENSP00000377840:p.Lys345Asn	Somatic		Capture	Illumina GAIIx	4	34593507	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	ENST00000394303.3	37	CCDS42311.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699730	0.68501	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	T;T;T	0.50548	0.74;0.74;0.74	5.35	2.29	0.28610	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.000000	0.85682	D	0.000000	T	0.70824	0.3268	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.991;0.999	T	0.73642	-0.3918	10	0.87932	D	0	-26.1551	9.2626	0.37621	0.0:0.7587:0.0:0.2413	.	390;345;345	Q02641-2;Q02641-3;Q02641	.;.;CACB1_HUMAN	N	295;345;390;345;296	ENSP00000377840:K345N;ENSP00000345461:K390N;ENSP00000377847:K345N	ENSP00000345461:K390N	K	-	3	2	CACNB1	34593507	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.281000	0.33214	0.644000	0.30656	0.491000	0.48974	AAG		0.567	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3			Missense_Mutation
CA9	768	genome.wustl.edu	37	9	35674151	35674151	+	Silent	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr9:35674151G>A	ENST00000378357.4	+	1	299	c.195G>A	c.(193-195)ctG>ctA	p.L65L	RN7SL22P_ENST00000471800.2_RNA	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	65	Proteoglycan-like (PG).				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.L65L(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AGGAGGATCTGCCCAGTGAAG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	9											56.0	54.0	55.0					9																	35674151		2203	4300	6503	35664151	SO:0001819	synonymous_variant	768			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.195G>A	9.37:g.35674151G>A		Somatic		Capture	Illumina GAIIx	4	35664151	Q5T4R1	Silent	SNP	ENST00000378357.4	37	CCDS6585.1	SNP	46	WashU																																																																																				0.592	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216		Silent
MELK	9833	genome.wustl.edu	37	9	36651858	36651858	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr9:36651858C>T	ENST00000298048.2	+	12	1221	c.1037C>T	c.(1036-1038)cCa>cTa	p.P346L	MELK_ENST00000543751.1_Missense_Mutation_p.P314L|MELK_ENST00000545008.1_Missense_Mutation_p.P275L|MELK_ENST00000541717.1_Missense_Mutation_p.P346L|MELK_ENST00000536329.1_Missense_Mutation_p.P275L|MELK_ENST00000538311.1_Missense_Mutation_p.P152L|MELK_ENST00000536987.1_Missense_Mutation_p.P215L|MELK_ENST00000536860.1_Missense_Mutation_p.P298L	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	346	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)	p.P346L(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			AGTGCTACCCCATTCACAGAC	0.502																																					Ovarian(82;980 1317 7225 14391 18624)											1	Substitution - Missense(1)	ovary(1)	9											207.0	190.0	196.0					9																	36651858		2203	4300	6503	36641858	SO:0001583	missense	9833			D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1037C>T	9.37:g.36651858C>T	ENSP00000298048:p.Pro346Leu	Somatic		Capture	Illumina GAIIx	4	36641858	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	37	CCDS6606.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367827	0.61513	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.70631	-0.31;0.66;0.46;0.99;0.36;-0.5;-0.28;-0.32	5.63	5.63	0.86233	.	0.319446	0.35349	N	0.003267	T	0.68559	0.3014	L	0.59436	1.845	0.23598	N	0.997321	B;B;B;B;B;B;B	0.16802	0.011;0.006;0.001;0.0;0.019;0.005;0.0	B;B;B;B;B;B;B	0.17979	0.016;0.01;0.005;0.003;0.02;0.012;0.001	T	0.62992	-0.6736	10	0.66056	D	0.02	-6.1185	15.2097	0.73209	0.0:1.0:0.0:0.0	.	266;275;298;346;275;314;346	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	L	346;152;215;275;298;275;346;314	ENSP00000298048:P346L;ENSP00000438226:P152L;ENSP00000439184:P215L;ENSP00000445452:P275L;ENSP00000439792:P298L;ENSP00000443550:P275L;ENSP00000437804:P346L;ENSP00000441596:P314L	ENSP00000298048:P346L	P	+	2	0	MELK	36641858	0.005000	0.15991	0.090000	0.20809	0.722000	0.41435	1.265000	0.33027	2.652000	0.90054	0.655000	0.94253	CCA		0.502	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791		Missense_Mutation
HLCS	3141	genome.wustl.edu	37	21	38309497	38309497	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr21:38309497C>T	ENST00000399120.1	-	5	1478	c.248G>A	c.(247-249)aGt>aAt	p.S83N	HLCS_ENST00000336648.4_Missense_Mutation_p.S83N	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	83					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)	p.S83N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	AGCAGGCTCACTCCCAGAGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	21											83.0	73.0	76.0					21																	38309497		2203	4300	6503	37231367	SO:0001583	missense	3141				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.248G>A	21.37:g.38309497C>T	ENSP00000382071:p.Ser83Asn	Somatic		Capture	Illumina GAIIx	4	37231367	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	37	CCDS13647.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587011	0.66105	.	.	ENSG00000159267	ENST00000399120;ENST00000336648;ENST00000448340;ENST00000419461	D;D	0.98150	-4.75;-4.75	5.42	-0.234	0.13074	.	1.199850	0.05389	N	0.538611	D	0.95050	0.8397	L	0.48642	1.525	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	D	0.86627	0.1883	10	0.34782	T	0.22	.	6.7132	0.23288	0.0:0.5044:0.1264:0.3692	.	83;83	B2RAH1;P50747	.;BPL1_HUMAN	N	83	ENSP00000382071:S83N;ENSP00000338387:S83N	ENSP00000338387:S83N	S	-	2	0	HLCS	37231367	0.000000	0.05858	0.000000	0.03702	0.996000	0.88848	0.258000	0.18387	0.016000	0.14998	0.655000	0.94253	AGT		0.557	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2			Missense_Mutation
C15orf57	90416	genome.wustl.edu	37	15	40855010	40855010	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr15:40855010C>G	ENST00000358005.3	-	2	478	c.205G>C	c.(205-207)Gct>Cct	p.A69P	C15orf57_ENST00000558113.1_Missense_Mutation_p.A69P|C15orf57_ENST00000416810.2_Missense_Mutation_p.A69P|C15orf57_ENST00000559911.1_Missense_Mutation_p.A69P|C15orf57_ENST00000560305.1_Missense_Mutation_p.A69P|C15orf57_ENST00000558871.1_Missense_Mutation_p.A69P|C15orf57_ENST00000561011.1_Missense_Mutation_p.A69P|C15orf57_ENST00000560109.1_5'UTR|C15orf57_ENST00000558750.1_Missense_Mutation_p.A78P	NM_001080791.1|NM_052849.2	NP_001074260.1|NP_443081.1	Q9BV29	CO057_HUMAN	chromosome 15 open reading frame 57	69								p.A69P(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	9						TGCAAGGGAGCCCAAGGCTTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	15											141.0	144.0	143.0					15																	40855010		2203	4300	6503	38642302	SO:0001583	missense	90416			BC012189	CCDS10060.1, CCDS42022.1, CCDS73706.1	15q15.1	2008-05-30	2008-05-30	2008-05-30	ENSG00000128891	ENSG00000128891			28295	protein-coding gene	gene with protein product			"""coiled-coil domain containing 32"""	CCDC32		12477932	Standard	NM_001080791		Approved	MGC20481	uc001zma.1	Q9BV29	OTTHUMG00000129993	ENST00000358005.3:c.205G>C	15.37:g.40855010C>G	ENSP00000350695:p.Ala69Pro	Somatic		Capture	Illumina GAIIx	4	38642302	A8KAL4|Q86TC4|Q8N788|Q8NAR7	Missense_Mutation	SNP	ENST00000358005.3	37	CCDS10060.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023560	0.75390	.	.	ENSG00000128891	ENST00000358005;ENST00000416810	T	0.48836	0.8	4.75	4.75	0.60458	.	0.364915	0.28946	N	0.013628	T	0.64360	0.2591	L	0.53249	1.67	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72075	0.976;0.976;0.976	T	0.63233	-0.6683	10	0.39692	T	0.17	-9.0374	18.1225	0.89576	0.0:1.0:0.0:0.0	.	69;78;69	Q9BV29;Q9BV29-2;Q9BV29-3	CO057_HUMAN;.;.	P	69;78	ENSP00000350695:A69P	ENSP00000350695:A69P	A	-	1	0	C15orf57	38642302	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	4.416000	0.59815	2.322000	0.78497	0.555000	0.69702	GCT		0.473	C15orf57-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252259.2	NM_052849		Missense_Mutation
CHD6	84181	genome.wustl.edu	37	20	40074317	40074317	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr20:40074317C>T	ENST00000373233.3	-	25	4042	c.3865G>A	c.(3865-3867)Gtg>Atg	p.V1289M	CHD6_ENST00000309279.7_Missense_Mutation_p.V772M	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1289					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.V1289M(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGCTTGAACACGCCAATGAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	20											130.0	107.0	115.0					20																	40074317		2203	4300	6503	39507731	SO:0001583	missense	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.3865G>A	20.37:g.40074317C>T	ENSP00000362330:p.Val1289Met	Somatic		Capture	Illumina GAIIx	4	39507731	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	33	5.225817	0.95173	.	.	ENSG00000124177	ENST00000373233;ENST00000309279	D;D	0.90324	-2.65;-2.65	5.91	5.91	0.95273	.	0.000000	0.52532	D	0.000080	D	0.95793	0.8631	M	0.81341	2.54	0.41241	D	0.986648	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.968	D	0.95640	0.8697	10	0.72032	D	0.01	-18.5735	20.2985	0.98592	0.0:1.0:0.0:0.0	.	772;1289	C9JFU2;Q8TD26	.;CHD6_HUMAN	M	1289;772	ENSP00000362330:V1289M;ENSP00000308684:V772M	ENSP00000308684:V772M	V	-	1	0	CHD6	39507731	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.776000	0.85560	2.793000	0.96121	0.655000	0.94253	GTG		0.522	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1			Missense_Mutation
LSR	51599	genome.wustl.edu	37	19	35753487	35753487	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:35753487C>G	ENST00000361790.3	+	5	973	c.814C>G	c.(814-816)Ctc>Gtc	p.L272V	LSR_ENST00000602122.1_Missense_Mutation_p.L253V|LSR_ENST00000347609.4_Missense_Mutation_p.L235V|LSR_ENST00000427250.1_Intron|AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000597933.1_3'UTR|LSR_ENST00000360798.3_Intron|LSR_ENST00000354900.3_Missense_Mutation_p.L253V	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	272					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGCTGCCTTCCTCATCTTCCT	0.632																																																0			19											151.0	120.0	130.0					19																	35753487		2203	4300	6503	40445327	SO:0001583	missense	51599			AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.814C>G	19.37:g.35753487C>G	ENSP00000354575:p.Leu272Val	Somatic		Capture	Illumina GAIIx	4	40445327	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	37	CCDS12450.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812402	0.50527	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000347609	T;T;T	0.56103	0.48;0.48;0.48	4.74	3.65	0.41850	LISCH7 (1);	0.192621	0.34628	N	0.003803	T	0.65144	0.2663	L	0.58101	1.795	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;0.996;0.995	D;P;P;D	0.83275	0.996;0.814;0.883;0.942	T	0.67015	-0.5777	10	0.87932	D	0	-28.297	9.7116	0.40249	0.0:0.8893:0.0:0.1107	.	235;253;253;272	Q86X29-2;Q86X29-3;E9PHD4;Q86X29	.;.;.;LSR_HUMAN	V	272;253;235	ENSP00000354575:L272V;ENSP00000346976:L253V;ENSP00000262627:L235V	ENSP00000262627:L235V	L	+	1	0	LSR	40445327	0.992000	0.36948	0.947000	0.38551	0.623000	0.37688	1.537000	0.36083	2.448000	0.82819	0.591000	0.81541	CTC		0.632	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925		Missense_Mutation
SPATA31A3	727830	genome.wustl.edu	37	9	40704394	40704394	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr9:40704394G>A	ENST00000356699.5	+	4	2080	c.2051G>A	c.(2050-2052)aGg>aAg	p.R684K	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	684					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R684K(1)									AATCTATCCAGGGATATGAAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											1.0	1.0	1.0					9																	40704394		55	104	159	40694394	SO:0001583	missense	727830					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.2051G>A	9.37:g.40704394G>A	ENSP00000349132:p.Arg684Lys	Somatic		Capture	Illumina GAIIx	4	40694394		Missense_Mutation	SNP	ENST00000356699.5	37	CCDS47969.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085028	0.36758	.	.	ENSG00000147926	ENST00000356699	T	0.07800	3.16	2.23	-1.47	0.08772	.	0.528659	0.17535	N	0.170753	T	0.07413	0.0187	L	0.43152	1.355	0.09310	N	1	D	0.62365	0.991	P	0.50405	0.64	T	0.27773	-1.0064	10	0.13853	T	0.58	-8.316	2.2205	0.03971	0.3542:0.0:0.4046:0.2412	.	684	Q5VYP0	F75A3_HUMAN	K	684	ENSP00000349132:R684K	ENSP00000349132:R684K	R	+	2	0	FAM75A3	40694394	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.077000	0.14738	-0.346000	0.08312	0.398000	0.26397	AGG		0.522	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124		Missense_Mutation
ZNF585A	199704	genome.wustl.edu	37	19	37643247	37643247	+	Silent	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:37643247C>T	ENST00000356958.4	-	5	1812	c.1554G>A	c.(1552-1554)ggG>ggA	p.G518G	ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Silent_p.G463G|ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000292841.5_Silent_p.G463G			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G463G(1)		breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGGCTTCTCCCCAGTATGGA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	19											59.0	60.0	60.0					19																	37643247		2203	4300	6503	42335087	SO:0001819	synonymous_variant	199704			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1554G>A	19.37:g.37643247C>T		Somatic		Capture	Illumina GAIIx	4	42335087	Q8TE95|Q96MV3	Silent	SNP	ENST00000356958.4	37		SNP	22	WashU																																																																																				0.398	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655		Silent
SLC20A2	6575	genome.wustl.edu	37	8	42329816	42329816	+	Silent	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr8:42329816G>A	ENST00000342228.3	-	2	462	c.93C>T	c.(91-93)aaC>aaT	p.N31N	SLC20A2_ENST00000520179.1_Silent_p.N31N|SLC20A2_ENST00000520262.1_Silent_p.N31N	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	31					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)	p.N31N(1)		breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TACCAAAGGAGTTGGCAACAT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	8											134.0	119.0	124.0					8																	42329816		2203	4300	6503	42448973	SO:0001819	synonymous_variant	6575				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.93C>T	8.37:g.42329816G>A		Somatic		Capture	Illumina GAIIx	4	42448973		Silent	SNP	ENST00000342228.3	37	CCDS6132.1	SNP	36	WashU																																																																																				0.473	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1			Silent
