#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
APC	324	hgsc.bcm.edu	37	5	112175143	112175143	+	Silent	SNP	A	A	G			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr5:112175143A>G	ENST00000457016.1	+	16	4232	c.3852A>G	c.(3850-3852)gaA>gaG	p.E1284E	APC_ENST00000257430.4_Silent_p.E1284E|APC_ENST00000508376.2_Silent_p.E1284E|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1284	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CATCAGCTGAAGATGAAATAG	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Unknown(1)|Deletion - Frameshift(1)	soft_tissue(1)|skin(1)	5											53.0	56.0	55.0					5																	112175143		2202	4300	6502	112203042	SO:0001819	synonymous_variant	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3852A>G	5.37:g.112175143A>G		Somatic		Capture	SOLID	Phase_IV	112203042	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	ENST00000457016.1	37	CCDS4107.1	SNP	3	Baylor																																																																																				0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038		Silent
ART3	419	hgsc.bcm.edu	37	4	77003471	77003471	+	Silent	SNP	A	A	T			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr4:77003471A>T	ENST00000355810.4	+	3	683	c.564A>T	c.(562-564)tcA>tcT	p.S188S	ART3_ENST00000349321.3_Silent_p.S188S|ART3_ENST00000341029.5_Silent_p.S188S|ART3_ENST00000513494.1_3'UTR	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	188					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.S188S(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGGCATATTCAGCCAAACCTC	0.418																																																1	Substitution - coding silent(1)	ovary(1)	4											44.0	42.0	43.0					4																	77003471		2203	4300	6503	77222495	SO:0001819	synonymous_variant	419			X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.564A>T	4.37:g.77003471A>T		Somatic		Capture	SOLID	Phase_IV	77222495	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Silent	SNP	ENST00000355810.4	37	CCDS47079.1	SNP	7	Baylor																																																																																				0.418	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179		Silent
ASTN2	23245	hgsc.bcm.edu	37	9	119739038	119739038	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr9:119739038C>T	ENST00000313400.4	-	8	1718	c.1618G>A	c.(1618-1620)Gcc>Acc	p.A540T	ASTN2_ENST00000361209.2_Missense_Mutation_p.A489T|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.A540T			O75129	ASTN2_HUMAN	astrotactin 2	540	EGF-like 1.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.A489T(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GGGTCAGGGGCATAGCCTTCA	0.498																																																1	Substitution - Missense(1)	ovary(1)	9											106.0	85.0	92.0					9																	119739038		2203	4300	6503	118778859	SO:0001583	missense	23245			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1618G>A	9.37:g.119739038C>T	ENSP00000314038:p.Ala540Thr	Somatic		Capture	SOLID	Phase_IV	118778859	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742578	0.49151	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.12039	2.91;2.91;2.72;2.92	6.02	5.12	0.69794	.	0.061008	0.64402	D	0.000002	T	0.08537	0.0212	N	0.14661	0.345	0.35556	D	0.804273	B;B;B	0.28933	0.228;0.011;0.202	B;B;B	0.33454	0.085;0.003;0.164	T	0.36261	-0.9755	9	.	.	.	-18.7658	8.9517	0.35792	0.2531:0.6791:0.0:0.0677	.	489;540;540	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	T	540;540;267;489	ENSP00000314038:A540T;ENSP00000363108:A540T;ENSP00000363098:A267T;ENSP00000354504:A489T	.	A	-	1	0	ASTN2	118778859	0.911000	0.30947	0.997000	0.53966	0.829000	0.46940	1.767000	0.38501	1.558000	0.49541	0.650000	0.86243	GCC		0.498	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010		Missense_Mutation
ATRX	546	hgsc.bcm.edu	37	X	76919015	76919015	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:76919015delA	ENST00000373344.5	-	12	4190	c.3976delT	c.(3976-3978)tcafs	p.S1326fs	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Frame_Shift_Del_p.S1288fs	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1326	Interaction with DAXX.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S1326fs*20(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCAGAATCTGAATCTGATTCA	0.348			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Unknown(1)|Deletion - Frameshift(1)	ovary(1)|bone(1)	X											67.0	56.0	60.0					X																	76919015		2203	4296	6499	76805671	SO:0001589	frameshift_variant	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3976delT	X.37:g.76919015delA	ENSP00000362441:p.Ser1326fs	Somatic		Capture	SOLID	Phase_IV	76805671	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	ENST00000373344.5	37	CCDS14434.1	DEL	9	Baylor																																																																																				0.348	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		Frame_Shift_Del
AURKC	6795	hgsc.bcm.edu	37	19	57743552	57743552	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr19:57743552C>G	ENST00000302804.7	+	3	442	c.256C>G	c.(256-258)Cac>Gac	p.H86D	AURKC_ENST00000599062.1_Missense_Mutation_p.H83D|AURKC_ENST00000448930.1_Missense_Mutation_p.H52D|AURKC_ENST00000415300.2_Missense_Mutation_p.H67D|AURKC_ENST00000598785.1_Missense_Mutation_p.H52D	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.H52D(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		AGGACTGGAGCACCAGCTGCG	0.502																																																1	Substitution - Missense(1)	ovary(1)	19											57.0	48.0	51.0					19																	57743552		2203	4300	6503	62435364	SO:0001583	missense	6795				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.256C>G	19.37:g.57743552C>G	ENSP00000302898:p.His86Asp	Somatic		Capture	SOLID	Phase_IV	62435364	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	ENST00000302804.7	37	CCDS33128.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252650	0.39797	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.64618	-0.11;-0.11;-0.11	3.6	2.57	0.30868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051108	0.85682	D	0.000000	T	0.39627	0.1085	N	0.03903	-0.33	0.58432	D	0.999999	B;B;B	0.26876	0.084;0.037;0.162	B;B;B	0.34489	0.184;0.083;0.146	T	0.41142	-0.9525	10	0.87932	D	0	-11.3451	9.1607	0.37021	0.0:0.89:0.0:0.11	.	83;86;67	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	D	67;52;86	ENSP00000407162:H67D;ENSP00000406798:H52D;ENSP00000302898:H86D	ENSP00000302898:H86D	H	+	1	0	AURKC	62435364	1.000000	0.71417	0.992000	0.48379	0.849000	0.48306	4.803000	0.62546	1.103000	0.41568	0.555000	0.69702	CAC		0.502	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465089.1	NM_003160		Missense_Mutation
NUGGC	389643	hgsc.bcm.edu	37	8	27886902	27886902	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr8:27886902C>T	ENST00000413272.2	-	17	2177	c.2035G>A	c.(2035-2037)Ggc>Agc	p.G679S	NUGGC_ENST00000341513.6_Missense_Mutation_p.G679S	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	679					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G679S(1)									GCTTTTTTGCCCGTGATCTGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	8											54.0	54.0	54.0					8																	27886902		1992	4171	6163	27942821	SO:0001583	missense	389643			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.2035G>A	8.37:g.27886902C>T	ENSP00000408697:p.Gly679Ser	Somatic		Capture	SOLID	Phase_IV	27942821	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.4	3.990910	0.74703	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.77358	-1.09;-1.09	5.56	4.67	0.58626	.	0.057047	0.64402	D	0.000001	T	0.79604	0.4474	L	0.34521	1.04	0.42923	D	0.994297	D	0.65815	0.995	P	0.61275	0.886	T	0.81609	-0.0855	10	0.87932	D	0	-10.8869	11.699	0.51560	0.177:0.823:0.0:0.0	.	679	Q68CJ6	SLIP_HUMAN	S	679	ENSP00000408697:G679S;ENSP00000345031:G679S	ENSP00000345031:G679S	G	-	1	0	C8orf80	27942821	0.992000	0.36948	0.984000	0.44739	0.707000	0.40811	4.258000	0.58822	1.316000	0.45131	0.655000	0.94253	GGC		0.542	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906		Missense_Mutation