FBLN1	2192	genome.wustl.edu	37	22	45914631	45914631	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr22:45914631G>A	ENST00000327858.6	+	2	244	c.149G>A	c.(148-150)tGc>tAc	p.C50Y	FBLN1_ENST00000262722.7_Missense_Mutation_p.C50Y|FBLN1_ENST00000340923.5_Missense_Mutation_p.C50Y|FBLN1_ENST00000442170.2_Missense_Mutation_p.C50Y|FBLN1_ENST00000348697.2_Missense_Mutation_p.C50Y|FBLN1_ENST00000402984.3_Missense_Mutation_p.C50Y	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	50	Anaphylatoxin-like 1. {ECO:0000255|PROSITE-ProRule:PRU00022}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)	p.C50Y(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CAGAAGGACTGCTCGCTGCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	22											89.0	70.0	76.0					22																	45914631		2203	4300	6503	44293295	SO:0001583	missense	2192				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.149G>A	22.37:g.45914631G>A	ENSP00000331544:p.Cys50Tyr	Somatic		Capture	Illumina GAIIx	4	44293295	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	20.3	3.969686	0.74246	.	.	ENSG00000077942	ENST00000411478;ENST00000445110;ENST00000455233;ENST00000348697;ENST00000402984;ENST00000262722;ENST00000327858;ENST00000442170;ENST00000340923;ENST00000439835;ENST00000450975;ENST00000454279	D;D;D;D;D;D;D;D;T	0.96265	-3.96;-3.96;-3.96;-3.62;-3.96;-3.96;-3.96;-3.96;0.51	4.64	4.64	0.57946	Anaphylatoxin/fibulin (4);	0.000000	0.85682	D	0.000000	D	0.96636	0.8902	L	0.36672	1.1	0.54753	D	0.99998	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.97110	0.997;0.998;1.0;0.999	D	0.97151	0.9831	10	0.87932	D	0	.	14.529	0.67912	0.0:0.0:1.0:0.0	.	50;50;50;50	B1AHL2;P23142;B1AHL4;P23142-4	.;FBLN1_HUMAN;.;.	Y	58;8;50;50;50;50;50;50;50;8;59;8	ENSP00000415289:C58Y;ENSP00000402963:C50Y;ENSP00000262723:C50Y;ENSP00000385521:C50Y;ENSP00000262722:C50Y;ENSP00000331544:C50Y;ENSP00000393812:C50Y;ENSP00000342212:C50Y;ENSP00000414584:C8Y	ENSP00000262722:C50Y	C	+	2	0	FBLN1	44293295	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	4.870000	0.63035	2.414000	0.81942	0.655000	0.94253	TGC		0.552	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486		Missense_Mutation
ARID2	196528	genome.wustl.edu	37	12	46245402	46245402	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:46245402G>C	ENST00000334344.6	+	15	3668	c.3496G>C	c.(3496-3498)Ggg>Cgg	p.G1166R	ARID2_ENST00000422737.1_Missense_Mutation_p.G1017R|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Missense_Mutation_p.G776R|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1166					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1166R(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CATTTTCCAAGGGACTTCTGG	0.483			"""N, S, F"""		hepatocellular carcinoma																																		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	1	Substitution - Missense(1)	ovary(1)	12											94.0	92.0	93.0					12																	46245402		2203	4300	6503	44531669	SO:0001583	missense	196528				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3496G>C	12.37:g.46245402G>C	ENSP00000335044:p.Gly1166Arg	Somatic		Capture	Illumina GAIIx	4	44531669	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036907	0.54896	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.39997	1.05	6.04	6.04	0.98038	.	0.092960	0.85682	D	0.000000	T	0.45054	0.1323	L	0.27053	0.805	0.80722	D	1	P;D;P	0.56521	0.865;0.976;0.787	B;P;B	0.50049	0.391;0.629;0.219	T	0.38308	-0.9667	10	0.66056	D	0.02	-5.9648	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1166;776;1166	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	R	1166;283;283;1017;776	ENSP00000335044:G1166R	ENSP00000335044:G1166R	G	+	1	0	ARID2	44531669	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.290000	0.78711	2.873000	0.98535	0.563000	0.77884	GGG		0.483	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875		Missense_Mutation
B4GALNT2	124872	genome.wustl.edu	37	17	47246987	47246987	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr17:47246987C>A	ENST00000300404.2	+	11	1657	c.1598C>A	c.(1597-1599)gCc>gAc	p.A533D	B4GALNT2_ENST00000393354.2_Missense_Mutation_p.A473D|RP11-708H21.4_ENST00000575159.1_lincRNA|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.A447D	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	533					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)	p.A533D(1)		endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GAACTGGCTGCCCTAGAGAAG	0.542																																					GBM(124;244 1635 8663 18097 33175)											1	Substitution - Missense(1)	ovary(1)	17											96.0	87.0	90.0					17																	47246987		2203	4300	6503	44601986	SO:0001583	missense	124872			AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1598C>A	17.37:g.47246987C>A	ENSP00000300404:p.Ala533Asp	Somatic		Capture	Illumina GAIIx	4	44601986	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	CCDS11544.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	7.912	0.736759	0.15574	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.25414	1.8;1.8;1.8	5.25	2.13	0.27403	.	0.982677	0.08312	N	0.965219	T	0.13884	0.0336	N	0.24115	0.695	0.09310	N	1	P;P	0.35348	0.496;0.454	B;B	0.31191	0.125;0.115	T	0.26744	-1.0094	10	0.19590	T	0.45	-2.1974	4.8938	0.13740	0.4033:0.4361:0.0:0.1606	.	473;533	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	D	447;473;533	ENSP00000425510:A447D;ENSP00000377022:A473D;ENSP00000300404:A533D	ENSP00000300404:A533D	A	+	2	0	B4GALNT2	44601986	0.000000	0.05858	0.052000	0.19188	0.072000	0.16883	0.484000	0.22308	0.206000	0.20587	-0.314000	0.08810	GCC		0.542	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446		Missense_Mutation
TRMU	55687	genome.wustl.edu	37	22	46742395	46742395	+	Silent	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr22:46742395T>G	ENST00000290846.4	+	4	772	c.432T>G	c.(430-432)gtT>gtG	p.V144V	TRMU_ENST00000381019.3_Silent_p.V144V|TRMU_ENST00000424260.2_Silent_p.V109V	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	144					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)	p.V144V(1)		NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		AGAAGCACGTTAAGAAGCCCG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	22											80.0	83.0	82.0					22																	46742395		2203	4300	6503	45121059	SO:0001819	synonymous_variant	55687			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.432T>G	22.37:g.46742395T>G		Somatic		Capture	Illumina GAIIx	4	45121059	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Silent	SNP	ENST00000290846.4	37	CCDS14075.1	SNP	61	WashU																																																																																				0.443	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006		Silent
ATP5S	27109	genome.wustl.edu	37	14	50792435	50792435	+	Silent	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr14:50792435G>A	ENST00000311459.7	+	5	1022	c.642G>A	c.(640-642)ttG>ttA	p.L214L	ATP5S_ENST00000554438.1_3'UTR|ATP5S_ENST00000358473.1_Intron|RP11-247L20.4_ENST00000555403.1_lincRNA|ATP5S_ENST00000245448.6_3'UTR	NM_001003803.2	NP_001003803.1	Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)	214					ATP biosynthetic process (GO:0006754)|hydrogen ion transmembrane transport (GO:1902600)|proton transport (GO:0015992)	mitochondrial inner membrane (GO:0005743)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|metal ion binding (GO:0046872)	p.L214L(1)		breast(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	12	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		AATTACAATTGAAGTAAAATA	0.299																																																1	Substitution - coding silent(1)	ovary(1)	14											78.0	85.0	83.0					14																	50792435		2203	4299	6502	49862185	SO:0001819	synonymous_variant	27109			U79253	CCDS32075.1, CCDS32076.1, CCDS45102.1	14q21.3	2011-04-13	2010-06-11			ENSG00000125375			18799	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)"""			11744738, 8619474	Standard	NM_015684		Approved	HSU79253, ATPW	uc001wxw.2	Q99766		ENST00000311459.7:c.642G>A	14.37:g.50792435G>A		Somatic		Capture	Illumina GAIIx	4	49862185	A8K1U3|D9N156|Q8WWX3|Q96F77	Silent	SNP	ENST00000311459.7	37	CCDS32075.1	SNP	45	WashU																																																																																				0.299	ATP5S-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410761.1	NM_015684		Silent
ATP5S	27109	genome.wustl.edu	37	14	50798898	50798898	+	Silent	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr14:50798898G>T	ENST00000358473.1	+	5	645	c.645G>T	c.(643-645)ctG>ctT	p.L215L	CDKL1_ENST00000395834.1_Intron|CDKL1_ENST00000216378.2_3'UTR			Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)	0					ATP biosynthetic process (GO:0006754)|hydrogen ion transmembrane transport (GO:1902600)|proton transport (GO:0015992)	mitochondrial inner membrane (GO:0005743)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	12	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		TGCTGGAGCTGAAAGCCACAA	0.493																																																0			14																																								49868648	SO:0001819	synonymous_variant	27109			U79253	CCDS32075.1, CCDS32076.1, CCDS45102.1	14q21.3	2011-04-13	2010-06-11			ENSG00000125375			18799	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)"""			11744738, 8619474	Standard	NM_015684		Approved	HSU79253, ATPW	uc001wxw.2	Q99766		ENST00000358473.1:c.645G>T	14.37:g.50798898G>T		Somatic		Capture	Illumina GAIIx	4	49868648	A8K1U3|D9N156|Q8WWX3|Q96F77	Silent	SNP	ENST00000358473.1	37		SNP	45	WashU																																																																																				0.493	ATP5S-011	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000410765.1	NM_015684		Silent
MYO5C	55930	genome.wustl.edu	37	15	52571808	52571808	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr15:52571808C>T	ENST00000261839.7	-	3	363	c.202G>A	c.(202-204)Ggc>Agc	p.G68S	MYO5C_ENST00000443683.2_5'UTR|MYO5C_ENST00000541028.1_5'UTR|MIR1266_ENST00000408125.1_RNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	68	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.G68S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCATTCTCGCCCACGAGGATG	0.473																																																1	Substitution - Missense(1)	ovary(1)	15											64.0	63.0	63.0					15																	52571808		1901	4125	6026	50359100	SO:0001583	missense	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.202G>A	15.37:g.52571808C>T	ENSP00000261839:p.Gly68Ser	Somatic		Capture	Illumina GAIIx	4	50359100	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.550233	0.96501	.	.	ENSG00000128833	ENST00000261839;ENST00000541028	D	0.95656	-3.77	5.88	5.88	0.94601	Myosin head, motor domain (1);	0.000000	0.85682	D	0.000000	D	0.98143	0.9387	M	0.88105	2.93	0.80722	D	1	D;P	0.57257	0.979;0.853	D;P	0.71656	0.974;0.573	D	0.98290	1.0513	10	0.66056	D	0.02	.	20.2366	0.98359	0.0:1.0:0.0:0.0	.	31;68	F5H231;Q9NQX4	.;MYO5C_HUMAN	S	68;31	ENSP00000261839:G68S	ENSP00000261839:G68S	G	-	1	0	MYO5C	50359100	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.792000	0.96026	0.557000	0.71058	GGC		0.473	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728		Missense_Mutation
RAD54L2	23132	genome.wustl.edu	37	3	51673615	51673615	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr3:51673615A>C	ENST00000409535.2	+	12	2166	c.2041A>C	c.(2041-2043)Agc>Cgc	p.S681R	RAD54L2_ENST00000296477.3_Missense_Mutation_p.S375R	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	681						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.S681R(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GGCAACCAATAGCAAGTTCCT	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	67.0	71.0					3																	51673615		2203	4300	6503	51648655	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.2041A>C	3.37:g.51673615A>C	ENSP00000386520:p.Ser681Arg	Somatic		Capture	Illumina GAIIx	4	51648655	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	SNP	15	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.27|15.27	2.783180|2.783180	0.49891|0.49891	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	D;D|.	0.93763|.	-3.2;-3.28|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.184267|.	0.56097|.	D|.	0.000029|.	T|.	0.55369|.	0.1916|.	L|L	0.29908|0.29908	0.895|0.895	0.42341|0.42341	D|D	0.992338|0.992338	B;B|.	0.27351|.	0.031;0.176|.	B;B|.	0.17098|.	0.01;0.017|.	T|.	0.52983|.	-0.8502|.	10|.	0.37606|.	T|.	0.19|.	-17.8699|-17.8699	15.2779|15.2779	0.73756|0.73756	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	681;272|.	Q9Y4B4;B3KV54|.	ARIP4_HUMAN;.|.	R|S	681;375|509	ENSP00000386520:S681R;ENSP00000296477:S375R|.	ENSP00000296477:S375R|.	S|X	+|+	1|2	0|0	RAD54L2|RAD54L2	51648655|51648655	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.990000|0.990000	0.78478|0.78478	3.825000|3.825000	0.55730|0.55730	2.195000|2.195000	0.70347|0.70347	0.533000|0.533000	0.62120|0.62120	AGC|TAG		0.537	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106		Missense_Mutation
THSD1	55901	genome.wustl.edu	37	13	52972015	52972015	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr13:52972015C>A	ENST00000258613.4	-	3	551	c.373G>T	c.(373-375)Gtg>Ttg	p.V125L	THSD1_ENST00000544466.1_Intron|RNY4P24_ENST00000362735.1_RNA|THSD1_ENST00000349258.4_Missense_Mutation_p.V125L	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	125			V -> G (in dbSNP:rs13313279).		hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.V125L(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GGCCATTCCACCTTCAGAAAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											141.0	129.0	133.0					13																	52972015		2203	4300	6503	51870016	SO:0001583	missense	55901			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.373G>T	13.37:g.52972015C>A	ENSP00000258613:p.Val125Leu	Somatic		Capture	Illumina GAIIx	4	51870016	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	37	CCDS9432.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121067	0.56613	.	.	ENSG00000136114	ENST00000349258;ENST00000258613;ENST00000378095	T;T	0.26067	1.76;1.76	5.39	4.54	0.55810	.	0.068770	0.56097	D	0.000022	T	0.33177	0.0854	M	0.74881	2.28	0.80722	D	1	B;B	0.20052	0.005;0.041	B;B	0.19391	0.016;0.025	T	0.17289	-1.0374	10	0.62326	D	0.03	-11.3844	15.3501	0.74376	0.0:0.8603:0.1397:0.0	.	125;125	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	L	125	ENSP00000340650:V125L;ENSP00000258613:V125L	ENSP00000258613:V125L	V	-	1	0	THSD1	51870016	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.881000	0.63114	1.257000	0.44085	0.561000	0.74099	GTG		0.507	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3			Missense_Mutation
RDH5	5959	genome.wustl.edu	37	12	56117746	56117746	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:56117746G>A	ENST00000257895.5	+	4	798	c.646G>A	c.(646-648)Gag>Aag	p.E216K	RDH5_ENST00000547072.1_Missense_Mutation_p.E119K|RP11-644F5.10_ENST00000550412.1_3'UTR|RDH5_ENST00000548082.1_Missense_Mutation_p.E216K	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	216					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)	p.E216K(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	GACCAACCTGGAGAGTCTGGA	0.607																																																1	Substitution - Missense(1)	ovary(1)	12											57.0	55.0	55.0					12																	56117746		2203	4300	6503	54404013	SO:0001583	missense	5959			U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.646G>A	12.37:g.56117746G>A	ENSP00000257895:p.Glu216Lys	Somatic		Capture	Illumina GAIIx	4	54404013	O00179|Q8TAI2	Missense_Mutation	SNP	ENST00000257895.5	37	CCDS31829.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288185	0.23478	.	.	ENSG00000135437	ENST00000547072;ENST00000257895;ENST00000548082	D;D;D	0.92965	-3.14;-3.14;-3.14	5.05	2.05	0.26809	NAD(P)-binding domain (1);	0.455814	0.25729	N	0.028689	D	0.87712	0.6246	M	0.64080	1.96	0.37796	D	0.927546	B	0.06786	0.001	B	0.09377	0.004	T	0.81095	-0.1088	10	0.30078	T	0.28	.	6.5752	0.22562	0.1713:0.1491:0.6796:0.0	.	216	Q92781	RDH1_HUMAN	K	119;216;216	ENSP00000449927:E119K;ENSP00000257895:E216K;ENSP00000447128:E216K	ENSP00000257895:E216K	E	+	1	0	RDH5	54404013	0.894000	0.30519	0.983000	0.44433	0.531000	0.34715	3.088000	0.50175	0.669000	0.31146	0.462000	0.41574	GAG		0.607	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407493.1	NM_002905		Missense_Mutation
ATP5B	506	genome.wustl.edu	37	12	57038968	57038968	+	Silent	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:57038968C>G	ENST00000262030.3	-	2	347	c.297G>C	c.(295-297)gtG>gtC	p.V99V	ATP5B_ENST00000550162.1_5'Flank|ATP5B_ENST00000552919.1_Silent_p.V99V|SNORD59A_ENST00000384304.1_RNA	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	99					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)	p.V99V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AATGCTGGGCCACCTCCAAAA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	12											87.0	90.0	89.0					12																	57038968		2203	4300	6503	55325235	SO:0001819	synonymous_variant	506			M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.297G>C	12.37:g.57038968C>G		Somatic		Capture	Illumina GAIIx	4	55325235	A8K4X0|Q14283	Silent	SNP	ENST00000262030.3	37	CCDS8924.1	SNP	21	WashU																																																																																				0.473	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686		Silent
CCDC85A	114800	genome.wustl.edu	37	2	56419726	56419726	+	Missense_Mutation	SNP	C	C	T	rs541266691		TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:56419726C>T	ENST00000407595.2	+	2	893	c.391C>T	c.(391-393)Cgc>Tgc	p.R131C	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	131								p.R131C(1)		breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAGACTGGGTCGCTACACTGC	0.557													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17860	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											62.0	72.0	68.0					2																	56419726		2038	4199	6237	56273230	SO:0001583	missense	114800			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.391C>T	2.37:g.56419726C>T	ENSP00000384040:p.Arg131Cys	Somatic		Capture	Illumina GAIIx	4	56273230		Missense_Mutation	SNP	ENST00000407595.2	37	CCDS46290.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284733	0.59867	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.42	4.46	0.54185	.	0.051596	0.85682	D	0.000000	T	0.79358	0.4432	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.82557	-0.0398	9	0.87932	D	0	-0.1288	15.1831	0.72975	0.2128:0.7872:0.0:0.0	.	131	Q96PX6	CC85A_HUMAN	C	131	.	ENSP00000384040:R131C	R	+	1	0	CCDC85A	56273230	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.969000	0.49232	2.532000	0.85374	0.655000	0.94253	CGC		0.557	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1			Missense_Mutation
ZNF614	80110	genome.wustl.edu	37	19	52520367	52520367	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:52520367C>T	ENST00000270649.6	-	5	1028	c.484G>A	c.(484-486)Gag>Aag	p.E162K	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E162K(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGTGTTTTCTCACCTCCAATA	0.318																																																1	Substitution - Missense(1)	ovary(1)	19											107.0	102.0	103.0					19																	52520367		2203	4299	6502	57212179	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.484G>A	19.37:g.52520367C>T	ENSP00000270649:p.Glu162Lys	Somatic		Capture	Illumina GAIIx	4	57212179	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	ENST00000270649.6	37	CCDS12847.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	9.339	1.062510	0.19987	.	.	ENSG00000142556	ENST00000270649	T	0.07567	3.18	3.53	-2.93	0.05598	.	.	.	.	.	T	0.06142	0.0159	L	0.38838	1.175	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37502	-0.9703	9	0.52906	T	0.07	.	5.2593	0.15563	0.0:0.2911:0.1587:0.5503	.	162	Q8N883	ZN614_HUMAN	K	162	ENSP00000270649:E162K	ENSP00000270649:E162K	E	-	1	0	ZNF614	57212179	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-0.751000	0.04803	-0.602000	0.05775	0.591000	0.81541	GAG		0.318	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	NM_025040		Missense_Mutation
ANXA2	302	genome.wustl.edu	37	15	60649426	60649426	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr15:60649426T>G	ENST00000396024.3	-	7	526	c.367A>C	c.(367-369)Acc>Ccc	p.T123P	ANXA2_ENST00000421017.2_Missense_Mutation_p.T123P|ANXA2_ENST00000451270.2_Missense_Mutation_p.T123P|ANXA2_ENST00000332680.4_Missense_Mutation_p.T141P	NM_001136015.2	NP_001129487.1	P07355	ANXA2_HUMAN	annexin A2	123					angiogenesis (GO:0001525)|body fluid secretion (GO:0007589)|cellular response to acid chemical (GO:0071229)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|membrane budding (GO:0006900)|membrane raft assembly (GO:0001765)|negative regulation of catalytic activity (GO:0043086)|osteoclast development (GO:0036035)|positive regulation of binding (GO:0051099)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vesicle fusion (GO:0031340)|protein heterotetramerization (GO:0051290)|protein targeting to plasma membrane (GO:0072661)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell surface (GO:0009986)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|late endosome membrane (GO:0031902)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)|midbody (GO:0030496)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|sarcolemma (GO:0042383)|Schmidt-Lanterman incisure (GO:0043220)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phospholipase A2 inhibitor activity (GO:0019834)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.T141P(1)		kidney(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9					Tenecteplase(DB00031)	TCCTCGTCGGTTCCCAGCCCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	15											87.0	77.0	80.0					15																	60649426		2203	4300	6503	58436718	SO:0001583	missense	302			D00017	CCDS10175.1, CCDS32256.1	15q22.2	2012-10-02			ENSG00000182718	ENSG00000182718		"""Annexins"""	537	protein-coding gene	gene with protein product	"""annexin II"""	151740		ANX2, ANX2L4, CAL1H, LPC2D		7961821	Standard	NM_001136015		Approved	LIP2	uc002agm.3	P07355	OTTHUMG00000132763	ENST00000396024.3:c.367A>C	15.37:g.60649426T>G	ENSP00000379342:p.Thr123Pro	Somatic		Capture	Illumina GAIIx	4	58436718	Q567R4|Q6N0B3|Q8TBV2|Q96DD5|Q9UDH8	Missense_Mutation	SNP	ENST00000396024.3	37	CCDS10175.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	33	5.264102	0.95399	.	.	ENSG00000182718	ENST00000396024;ENST00000332680;ENST00000421017;ENST00000451270;ENST00000504475	T;T;T;T	0.06449	3.3;3.3;3.3;3.3	5.34	5.34	0.76211	Annexin repeat, conserved site (1);	0.000000	0.85682	U	0.000000	T	0.35595	0.0937	H	0.94808	3.585	0.80722	D	1	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.91635	0.944;0.997;0.999	T	0.50583	-0.8811	10	0.87932	D	0	.	14.3105	0.66413	0.0:0.0:0.0:1.0	.	123;141;123	B4DNH8;P07355-2;P07355	.;.;ANXA2_HUMAN	P	123;141;123;123;6	ENSP00000379342:T123P;ENSP00000346032:T141P;ENSP00000411352:T123P;ENSP00000387545:T123P	ENSP00000346032:T141P	T	-	1	0	ANXA2	58436718	1.000000	0.71417	0.761000	0.31378	0.496000	0.33645	7.373000	0.79623	2.038000	0.60285	0.379000	0.24179	ACC		0.478	ANXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256135.1	NM_001002857		Missense_Mutation
FEN1	2237	genome.wustl.edu	37	11	61563786	61563786	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr11:61563786A>T	ENST00000305885.2	+	2	1366	c.953A>T	c.(952-954)gAg>gTg	p.E318V	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1									p.E318V(1)		endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						CAGTTCTCTGAGGAGCGAATC	0.557								Editing and processing nucleases																																								1	Substitution - Missense(1)	ovary(1)	11											46.0	47.0	46.0					11																	61563786		2202	4299	6501	61320362	SO:0001583	missense	2237			L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.953A>T	11.37:g.61563786A>T	ENSP00000305480:p.Glu318Val	Somatic		Capture	Illumina GAIIx	4	61320362		Missense_Mutation	SNP	ENST00000305885.2	37	CCDS8010.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	17.35	3.367127	0.61513	.	.	ENSG00000168496	ENST00000305885	T	0.32753	1.44	5.44	5.44	0.79542	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.000000	0.85682	D	0.000000	T	0.57592	0.2064	M	0.85859	2.78	0.80722	D	1	D	0.69078	0.997	P	0.61328	0.887	T	0.65759	-0.6090	10	0.87932	D	0	-7.4816	15.828	0.78730	1.0:0.0:0.0:0.0	.	318	P39748	FEN1_HUMAN	V	318	ENSP00000305480:E318V	ENSP00000305480:E318V	E	+	2	0	FEN1	61320362	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	8.441000	0.90313	2.200000	0.70718	0.459000	0.35465	GAG		0.557	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398526.1	NM_004111		Missense_Mutation
HERC1	8925	genome.wustl.edu	37	15	63964733	63964733	+	Silent	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr15:63964733T>G	ENST00000443617.2	-	39	8094	c.8007A>C	c.(8005-8007)gcA>gcC	p.A2669A	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2669					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.A2669A(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGGACTCGGATGCAGGCACTG	0.522																																																1	Substitution - coding silent(1)	ovary(1)	15											69.0	73.0	72.0					15																	63964733		2063	4204	6267	61751786	SO:0001819	synonymous_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8007A>C	15.37:g.63964733T>G		Somatic		Capture	Illumina GAIIx	4	61751786	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1	SNP	51	WashU																																																																																				0.522	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		Silent
GANAB	23193	genome.wustl.edu	37	11	62407101	62407101	+	Silent	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr11:62407101G>A	ENST00000356638.3	-	2	157	c.141C>T	c.(139-141)tgC>tgT	p.C47C	GANAB_ENST00000534779.1_Intron|GANAB_ENST00000346178.4_Silent_p.C47C|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_5'UTR	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	47					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.C47C(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TATCATACTTGCAGAAAGAAC	0.483																																					Melanoma(23;1005 1074 15747 18937)											1	Substitution - coding silent(1)	ovary(1)	11											78.0	76.0	77.0					11																	62407101		2202	4299	6501	62163677	SO:0001819	synonymous_variant	23193			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.141C>T	11.37:g.62407101G>A		Somatic		Capture	Illumina GAIIx	4	62163677	A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	CCDS8026.1	SNP	46	WashU																																																																																				0.483	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334		Silent
SPTB	6710	genome.wustl.edu	37	14	65239323	65239323	+	Missense_Mutation	SNP	C	C	T	rs534004149	byFrequency	TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr14:65239323C>T	ENST00000389721.5	-	25	5560	c.5528G>A	c.(5527-5529)cGg>cAg	p.R1843Q	SPTB_ENST00000389722.3_Missense_Mutation_p.R1843Q|SPTB_ENST00000556626.1_Missense_Mutation_p.R1843Q|SPTB_ENST00000542895.1_Missense_Mutation_p.R1843Q|SPTB_ENST00000389720.3_Missense_Mutation_p.R1843Q	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1843					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.R1843Q(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GTGGAGCTCCCGCTCGAAGGC	0.677													C|||	6	0.00119808	0.0	0.0086	5008	,	,		16339	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	14											31.0	32.0	32.0					14																	65239323		2203	4300	6503	64309076	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5528G>A	14.37:g.65239323C>T	ENSP00000374371:p.Arg1843Gln	Somatic		Capture	Illumina GAIIx	4	64309076	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899305	0.33535	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	5.0	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	L	0.31476	0.935	0.50632	D	0.999889	B;B;B	0.25772	0.134;0.005;0.023	B;B;B	0.23852	0.049;0.007;0.004	T	0.06844	-1.0804	10	0.14252	T	0.57	.	8.936	0.35700	0.0:0.8264:0.0:0.1736	.	627;1843;1847	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	Q	1847;1843;627;508;1843;1843;1843;1843	ENSP00000374372:R1843Q;ENSP00000451324:R508Q;ENSP00000451752:R1843Q;ENSP00000374371:R1843Q;ENSP00000443882:R1843Q;ENSP00000374370:R1843Q	ENSP00000334218:R627Q	R	-	2	0	SPTB	64309076	0.002000	0.14202	1.000000	0.80357	0.983000	0.72400	0.177000	0.16801	1.241000	0.43820	0.561000	0.74099	CGG		0.677	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			Missense_Mutation
SMG1P7	100506060	genome.wustl.edu	37	16	70268080	70268080	+	RNA	SNP	T	T	C			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	C	T	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr16:70268080T>C	ENST00000459379.1	-	0	0																											GTCTTACTGTTGGCTAAAAGG	0.373																																																0			16																																								68825581																																		16.37:g.70268080T>C		Germline		Capture	Illumina GAIIx	4	68825581		Missense_Mutation	SNP	ENST00000459379.1	37		SNP	63	WashU																																																																																				0.373	snoU13.216-201	NOVEL	basic	snoRNA	snoRNA				Missense_Mutation
WDR61	80349	genome.wustl.edu	37	15	78581979	78581979	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr15:78581979G>A	ENST00000267973.2	-	7	815	c.544C>T	c.(544-546)Ctt>Ttt	p.L182F	WDR61_ENST00000558459.1_Missense_Mutation_p.L89F|WDR61_ENST00000558311.1_Missense_Mutation_p.L182F			Q9GZS3	WDR61_HUMAN	WD repeat domain 61	182					histone H3-K4 trimethylation (GO:0080182)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)		p.L182F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						GTATGCAGAAGTTTTCCAGTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	15											79.0	76.0	77.0					15																	78581979		2196	4293	6489	76369034	SO:0001583	missense	80349				CCDS10300.1	15q25.1	2013-01-09			ENSG00000140395	ENSG00000140395		"""WD repeat domain containing"""	30300	protein-coding gene	gene with protein product		609540				12477932	Standard	NM_025234		Approved	REC14	uc002bdn.3	Q9GZS3	OTTHUMG00000143735	ENST00000267973.2:c.544C>T	15.37:g.78581979G>A	ENSP00000267973:p.Leu182Phe	Somatic		Capture	Illumina GAIIx	4	76369034	D3DW84|Q6IA22|Q7Z4X4	Missense_Mutation	SNP	ENST00000267973.2	37	CCDS10300.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706980	0.89018	.	.	ENSG00000140395	ENST00000267973	T	0.61392	0.11	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056292	0.64402	D	0.000001	T	0.74794	0.3763	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.69091	-0.5237	10	0.10902	T	0.67	-8.0166	18.891	0.92403	0.0:0.0:1.0:0.0	.	182	Q9GZS3	WDR61_HUMAN	F	182	ENSP00000267973:L182F	ENSP00000267973:L182F	L	-	1	0	WDR61	76369034	1.000000	0.71417	0.987000	0.45799	0.986000	0.74619	9.631000	0.98424	2.720000	0.93068	0.591000	0.81541	CTT		0.348	WDR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289803.3	NM_025234		Missense_Mutation