CD3E	916	hgsc.bcm.edu	37	11	118184469	118184469	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr11:118184469G>C	ENST00000361763.4	+	7	691	c.400G>C	c.(400-402)Gtc>Ctc	p.V134L	CD3E_ENST00000528600.1_Missense_Mutation_p.V128L	NM_000733.3	NP_000724.1	P07766	CD3E_HUMAN	CD3e molecule, epsilon (CD3-TCR complex)	134					apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of smoothened signaling pathway (GO:0045879)|negative thymic T cell selection (GO:0045060)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell anergy (GO:0002669)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)|regulation of immune response (GO:0050776)|response to nutrient (GO:0007584)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)|SH3 domain binding (GO:0017124)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)	p.V134L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|ovary(2)|stomach(1)	8	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	GGCCACAATTGTCATAGTGGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											102.0	89.0	93.0					11																	118184469		2200	4296	6496	117689679	SO:0001583	missense	916			X03884	CCDS31685.1	11q23	2014-09-17	2006-03-28		ENSG00000198851	ENSG00000198851		"""CD molecules"""	1674	protein-coding gene	gene with protein product		186830	"""CD3e antigen, epsilon polypeptide (TiT3 complex)"""				Standard	NM_000733		Approved		uc001psq.4	P07766	OTTHUMG00000166968	ENST00000361763.4:c.400G>C	11.37:g.118184469G>C	ENSP00000354566:p.Val134Leu	Somatic		Capture	SOLID	Phase_IV	117689679	A8K997	Missense_Mutation	SNP	ENST00000361763.4	37	CCDS31685.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665558	0.29604	.	.	ENSG00000198851	ENST00000361763;ENST00000528600	T;T	0.21734	1.99;1.99	4.97	-3.09	0.05331	.	0.392395	0.28442	N	0.015335	T	0.15435	0.0372	L	0.42245	1.32	0.09310	N	1	B	0.19583	0.037	B	0.20767	0.031	T	0.20940	-1.0260	10	0.42905	T	0.14	.	11.2465	0.49000	0.4096:0.0:0.5904:0.0	.	134	P07766	CD3E_HUMAN	L	134;128	ENSP00000354566:V134L;ENSP00000433975:V128L	ENSP00000354566:V134L	V	+	1	0	CD3E	117689679	0.000000	0.05858	0.000000	0.03702	0.933000	0.57130	-0.582000	0.05814	-0.440000	0.07211	-0.339000	0.08088	GTC		0.542	CD3E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392120.1	NM_000733		Missense_Mutation
CDC42BPA	8476	hgsc.bcm.edu	37	1	227182581	227182581	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:227182581C>G	ENST00000366769.3	-	35	6262	c.4971G>C	c.(4969-4971)ttG>ttC	p.L1657F	CDC42BPA_ENST00000366766.2_Missense_Mutation_p.L1692F|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.L1576F|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.L1719F|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.L1629F|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.L1637F|RP5-1087E8.3_ENST00000433837.1_RNA|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.L1670F	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.L1576F(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CTCCAGAGGACAAAGAGCCCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	92.0	93.0					1																	227182581		2203	4300	6503	225249204	SO:0001583	missense	8476			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.4971G>C	1.37:g.227182581C>G	ENSP00000355731:p.Leu1657Phe	Somatic		Capture	SOLID	Phase_IV	225249204		Missense_Mutation	SNP	ENST00000366769.3	37	CCDS1558.1	SNP	17	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	18.73|18.73	3.687242|3.687242	0.68157|0.68157	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765|ENST00000448940;ENST00000442054	T;T;T;T;T;T;T|.	0.69685|.	-0.29;-0.29;-0.42;-0.29;-0.33;-0.3;-0.27|.	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.275257|.	0.31648|.	N|.	0.007297|.	T|T	0.63570|0.63570	0.2522|0.2522	L|L	0.53249|0.53249	1.67|1.67	0.54753|0.54753	D|D	0.999985|0.999985	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;0.999|.	D;D;D;D;D;D|.	0.91635|.	0.998;0.997;0.999;0.997;0.997;0.998|.	T|T	0.61676|0.61676	-0.7014|-0.7014	10|5	0.25751|.	T|.	0.34|.	.|.	13.6073|13.6073	0.62054|0.62054	0.0:0.923:0.0:0.077|0.0:0.923:0.0:0.077	.|.	1637;1629;1576;1657;1692;921|.	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2;Q5T799|.	.;.;.;.;.;.|.	F|L	1657;1576;1719;1692;1629;1637;1670|922;986	ENSP00000355731:L1657F;ENSP00000355729:L1576F;ENSP00000335341:L1719F;ENSP00000355728:L1692F;ENSP00000355726:L1629F;ENSP00000443275:L1637F;ENSP00000355727:L1670F|.	ENSP00000335341:L1719F|.	L|V	-|-	3|1	2|0	CDC42BPA|CDC42BPA	225249204|225249204	1.000000|1.000000	0.71417|0.71417	0.919000|0.919000	0.36401|0.36401	0.629000|0.629000	0.37895|0.37895	1.684000|1.684000	0.37649|0.37649	2.297000|2.297000	0.77311|0.77311	0.556000|0.556000	0.70494|0.70494	TTG|GTC		0.577	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826		Missense_Mutation
CHMP6	79643	hgsc.bcm.edu	37	17	78972931	78972931	+	Missense_Mutation	SNP	C	C	T	rs374101426		TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:78972931C>T	ENST00000325167.5	+	8	662	c.584C>T	c.(583-585)gCg>gTg	p.A195V	CTD-2561B21.7_ENST00000576215.1_RNA|CTD-2561B21.7_ENST00000577061.2_RNA	NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	195					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)	p.A195V(1)		lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCCAGGCAGGCGGAGCTGGTG	0.617																																																1	Substitution - Missense(1)	ovary(1)	17						C	VAL/ALA	0,4406		0,0,2203	120.0	101.0	108.0		584	1.6	0.3	17		108	1,8599	1.2+/-3.3	0,1,4299	no	missense	CHMP6	NM_024591.4	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	195/202	78972931	1,13005	2203	4300	6503	76587526	SO:0001583	missense	79643			BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.584C>T	17.37:g.78972931C>T	ENSP00000317468:p.Ala195Val	Somatic		Capture	SOLID	Phase_IV	76587526	A8K7U0|Q53FU4|Q9HAE8	Missense_Mutation	SNP	ENST00000325167.5	37	CCDS11774.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740451	0.30865	0.0	1.16E-4	ENSG00000176108	ENST00000325167	T	0.59364	0.27	4.77	1.58	0.23477	.	0.428871	0.22920	N	0.054027	T	0.38480	0.1042	N	0.22421	0.69	0.25115	N	0.99068	B	0.20052	0.041	B	0.11329	0.006	T	0.21965	-1.0230	10	0.45353	T	0.12	-28.1219	7.7351	0.28810	0.0:0.7203:0.0:0.2797	.	195	Q96FZ7	CHMP6_HUMAN	V	195	ENSP00000317468:A195V	ENSP00000317468:A195V	A	+	2	0	CHMP6	76587526	0.987000	0.35691	0.285000	0.24819	0.530000	0.34684	1.138000	0.31491	0.067000	0.16545	0.645000	0.84053	GCG		0.617	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438215.1	NM_024591		Missense_Mutation
CLUL1	27098	hgsc.bcm.edu	37	18	644982	644982	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr18:644982C>A	ENST00000400606.2	+	8	1427	c.1282C>A	c.(1282-1284)Cct>Act	p.P428T	CLUL1_ENST00000581619.1_Missense_Mutation_p.P453T|CLUL1_ENST00000579494.1_Missense_Mutation_p.P428T|C18orf56_ENST00000585033.1_Intron|CLUL1_ENST00000338387.7_Missense_Mutation_p.P428T|CLUL1_ENST00000540035.1_Missense_Mutation_p.P480T	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	428					cell death (GO:0008219)	extracellular region (GO:0005576)		p.P428T(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						AAGCATTCTGCCTTCCTCTAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	18											108.0	101.0	103.0					18																	644982		1859	4101	5960	634982	SO:0001583	missense	27098			D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.1282C>A	18.37:g.644982C>A	ENSP00000383449:p.Pro428Thr	Somatic		Capture	SOLID	Phase_IV	634982	A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	CCDS42405.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.353879	0.01256	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.22945	1.93;1.93;1.93	4.87	2.92	0.33932	Clusterin, C-terminal (1);	0.224065	0.45126	D	0.000384	T	0.14442	0.0349	L	0.31207	0.915	0.80722	D	1	B;B	0.23937	0.094;0.043	B;B	0.23419	0.027;0.046	T	0.07028	-1.0794	10	0.13470	T	0.59	-2.2025	5.8753	0.18826	0.282:0.6165:0.0:0.1015	.	480;428	F5GWQ8;Q15846	.;CLUL1_HUMAN	T	428;480;428	ENSP00000383449:P428T;ENSP00000441726:P480T;ENSP00000341128:P428T	ENSP00000341128:P428T	P	+	1	0	CLUL1	634982	1.000000	0.71417	0.999000	0.59377	0.623000	0.37688	1.051000	0.30417	1.278000	0.44430	0.591000	0.81541	CCT		0.383	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			Missense_Mutation
CNGA3	1261	hgsc.bcm.edu	37	2	99013534	99013534	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr2:99013534G>T	ENST00000272602.2	+	7	1940	c.1901G>T	c.(1900-1902)gGg>gTg	p.G634V	CNGA3_ENST00000436404.2_Missense_Mutation_p.G616V|CNGA3_ENST00000393504.1_Missense_Mutation_p.G634V|CNGA3_ENST00000409937.1_Missense_Mutation_p.G638V			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	634					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.G634V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GAGCAGCTGGGGTCCTCCCTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											40.0	37.0	38.0					2																	99013534		2203	4300	6503	98379966	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1901G>T	2.37:g.99013534G>T	ENSP00000272602:p.Gly634Val	Somatic		Capture	SOLID	Phase_IV	98379966	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648741	0.29336	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97480	-4.29;-4.2;-4.29;-4.4	5.42	4.28	0.50868	.	0.153629	0.56097	D	0.000025	D	0.93015	0.7777	L	0.29908	0.895	0.51767	D	0.999938	B;B;B	0.25743	0.133;0.044;0.019	B;B;B	0.23275	0.045;0.028;0.028	D	0.89780	0.3960	10	0.48119	T	0.1	.	9.8193	0.40871	0.9166:0.0:0.0834:0.0	.	638;616;634	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	V	634;616;634;638	ENSP00000377140:G634V;ENSP00000410070:G616V;ENSP00000272602:G634V;ENSP00000386761:G638V	ENSP00000272602:G634V	G	+	2	0	CNGA3	98379966	0.998000	0.40836	1.000000	0.80357	0.776000	0.43924	3.217000	0.51184	1.087000	0.41251	-0.471000	0.05019	GGG		0.597	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		Missense_Mutation