NT5E	4907	genome.wustl.edu	37	6	86195099	86195099	+	Missense_Mutation	SNP	G	G	A	rs148199616		TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr6:86195099G>A	ENST00000257770.3	+	4	947	c.898G>A	c.(898-900)Gtc>Atc	p.V300I	NT5E_ENST00000369651.3_Missense_Mutation_p.V300I	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	300					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.V300I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	AAGAGGAAACGTCATCTCTTC	0.438																																					Melanoma(140;797 1765 2035 2752 18208)											1	Substitution - Missense(1)	ovary(1)	6						G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	149.0	135.0	140.0		898,898	5.4	0.9	6	dbSNP_134	140	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NT5E	NM_001204813.1,NM_002526.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	300/525,300/575	86195099	1,13005	2203	4300	6503	86251818	SO:0001583	missense	4907			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.898G>A	6.37:g.86195099G>A	ENSP00000257770:p.Val300Ile	Somatic		Capture	Illumina GAIIx	4	86251818	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	ENST00000257770.3	37	CCDS5002.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782322	0.90282	0.0	1.16E-4	ENSG00000135318	ENST00000369647;ENST00000257770;ENST00000369651	T;T	0.56776	0.44;0.45	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	L	0.53729	1.69	0.80722	D	1	D;D	0.65815	0.995;0.991	P;P	0.54060	0.741;0.691	T	0.53056	-0.8492	10	0.42905	T	0.14	-16.8414	19.0919	0.93229	0.0:0.0:1.0:0.0	.	300;300	B3KQI8;P21589	.;5NTD_HUMAN	I	76;300;300	ENSP00000257770:V300I;ENSP00000358665:V300I	ENSP00000257770:V300I	V	+	1	0	NT5E	86251818	1.000000	0.71417	0.945000	0.38365	0.848000	0.48234	9.307000	0.96226	2.496000	0.84212	0.462000	0.41574	GTC		0.438	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1			Missense_Mutation
GRM3	2913	genome.wustl.edu	37	7	86468753	86468753	+	Silent	SNP	T	T	C			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:86468753T>C	ENST00000361669.2	+	4	3022	c.1923T>C	c.(1921-1923)tgT>tgC	p.C641C	GRM3_ENST00000546348.1_Silent_p.C233C|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000536043.1_Silent_p.C513C	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	641					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.C641C(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CAGTCATCTGTGCATTGCGCC	0.522																																					GBM(52;969 1098 3139 52280)											1	Substitution - coding silent(1)	ovary(1)	7											230.0	189.0	203.0					7																	86468753		2203	4300	6503	86306689	SO:0001819	synonymous_variant	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1923T>C	7.37:g.86468753T>C		Somatic		Capture	Illumina GAIIx	4	86306689	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	ENST00000361669.2	37	CCDS5600.1	SNP	59	WashU																																																																																				0.522	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			Silent
BARHL2	343472	genome.wustl.edu	37	1	91178121	91178121	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:91178121G>C	ENST00000370445.4	-	3	953	c.912C>G	c.(910-912)taC>taG	p.Y304*		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	304					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.Y304*(1)		cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		GCAGCGCCGAGTAGTTCCCTG	0.632																																					GBM(199;3561 4100 22440)											1	Substitution - Nonsense(1)	ovary(1)	1											31.0	30.0	30.0					1																	91178121		2201	4300	6501	90950709	SO:0001587	stop_gained	343472			AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.912C>G	1.37:g.91178121G>C	ENSP00000359474:p.Tyr304*	Somatic		Capture	Illumina GAIIx	4	90950709	A0AVP2|Q7Z4N7	Nonsense_Mutation	SNP	ENST00000370445.4	37	CCDS730.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433197	0.62844	.	.	ENSG00000143032	ENST00000370445	.	.	.	5.42	3.54	0.40534	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8319	0.35089	0.2293:0.0:0.7707:0.0	.	.	.	.	X	304	.	ENSP00000359474:Y304X	Y	-	3	2	BARHL2	90950709	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	1.850000	0.39328	1.447000	0.47661	0.556000	0.70494	TAC		0.632	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2			Nonsense_Mutation
VSIG1	340547	genome.wustl.edu	37	X	107310217	107310217	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chrX:107310217C>G	ENST00000217957.5	+	3	382	c.265C>G	c.(265-267)Cga>Gga	p.R89G	VSIG1_ENST00000485533.1_3'UTR|VSIG1_ENST00000415430.3_Missense_Mutation_p.R125G	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	89	Ig-like V-type 1.					integral component of membrane (GO:0016021)		p.R89G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						ATTTAAAGATCGAATTACAGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											132.0	115.0	120.0					X																	107310217		2203	4300	6503	107196873	SO:0001583	missense	340547			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.265C>G	X.37:g.107310217C>G	ENSP00000217957:p.Arg89Gly	Somatic		Capture	Illumina GAIIx	4	107196873	C9J4P2|Q6MZS4	Missense_Mutation	SNP	ENST00000217957.5	37	CCDS14535.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	13.84	2.358432	0.41801	.	.	ENSG00000101842	ENST00000415430;ENST00000217957;ENST00000458383	T;T;T	0.72394	-0.65;1.09;-0.65	5.19	5.19	0.71726	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000042	D	0.87293	0.6141	M	0.92077	3.27	0.44500	D	0.997449	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90178	0.4240	10	0.87932	D	0	.	14.5308	0.67923	0.0:1.0:0.0:0.0	.	125;89	C9J4P2;Q86XK7	.;VSIG1_HUMAN	G	125;89;125	ENSP00000402219:R125G;ENSP00000217957:R89G;ENSP00000407102:R125G	ENSP00000217957:R89G	R	+	1	2	VSIG1	107196873	0.993000	0.37304	0.646000	0.29493	0.096000	0.18686	2.216000	0.42871	2.406000	0.81754	0.594000	0.82650	CGA		0.443	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057858.1	NM_182607		Missense_Mutation
ATP2A2	488	genome.wustl.edu	37	12	110720597	110720597	+	Silent	SNP	T	T	C			TCGA-13-0755-01	TCGA-13-0755-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:110720597T>C	ENST00000539276.2	+	3	325	c.216T>C	c.(214-216)tcT>tcC	p.S72S	ATP2A2_ENST00000308664.6_Silent_p.S72S|ATP2A2_ENST00000552636.1_5'UTR|ATP2A2_ENST00000395494.2_Silent_p.S72S			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	72					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)	p.S72S(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CATGTATATCTTTTGTAAGTA	0.323																																																1	Substitution - coding silent(1)	ovary(1)	12											66.0	65.0	66.0					12																	110720597		2203	4300	6503	109204980	SO:0001819	synonymous_variant	488				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.216T>C	12.37:g.110720597T>C		Somatic		Capture	Illumina GAIIx	4	109204980	A6NDN7|B4DF05|P16614|Q86VJ2	Silent	SNP	ENST00000539276.2	37	CCDS9144.1	SNP	56	WashU																																																																																				0.323	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681		Silent
MYH15	22989	genome.wustl.edu	37	3	108195349	108195349	+	Silent	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr3:108195349A>T	ENST00000273353.3	-	13	1244	c.1188T>A	c.(1186-1188)gcT>gcA	p.A396A		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	396	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A396A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TGAGGAAAGCAGCTTTGTCAG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	3											69.0	63.0	65.0					3																	108195349		1908	4127	6035	109678039	SO:0001819	synonymous_variant	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1188T>A	3.37:g.108195349A>T		Somatic		Capture	Illumina GAIIx	4	109678039		Silent	SNP	ENST00000273353.3	37	CCDS43127.1	SNP	7	WashU																																																																																				0.403	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		Silent
PIH1D2	120379	genome.wustl.edu	37	11	111938623	111938623	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr11:111938623G>A	ENST00000280350.4	-	6	1142	c.920C>T	c.(919-921)aCg>aTg	p.T307M	PIH1D2_ENST00000431456.1_Intron|PIH1D2_ENST00000532211.1_Missense_Mutation_p.T307M|PIH1D2_ENST00000528775.1_Intron	NM_138789.3	NP_620144.1	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2	307								p.T307M(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		GATGATTAGCGTGGATTTTTC	0.333																																																1	Substitution - Missense(1)	ovary(1)	11											171.0	161.0	164.0					11																	111938623		2201	4296	6497	111443833	SO:0001583	missense	120379			BC019238	CCDS8355.1, CCDS44730.1	11q23.1	2007-01-31			ENSG00000150773	ENSG00000150773			25210	protein-coding gene	gene with protein product						12477932	Standard	NM_138789		Approved		uc001pmp.4	Q8WWB5	OTTHUMG00000166925	ENST00000280350.4:c.920C>T	11.37:g.111938623G>A	ENSP00000280350:p.Thr307Met	Somatic		Capture	Illumina GAIIx	4	111443833	B4DU48|E9PD82	Missense_Mutation	SNP	ENST00000280350.4	37	CCDS8355.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	13.08	2.131581	0.37630	.	.	ENSG00000150773	ENST00000532211;ENST00000280350	T;T	0.18657	2.2;2.2	5.39	3.47	0.39725	.	0.718910	0.14081	N	0.342694	T	0.16981	0.0408	.	.	.	0.20764	N	0.99986	D	0.55800	0.973	P	0.46362	0.514	T	0.09228	-1.0684	9	0.27785	T	0.31	-4.2418	4.2396	0.10642	0.2718:0.172:0.5562:0.0	.	307	Q8WWB5	PIHD2_HUMAN	M	307	ENSP00000431841:T307M;ENSP00000280350:T307M	ENSP00000280350:T307M	T	-	2	0	PIH1D2	111443833	0.002000	0.14202	0.927000	0.36925	0.458000	0.32498	0.341000	0.19909	0.793000	0.33875	0.471000	0.43371	ACG		0.333	PIH1D2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391916.1	NM_138789		Missense_Mutation
CTTNBP2	83992	genome.wustl.edu	37	7	117424414	117424414	+	Silent	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:117424414T>G	ENST00000160373.3	-	5	2254	c.2163A>C	c.(2161-2163)ggA>ggC	p.G721G		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	721					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.G721G(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AAGTGACATTTCCCTGGGCAG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	7											101.0	110.0	107.0					7																	117424414		2203	4300	6503	117211650	SO:0001819	synonymous_variant	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2163A>C	7.37:g.117424414T>G		Somatic		Capture	Illumina GAIIx	4	117211650	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	10.38	1.334327	0.24253	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	T	0.71771	0.3379	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71130	-0.4682	4	.	.	.	0.0128	15.8142	0.78586	0.0:0.0:0.0:1.0	.	.	.	.	Q	209	.	.	K	-	1	0	CTTNBP2	117211650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.716000	0.68437	2.184000	0.69523	0.533000	0.62120	AAA		0.507	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		Silent
GFRA1	2674	genome.wustl.edu	37	10	117884825	117884825	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr10:117884825C>A	ENST00000355422.6	-	6	1227	c.677G>T	c.(676-678)cGa>cTa	p.R226L	GFRA1_ENST00000544592.1_Missense_Mutation_p.R105L|GFRA1_ENST00000439649.3_Missense_Mutation_p.R221L|GFRA1_ENST00000369236.1_Missense_Mutation_p.R221L	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	226					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.R221L(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GATGGTCTGTCGCCTCCGCTC	0.562																																					Ovarian(128;329 1725 45498 46808 50759)											1	Substitution - Missense(1)	ovary(1)	10											80.0	68.0	72.0					10																	117884825		2203	4300	6503	117874815	SO:0001583	missense	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.677G>T	10.37:g.117884825C>A	ENSP00000347591:p.Arg226Leu	Somatic		Capture	Illumina GAIIx	4	117874815	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	CCDS44481.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.517755	0.96416	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000544592;ENST00000369234	T;T	0.65364	-0.15;-0.15	5.75	5.75	0.90469	GDNF/GAS1 (2);	0.000000	0.85682	D	0.000000	D	0.83175	0.5197	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70227	0.968;0.927	D	0.85626	0.1267	10	0.87932	D	0	-15.5798	19.9522	0.97203	0.0:1.0:0.0:0.0	.	226;221	P56159;P56159-2	GFRA1_HUMAN;.	L	226;221;221;105;221	ENSP00000358239:R221L;ENSP00000442179:R105L	ENSP00000347591:R221L	R	-	2	0	GFRA1	117874815	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.818000	0.86416	2.725000	0.93324	0.655000	0.94253	CGA		0.562	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		Missense_Mutation
KIAA1109	84162	genome.wustl.edu	37	4	123161217	123161217	+	Silent	SNP	T	T	A			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr4:123161217T>A	ENST00000264501.4	+	29	4753	c.4380T>A	c.(4378-4380)ccT>ccA	p.P1460P	KIAA1109_ENST00000455637.1_Silent_p.P1460P|KIAA1109_ENST00000388738.3_Silent_p.P1460P			Q2LD37	K1109_HUMAN	KIAA1109	1460					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P1460P(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AAACTCATCCTTCTCAGGCTT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	4											94.0	89.0	90.0					4																	123161217		1863	4100	5963	123380667	SO:0001819	synonymous_variant	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4380T>A	4.37:g.123161217T>A		Somatic		Capture	Illumina GAIIx	4	123380667	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	8.806	0.934026	0.18206	.	.	ENSG00000138688	ENST00000446180	.	.	.	6.05	-3.77	0.04346	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36986	-0.9725	4	.	.	.	.	0.528	0.00623	0.323:0.2132:0.1112:0.3526	.	.	.	.	H	33	.	.	L	+	2	0	KIAA1109	123380667	0.970000	0.33590	0.990000	0.47175	0.988000	0.76386	0.009000	0.13219	-0.446000	0.07149	-0.321000	0.08615	CTT		0.408	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		Silent
TACC2	10579	genome.wustl.edu	37	10	123847278	123847278	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr10:123847278G>T	ENST00000369005.1	+	4	5603	c.5263G>T	c.(5263-5265)Gct>Tct	p.A1755S	TACC2_ENST00000515603.1_Missense_Mutation_p.A1755S|TACC2_ENST00000334433.3_Missense_Mutation_p.A1755S|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.A1755S|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.A1755S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1755					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.A1755S(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CTCTGACAAGGCTCCGGGGAT	0.637																																																1	Substitution - Missense(1)	ovary(1)	10											33.0	30.0	31.0					10																	123847278		2203	4300	6503	123837268	SO:0001583	missense	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5263G>T	10.37:g.123847278G>T	ENSP00000358001:p.Ala1755Ser	Somatic		Capture	Illumina GAIIx	4	123837268	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168468	0.38315	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.04862	3.88;3.54;3.83;3.88;3.54	5.65	-0.699	0.11277	.	0.497156	0.15141	N	0.278308	T	0.03305	0.0096	L	0.27053	0.805	0.09310	N	1	P;P;P	0.40731	0.728;0.728;0.728	B;B;B	0.35114	0.196;0.196;0.196	T	0.44832	-0.9302	10	0.22109	T	0.4	0.644	4.9689	0.14105	0.3934:0.2702:0.3365:0.0	.	1755;1755;1755	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	S	1755;1755;1755;1755;1755;1745	ENSP00000358001:A1755S;ENSP00000424467:A1755S;ENSP00000427618:A1755S;ENSP00000334280:A1755S;ENSP00000395048:A1755S	ENSP00000334280:A1755S	A	+	1	0	TACC2	123837268	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.149000	0.10204	-0.169000	0.10834	0.643000	0.83706	GCT		0.637	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			Missense_Mutation
GRM8	2918	genome.wustl.edu	37	7	126883067	126883067	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:126883067A>C	ENST00000339582.2	-	2	1000	c.192T>G	c.(190-192)tgT>tgG	p.C64W	GRM8_ENST00000444921.2_Missense_Mutation_p.C64W|GRM8_ENST00000358373.3_Missense_Mutation_p.C64W|GRM8_ENST00000405249.1_Missense_Mutation_p.C64W			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	64					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.C64W(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TCAGCTCCCCACAAGGCACCC	0.522										HNSCC(24;0.065)																																						1	Substitution - Missense(1)	ovary(1)	7											86.0	72.0	77.0					7																	126883067		2203	4300	6503	126670303	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.192T>G	7.37:g.126883067A>C	ENSP00000344173:p.Cys64Trp	Somatic		Capture	Illumina GAIIx	4	126670303	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	CCDS5794.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	15.70	2.910182	0.52439	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	6.17	2.54	0.30619	.	0.000000	0.85682	D	0.000000	D	0.89100	0.6619	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.995;1.0	D	0.87660	0.2534	10	0.87932	D	0	.	9.2563	0.37586	0.7967:0.0:0.2033:0.0	.	64;64	O00222-2;O00222	.;GRM8_HUMAN	W	64	ENSP00000344173:C64W;ENSP00000409790:C64W;ENSP00000351142:C64W;ENSP00000385731:C64W;ENSP00000415522:C64W	ENSP00000344173:C64W	C	-	3	2	GRM8	126670303	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.791000	0.38744	0.204000	0.20548	0.533000	0.62120	TGT		0.522	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			Missense_Mutation
MEGF10	84466	genome.wustl.edu	37	5	126758360	126758360	+	Splice_Site	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr5:126758360A>T	ENST00000274473.6	+	14	1857		c.e14-1		MEGF10_ENST00000508365.1_Splice_Site|MEGF10_ENST00000418761.2_Splice_Site|MEGF10_ENST00000503335.2_Splice_Site	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10						homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.?(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TTTTCCATGCAGGATGGCACG	0.587																																																1	Unknown(1)	ovary(1)	5											43.0	40.0	41.0					5																	126758360		2203	4300	6503	126786259	SO:0001630	splice_region_variant	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1591-1A>T	5.37:g.126758360A>T		Somatic		Capture	Illumina GAIIx	4	126786259	Q68DE5|Q8WUL3	Splice_Site_SNP	SNP	ENST00000274473.6	37	CCDS4142.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202746	0.79127	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5068	0.75748	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MEGF10	126786259	1.000000	0.71417	0.991000	0.47740	0.975000	0.68041	9.251000	0.95483	2.130000	0.65690	0.528000	0.53228	.		0.587	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	Intron	Splice_Site_SNP
ASAP1	50807	genome.wustl.edu	37	8	131073023	131073023	+	Silent	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr8:131073023C>G	ENST00000518721.1	-	28	3221	c.2994G>C	c.(2992-2994)ctG>ctC	p.L998L	ASAP1_ENST00000357668.1_Silent_p.L998L	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	998					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.L998L(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ATTTTGCTAGCAGGTCTCCCA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	8											157.0	150.0	153.0					8																	131073023		2203	4300	6503	131142205	SO:0001819	synonymous_variant	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2994G>C	8.37:g.131073023C>G		Somatic		Capture	Illumina GAIIx	4	131142205	B2RNV3	Silent	SNP	ENST00000518721.1	37	CCDS6362.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	8.074	0.770873	0.15983	.	.	ENSG00000153317	ENST00000524124;ENST00000519483	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	T	0.70378	0.3217	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68503	-0.5391	4	.	.	.	.	13.9666	0.64213	0.0:0.9253:0.0:0.0747	.	.	.	.	P	819;355	.	.	A	-	1	0	ASAP1	131142205	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.918000	0.28678	2.644000	0.89710	0.561000	0.74099	GCT		0.552	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482		Silent
FRG2B	441581	genome.wustl.edu	37	10	135439015	135439015	+	Missense_Mutation	SNP	T	T	C	rs75470891		TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	C	T	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr10:135439015T>C	ENST00000425520.1	-	4	477	c.425A>G	c.(424-426)gAt>gGt	p.D142G	FRG2B_ENST00000443774.1_Missense_Mutation_p.D143G	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	142						nucleus (GO:0005634)		p.D143G(1)|p.D142G(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATGGTGGGCATCACAGGTCTC	0.517																																																2	Substitution - Missense(2)	prostate(2)	10											94.0	106.0	102.0					10																	135439015		2200	4298	6498	135289005	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.425A>G	10.37:g.135439015T>C	ENSP00000401310:p.Asp142Gly	Germline		Capture	Illumina GAIIx	4	135289005	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	SNP	50	WashU	.	.	.	.	.	.	.	.	.	.	.	7.820	0.717602	0.15372	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.46063	0.88;0.88	.	.	.	.	2.387620	0.01707	N	0.027493	T	0.45115	0.1326	N	0.19112	0.55	0.80722	P	0.0	D	0.61697	0.99	D	0.66351	0.943	T	0.44967	-0.9293	7	0.25751	T	0.34	-0.0211	.	.	.	.	142	Q96QU4	FRG2B_HUMAN	G	143;142	ENSP00000408343:D143G;ENSP00000401310:D142G	ENSP00000401310:D142G	D	-	2	0	FRG2B	135289005	0.038000	0.19896	0.258000	0.24420	0.260000	0.26232	0.264000	0.18497	0.103000	0.17682	0.102000	0.15555	GAT		0.517	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		Missense_Mutation
NXPH2	11249	genome.wustl.edu	37	2	139428965	139428965	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:139428965A>T	ENST00000272641.3	-	2	428	c.322T>A	c.(322-324)Ttt>Att	p.F108I		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	108	III.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.F108I(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		ATTTTCTTAAATTTTCCTGTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											85.0	78.0	80.0					2																	139428965		1843	4089	5932	139145435	SO:0001583	missense	11249			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.322T>A	2.37:g.139428965A>T	ENSP00000272641:p.Phe108Ile	Somatic		Capture	Illumina GAIIx	4	139145435	B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	ENST00000272641.3	37	CCDS46421.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	22.5	4.295299	0.81025	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	M	0.66939	2.045	0.80722	D	1	D	0.64830	0.994	D	0.71656	0.974	T	0.76809	-0.2822	8	.	.	.	-18.3434	16.2026	0.82095	1.0:0.0:0.0:0.0	.	108	O95156	NXPH2_HUMAN	I	108	.	.	F	-	1	0	NXPH2	139145435	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.287000	0.95975	2.285000	0.76669	0.533000	0.62120	TTT		0.408	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1			Missense_Mutation
NXPH2	11249	genome.wustl.edu	37	2	139429227	139429227	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:139429227A>T	ENST00000272641.3	-	2	166	c.60T>A	c.(58-60)tgT>tgA	p.C20*		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	20					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.C20*(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		CCTTACTGTCACAAAATAGCT	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	2											49.0	48.0	48.0					2																	139429227		1908	4115	6023	139145697	SO:0001587	stop_gained	11249			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.60T>A	2.37:g.139429227A>T	ENSP00000272641:p.Cys20*	Somatic		Capture	Illumina GAIIx	4	139145697	B7WP24|Q494R1|Q75QC3	Nonsense_Mutation	SNP	ENST00000272641.3	37	CCDS46421.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447399	0.63178	.	.	ENSG00000144227	ENST00000272641	.	.	.	6.17	6.17	0.99709	.	0.266775	0.39020	N	0.001497	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.4021	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	.	.	.	X	20	.	.	C	-	3	2	NXPH2	139145697	1.000000	0.71417	1.000000	0.80357	0.399000	0.30720	3.792000	0.55476	2.371000	0.80710	0.533000	0.62120	TGT		0.463	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1			Nonsense_Mutation
EIF4EBP3	8637	genome.wustl.edu	37	5	139928548	139928548	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr5:139928548C>T	ENST00000310331.2	+	2	233	c.161C>T	c.(160-162)gCc>gTc	p.A54V	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.C2579C|SRA1_ENST00000520427.1_5'Flank|ANKHD1_ENST00000297183.6_Silent_p.C2579C	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3	54					negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)	p.A54V(1)|p.C2579C(1)		endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACCCATTGCCCGGACACCC	0.592																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(2)	5											44.0	44.0	44.0					5																	139928548		2203	4300	6503	139908732	SO:0001583	missense	8637			AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498	ENST00000310331.2:c.161C>T	5.37:g.139928548C>T	ENSP00000308472:p.Ala54Val	Somatic		Capture	Illumina GAIIx	4	139908732		Missense_Mutation	SNP	ENST00000310331.2	37	CCDS4226.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.538327	0.96460	.	.	ENSG00000243056	ENST00000310331	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	T	0.79896	0.4525	.	.	.	0.58432	D	0.999999	D	0.76494	0.999	D	0.87578	0.998	T	0.80665	-0.1281	7	0.56958	D	0.05	.	16.7164	0.85398	0.0:1.0:0.0:0.0	.	54	O60516	4EBP3_HUMAN	V	54	.	ENSP00000308472:A54V	A	+	2	0	EIF4EBP3	139908732	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.985000	0.76193	2.726000	0.93360	0.655000	0.94253	GCC		0.592	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732		Missense_Mutation
Unknown	0	genome.wustl.edu	37	7	0	0	+	IGR	SNP	A	A	G			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	G	A	A	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:0A>G								None (None upstream) : AC093627.7 (70971 downstream)																							NNNNNNNNNN	0.0																																																0			7																																								141876211	SO:0001628	intergenic_variant																																7.37:g.0A>G		Somatic		Capture	Illumina GAIIx	4	141876211		Missense_Mutation	SNP		37		SNP	12	WashU																																																																																			0	0.000									Missense_Mutation
TXNIP	10628	genome.wustl.edu	37	1	145440063	145440063	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:145440063A>G	ENST00000369317.4	+	4	831	c.497A>G	c.(496-498)aAg>aGg	p.K166R	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	166					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)	p.K166R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAAAAAGAAAAGAAAGTTTCC	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											172.0	195.0	187.0					1																	145440063		2203	4300	6503	144151420	SO:0001583	missense	10628			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.497A>G	1.37:g.145440063A>G	ENSP00000358323:p.Lys166Arg	Somatic		Capture	Illumina GAIIx	4	144151420	B4E3D3|Q16226|Q6PML0|Q9BXG9	Missense_Mutation	SNP	ENST00000369317.4	37	CCDS913.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	13.46	2.244851	0.39697	.	.	ENSG00000117289	ENST00000369317;ENST00000425134	T;T	0.07688	3.17;3.17	5.17	4.05	0.47172	Immunoglobulin E-set (1);	0.056736	0.64402	D	0.000002	T	0.03739	0.0106	M	0.65498	2.005	0.45366	D	0.998352	B;B	0.17852	0.024;0.0	B;B	0.18871	0.023;0.001	T	0.14755	-1.0461	10	0.44086	T	0.13	-8.3208	4.4098	0.11427	0.7362:0.0:0.0911:0.1728	.	111;166	B4E3D3;Q9H3M7	.;TXNIP_HUMAN	R	166;111	ENSP00000358323:K166R;ENSP00000396322:K111R	ENSP00000358323:K166R	K	+	2	0	TXNIP	144151420	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.676000	0.74498	1.005000	0.39183	0.529000	0.55759	AAG		0.413	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472		Missense_Mutation
GRPEL2	134266	genome.wustl.edu	37	5	148727896	148727896	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr5:148727896G>C	ENST00000329271.3	+	2	249	c.139G>C	c.(139-141)Gag>Cag	p.E47Q	GRPEL2_ENST00000416916.2_Missense_Mutation_p.E47Q|GRPEL2-AS1_ENST00000521295.1_RNA|GRPEL2_ENST00000513661.1_Missense_Mutation_p.E47Q|GRPEL2_ENST00000507562.1_3'UTR	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	47					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)	p.E47Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCCGTTCTGAGGACCCTCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	96.0	97.0					5																	148727896		2203	4300	6503	148708089	SO:0001583	missense	134266			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.139G>C	5.37:g.148727896G>C	ENSP00000329558:p.Glu47Gln	Somatic		Capture	Illumina GAIIx	4	148708089	B4DFA6|Q49AJ6	Missense_Mutation	SNP	ENST00000329271.3	37	CCDS4295.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469967	0.84533	.	.	ENSG00000164284	ENST00000513661;ENST00000329271;ENST00000416916	.	.	.	5.77	4.72	0.59763	.	0.336639	0.27764	N	0.017959	T	0.63200	0.2491	L	0.34521	1.04	0.40373	D	0.979361	D;D	0.64830	0.989;0.994	P;P	0.61658	0.836;0.892	T	0.62699	-0.6799	9	0.41790	T	0.15	-2.4103	15.7046	0.77569	0.0762:0.0:0.9238:0.0	.	47;47	B4DFA6;Q8TAA5	.;GRPE2_HUMAN	Q	47	.	ENSP00000329558:E47Q	E	+	1	0	GRPEL2	148708089	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.092000	0.64511	2.732000	0.93576	0.561000	0.74099	GAG		0.512	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407		Missense_Mutation
FLG	2312	genome.wustl.edu	37	1	152276913	152276913	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:152276913T>G	ENST00000368799.1	-	3	10484	c.10449A>C	c.(10447-10449)agA>agC	p.R3483S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3483	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R3483S(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGGCACTTCTGGATCCTG	0.557									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											303.0	291.0	295.0					1																	152276913		2203	4298	6501	150543537	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10449A>C	1.37:g.152276913T>G	ENSP00000357789:p.Arg3483Ser	Somatic		Capture	Illumina GAIIx	4	150543537	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	12.94	2.087577	0.36855	.	.	ENSG00000143631	ENST00000368799	T	0.01323	5.01	2.86	-5.73	0.02398	.	.	.	.	.	T	0.00998	0.0033	M	0.64997	1.995	0.09310	N	1	D	0.65815	0.995	D	0.79108	0.992	T	0.45906	-0.9229	9	0.09084	T	0.74	.	0.2783	0.00241	0.2481:0.2895:0.1714:0.291	.	3483	P20930	FILA_HUMAN	S	3483	ENSP00000357789:R3483S	ENSP00000357789:R3483S	R	-	3	2	FLG	150543537	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-3.535000	0.00439	-0.806000	0.04398	0.327000	0.21459	AGA		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