SPECC1	92521	hgsc.bcm.edu	37	17	20150560	20150560	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0761-01	TCGA-13-0761-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:20150560delT	ENST00000261503.5	+	9	2577	c.2526delT	c.(2524-2526)catfs	p.H842fs	SPECC1_ENST00000395527.4_Frame_Shift_Del_p.H842fs|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000536879.1_Frame_Shift_Del_p.H182fs|SPECC1_ENST00000395530.2_Frame_Shift_Del_p.H761fs	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	842					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.H842fs*8(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TTTCTGTCCATAAGACCCCCA	0.458																																																1	Deletion - Frameshift(1)	ovary(1)	17											48.0	51.0	50.0					17																	20150560		2203	4300	6503	20091152	SO:0001589	frameshift_variant	92521			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.2526delT	17.37:g.20150560delT	ENSP00000261503:p.His842fs	Somatic		Capture	SOLID	Phase_IV	20091152	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Frame_Shift_Del	DEL	ENST00000261503.5	37	CCDS32590.1	DEL	49	Baylor																																																																																				0.458	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		Frame_Shift_Del
DCTN1	1639	hgsc.bcm.edu	37	2	74594894	74594894	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr2:74594894G>C	ENST00000361874.3	-	18	2430	c.2113C>G	c.(2113-2115)Ctg>Gtg	p.L705V	DCTN1_ENST00000409567.3_Missense_Mutation_p.L685V|DCTN1_ENST00000495643.1_5'UTR|DCTN1_ENST00000394003.3_Missense_Mutation_p.L698V|DCTN1_ENST00000409868.1_Missense_Mutation_p.L688V|DCTN1_ENST00000409438.1_Missense_Mutation_p.L571V|DCTN1_ENST00000409240.1_Missense_Mutation_p.L668V|DCTN1_ENST00000407639.2_Missense_Mutation_p.L571V	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	705					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.L705V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TTGTGCAGCAGTTCAATGAGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	86.0	89.0					2																	74594894		2203	4300	6503	74448402	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2113C>G	2.37:g.74594894G>C	ENSP00000354791:p.Leu705Val	Somatic		Capture	SOLID	Phase_IV	74448402	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109351	0.56398	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	5.64	3.85	0.44370	.	0.000000	0.34411	N	0.003981	D	0.92756	0.7697	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.996;1.0;0.996	D;D;D;D;D;D	0.87578	0.997;0.998;0.987;0.979;0.987;0.978	D	0.91528	0.5240	10	0.42905	T	0.14	-6.1686	11.3771	0.49735	0.1498:0.0:0.8502:0.0	.	685;668;705;698;571;571	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	V	705;698;688;571;571;668;688;685	ENSP00000354791:L705V;ENSP00000377571:L698V;ENSP00000384844:L571V;ENSP00000387270:L571V;ENSP00000386406:L668V;ENSP00000387327:L688V;ENSP00000386843:L685V	ENSP00000354791:L705V	L	-	1	2	DCTN1	74448402	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	6.696000	0.74598	0.736000	0.32559	0.561000	0.74099	CTG		0.522	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082		Missense_Mutation
DNAH2	146754	hgsc.bcm.edu	37	17	7636416	7636416	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:7636416G>C	ENST00000572933.1	+	5	1871	c.411G>C	c.(409-411)caG>caC	p.Q137H	DNAH2_ENST00000570791.1_Missense_Mutation_p.Q137H|DNAH2_ENST00000389173.2_Missense_Mutation_p.Q137H|DNAH2_ENST00000082259.3_Missense_Mutation_p.Q137H			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	137	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q137H(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCCAGAACCAGCTTGTCTACT	0.572																																																1	Substitution - Missense(1)	ovary(1)	17											80.0	73.0	75.0					17																	7636416		2203	4300	6503	7577141	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.411G>C	17.37:g.7636416G>C	ENSP00000458355:p.Gln137His	Somatic		Capture	SOLID	Phase_IV	7577141	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227482	0.39399	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.42900	0.96;0.96	5.19	4.22	0.49857	.	1.524580	0.03772	N	0.259897	T	0.35508	0.0934	N	0.14661	0.345	0.39410	D	0.966745	B;P	0.40731	0.037;0.728	B;B	0.42522	0.005;0.39	T	0.05484	-1.0882	10	0.59425	D	0.04	.	9.8537	0.41073	0.1682:0.0:0.8318:0.0	.	137;137	Q9P225;Q9P225-3	DYH2_HUMAN;.	H	137	ENSP00000373825:Q137H;ENSP00000082259:Q137H	ENSP00000082259:Q137H	Q	+	3	2	DNAH2	7577141	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	2.636000	0.46545	1.324000	0.45282	0.655000	0.94253	CAG		0.572	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		Missense_Mutation
DTNBP1	84062	hgsc.bcm.edu	37	6	15652350	15652350	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr6:15652350C>A	ENST00000344537.5	-	2	250	c.78G>T	c.(76-78)aaG>aaT	p.K26N	DTNBP1_ENST00000355917.3_Missense_Mutation_p.K26N|DTNBP1_ENST00000338950.5_Missense_Mutation_p.K26N	NM_032122.4	NP_115498.2	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1	26					actin cytoskeleton reorganization (GO:0031532)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|neuron projection morphogenesis (GO:0048812)|platelet dense granule organization (GO:0060155)|positive regulation of gene expression (GO:0010628)|positive regulation of neurotransmitter secretion (GO:0001956)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of dopamine secretion (GO:0014059)	axon (GO:0030424)|BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|growth cone (GO:0030426)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)|synaptic vesicle membrane (GO:0030672)		p.K26N(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	14	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			CTTCTCTTGACTTGTCACTTA	0.299									Hermansky-Pudlak syndrome																																							1	Substitution - Missense(1)	ovary(1)	6											97.0	86.0	90.0					6																	15652350		2202	4299	6501	15760329	SO:0001583	missense	84062	Familial Cancer Database	HPS, HPS1-8	AF394226	CCDS4534.1, CCDS4535.1, CCDS75404.1, CCDS75405.1	6p22.3	2013-09-27			ENSG00000047579	ENSG00000047579		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17328	protein-coding gene	gene with protein product	"""dysbindin-1"", ""biogenesis of lysosomal organelles complex-1, subunit 8"""	607145				11316798	Standard	NM_032122		Approved	Dysbindin, My031, HPS7, DBND, BLOC1S8	uc003nbm.3	Q96EV8	OTTHUMG00000014295	ENST00000344537.5:c.78G>T	6.37:g.15652350C>A	ENSP00000341680:p.Lys26Asn	Somatic		Capture	SOLID	Phase_IV	15760329	A8K3V3|Q5THY3|Q5THY4|Q96NV2|Q9H0U2|Q9H3J5	Missense_Mutation	SNP	ENST00000344537.5	37	CCDS4534.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371945	0.61624	.	.	ENSG00000047579	ENST00000344537;ENST00000355917;ENST00000338950;ENST00000543749	T;T;T	0.36340	1.26;1.26;1.3	5.53	1.78	0.24846	.	0.000000	0.64402	D	0.000016	T	0.43875	0.1267	M	0.78916	2.43	0.41117	D	0.985786	D;D;P	0.89917	1.0;1.0;0.473	D;D;B	0.91635	0.993;0.999;0.24	T	0.42155	-0.9468	10	0.56958	D	0.05	-13.0534	7.9347	0.29923	0.0:0.5872:0.0:0.4128	.	26;26;26	F5GY46;Q96EV8-2;Q96EV8	.;.;DTBP1_HUMAN	N	26	ENSP00000341680:K26N;ENSP00000348183:K26N;ENSP00000344718:K26N	ENSP00000344718:K26N	K	-	3	2	DTNBP1	15760329	0.995000	0.38212	0.997000	0.53966	0.989000	0.77384	0.012000	0.13287	0.114000	0.18032	0.479000	0.44913	AAG		0.299	DTNBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000039933.2	NM_032122		Missense_Mutation
DYNC1LI1	51143	hgsc.bcm.edu	37	3	32570047	32570047	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr3:32570047C>G	ENST00000273130.4	-	12	1456	c.1353G>C	c.(1351-1353)ttG>ttC	p.L451F	DYNC1LI1_ENST00000432458.2_Missense_Mutation_p.L335F	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	451					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.L451F(1)		kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						TTTTACTCAACAAACTGTTGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											72.0	72.0	72.0					3																	32570047		2203	4300	6503	32545051	SO:0001583	missense	51143			AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.1353G>C	3.37:g.32570047C>G	ENSP00000273130:p.Leu451Phe	Somatic		Capture	SOLID	Phase_IV	32545051	A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	ENST00000273130.4	37	CCDS2654.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674602	0.67928	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	T;T	0.37584	1.19;1.19	5.76	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.62708	0.2450	M	0.85859	2.78	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.68652	-0.5352	10	0.87932	D	0	-8.4554	11.9312	0.52847	0.0:0.8113:0.1219:0.0668	.	335;451	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	F	451;335	ENSP00000273130:L451F;ENSP00000407279:L335F	ENSP00000273130:L451F	L	-	3	2	DYNC1LI1	32545051	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.261000	0.32980	1.447000	0.47661	-0.224000	0.12420	TTG		0.453	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253250.1	NM_016141		Missense_Mutation