KMT2C	58508	genome.wustl.edu	37	7	151962210	151962210	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr7:151962210T>G	ENST00000262189.6	-	8	1315	c.1097A>C	c.(1096-1098)tAt>tCt	p.Y366S	KMT2C_ENST00000355193.2_Missense_Mutation_p.Y366S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	366					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.Y366S(1)									CATTCCATGATAGTGCTGACC	0.448																																																1	Substitution - Missense(1)	ovary(1)	7											397.0	355.0	370.0					7																	151962210		2203	4300	6503	151593143	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1097A>C	7.37:g.151962210T>G	ENSP00000262189:p.Tyr366Ser	Somatic		Capture	Illumina GAIIx	4	151593143	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	12.58	1.981691	0.34942	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.99070	-5.39;-5.39	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38111	U	0.001814	D	0.99248	0.9738	M	0.85542	2.76	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.99174	1.0865	10	0.87932	D	0	.	14.395	0.67005	0.0:0.0:0.0:1.0	.	366	Q8NEZ4	MLL3_HUMAN	S	366	ENSP00000262189:Y366S;ENSP00000347325:Y366S	ENSP00000262189:Y366S	Y	-	2	0	MLL3	151593143	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	7.997000	0.88414	1.843000	0.53566	0.455000	0.32223	TAT		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			Missense_Mutation
DUSP9	1852	genome.wustl.edu	37	X	152915581	152915581	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chrX:152915581A>T	ENST00000342782.3	+	4	1241	c.976A>T	c.(976-978)Aac>Tac	p.N326Y	DUSP9_ENST00000370167.4_Missense_Mutation_p.N326Y			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	326	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.N326Y(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAAGAAGTCTAACATCTCCCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	X											273.0	235.0	248.0					X																	152915581		2203	4300	6503	152568775	SO:0001583	missense	1852			Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.976A>T	X.37:g.152915581A>T	ENSP00000345853:p.Asn326Tyr	Somatic		Capture	Illumina GAIIx	4	152568775	D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	37	CCDS14724.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	a	23.7	4.449341	0.84101	.	.	ENSG00000130829	ENST00000370167;ENST00000342782	D;D	0.85773	-2.03;-2.03	4.53	4.53	0.55603	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.077205	0.52532	D	0.000075	D	0.90164	0.6926	M	0.63208	1.945	0.53688	D	0.999976	D	0.89917	1.0	D	0.79784	0.993	D	0.90894	0.4763	10	0.72032	D	0.01	.	12.2239	0.54449	1.0:0.0:0.0:0.0	.	326	Q99956	DUS9_HUMAN	Y	326	ENSP00000359186:N326Y;ENSP00000345853:N326Y	ENSP00000345853:N326Y	N	+	1	0	DUSP9	152568775	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	6.934000	0.75880	1.799000	0.52666	0.430000	0.28490	AAC		0.592	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	NM_001395		Missense_Mutation
MBNL1	4154	genome.wustl.edu	37	3	152018065	152018065	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr3:152018065C>G	ENST00000463374.1	+	1	594	c.83C>G	c.(82-84)tCa>tGa	p.S28*	MBNL1_ENST00000355460.2_Nonsense_Mutation_p.S28*|MBNL1_ENST00000461436.1_3'UTR|MBNL1_ENST00000485509.1_Nonsense_Mutation_p.S28*|MBNL1_ENST00000324210.5_Nonsense_Mutation_p.S28*|MBNL1_ENST00000498502.1_Nonsense_Mutation_p.S28*|MBNL1_ENST00000485910.1_Nonsense_Mutation_p.S28*|MBNL1_ENST00000282486.6_Nonsense_Mutation_p.S28*|MBNL1_ENST00000357472.3_Nonsense_Mutation_p.S28*|MBNL1_ENST00000324196.5_Nonsense_Mutation_p.S28*|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000545754.1_Nonsense_Mutation_p.S28*|MBNL1_ENST00000492948.1_Nonsense_Mutation_p.S28*|MBNL1_ENST00000282488.7_Nonsense_Mutation_p.S28*	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	28					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S28*(2)		endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GGGACTTGCTCACGGCCAGAC	0.438																																																2	Substitution - Nonsense(2)	ovary(2)	3											107.0	103.0	104.0					3																	152018065		2203	4300	6503	153500755	SO:0001587	stop_gained	4154			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.83C>G	3.37:g.152018065C>G	ENSP00000418108:p.Ser28*	Somatic		Capture	Illumina GAIIx	4	153500755	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Nonsense_Mutation	SNP	ENST00000463374.1	37	CCDS3165.1	SNP	29	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	9.042665|9.042665	0.99046|0.99046	.|.	.|.	ENSG00000152601|ENSG00000152601	ENST00000464596|ENST00000282486;ENST00000282488;ENST00000355460;ENST00000324210;ENST00000498502;ENST00000324196;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948;ENST00000485509	.|.	.|.	.|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|0.146378	.|0.48286	.|D	.|0.000200	T|.	0.81583|.	0.4853|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	D|.	0.83541|.	0.0096|.	3|.	.|0.72032	.|D	.|0.01	.|.	19.297|19.297	0.94126|0.94126	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	27|28	.|.	.|ENSP00000282486:S28X	H|S	+|+	1|2	0|0	MBNL1|MBNL1	153500755|153500755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.847000|5.847000	0.69451|0.69451	2.561000|2.561000	0.86390|0.86390	0.586000|0.586000	0.80456|0.80456	CAC|TCA		0.438	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038		Nonsense_Mutation
MPP1	4354	genome.wustl.edu	37	X	154020120	154020120	+	Silent	SNP	T	T	A			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chrX:154020120T>A	ENST00000369534.3	-	3	396	c.249A>T	c.(247-249)ggA>ggT	p.G83G	MPP1_ENST00000462825.1_Intron|MPP1_ENST00000393531.1_Silent_p.G83G|MPP1_ENST00000413259.3_Silent_p.G53G	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	83	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.G83G(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCAGCGTGATTCCCTGAAATA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	X											110.0	85.0	94.0					X																	154020120		2203	4300	6503	153673314	SO:0001819	synonymous_variant	4354				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.249A>T	X.37:g.154020120T>A		Somatic		Capture	Illumina GAIIx	4	153673314	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Silent	SNP	ENST00000369534.3	37	CCDS14762.1	SNP	62	WashU																																																																																				0.418	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436		Silent
YY1AP1	55249	genome.wustl.edu	37	1	155638494	155638494	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:155638494G>C	ENST00000295566.4	-	9	964	c.941C>G	c.(940-942)aCc>aGc	p.T314S	YY1AP1_ENST00000368339.5_Missense_Mutation_p.T406S|YY1AP1_ENST00000405763.3_Missense_Mutation_p.T406S|YY1AP1_ENST00000368340.5_Missense_Mutation_p.T386S|YY1AP1_ENST00000361831.5_Missense_Mutation_p.T257S|YY1AP1_ENST00000311573.5_Missense_Mutation_p.T237S|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000347088.5_Missense_Mutation_p.T268S|YY1AP1_ENST00000407221.1_Missense_Mutation_p.T237S|YY1AP1_ENST00000359205.5_Missense_Mutation_p.T257S|YY1AP1_ENST00000368330.2_Missense_Mutation_p.T268S|YY1AP1_ENST00000476093.1_5'Flank|YY1AP1_ENST00000355499.4_Missense_Mutation_p.T268S|YY1AP1_ENST00000404643.1_Missense_Mutation_p.T248S|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000535662.1_Missense_Mutation_p.T114S	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	314					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T314S(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGTCTTGCAGGTTAGAAGGTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											251.0	213.0	226.0					1																	155638494		2203	4300	6503	153905118	SO:0001583	missense	55249			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.941C>G	1.37:g.155638494G>C	ENSP00000295566:p.Thr314Ser	Somatic		Capture	Illumina GAIIx	4	153905118	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	37	CCDS1115.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531389	0.64972	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662;ENST00000405763	T;T;T;T;T;T;T;T;T;T;T;T	0.25414	1.84;1.84;1.86;1.84;1.84;1.85;1.86;1.84;1.86;1.87;1.8;1.87	3.4	3.4	0.38934	.	0.196398	0.34223	N	0.004150	T	0.28300	0.0699	M	0.68952	2.095	0.80722	D	1	P;D;P;P;D;P;P	0.64830	0.894;0.994;0.763;0.944;0.994;0.945;0.838	P;P;B;P;P;P;B	0.58520	0.591;0.84;0.43;0.671;0.791;0.539;0.414	T	0.08994	-1.0695	10	0.14656	T	0.56	.	14.9327	0.70929	0.0:0.0:1.0:0.0	.	334;406;248;406;314;268;386	B4DQQ0;B4DMP2;Q9H869-4;B0QZ55;Q9H869;Q9H869-2;Q5VYZ1	.;.;.;.;YYAP1_HUMAN;.;.	S	257;268;237;268;257;386;314;268;237;248;406;114;406	ENSP00000352134:T257S;ENSP00000347686:T268S;ENSP00000311138:T237S;ENSP00000316079:T268S;ENSP00000355298:T257S;ENSP00000357324:T386S;ENSP00000295566:T314S;ENSP00000357314:T268S;ENSP00000385791:T237S;ENSP00000385390:T248S;ENSP00000357323:T406S;ENSP00000437926:T114S	ENSP00000295566:T314S	T	-	2	0	YY1AP1	153905118	0.998000	0.40836	0.989000	0.46669	0.993000	0.82548	6.319000	0.72871	1.879000	0.54435	0.462000	0.41574	ACC		0.418	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118		Missense_Mutation
KIF4B	285643	genome.wustl.edu	37	5	154394266	154394266	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr5:154394266G>T	ENST00000435029.4	+	1	1007	c.847G>T	c.(847-849)Ggt>Tgt	p.G283C		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	283	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.G283C(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGACAAAAAGGGTAGCTTTGT	0.458																																																1	Substitution - Missense(1)	ovary(1)	5											161.0	163.0	162.0					5																	154394266		2203	4300	6503	154374459	SO:0001583	missense	285643			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.847G>T	5.37:g.154394266G>T	ENSP00000387875:p.Gly283Cys	Somatic		Capture	Illumina GAIIx	4	154374459		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	g	8.918	0.960277	0.18507	.	.	ENSG00000226650	ENST00000435029	T	0.75154	-0.91	1.48	-0.668	0.11392	Kinesin, motor domain (3);	.	.	.	.	T	0.71005	0.3289	M	0.81179	2.53	0.44539	D	0.99749	B	0.15930	0.015	B	0.29077	0.098	T	0.61623	-0.7025	9	0.48119	T	0.1	.	4.1331	0.10158	0.1754:0.2427:0.5819:0.0	.	283	Q2VIQ3	KIF4B_HUMAN	C	283	ENSP00000387875:G283C	ENSP00000387875:G283C	G	+	1	0	KIF4B	154374459	0.999000	0.42202	0.924000	0.36721	0.988000	0.76386	1.551000	0.36233	-0.218000	0.10018	0.563000	0.77884	GGT		0.458	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			Missense_Mutation
FCRL5	83416	genome.wustl.edu	37	1	157512668	157512668	+	Silent	SNP	A	A	C			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:157512668A>C	ENST00000361835.3	-	6	1261	c.1104T>G	c.(1102-1104)gcT>gcG	p.A368A	FCRL5_ENST00000368190.3_Silent_p.A368A|FCRL5_ENST00000368189.3_Silent_p.A368A|FCRL5_ENST00000356953.4_Silent_p.A368A|FCRL5_ENST00000368191.3_Silent_p.A283A	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	368	Ig-like C2-type 3.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)		p.A368A(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGAGGCTCACAGCCTTACTGG	0.557																																																1	Substitution - coding silent(1)	ovary(1)	1											127.0	121.0	123.0					1																	157512668		2203	4300	6503	155779292	SO:0001819	synonymous_variant	83416			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1104T>G	1.37:g.157512668A>C		Somatic		Capture	Illumina GAIIx	4	155779292	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	CCDS1165.1	SNP	7	WashU																																																																																				0.557	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		Silent
PKP4	8502	genome.wustl.edu	37	2	159519424	159519424	+	Missense_Mutation	SNP	G	G	A	rs374838936		TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:159519424G>A	ENST00000389759.3	+	14	2339	c.2227G>A	c.(2227-2229)Gtg>Atg	p.V743M	PKP4_ENST00000389757.3_Missense_Mutation_p.V743M|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	743					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)		p.V743M(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GGAGAACTGCGTGTGCACCCT	0.498										HNSCC(62;0.18)																																						1	Substitution - Missense(1)	ovary(1)	2						G	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	55.0	57.0	56.0		2227,2227	5.7	1.0	2		56	0,8600		0,0,4300	no	missense,missense	PKP4	NM_001005476.1,NM_003628.3	21,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	743/1150,743/1193	159519424	1,13005	2203	4300	6503	159227670	SO:0001583	missense	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2227G>A	2.37:g.159519424G>A	ENSP00000374409:p.Val743Met	Somatic		Capture	Illumina GAIIx	4	159227670	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	17.27	3.345785	0.61073	2.27E-4	0.0	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	D;D	0.84944	-1.92;-1.92	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.258302	0.39274	N	0.001416	D	0.91240	0.7239	M	0.62209	1.925	0.80722	D	1	D;D;P;D	0.71674	0.992;0.994;0.614;0.998	P;P;B;D	0.65010	0.79;0.848;0.135;0.931	D	0.91520	0.5234	10	0.87932	D	0	-10.6953	19.8968	0.96969	0.0:0.0:1.0:0.0	.	698;743;743;594	Q4W5T8;Q99569-2;Q99569;F8W7E2	.;.;PKP4_HUMAN;.	M	594;743;743	ENSP00000374407:V743M;ENSP00000374409:V743M	ENSP00000374407:V743M	V	+	1	0	PKP4	159227670	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.106000	0.64597	2.691000	0.91804	0.655000	0.94253	GTG		0.498	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1			Missense_Mutation
USP21	27005	genome.wustl.edu	37	1	161132065	161132065	+	Silent	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:161132065C>T	ENST00000289865.8	+	4	887	c.666C>T	c.(664-666)ttC>ttT	p.F222F	RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368002.3_Silent_p.F222F|USP21_ENST00000368001.1_Silent_p.F222F	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	222	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.F222F(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCCAGTGCTTCCTGAATGCTG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	1											74.0	73.0	73.0					1																	161132065		2203	4300	6503	159398689	SO:0001819	synonymous_variant	27005			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.666C>T	1.37:g.161132065C>T		Somatic		Capture	Illumina GAIIx	4	159398689	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	ENST00000289865.8	37	CCDS30920.1	SNP	30	WashU																																																																																				0.587	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1			Missense_Mutation