DYX1C1	161582	hgsc.bcm.edu	37	15	55724793	55724793	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0761-01	TCGA-13-0761-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr15:55724793T>A	ENST00000321149.3	-	9	1422	c.1055A>T	c.(1054-1056)gAa>gTa	p.E352V	DYX1C1_ENST00000380679.1_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000457155.2_Intron|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000348518.3_Intron	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	352					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)	p.E352V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		CATCAATAATTCCAGTGCCTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	15											78.0	72.0	74.0					15																	55724793		2193	4292	6485	53512085	SO:0001583	missense	161582				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.1055A>T	15.37:g.55724793T>A	ENSP00000323275:p.Glu352Val	Somatic		Capture	SOLID	Phase_IV	53512085	Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	ENST00000321149.3	37	CCDS10154.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.8	4.042415	0.75732	.	.	ENSG00000256061	ENST00000321149	T	0.62232	0.04	5.4	5.4	0.78164	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.133193	0.48286	U	0.000190	T	0.76779	0.4035	M	0.78285	2.405	0.80722	D	1	B	0.33583	0.418	P	0.51550	0.673	T	0.77699	-0.2490	10	0.52906	T	0.07	-22.5694	14.6656	0.68904	0.0:0.0:0.0:1.0	.	352	Q8WXU2	DYXC1_HUMAN	V	352	ENSP00000323275:E352V	ENSP00000323275:E352V	E	-	2	0	DYX1C1	53512085	1.000000	0.71417	0.974000	0.42286	0.843000	0.47879	4.114000	0.57858	2.079000	0.62486	0.524000	0.50904	GAA		0.378	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810		Missense_Mutation
FAM53B	9679	hgsc.bcm.edu	37	10	126370760	126370760	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr10:126370760G>C	ENST00000337318.3	-	4	533	c.322C>G	c.(322-324)Ccc>Gcc	p.P108A	FAM53B_ENST00000392754.3_Missense_Mutation_p.P108A|FAM53B_ENST00000280780.6_Missense_Mutation_p.P108A|RP11-12J10.3_ENST00000494792.1_3'UTR	NM_014661.3	NP_055476.3	Q14153	FA53B_HUMAN	family with sequence similarity 53, member B	108								p.P108A(1)		cervix(1)|lung(5)|ovary(2)|pancreas(1)	9		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		TTGCTAGGGGGTGCTGAGGGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	10											46.0	32.0	37.0					10																	126370760		2203	4300	6503	126360750	SO:0001583	missense	9679			D50930	CCDS7641.1	10q26.13	2004-11-24	2004-11-24	2004-11-24	ENSG00000189319	ENSG00000189319			28968	protein-coding gene	gene with protein product			"""KIAA0140"""	KIAA0140		8590280	Standard	NM_014661		Approved	bA12J10.2	uc001lhv.1	Q14153	OTTHUMG00000019215	ENST00000337318.3:c.322C>G	10.37:g.126370760G>C	ENSP00000338532:p.Pro108Ala	Somatic		Capture	SOLID	Phase_IV	126360750	D3DRF1|Q5VUW1|Q5VUW2|Q8N5S6	Missense_Mutation	SNP	ENST00000337318.3	37	CCDS7641.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724820	0.89298	.	.	ENSG00000189319	ENST00000337318;ENST00000392754;ENST00000280780	T;T;T	0.80653	-1.4;-1.4;-1.4	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.90000	0.6878	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.90752	0.4658	10	0.72032	D	0.01	-8.4266	18.8173	0.92081	0.0:0.0:1.0:0.0	.	108;108;108	Q14153-2;Q14153;B3KMZ2	.;FA53B_HUMAN;.	A	108	ENSP00000338532:P108A;ENSP00000376509:P108A;ENSP00000280780:P108A	ENSP00000280780:P108A	P	-	1	0	FAM53B	126360750	1.000000	0.71417	0.971000	0.41717	0.989000	0.77384	9.325000	0.96381	2.746000	0.94184	0.655000	0.94253	CCC		0.612	FAM53B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050879.1	NM_014661		Missense_Mutation
FEM1B	10116	hgsc.bcm.edu	37	15	68582254	68582254	+	Silent	SNP	T	T	C			TCGA-13-0761-01	TCGA-13-0761-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr15:68582254T>C	ENST00000306917.4	+	2	1173	c.558T>C	c.(556-558)tgT>tgC	p.C186C		NM_015322.4	NP_056137.1	Q9UK73	FEM1B_HUMAN	fem-1 homolog b (C. elegans)	186					apoptotic process (GO:0006915)|branching involved in prostate gland morphogenesis (GO:0060442)|epithelial cell maturation involved in prostate gland development (GO:0060743)|regulation of DNA damage checkpoint (GO:2000001)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death receptor binding (GO:0005123)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						AAGCACATTGTGGAGCCACAG	0.463																																																0			15											68.0	58.0	61.0					15																	68582254		2200	4298	6498	66369308	SO:0001819	synonymous_variant	10116				CCDS10228.1	15q22	2013-02-19	2001-11-28		ENSG00000169018	ENSG00000169018		"""Ankyrin repeat domain containing"""	3649	protein-coding gene	gene with protein product		613539	"""FEM-1 (C. elegans) homolog b"""			10623617	Standard	NM_015322		Approved		uc002arg.3	Q9UK73	OTTHUMG00000133285	ENST00000306917.4:c.558T>C	15.37:g.68582254T>C		Somatic		Capture	SOLID	Phase_IV	66369308	O43146	Silent	SNP	ENST00000306917.4	37	CCDS10228.1	SNP	59	Baylor																																																																																				0.463	FEM1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257065.1			Silent
GEMIN4	50628	hgsc.bcm.edu	37	17	650077	650077	+	Silent	SNP	G	G	A			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:650077G>A	ENST00000319004.5	-	2	1324	c.1206C>T	c.(1204-1206)atC>atT	p.I402I	GEMIN4_ENST00000576778.1_Silent_p.I391I|GEMIN4_ENST00000437269.1_3'UTR	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	402					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)		p.I402I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGGAAGCTGTGATATCCTCCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	17											69.0	72.0	71.0					17																	650077		2056	4195	6251	596827	SO:0001819	synonymous_variant	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.1206C>T	17.37:g.650077G>A		Somatic		Capture	SOLID	Phase_IV	596827	Q9NZS7|Q9UG32|Q9Y4Q2	Silent	SNP	ENST00000319004.5	37	CCDS45559.1	SNP	45	Baylor																																																																																				0.557	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721		Silent
GPNMB	10457	hgsc.bcm.edu	37	7	23296646	23296646	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr7:23296646G>C	ENST00000381990.2	+	4	664	c.503G>C	c.(502-504)tGg>tCg	p.W168S	GPNMB_ENST00000453162.2_Intron|GPNMB_ENST00000409458.3_Missense_Mutation_p.W168S|GPNMB_ENST00000258733.4_Missense_Mutation_p.W168S|GPNMB_ENST00000539136.1_Missense_Mutation_p.W69S	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	168					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)	p.W168S(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			CACCCCGGATGGAGAAGATGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											124.0	115.0	118.0					7																	23296646		2203	4300	6503	23263171	SO:0001583	missense	10457			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.503G>C	7.37:g.23296646G>C	ENSP00000371420:p.Trp168Ser	Somatic		Capture	SOLID	Phase_IV	23263171	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966330	0.74131	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000409458;ENST00000539136	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.68	4.68	0.58851	.	0.264822	0.33959	N	0.004386	T	0.33818	0.0876	L	0.56199	1.76	0.80722	D	1	P;P;P;P	0.50443	0.673;0.544;0.919;0.935	B;B;P;P	0.53689	0.225;0.113;0.59;0.732	T	0.02844	-1.1103	10	0.23891	T	0.37	0.0057	17.9413	0.89027	0.0:0.0:1.0:0.0	.	69;168;168;168	F6SKP1;Q14956;Q14956-2;Q96F58	.;GPNMB_HUMAN;.;.	S	168;203;168;168;69	ENSP00000258733:W168S;ENSP00000371420:W168S;ENSP00000386476:W168S;ENSP00000445266:W69S	ENSP00000258733:W168S	W	+	2	0	GPNMB	23263171	1.000000	0.71417	0.060000	0.19600	0.553000	0.35397	8.172000	0.89677	2.306000	0.77630	0.561000	0.74099	TGG		0.468	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340		Missense_Mutation
GTF3C2	2976	hgsc.bcm.edu	37	2	27556599	27556599	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr2:27556599G>C	ENST00000359541.2	-	12	2084	c.1655C>G	c.(1654-1656)tCt>tGt	p.S552C	AC109828.1_ENST00000592265.1_RNA|AC109828.1_ENST00000585326.1_RNA|GTF3C2_ENST00000264720.3_Missense_Mutation_p.S552C|AC109828.1_ENST00000608473.1_RNA|AC109828.1_ENST00000416453.2_RNA			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	552					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCACACTCAGAGGGGTCTGT	0.498																																																0			2											121.0	122.0	122.0					2																	27556599		2203	4300	6503	27410103	SO:0001583	missense	2976			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1655C>G	2.37:g.27556599G>C	ENSP00000352536:p.Ser552Cys	Somatic		Capture	SOLID	Phase_IV	27410103	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	37	CCDS1749.1	SNP	33	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.20|18.20	3.571890|3.571890	0.65765|0.65765	.|.	.|.	ENSG00000115207|ENSG00000115207	ENST00000454704|ENST00000359541;ENST00000264720	.|T;T	.|0.74209	.|-0.82;-0.82	5.39|5.39	5.39|5.39	0.77823|0.77823	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.642529	.|0.16465	.|N	.|0.213229	T|T	0.81861|0.81861	0.4912|0.4912	L|L	0.50333|0.50333	1.59|1.59	0.31619|0.31619	N|N	0.650472|0.650472	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.73380	.|0.98;0.97	T|T	0.81982|0.81982	-0.0683|-0.0683	5|10	.|0.56958	.|D	.|0.05	-15.9475|-15.9475	12.4156|12.4156	0.55492|0.55492	0.0:0.1689:0.8311:0.0|0.0:0.1689:0.8311:0.0	.|.	.|552;552	.|Q8WUA4-2;Q8WUA4	.|.;TF3C2_HUMAN	V|C	61|552	.|ENSP00000352536:S552C;ENSP00000264720:S552C	.|ENSP00000264720:S552C	L|S	-|-	1|2	2|0	GTF3C2|GTF3C2	27410103|27410103	0.987000|0.987000	0.35691|0.35691	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.200000|4.200000	0.58433|0.58433	2.537000|2.537000	0.85549|0.85549	0.655000|0.655000	0.94253|0.94253	CTG|TCT		0.498	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2			Missense_Mutation
GUCY2C	2984	hgsc.bcm.edu	37	12	14794029	14794029	+	Silent	SNP	A	A	G			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr12:14794029A>G	ENST00000261170.3	-	18	2191	c.2055T>C	c.(2053-2055)tgT>tgC	p.C685C		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	685	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)	p.C685C(1)		breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	TCCGGTCCCGACAGCTCAAAG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	12											141.0	100.0	113.0					12																	14794029		2203	4300	6503	14685296	SO:0001819	synonymous_variant	2984				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2055T>C	12.37:g.14794029A>G		Somatic		Capture	SOLID	Phase_IV	14685296	B2RMY6	Silent	SNP	ENST00000261170.3	37	CCDS8664.1	SNP	10	Baylor																																																																																				0.498	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1			Silent
GUCY2F	2986	hgsc.bcm.edu	37	X	108652311	108652311	+	Silent	SNP	A	A	G			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:108652311A>G	ENST00000218006.2	-	9	2169	c.1878T>C	c.(1876-1878)tgT>tgC	p.C626C		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	626	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TCCCTCGGGAACAGAATTCTG	0.403																																																0			X											161.0	137.0	145.0					X																	108652311		2203	4300	6503	108538967	SO:0001819	synonymous_variant	2986			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1878T>C	X.37:g.108652311A>G		Somatic		Capture	SOLID	Phase_IV	108538967	Q9UJF1	Silent	SNP	ENST00000218006.2	37	CCDS14545.1	SNP	2	Baylor																																																																																				0.403	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522		Silent
HIPK4	147746	hgsc.bcm.edu	37	19	40886975	40886975	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr19:40886975C>A	ENST00000291823.2	-	3	1207	c.923G>T	c.(922-924)cGg>cTg	p.R308L		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	308	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CAGCGCCTCCCGGTCAGGGAA	0.612																																																0			19											43.0	39.0	41.0					19																	40886975		2201	4296	6497	45578815	SO:0001583	missense	147746			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.923G>T	19.37:g.40886975C>A	ENSP00000291823:p.Arg308Leu	Somatic		Capture	SOLID	Phase_IV	45578815	A8K863|Q96M54	Missense_Mutation	SNP	ENST00000291823.2	37	CCDS12555.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971765	0.53614	.	.	ENSG00000160396	ENST00000291823;ENST00000452139	T	0.19532	2.14	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000060	T	0.17365	0.0417	N	0.02192	-0.645	0.47621	D	0.999474	D	0.63046	0.992	P	0.59288	0.855	T	0.33189	-0.9878	10	0.11485	T	0.65	.	16.6992	0.85344	0.0:1.0:0.0:0.0	.	308	Q8NE63	HIPK4_HUMAN	L	308;273	ENSP00000291823:R308L	ENSP00000291823:R308L	R	-	2	0	HIPK4	45578815	0.024000	0.19004	0.954000	0.39281	0.009000	0.06853	0.690000	0.25451	2.677000	0.91161	0.561000	0.74099	CGG		0.612	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	NM_144685		Missense_Mutation
INPP5D	3635	hgsc.bcm.edu	37	2	233925286	233925286	+	Missense_Mutation	SNP	G	G	C	rs62194575		TCGA-13-0761-01	TCGA-13-0761-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Biotage_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr2:233925286G>C	ENST00000359570.5	+	1	98	c.98G>C	c.(97-99)aGc>aCc	p.S33T	INPP5D_ENST00000538935.1_Missense_Mutation_p.S33T			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	33	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)	p.S33T(1)		central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GTGCGTGCCAGCGAGTCCATC	0.637																																					NSCLC(82;1215 1426 16163 20348 41018)											1	Substitution - Missense(1)	ovary(1)	2											42.0	48.0	46.0					2																	233925286		2093	4215	6308	233633530	SO:0001583	missense	3635			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.98G>C	2.37:g.233925286G>C	ENSP00000352575:p.Ser33Thr	Somatic		Capture	SOLID	Phase_IV	233633530	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37		SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074252	0.76415	.	.	ENSG00000168918	ENST00000422935;ENST00000451407;ENST00000359570;ENST00000538935	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	4.68	4.68	0.58851	SH2 motif (5);	0.043948	0.85682	D	0.000000	D	0.97315	0.9122	.	.	.	0.43313	D	0.995322	D;D	0.60160	0.984;0.987	D;D	0.77557	0.984;0.99	D	0.98152	1.0442	9	0.72032	D	0.01	.	17.6467	0.88150	0.0:0.0:1.0:0.0	.	33;33	Q92835-2;Q92835	.;SHIP1_HUMAN	T	33	ENSP00000409018:S33T;ENSP00000415253:S33T;ENSP00000352575:S33T;ENSP00000441010:S33T	ENSP00000352575:S33T	S	+	2	0	INPP5D	233633530	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.017000	0.93651	2.175000	0.68902	0.485000	0.47835	AGC		0.637	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915		Missense_Mutation
IQSEC2	23096	hgsc.bcm.edu	37	X	53270968	53270968	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:53270968C>A	ENST00000375368.5	-	9	3183	c.2983G>T	c.(2983-2985)Gtg>Ttg	p.V995L	IQSEC2_ENST00000375365.2_Missense_Mutation_p.V800L|IQSEC2_ENST00000396435.3_Missense_Mutation_p.V1005L			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	995	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.V1002L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GCTCATACCACAAGGAGATCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	60.0	68.0					X																	53270968		2203	4300	6503	53287693	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2983G>T	X.37:g.53270968C>A	ENSP00000364517:p.Val995Leu	Somatic		Capture	SOLID	Phase_IV	53287693	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	c	17.68	3.450435	0.63290	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.55930	0.49;0.49;0.49	5.12	5.12	0.69794	.	0.246012	0.40554	N	0.001072	T	0.45955	0.1368	L	0.35723	1.085	0.80722	D	1	B;B	0.26512	0.151;0.098	B;B	0.27796	0.083;0.045	T	0.38436	-0.9661	10	0.38643	T	0.18	.	16.6748	0.85276	0.0:1.0:0.0:0.0	.	1005;800	Q5JU85-2;Q5JU85-3	.;.	L	1005;995;800	ENSP00000379712:V1005L;ENSP00000364517:V995L;ENSP00000364514:V800L	ENSP00000364514:V800L	V	-	1	0	IQSEC2	53287693	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.769000	0.85360	2.283000	0.76528	0.585000	0.79938	GTG		0.547	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		Missense_Mutation
IVNS1ABP	10625	hgsc.bcm.edu	37	1	185277998	185277998	+	Silent	SNP	T	T	A			TCGA-13-0761-01	TCGA-13-0761-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:185277998T>A	ENST00000367498.3	-	5	913	c.291A>T	c.(289-291)gcA>gcT	p.A97A	IVNS1ABP_ENST00000392007.3_5'UTR|IVNS1ABP_ENST00000367497.1_Silent_p.A97A|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	97	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.A97A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						ATTCCTTATCTGCTTTCAACC	0.294																																																1	Substitution - coding silent(1)	ovary(1)	1											129.0	123.0	125.0					1																	185277998		2202	4298	6500	183544621	SO:0001819	synonymous_variant	10625			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.291A>T	1.37:g.185277998T>A		Somatic		Capture	SOLID	Phase_IV	183544621	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	ENST00000367498.3	37	CCDS1368.1	SNP	55	Baylor																																																																																				0.294	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469		Silent
KCND1	3750	hgsc.bcm.edu	37	X	48819869	48819869	+	Silent	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:48819869G>C	ENST00000218176.3	-	6	3214	c.1917C>G	c.(1915-1917)ccC>ccG	p.P639P	KCND1_ENST00000376477.1_Silent_p.P262P	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	639					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)	p.P639P(1)		endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	TGACAGTCTCGGGGAAGAGGC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	X											23.0	21.0	22.0					X																	48819869		2203	4300	6503	48704813	SO:0001819	synonymous_variant	3750			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.1917C>G	X.37:g.48819869G>C		Somatic		Capture	SOLID	Phase_IV	48704813	A6NEF1|B2RCG0|O75671	Silent	SNP	ENST00000218176.3	37	CCDS14314.1	SNP	39	Baylor																																																																																				0.587	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979		Silent