BAZ2B	29994	genome.wustl.edu	37	2	160240191	160240191	+	Splice_Site	SNP	A	A	T			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:160240191A>T	ENST00000392783.2	-	24	4182	c.3687T>A	c.(3685-3687)agT>agA	p.S1229R	BAZ2B_ENST00000392782.1_Splice_Site_p.S1193R|BAZ2B_ENST00000343439.5_Splice_Site_p.S1129R|BAZ2B_ENST00000355831.2_Splice_Site_p.S1195R|AC008277.1_ENST00000420020.1_RNA	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S1229R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TGTCGATTTCACTGCCAATGC	0.284																																																1	Substitution - Missense(1)	ovary(1)	2											112.0	99.0	103.0					2																	160240191		1824	4064	5888	159948437	SO:0001630	splice_region_variant	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.3687-1T>A	2.37:g.160240191A>T		Somatic		Capture	Illumina GAIIx	4	159948437	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	17.91	3.503747	0.64298	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.58210	0.43;0.44;0.43;0.35	5.77	5.77	0.91146	.	0.000000	0.43416	U	0.000568	T	0.56187	0.1968	N	0.15975	0.35	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.83275	0.962;0.996	T	0.55509	-0.8130	10	0.24483	T	0.36	.	16.3892	0.83528	1.0:0.0:0.0:0.0	.	1193;1229	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	R	1193;1229;1195;1129	ENSP00000376533:S1193R;ENSP00000376534:S1229R;ENSP00000348087:S1195R;ENSP00000339670:S1129R	ENSP00000339670:S1129R	S	-	3	2	BAZ2B	159948437	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.472000	0.53114	2.330000	0.79161	0.477000	0.44152	AGT		0.284	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		Missense_Mutation	Missense_Mutation
LPA	4018	genome.wustl.edu	37	6	161056238	161056238	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr6:161056238G>A	ENST00000316300.5	-	7	1036	c.992C>T	c.(991-993)aCg>aTg	p.T331M	LPA_ENST00000447678.1_Missense_Mutation_p.T331M			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2839	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.T331M(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGAGCATTGCGTCAGGTTGCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											15.0	22.0	20.0					6																	161056238		1285	3178	4463	160976228	SO:0001583	missense	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.992C>T	6.37:g.161056238G>A	ENSP00000321334:p.Thr331Met	Somatic		Capture	Illumina GAIIx	4	160976228	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	g	11.75	1.731506	0.30684	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62941	-0.01;-0.01	2.18	-4.21	0.03812	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.50888	0.1642	L	0.52206	1.635	0.09310	N	1	D	0.65815	0.995	D	0.74674	0.984	T	0.46884	-0.9159	9	0.66056	D	0.02	.	4.0039	0.09592	0.0:0.2444:0.1964:0.5591	.	2839	P08519	APOA_HUMAN	M	331	ENSP00000321334:T331M;ENSP00000395608:T331M	ENSP00000321334:T331M	T	-	2	0	LPA	160976228	0.000000	0.05858	0.291000	0.24904	0.025000	0.11179	-1.165000	0.03132	-1.022000	0.03346	0.184000	0.17185	ACG		0.562	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		Missense_Mutation
DDX60L	91351	genome.wustl.edu	37	4	169315648	169315648	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr4:169315648C>G	ENST00000511577.1	-	28	4025	c.3778G>C	c.(3778-3780)Gtt>Ctt	p.V1260L	DDX60L_ENST00000260184.7_Missense_Mutation_p.V1260L|DDX60L_ENST00000505890.1_Missense_Mutation_p.V1261L			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1260	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)	p.V1261L(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AGTATCTCAACAAACTCTTTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											86.0	79.0	81.0					4																	169315648		1817	4076	5893	169552223	SO:0001583	missense	91351			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3778G>C	4.37:g.169315648C>G	ENSP00000422423:p.Val1260Leu	Somatic		Capture	Illumina GAIIx	4	169552223	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		SNP	17	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.82|15.82	2.946868|2.946868	0.53186|0.53186	.|.	.|.	ENSG00000181381|ENSG00000181381	ENST00000514580|ENST00000260184;ENST00000511577;ENST00000505890	.|T;T;T	.|0.49139	.|0.79;0.79;0.79	3.16|3.16	2.27|2.27	0.28462|0.28462	.|Helicase, C-terminal (3);	.|0.581240	.|0.12157	.|U	.|0.494365	T|T	0.62829|0.62829	0.2460|0.2460	M|M	0.79614|0.79614	2.46|2.46	0.09310|0.09310	N|N	0.999999|0.999999	.|D;D	.|0.67145	.|0.996;0.994	.|P;P	.|0.59825	.|0.864;0.772	T|T	0.51348|0.51348	-0.8717|-0.8717	5|10	.|0.87932	.|D	.|0	.|.	9.7436|9.7436	0.40433|0.40433	0.0:0.8807:0.0:0.1193|0.0:0.8807:0.0:0.1193	.|.	.|1261;1260	.|D6R906;Q5H9U9	.|.;DDX6L_HUMAN	S|L	147|1260;1260;1261	.|ENSP00000260184:V1260L;ENSP00000422423:V1260L;ENSP00000422202:V1261L	.|ENSP00000260184:V1260L	C|V	-|-	2|1	0|0	DDX60L|DDX60L	169552223|169552223	0.940000|0.940000	0.31905|0.31905	0.033000|0.033000	0.17914|0.17914	0.171000|0.171000	0.22731|0.22731	2.660000|2.660000	0.46749|0.46749	1.453000|1.453000	0.47775|0.47775	0.467000|0.467000	0.42956|0.42956	TGT|GTT		0.358	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179458169	179458169	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:179458169G>C	ENST00000591111.1	-	249	54067	c.53843C>G	c.(53842-53844)aCa>aGa	p.T17948R	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T17021R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T10649R|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.T10524R|TTN_ENST00000589042.1_Missense_Mutation_p.T19589R|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T10716R|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17948	Fibronectin type-III 30. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T17019R(1)|p.T10524R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTAACTTCTGTAACAATTGG	0.363																																																2	Substitution - Missense(2)	ovary(2)	2											62.0	61.0	61.0					2																	179458169		1860	4101	5961	179166415	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.53843C>G	2.37:g.179458169G>C	ENSP00000465570:p.Thr17948Arg	Somatic		Capture	Illumina GAIIx	4	179166415	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	9.485	1.099264	0.20552	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54967	0.1891	L	0.55990	1.75	0.34614	D	0.717838	P;P;P;P	0.34864	0.473;0.473;0.473;0.473	B;B;B;B	0.34931	0.192;0.192;0.192;0.192	T	0.68262	-0.5455	9	0.87932	D	0	.	13.6708	0.62424	0.0:0.0:0.7491:0.2509	.	10524;10649;10716;17948	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	17021;10524;10716;10649;10522	ENSP00000343764:T17021R;ENSP00000434586:T10524R;ENSP00000340554:T10716R;ENSP00000352154:T10649R	ENSP00000340554:T10716R	T	-	2	0	TTN	179166415	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.998000	0.57024	2.937000	0.99478	0.650000	0.86243	ACA		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179605096	179605096	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:179605096C>A	ENST00000591111.1	-	46	12137	c.11913G>T	c.(11911-11913)gaG>gaT	p.E3971D	TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E4050D|TTN_ENST00000460472.2_Missense_Mutation_p.E3925D|TTN_ENST00000589042.1_Missense_Mutation_p.E4288D|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E4117D|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E3925D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGACTAGGGGCTCATAGTTTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	2											70.0	66.0	67.0					2																	179605096		1913	4124	6037	179313341	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11913G>T	2.37:g.179605096C>A	ENSP00000465570:p.Glu3971Asp	Somatic		Capture	Illumina GAIIx	4	179313341	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	10.90	1.482262	0.26598	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;D;D	0.81821	-1.38;-1.53;-1.54	5.3	0.0206	0.14125	.	.	.	.	.	T	0.68622	0.3021	L	0.36672	1.1	0.21984	N	0.999435	B;B;B	0.16603	0.018;0.018;0.018	B;B;B	0.15052	0.012;0.012;0.012	T	0.59473	-0.7448	9	0.87932	D	0	.	5.4843	0.16741	0.1308:0.4094:0.0:0.4598	.	3925;4050;4117	D3DPF9;E7EQE6;E7ET18	.;.;.	D	3925;4117;4050;3925	ENSP00000434586:E3925D;ENSP00000340554:E4117D;ENSP00000352154:E4050D	ENSP00000340554:E4117D	E	-	3	2	TTN	179313341	0.996000	0.38824	0.765000	0.31456	0.888000	0.51559	0.296000	0.19083	0.171000	0.19730	0.655000	0.94253	GAG		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
ATP13A3	79572	genome.wustl.edu	37	3	194152547	194152547	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr3:194152547C>A	ENST00000439040.1	-	22	3111	c.2320G>T	c.(2320-2322)Gct>Tct	p.A774S	ATP13A3_ENST00000256031.4_Missense_Mutation_p.A774S			Q9H7F0	AT133_HUMAN	ATPase type 13A3	774						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.A774S(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		AATGCTTCAGCAATAATCACT	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	81.0	83.0					3																	194152547		1923	4139	6062	195633836	SO:0001583	missense	79572			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.2320G>T	3.37:g.194152547C>A	ENSP00000416508:p.Ala774Ser	Somatic		Capture	Illumina GAIIx	4	195633836	Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	CCDS43187.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	34	5.390934	0.95988	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	T;T	0.67523	-0.27;-0.27	5.71	5.71	0.89125	HAD-like domain (1);	0.048651	0.85682	D	0.000000	T	0.70456	0.3226	L	0.31845	0.965	0.80722	D	1	P	0.39157	0.662	P	0.53035	0.716	T	0.61642	-0.7021	10	0.15952	T	0.53	-0.4359	19.8593	0.96777	0.0:1.0:0.0:0.0	.	774	Q9H7F0	AT133_HUMAN	S	774;774;512	ENSP00000416508:A774S;ENSP00000256031:A774S	ENSP00000256031:A774S	A	-	1	0	ATP13A3	195633836	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.175000	0.77632	2.700000	0.92200	0.557000	0.71058	GCT		0.403	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524		Missense_Mutation
ALS2CR11	151254	genome.wustl.edu	37	2	202430564	202430564	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:202430564G>T	ENST00000286195.3	-	9	909	c.865C>A	c.(865-867)Cca>Aca	p.P289T	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.P289T|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.P289T|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.P289T	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	289								p.P289T(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						AAGAATGCTGGATATTCTACT	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											86.0	85.0	85.0					2																	202430564		2203	4300	6503	202138809	SO:0001583	missense	151254			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.865C>A	2.37:g.202430564G>T	ENSP00000286195:p.Pro289Thr	Somatic		Capture	Illumina GAIIx	4	202138809	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	37	CCDS2349.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909670	0.72983	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000026	T	0.63943	0.2554	M	0.65498	2.005	0.39143	D	0.962088	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;1.0	T	0.68262	-0.5455	10	0.87932	D	0	.	16.4188	0.83752	0.0:0.0:1.0:0.0	.	289;289;289	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	T	289	ENSP00000286195:P289T;ENSP00000400672:P289T;ENSP00000409937:P289T;ENSP00000399016:P289T	ENSP00000286195:P289T	P	-	1	0	ALS2CR11	202138809	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.431000	0.52814	2.602000	0.87976	0.655000	0.94253	CCA		0.388	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525		Missense_Mutation
CD34	947	genome.wustl.edu	37	1	208062048	208062048	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:208062048C>G	ENST00000310833.7	-	7	1272	c.951G>C	c.(949-951)tgG>tgC	p.W317C	CD34_ENST00000356522.4_Missense_Mutation_p.W317C|CD34_ENST00000367036.3_Missense_Mutation_p.W159C|CD34_ENST00000485761.1_5'UTR|CD34_ENST00000537704.1_Missense_Mutation_p.W182C	NM_001025109.1	NP_001020280.1	P28906	CD34_HUMAN	CD34 molecule	317					cell motility (GO:0048870)|cell proliferation (GO:0008283)|endothelial cell proliferation (GO:0001935)|endothelium development (GO:0003158)|extracellular vesicular exosome assembly (GO:0071971)|glomerular endothelium development (GO:0072011)|glomerular filtration (GO:0003094)|glutamate metabolic process (GO:0006536)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|leukocyte migration (GO:0050900)|mesangial cell-matrix adhesion (GO:0035759)|metanephric glomerular mesangial cell differentiation (GO:0072254)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cellular response to heat (GO:1900035)|negative regulation of cellular response to hypoxia (GO:1900038)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of neuron death (GO:1901215)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of tumor necrosis factor production (GO:0032720)|paracrine signaling (GO:0038001)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|positive regulation of glial cell line-derived neurotrophic factor secretion (GO:1900168)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of odontogenesis (GO:0042482)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasculogenesis (GO:2001214)|regulation of blood pressure (GO:0008217)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|stem cell proliferation (GO:0072089)|tissue homeostasis (GO:0001894)|transdifferentiation (GO:0060290)|vascular wound healing (GO:0061042)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|glomerular endothelium fenestra (GO:0036053)|integral component of plasma membrane (GO:0005887)|intercellular bridge (GO:0045171)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|sulfate binding (GO:0043199)|transcription factor binding (GO:0008134)	p.W317C(1)		kidney(2)|large_intestine(2)|lung(8)|ovary(1)	13						CTGTGGGGCTCCAGCTGCGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											206.0	224.0	218.0					1																	208062048		2203	4300	6503	206128671	SO:0001583	missense	947			M81104	CCDS31011.1, CCDS31012.1	1q32	2008-02-05	2006-03-28		ENSG00000174059	ENSG00000174059		"""CD molecules"""	1662	protein-coding gene	gene with protein product		142230	"""CD34 antigen"""			1370171, 1374051	Standard	NM_001025109		Approved		uc001hgw.1	P28906	OTTHUMG00000036565	ENST00000310833.7:c.951G>C	1.37:g.208062048C>G	ENSP00000310036:p.Trp317Cys	Somatic		Capture	Illumina GAIIx	4	206128671	A8K664|Q15970|Q15971|Q5JTA3|Q5JTA4|Q9UJB1	Missense_Mutation	SNP	ENST00000310833.7	37	CCDS31011.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549233	0.65311	.	.	ENSG00000174059	ENST00000310833;ENST00000356522;ENST00000367036;ENST00000537704;ENST00000367037	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	4.54	4.54	0.55810	.	0.000000	0.53938	D	0.000049	T	0.49864	0.1582	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.52866	-0.8518	10	0.87932	D	0	-6.3435	13.0066	0.58707	0.0:1.0:0.0:0.0	.	182;317;317;159	B4DG27;P28906-2;P28906;Q5JTA5	.;.;CD34_HUMAN;.	C	317;317;159;182;287	ENSP00000310036:W317C;ENSP00000348916:W317C;ENSP00000356003:W159C;ENSP00000442874:W182C	ENSP00000310036:W317C	W	-	3	0	CD34	206128671	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.963000	0.56773	2.524000	0.85096	0.650000	0.86243	TGG		0.557	CD34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088933.1	NM_001773		Missense_Mutation