KCNJ12	3768	hgsc.bcm.edu	37	17	21319682	21319682	+	Missense_Mutation	SNP	C	C	T	rs80203231	byFrequency	TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:21319682C>T	ENST00000583088.1	+	3	1923	c.1028C>T	c.(1027-1029)tCg>tTg	p.S343L	KCNJ12_ENST00000331718.5_Missense_Mutation_p.S343L	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	343				S -> L (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.S343L(3)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	ATTGACTACTCGCACTTCCAC	0.582										Prostate(3;0.18)																																						3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	17											155.0	153.0	154.0					17																	21319682		2203	4300	6503	21260275	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1028C>T	17.37:g.21319682C>T	ENSP00000463778:p.Ser343Leu	Somatic		Capture	SOLID	Phase_IV	21260275	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857121	0.71834	.	.	ENSG00000184185	ENST00000331718	D	0.92858	-3.12	5.76	5.76	0.90799	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.057257	0.64402	D	0.000001	D	0.92551	0.7634	M	0.77486	2.375	0.80722	D	1	B	0.27013	0.166	B	0.25140	0.058	D	0.90235	0.4282	10	0.62326	D	0.03	.	19.9738	0.97296	0.0:1.0:0.0:0.0	.	343	Q14500	IRK12_HUMAN	L	343	ENSP00000328150:S343L	ENSP00000328150:S343L	S	+	2	0	KCNJ12	21260275	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.686000	0.84128	2.732000	0.93576	0.655000	0.94253	TCG		0.582	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		Missense_Mutation
KCNJ15	3772	hgsc.bcm.edu	37	21	39672247	39672247	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr21:39672247A>T	ENST00000328656.4	+	4	1367	c.1064A>T	c.(1063-1065)tAc>tTc	p.Y355F	KCNJ15_ENST00000398938.2_Missense_Mutation_p.Y355F|KCNJ15_ENST00000398932.1_Missense_Mutation_p.Y355F|KCNJ15_ENST00000398930.1_Missense_Mutation_p.Y355F|KCNJ15_ENST00000398934.1_Missense_Mutation_p.Y355F	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	355					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.Y355F(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GAGGAGAAGTACAGGCAGGAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	21											53.0	55.0	54.0					21																	39672247		2203	4300	6503	38594117	SO:0001583	missense	3772			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.1064A>T	21.37:g.39672247A>T	ENSP00000331698:p.Tyr355Phe	Somatic		Capture	SOLID	Phase_IV	38594117	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1	SNP	14	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.93	2.084092	0.36758	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000398930;ENST00000398934	D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29	5.83	5.83	0.93111	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.470091	0.22257	N	0.062479	D	0.91408	0.7289	L	0.55834	1.745	0.54753	D	0.99998	B	0.25235	0.121	B	0.26416	0.069	D	0.88261	0.2923	9	.	.	.	.	16.2127	0.82178	1.0:0.0:0.0:0.0	.	355	Q99712	IRK15_HUMAN	F	355	ENSP00000331698:Y355F;ENSP00000381911:Y355F;ENSP00000381905:Y355F;ENSP00000381904:Y355F;ENSP00000381907:Y355F	.	Y	+	2	0	KCNJ15	38594117	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.657000	0.61490	2.236000	0.73375	0.533000	0.62120	TAC		0.453	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243		Missense_Mutation
CEMIP	57214	hgsc.bcm.edu	37	15	81234204	81234204	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr15:81234204A>G	ENST00000394685.3	+	26	3841	c.3422A>G	c.(3421-3423)aAg>aGg	p.K1141R	KIAA1199_ENST00000356249.5_Missense_Mutation_p.K1141R|KIAA1199_ENST00000220244.3_Missense_Mutation_p.K1141R|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		1141					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTGTTCCTGAAGCTGAAAGCT	0.493																																																0			15											60.0	62.0	61.0					15																	81234204		2203	4300	6503	79021259	SO:0001583	missense	57214																														ENST00000394685.3:c.3422A>G	15.37:g.81234204A>G	ENSP00000378177:p.Lys1141Arg	Somatic		Capture	SOLID	Phase_IV	79021259	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.694	1.152575	0.21371	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.48522	0.81;0.81;0.81	5.76	3.42	0.39159	.	0.107044	0.64402	N	0.000008	T	0.37210	0.0995	L	0.58428	1.81	0.26526	N	0.974335	B	0.10296	0.003	B	0.08055	0.003	T	0.28650	-1.0037	10	0.28530	T	0.3	-22.1354	3.8355	0.08893	0.6649:0.1361:0.0689:0.1301	.	1141	Q8WUJ3	K1199_HUMAN	R	1141	ENSP00000220244:K1141R;ENSP00000378177:K1141R;ENSP00000348583:K1141R	ENSP00000220244:K1141R	K	+	2	0	KIAA1199	79021259	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	5.456000	0.66665	0.439000	0.26476	-0.326000	0.08463	AAG		0.493	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1			Missense_Mutation
KIF1B	23095	hgsc.bcm.edu	37	1	10386189	10386189	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:10386189G>T	ENST00000377086.1	+	27	2898	c.2696G>T	c.(2695-2697)tGt>tTt	p.C899F	KIF1B_ENST00000263934.6_Missense_Mutation_p.C853F|KIF1B_ENST00000377081.1_Missense_Mutation_p.C899F			O60333	KIF1B_HUMAN	kinesin family member 1B	899					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.C853F(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TTCCACGGCTGTGTGAACGAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											160.0	156.0	158.0					1																	10386189		2203	4300	6503	10308776	SO:0001583	missense	23095			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2696G>T	1.37:g.10386189G>T	ENSP00000366290:p.Cys899Phe	Somatic		Capture	SOLID	Phase_IV	10308776	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199843	0.79015	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74632	-0.8;-0.86;-0.86	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	N	0.08118	0	0.80722	D	1	P;P;D;D;D;D	0.71674	0.754;0.706;0.995;0.998;0.98;0.988	B;B;D;D;D;D	0.79784	0.313;0.216;0.986;0.993;0.962;0.983	T	0.78404	-0.2217	10	0.40728	T	0.16	.	19.9326	0.97124	0.0:0.0:1.0:0.0	.	885;859;899;873;899;853	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	F	899;853;899;899	ENSP00000263934:C853F;ENSP00000366290:C899F;ENSP00000366284:C899F	ENSP00000263934:C853F	C	+	2	0	KIF1B	10308776	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.720000	0.93068	0.650000	0.86243	TGT		0.547	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			Missense_Mutation
KIF21B	23046	hgsc.bcm.edu	37	1	200944785	200944785	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:200944785C>T	ENST00000422435.2	-	33	4772	c.4456G>A	c.(4456-4458)Ggc>Agc	p.G1486S	KIF21B_ENST00000332129.2_Missense_Mutation_p.G1473S|KIF21B_ENST00000360529.5_Missense_Mutation_p.G1473S|KIF21B_ENST00000461742.2_Missense_Mutation_p.G1486S	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1486					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						ACACACTCGCCCAGCTCGAAC	0.627																																																0			1											42.0	36.0	38.0					1																	200944785		2203	4300	6503	199211408	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4456G>A	1.37:g.200944785C>T	ENSP00000411831:p.Gly1486Ser	Somatic		Capture	SOLID	Phase_IV	199211408	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.640	0.118961	0.08881	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.05786	3.39;3.39;3.39;3.39	4.84	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.063541	0.64402	D	0.000007	T	0.03220	0.0094	N	0.08118	0	0.36660	D	0.877898	B;B;B;B	0.24258	0.1;0.02;0.044;0.015	B;B;B;B	0.15870	0.014;0.014;0.014;0.007	T	0.42481	-0.9449	10	0.09338	T	0.73	.	12.4181	0.55504	0.0:0.9156:0.0:0.0844	.	1473;1486;1486;1473	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	S	1473;1473;1486;1486;1486	ENSP00000328494:G1473S;ENSP00000353724:G1473S;ENSP00000433808:G1486S;ENSP00000411831:G1486S	ENSP00000328494:G1473S	G	-	1	0	KIF21B	199211408	0.998000	0.40836	0.990000	0.47175	0.065000	0.16274	2.528000	0.45624	2.218000	0.71995	0.561000	0.74099	GGC		0.627	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		Missense_Mutation
KIF6	221458	hgsc.bcm.edu	37	6	39563851	39563851	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr6:39563851C>A	ENST00000287152.7	-	7	919	c.825G>T	c.(823-825)ttG>ttT	p.L275F	KIF6_ENST00000373215.3_Missense_Mutation_p.L275F|KIF6_ENST00000373213.4_Missense_Mutation_p.L114F|KIF6_ENST00000538893.1_Missense_Mutation_p.L275F|KIF6_ENST00000373216.3_Missense_Mutation_p.L275F	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	275	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L275F(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AATGTAGTGACAAGTTGATAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											100.0	93.0	95.0					6																	39563851		2203	4300	6503	39671829	SO:0001583	missense	221458			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.825G>T	6.37:g.39563851C>A	ENSP00000287152:p.Leu275Phe	Somatic		Capture	SOLID	Phase_IV	39671829	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	CCDS4844.1	SNP	17	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.05|18.05	3.536796|3.536796	0.65085|0.65085	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000458470|ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893;ENST00000441975;ENST00000373211	.|T;T;T;T;T;T	.|0.75260	.|-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.98|5.98	5.04|5.04	0.67666|0.67666	.|Kinesin, motor domain (4);	.|.	.|.	.|.	.|.	D|D	0.85622|0.85622	0.5739|0.5739	M|M	0.91872|0.91872	3.25|3.25	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;1.0;1.0	.|D;D;D;D	.|0.81914	.|0.995;0.986;0.994;0.995	D|D	0.87367|0.87367	0.2348|0.2348	5|9	.|0.87932	.|D	.|0	.|.	10.482|10.482	0.44700|0.44700	0.1452:0.7783:0.0:0.0764|0.1452:0.7783:0.0:0.0764	.|.	.|275;275;275;275	.|E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9	.|.;.;.;KIF6_HUMAN	F|F	167|275;275;114;275;275;62;66	.|ENSP00000287152:L275F;ENSP00000362312:L275F;ENSP00000362309:L114F;ENSP00000362311:L275F;ENSP00000441435:L275F;ENSP00000404856:L62F	.|ENSP00000287152:L275F	C|L	-|-	2|3	0|2	KIF6|KIF6	39671829|39671829	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.924000|0.924000	0.55760|0.55760	0.683000|0.683000	0.25349|0.25349	2.835000|2.835000	0.97688|0.97688	0.650000|0.650000	0.86243|0.86243	TGT|TTG		0.433	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027		Missense_Mutation
KIR3DL1	3811	hgsc.bcm.edu	37	19	55324675	55324675	+	Intron	DEL	A	A	-			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr19:55324675delA	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000345540.5_Intron|KIR2DL4_ENST00000357494.4_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000396284.2_Frame_Shift_Del_p.K268fs|KIR2DL4_ENST00000359085.4_Frame_Shift_Del_p.K270fs|KIR2DL4_ENST00000346587.4_Intron|KIR3DL1_ENST00000541392.1_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.M271fs*>3(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTGGTGCTCCAAAAAAAAAGT	0.532																																																1	Deletion - Frameshift(1)	ovary(1)	19							,,	51,3917		3,45,1936	66.0	101.0	90.0		,,	-1.0	0.0	19	dbSNP_134	94	51,8005		2,47,3979	no	frameshift,frameshift,intron	KIR2DL4	NM_002255.5,NM_001080772.1,NM_001080770.1	,,	5,92,5915	A1A1,A1R,RR		0.6331,1.2853,0.8483	,,	,,	55324675	102,11922	2077	4226	6303	60016487	SO:0001627	intron_variant	3805			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4314A>-	19.37:g.55324675delA		Somatic		Capture	SOLID	Phase_IV	60016487	O43473|Q14946|Q16541	Frame_Shift_Del	DEL	ENST00000538269.1	37		DEL	5	Baylor																																																																																				0.532	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289		Frame_Shift_Del
KNTC1	9735	hgsc.bcm.edu	37	12	123047187	123047187	+	Silent	SNP	G	G	A			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr12:123047187G>A	ENST00000333479.7	+	20	1722	c.1545G>A	c.(1543-1545)gtG>gtA	p.V515V	KNTC1_ENST00000450485.2_Silent_p.V478V	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	515					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.V515V(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTCTTCAGGTGCTAAGAGCTC	0.284																																																1	Substitution - coding silent(1)	ovary(1)	12											48.0	44.0	46.0					12																	123047187		1793	4069	5862	121613140	SO:0001819	synonymous_variant	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1545G>A	12.37:g.123047187G>A		Somatic		Capture	SOLID	Phase_IV	121613140	A7E2C4|B3KSG2	Silent	SNP	ENST00000333479.7	37	CCDS45002.1	SNP	46	Baylor																																																																																				0.284	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2			Silent
L1CAM	3897	hgsc.bcm.edu	37	X	153130774	153130774	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:153130774G>T	ENST00000370060.1	-	21	2918	c.2729C>A	c.(2728-2730)aCc>aAc	p.T910N	L1CAM_ENST00000538883.1_Missense_Mutation_p.T912N|L1CAM_ENST00000543994.1_Missense_Mutation_p.T912N|L1CAM_ENST00000370055.1_Missense_Mutation_p.T905N|L1CAM_ENST00000361699.4_Missense_Mutation_p.T910N|L1CAM_ENST00000370057.3_Missense_Mutation_p.T910N|L1CAM_ENST00000361981.3_Missense_Mutation_p.T905N	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	910	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T910N(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGTGCTGAAGGTGAACTCGCT	0.652																																																1	Substitution - Missense(1)	ovary(1)	X											57.0	55.0	56.0					X																	153130774		2203	4300	6503	152783968	SO:0001583	missense	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2729C>A	X.37:g.153130774G>T	ENSP00000359077:p.Thr910Asn	Somatic		Capture	SOLID	Phase_IV	152783968	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.169	0.587314	0.13812	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.17	3.02	0.34903	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.385688	0.21342	N	0.076117	T	0.32406	0.0828	L	0.31120	0.905	0.23010	N	0.998437	B;B;B	0.16396	0.017;0.002;0.01	B;B;B	0.17433	0.018;0.014;0.008	T	0.13980	-1.0489	10	0.12766	T	0.61	.	4.5334	0.12017	0.2903:0.1777:0.532:0.0	.	905;910;910	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	N	910;912;910;912;905;905;910	ENSP00000359077:T910N;ENSP00000438430:T912N;ENSP00000359074:T910N;ENSP00000439645:T912N;ENSP00000354712:T905N;ENSP00000359072:T905N;ENSP00000355380:T910N	ENSP00000355380:T910N	T	-	2	0	L1CAM	152783968	0.593000	0.26840	0.282000	0.24776	0.282000	0.26991	0.849000	0.27723	0.956000	0.37904	0.529000	0.55759	ACC		0.652	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Missense_Mutation
LHFPL4	375323	hgsc.bcm.edu	37	3	9543917	9543917	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr3:9543917A>T	ENST00000287585.6	-	4	1007	c.722T>A	c.(721-723)gTg>gAg	p.V241E	RP11-58B17.2_ENST00000602693.1_lincRNA	NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	0						integral component of membrane (GO:0016021)		p.V241E(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					TGAGTGAGCCACGGGGCAGGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	3											53.0	49.0	51.0					3																	9543917		2203	4300	6503	9518917	SO:0001583	missense	375323			AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.722T>A	3.37:g.9543917A>T	ENSP00000287585:p.Val241Glu	Somatic		Capture	SOLID	Phase_IV	9518917	A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000287585.6	37	CCDS33691.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.21	1.869581	0.33069	.	.	ENSG00000156959	ENST00000287585	T	0.74209	-0.82	4.3	3.15	0.36227	.	1.317330	0.05647	N	0.584436	T	0.51787	0.1695	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.28784	0.094	T	0.50180	-0.8858	10	0.66056	D	0.02	-25.0576	6.3505	0.21373	0.8888:0.0:0.1112:0.0	.	241	Q7Z7J7	LHPL4_HUMAN	E	241	ENSP00000287585:V241E	ENSP00000287585:V241E	V	-	2	0	LHFPL4	9518917	0.729000	0.28090	0.101000	0.21167	0.977000	0.68977	4.472000	0.60189	0.714000	0.32081	-0.376000	0.06991	GTG		0.577	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	NM_198560		Missense_Mutation
MADD	8567	hgsc.bcm.edu	37	11	47345815	47345815	+	Splice_Site	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr11:47345815G>T	ENST00000311027.5	+	32	4707		c.e32-1		MADD_ENST00000342922.4_Splice_Site|MADD_ENST00000407859.3_Splice_Site|MADD_ENST00000349238.3_Splice_Site|MADD_ENST00000405573.2_Splice_Site|MADD_ENST00000395344.3_Splice_Site|MADD_ENST00000402799.1_Splice_Site|MADD_ENST00000406482.1_Splice_Site|MADD_ENST00000402192.2_Splice_Site|MADD_ENST00000395336.3_Splice_Site	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.?(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CTGTGCCACAGTGTCGGGAGC	0.587																																																1	Unknown(1)	ovary(1)	11											53.0	52.0	52.0					11																	47345815		2201	4298	6499	47302391	SO:0001630	splice_region_variant	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4543-1G>T	11.37:g.47345815G>T		Somatic		Capture	SOLID	Phase_IV	47302391		Splice_Site_SNP	SNP	ENST00000311027.5	37	CCDS7930.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454360	0.84209	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8881	0.96917	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MADD	47302391	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.465000	0.97660	2.708000	0.92522	0.555000	0.69702	.		0.587	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1		Intron	Splice_Site_SNP