RBM34	23029	genome.wustl.edu	37	1	235324283	235324283	+	Silent	SNP	A	A	G			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:235324283A>G	ENST00000408888.3	-	2	383	c.153T>C	c.(151-153)ggT>ggC	p.G51G	RBM34_ENST00000366606.3_Silent_p.G46G			P42696	RBM34_HUMAN	RNA binding motif protein 34	51						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G51G(1)		central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			GACCGGTGCCACCTCTGGAAT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	1											44.0	49.0	47.0					1																	235324283		1930	4132	6062	233390906	SO:0001819	synonymous_variant	23029				CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.153T>C	1.37:g.235324283A>G		Somatic		Capture	Illumina GAIIx	4	233390906	A8K8J7|Q8N2Z8|Q9H5A1	Silent	SNP	ENST00000408888.3	37	CCDS41477.2	SNP	6	WashU																																																																																				0.592	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014		Silent
TRIM46	80128	genome.wustl.edu	37	1	155154504	155154504	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:155154504C>G	ENST00000334634.4	+	9	1765	c.1765C>G	c.(1765-1767)Cag>Gag	p.Q589E	TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000543729.1_3'UTR|TRIM46_ENST00000392451.2_3'UTR|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_Missense_Mutation_p.Q463E|TRIM46_ENST00000368382.1_Missense_Mutation_p.Q566E|TRIM46_ENST00000368383.3_Missense_Mutation_p.Q589E	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	589	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q589E(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGCTGTGACCCAGGGCCGCAG	0.657																																																1	Substitution - Missense(1)	ovary(1)	1											25.0	24.0	24.0					1																	155154504		2203	4300	6503	153421128	SO:0001583	missense	80128				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1765C>G	1.37:g.155154504C>G	ENSP00000334657:p.Gln589Glu	Somatic		Capture	Illumina GAIIx	4	153421128	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	CCDS1097.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729699	0.30684	.	.	ENSG00000163462	ENST00000430513;ENST00000545012;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T	0.60548	0.18;2.61;0.18;0.18	4.06	4.06	0.47325	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000002	T	0.31918	0.0812	L	0.40543	1.245	0.35632	D	0.810265	B;B	0.17667	0.023;0.023	B;B	0.22880	0.042;0.028	T	0.33033	-0.9884	10	0.49607	T	0.09	.	9.3644	0.38215	0.2134:0.7866:0.0:0.0	.	589;589	Q5VT61;Q7Z4K8	.;TRI46_HUMAN	E	547;463;589;566;589	ENSP00000440254:Q463E;ENSP00000357367:Q589E;ENSP00000357366:Q566E;ENSP00000334657:Q589E	ENSP00000334657:Q589E	Q	+	1	0	TRIM46	153421128	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.538000	0.45710	2.285000	0.76669	0.561000	0.74099	CAG		0.657	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058		Missense_Mutation
KDM5B	10765	genome.wustl.edu	37	1	202711576	202711576	+	Frame_Shift_Ins	INS	-	-	C			TCGA-13-0755-01	TCGA-13-0755-10	-	C	C	C	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:202711576_202711576insC	ENST00000367265.3	-	18	3696	c.2532_2532insG	c.(2530-2532)cagfs	p.Q844fs	KDM5B_ENST00000367264.2_Frame_Shift_Ins_p.Q880fs	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	844					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.F982fs*32(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GTGTTACAAACTGCCGGAGCT	0.438																																																1	Insertion - Frameshift(1)	ovary(1)	1											158.0	145.0	150.0					1																	202711576		2203	4300	6503	200978199	SO:0001589	frameshift_variant				AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.2533dupG	1.37:g.202711576_202711576dupC	ENSP00000356234:p.Gln844fs	Somatic		Capture	Illumina GAIIx	Phase_III	200978199	O95811|Q15752|Q9Y3Q5	Frame_Shift_Ins	INS	ENST00000367265.3	37	CCDS30974.1	INS	20	WashU																																																																																				0.438	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		Frame_Shift_Ins
CEP170	9859	genome.wustl.edu	37	1	243336021	243336021	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:243336021G>A	ENST00000366542.1	-	11	1745	c.1694C>T	c.(1693-1695)aCa>aTa	p.T565I	CEP170_ENST00000366543.1_Missense_Mutation_p.T467I|CEP170_ENST00000366544.1_Missense_Mutation_p.T467I	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	565						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.T565I(1)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AAATCCAGATGTAGTCAGTGG	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											35.0	34.0	34.0					1																	243336021		1803	4067	5870	241402644	SO:0001583	missense	9859			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1694C>T	1.37:g.243336021G>A	ENSP00000355500:p.Thr565Ile	Somatic		Capture	Illumina GAIIx	4	241402644	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	SNP	48	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.38|11.38	1.622553|1.622553	0.28889|0.28889	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543	.|T;T;T	.|0.46451	.|0.87;0.89;0.88	5.35|5.35	4.44|4.44	0.53790|0.53790	.|.	.|0.471757	.|0.23799	.|N	.|0.044443	T|T	0.33206|0.33206	0.0855|0.0855	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.06786	.|0.001;0.001;0.0	.|B;B;B	.|0.06405	.|0.001;0.002;0.001	T|T	0.07712|0.07712	-1.0758|-1.0758	5|10	.|0.34782	.|T	.|0.22	-5.0144|-5.0144	12.3733|12.3733	0.55265|0.55265	0.0785:0.0:0.9215:0.0|0.0785:0.0:0.9215:0.0	.|.	.|467;467;565	.|Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;CE170_HUMAN	Y|I	529|565;467;467	.|ENSP00000355500:T565I;ENSP00000355502:T467I;ENSP00000355501:T467I	.|ENSP00000355500:T565I	H|T	-|-	1|2	0|0	CEP170|CEP170	241402644|241402644	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.456000|0.456000	0.32438|0.32438	4.391000|4.391000	0.59652|0.59652	1.265000|1.265000	0.44215|0.44215	0.455000|0.455000	0.32223|0.32223	CAT|ACA		0.348	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812		Missense_Mutation
ROBO4	54538	genome.wustl.edu	37	11	124763776	124763776	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0755-01	TCGA-13-0755-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr11:124763776G>T	ENST00000306534.3	-	9	1969	c.1484C>A	c.(1483-1485)gCt>gAt	p.A495D	ROBO4_ENST00000533054.1_Missense_Mutation_p.A350D|ROBO4_ENST00000526899.1_5'Flank	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	495					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.A495D(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GTGCACCCTAGCTCGGCGCCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	11											19.0	23.0	22.0					11																	124763776		2200	4297	6497	124268986	SO:0001583	missense	54538			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1484C>A	11.37:g.124763776G>T	ENSP00000304945:p.Ala495Asp	Somatic		Capture	Illumina GAIIx	4	124268986	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	CCDS8455.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391812	0.62066	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.64260	-0.09;0.27	5.31	4.34	0.51931	.	0.000000	0.37219	N	0.002184	T	0.65606	0.2707	M	0.63428	1.95	0.09310	N	1	P;D;P	0.53151	0.571;0.958;0.915	B;P;B	0.51229	0.395;0.663;0.374	T	0.59867	-0.7373	10	0.42905	T	0.14	.	11.1115	0.48235	0.0:0.1866:0.8134:0.0	.	495;385;495	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	D	495;385;350	ENSP00000304945:A495D;ENSP00000437129:A350D	ENSP00000304945:A495D	A	-	2	0	ROBO4	124268986	0.030000	0.19436	0.257000	0.24404	0.949000	0.60115	2.179000	0.42528	2.481000	0.83766	0.655000	0.94253	GCT		0.632	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055		Missense_Mutation
FBXL14	144699	genome.wustl.edu	37	12	1702231	1702231	+	Silent	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:1702231C>T	ENST00000339235.3	-	1	1100	c.1002G>A	c.(1000-1002)acG>acA	p.T334T	WNT5B_ENST00000537031.1_Intron|FBXL14_ENST00000543278.1_5'Flank	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	334					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)	p.T334T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			CAATGTTGAGCGTGCGCAGCC	0.617																																																1	Substitution - coding silent(1)	ovary(1)	12											121.0	100.0	107.0					12																	1702231		2203	4300	6503	1572492	SO:0001819	synonymous_variant	144699			BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.1002G>A	12.37:g.1702231C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	1572492		Silent	SNP	ENST00000339235.3	37	CCDS8509.1	SNP	27	WashU																																																																																				0.617	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206741.1	NM_152441		Silent
SFSWAP	6433	genome.wustl.edu	37	12	132283985	132283985	+	Silent	SNP	C	C	T			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr12:132283985C>T	ENST00000261674.4	+	18	2949	c.2808C>T	c.(2806-2808)gtC>gtT	p.V936V	RNA5SP378_ENST00000363646.1_RNA|SFSWAP_ENST00000539506.1_3'UTR|SFSWAP_ENST00000541286.1_Silent_p.V988V	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	936	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)	p.V936V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						TGGCCAAAGTCAGAGCGATGC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	12											64.0	56.0	59.0					12																	132283985		2203	4300	6503	130849938	SO:0001819	synonymous_variant	6433			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.2808C>T	12.37:g.132283985C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	130849938	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Silent	SNP	ENST00000261674.4	37	CCDS9273.1	SNP	29	WashU																																																																																				0.592	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592		Silent
AVPR1B	553	genome.wustl.edu	37	1	206225335	206225335	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0755-01	TCGA-13-0755-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr1:206225335delA	ENST00000367126.4	+	1	1360	c.895delA	c.(895-897)agtfs	p.S299fs	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	299					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.S299fs*82(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	TCCCTTCTTCAGTGTCCAGAT	0.557																																																1	Deletion - Frameshift(1)	ovary(1)	1											89.0	81.0	84.0					1																	206225335		2203	4300	6503	204391958	SO:0001589	frameshift_variant	553			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.895delA	1.37:g.206225335delA	ENSP00000356094:p.Ser299fs	Somatic		Capture	Illumina GAIIx	PhaseIII	204391958	B0M0J6|Q5TZ00	Frame_Shift_Del	DEL	ENST00000367126.4	37	CCDS30994.1	DEL	7	WashU																																																																																				0.557	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707		Frame_Shift_Del
Unknown	0	genome.wustl.edu	37	3	0	0	+	IGR	DEL	GGGTGAGTAAAAG	GGGTGAGTAAAAG	-			TCGA-13-0755-01	TCGA-13-0755-10	GGGTGAGTAAAAG	GGGTGAGTAAAAG	GGGTGAGTAAAAG	-	GGGTGAGTAAAAG	GGGTGAGTAAAAG	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr3:0delGGGTGAGTAAAAG								None (None upstream) : AY269186.1 (65430 downstream)																							NNNNNNNNNN	0.0																																																0			3																																								144239744	SO:0001628	intergenic_variant	23350																															3.37:g.0delGGGTGAGTAAAAG		Somatic		Capture	Illumina GAIIx	PhaseIII	144239733		Frame_Shift_Del	DEL		37		DEL	7	WashU																																																																																			0	0.000									Frame_Shift_Del
YIPF5	81555	genome.wustl.edu	37	5	143540024	143540032	+	In_Frame_Del	DEL	TTGCTGTCC	TTGCTGTCC	-			TCGA-13-0755-01	TCGA-13-0755-10	TTGCTGTCC	TTGCTGTCC	TTGCTGTCC	-	TTGCTGTCC	TTGCTGTCC	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr5:143540024_143540032delTTGCTGTCC	ENST00000274496.5	-	6	837_845	c.703_711delGGACAGCAA	c.(703-711)ggacagcaadel	p.GQQ235del	YIPF5_ENST00000448443.2_In_Frame_Del_p.GQQ235del|YIPF5_ENST00000513112.1_In_Frame_Del_p.GQQ181del	NM_001271732.1|NM_030799.7	NP_001258661.1|NP_110426.4	Q969M3	YIPF5_HUMAN	Yip1 domain family, member 5	235					protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum exit site (GO:0070971)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)		p.G235_Q237del(1)		large_intestine(2)|lung(5)|ovary(1)|skin(1)	9		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CTACTAAAAGTTGCTGTCCTTCCATGGCT	0.402																																																1	Deletion - In frame(1)	ovary(1)	5																																								143520225	SO:0001651	inframe_deletion	81555			AF318329	CCDS4279.1, CCDS64277.1	5q31.3	2009-01-12			ENSG00000145817	ENSG00000145817		"""Yip1 domain family"""	24877	protein-coding gene	gene with protein product		611483				12975309, 18718466	Standard	NM_001024947		Approved	SMAP-5, FinGER5	uc003lnl.5	Q969M3	OTTHUMG00000129679	ENST00000274496.5:c.703_711delGGACAGCAA	5.37:g.143540024_143540032delTTGCTGTCC	ENSP00000274496:p.Gly235_Gln237del	Somatic		Capture	Illumina GAIIx	PhaseIII	143520217	D3DQF5|Q4VSN6|Q53EX4|Q8NHE5|Q9H338|Q9H3U4	In_Frame_Del	DEL	ENST00000274496.5	37	CCDS4279.1	DEL	60	WashU																																																																																				0.402	YIPF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251882.1	NM_030799		In_Frame_Del
CERS4	79603	genome.wustl.edu	37	19	8322867	8322867	+	Silent	SNP	C	C	A			TCGA-13-0755-01	TCGA-13-0755-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr19:8322867C>A	ENST00000251363.5	+	10	1146	c.846C>A	c.(844-846)acC>acA	p.T282T	CERS4_ENST00000595722.1_3'UTR|CERS4_ENST00000559336.1_Intron|CERS4_ENST00000559450.1_Silent_p.T282T|CERS4_ENST00000558331.1_Silent_p.T231T	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	282	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.T282T(1)									TCTTTCCCACCCAGTGAGTCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	19											201.0	161.0	175.0					19																	8322867		2203	4300	6503	8228867	SO:0001819	synonymous_variant	79603				CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.846C>A	19.37:g.8322867C>A		Somatic		Capture	Illumina GAIIx	PhaseIII	8228867	D6W665	Silent	SNP	ENST00000251363.5	37	CCDS12197.1	SNP	22	WashU																																																																																				0.567	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419200.1	NM_024552		Silent
ASPRV1	151516	genome.wustl.edu	37	2	70188686	70188686	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0755-01	TCGA-13-0755-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0755-01	TCGA-13-0755-10	g.chr2:70188686delT	ENST00000320256.4	-	1	711	c.135delA	c.(133-135)caafs	p.Q45fs	PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1									p.V46fs*14(1)		endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						TGGGGATGACTTGCCCGGCCT	0.637																																																1	Deletion - Frameshift(1)	ovary(1)	2											47.0	48.0	48.0					2																	70188686		2203	4300	6503	70042190	SO:0001589	frameshift_variant	151516			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.135delA	2.37:g.70188686delT	ENSP00000315383:p.Gln45fs	Somatic		Capture	Illumina GAIIx	PhaseIII	70042190		Frame_Shift_Del	DEL	ENST00000320256.4	37	CCDS1897.1	DEL	56	WashU																																																																																				0.637	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792		Frame_Shift_Del