LINC00174	285908	hgsc.bcm.edu	37	7	65842545	65842546	+	lincRNA	INS	-	-	GC	rs3815685|rs200497102|rs71523758	byFrequency	TCGA-13-0761-01	TCGA-13-0761-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr7:65842545_65842546insGC	ENST00000421767.1	-	0	3186_3187					NR_026873.1				long intergenic non-protein coding RNA 174									p.T18fs*93(2)									CCAACACACGTGCTGTTCCTGG	0.569																																																2	Insertion - Frameshift(2)	ovary(1)|kidney(1)	7																																								65479981			285908			AK091213		7q11.21	2013-12-05	2013-12-05	2013-12-05	ENSG00000179406	ENSG00000179406		"""Long non-coding RNAs"""	27788	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 174"""	NCRNA00174			Standard	NR_026873		Approved		uc003tux.4		OTTHUMG00000156590		7.37:g.65842546_65842547dupGC		Somatic		Capture	SOLID	Phase_IV	65479980		Frame_Shift_Ins	INS	ENST00000421767.1	37		INS	59	Baylor																																																																																				0.569	LINC00174-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000344721.1	NR_026873		Frame_Shift_Ins
MET	4233	hgsc.bcm.edu	37	7	116436143	116436143	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0761-01	TCGA-13-0761-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr7:116436143G>A	ENST00000318493.6	+	21	4379	c.4192G>A	c.(4192-4194)Gac>Aac	p.D1398N	MET_ENST00000397752.3_Missense_Mutation_p.D1380N|MET_ENST00000539704.1_Missense_Mutation_p.D250N			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D1398N(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TGATGAGGTGGACACACGACC	0.458			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																														Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	1	Substitution - Missense(1)	ovary(1)	7											196.0	180.0	185.0					7																	116436143		2019	4196	6215	116223379	SO:0001583	missense	4233	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.4192G>A	7.37:g.116436143G>A	ENSP00000317272:p.Asp1398Asn	Somatic		Capture	SOLID	Phase_IV	116223379	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278598	0.59758	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.77358	-0.79;-0.81;-1.09	4.43	3.53	0.40419	.	0.231206	0.52532	N	0.000078	T	0.65502	0.2697	N	0.25890	0.77	0.34616	D	0.71809	B;B	0.19445	0.036;0.009	B;B	0.21917	0.037;0.006	T	0.66787	-0.5835	10	0.41790	T	0.15	.	11.4117	0.49929	0.0908:0.0:0.9092:0.0	.	1398;1380	P08581-2;P08581	.;MET_HUMAN	N	1380;1398;250	ENSP00000380860:D1380N;ENSP00000317272:D1398N;ENSP00000445020:D250N	ENSP00000317272:D1398N	D	+	1	0	MET	116223379	1.000000	0.71417	0.984000	0.44739	0.597000	0.36814	2.979000	0.49313	0.800000	0.34041	0.655000	0.94253	GAC		0.458	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3			Missense_Mutation
MEST	4232	hgsc.bcm.edu	37	7	130138109	130138109	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr7:130138109C>T	ENST00000223215.4	+	5	690	c.469C>T	c.(469-471)Ctc>Ttc	p.L157F	hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000341441.5_Missense_Mutation_p.L148F|MEST_ENST00000393187.1_Missense_Mutation_p.L148F|MEST_ENST00000378576.4_Missense_Mutation_p.L148F|MEST_ENST00000416162.2_Missense_Mutation_p.L148F|MEST_ENST00000437945.1_Missense_Mutation_p.L157F|MEST_ENST00000462132.1_3'UTR|MIR335_ENST00000362173.1_RNA	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	157					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.L157F(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					TCAGGAGCTTCTCTACAGGTC	0.483																																					Colon(126;2182 2305 6517 35181)											1	Substitution - Missense(1)	ovary(1)	7											89.0	91.0	90.0					7																	130138109		2203	4300	6503	129925345	SO:0001583	missense	4232				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.469C>T	7.37:g.130138109C>T	ENSP00000223215:p.Leu157Phe	Somatic		Capture	SOLID	Phase_IV	129925345	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	37	CCDS5822.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117307	0.77323	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000433159;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945;ENST00000458161	T;T;T;T;T;T;T;T;T	0.04119	3.7;3.7;3.7;3.7;3.7;3.7;3.7;3.7;3.7	5.33	3.51	0.40186	.	0.192170	0.46442	D	0.000291	T	0.22820	0.0551	M	0.88105	2.93	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.81914	0.995;0.982;0.969;0.977	T	0.00759	-1.1578	10	0.72032	D	0.01	-14.0304	9.7076	0.40225	0.1407:0.7856:0.0:0.0737	.	143;157;157;148	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	F	148;148;148;148;148;148;148;157;157;148	ENSP00000342749:L148F;ENSP00000409505:L148F;ENSP00000408933:L148F;ENSP00000367839:L148F;ENSP00000409768:L148F;ENSP00000376884:L148F;ENSP00000407222:L148F;ENSP00000223215:L157F;ENSP00000401657:L157F	ENSP00000223215:L157F	L	+	1	0	MEST	129925345	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.435000	0.59941	0.730000	0.32425	-0.314000	0.08810	CTC		0.483	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402		Missense_Mutation
NEDD4L	23327	hgsc.bcm.edu	37	18	55912724	55912724	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr18:55912724C>A	ENST00000400345.3	+	3	471	c.188C>A	c.(187-189)aCa>aAa	p.T63K	NEDD4L_ENST00000588516.1_3'UTR|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000431212.2_5'UTR|NEDD4L_ENST00000586263.1_Missense_Mutation_p.T55K|NEDD4L_ENST00000456986.1_5'UTR|NEDD4L_ENST00000256832.7_5'UTR|NEDD4L_ENST00000256830.9_Missense_Mutation_p.T63K|NEDD4L_ENST00000356462.6_Missense_Mutation_p.T63K|NEDD4L_ENST00000357895.5_Missense_Mutation_p.T55K|NEDD4L_ENST00000435432.2_5'UTR|NEDD4L_ENST00000382850.4_Missense_Mutation_p.T63K|NEDD4L_ENST00000456173.2_5'UTR	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	63	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)	p.T63K(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TTGGTCCAGACAAAAACAATT	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											41.0	41.0	41.0					18																	55912724		1836	4091	5927	54063704	SO:0001583	missense	23327			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.188C>A	18.37:g.55912724C>A	ENSP00000383199:p.Thr63Lys	Somatic		Capture	SOLID	Phase_IV	54063704	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	CCDS45872.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010305	0.93346	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000357895	D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3	5.99	5.99	0.97316	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.95175	0.8436	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;1.0	D	0.95178	0.8296	10	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	55;55;63;63;63	Q96PU5-6;Q96PU5-7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;NED4L_HUMAN;.	K	63;63;63;63;55	ENSP00000383199:T63K;ENSP00000372301:T63K;ENSP00000348847:T63K;ENSP00000256830:T63K;ENSP00000350569:T55K	ENSP00000256830:T63K	T	+	2	0	NEDD4L	54063704	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.844000	0.75390	2.840000	0.97914	0.655000	0.94253	ACA		0.318	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1			Missense_Mutation
NOTCH1	4851	hgsc.bcm.edu	37	9	139390942	139390942	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr9:139390942G>C	ENST00000277541.6	-	34	7324	c.7249C>G	c.(7249-7251)Ccg>Gcg	p.P2417A		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2417	Poly-Pro.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P2416fs*11(1)|p.P2418A(1)|p.P2417A(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCAAGGTGCGGCTGTGGTGGT	0.652			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	3	Substitution - Missense(2)|Deletion - Frameshift(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)	9											22.0	29.0	27.0					9																	139390942		2149	4257	6406	138510763	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7249C>G	9.37:g.139390942G>C	ENSP00000277541:p.Pro2417Ala	Somatic		Capture	SOLID	Phase_IV	138510763	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.642	1.139146	0.21205	.	.	ENSG00000148400	ENST00000277541	T	0.81078	-1.45	5.18	4.25	0.50352	.	0.444772	0.18202	N	0.148487	T	0.65842	0.2730	N	0.14661	0.345	0.24957	N	0.99175	B	0.29481	0.245	B	0.30646	0.118	T	0.49716	-0.8910	10	0.11794	T	0.64	.	14.4746	0.67537	0.0:0.1485:0.8515:0.0	.	2417	P46531	NOTC1_HUMAN	A	2417	ENSP00000277541:P2417A	ENSP00000277541:P2417A	P	-	1	0	NOTCH1	138510763	1.000000	0.71417	0.980000	0.43619	0.297000	0.27493	4.511000	0.60462	1.272000	0.44329	0.558000	0.71614	CCG		0.652	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		Missense_Mutation
ONECUT1	3175	hgsc.bcm.edu	37	15	53049880	53049880	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr15:53049880A>T	ENST00000305901.5	-	2	1397	c.1270T>A	c.(1270-1272)Ttg>Atg	p.L424M	ONECUT1_ENST00000561401.2_5'UTR|ONECUT1_ENST00000560699.2_Silent_p.G64G	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	424					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		CTCAGCTCCAACCCCAGCTGC	0.493																																																0			15											162.0	151.0	155.0					15																	53049880		2194	4293	6487	50837172	SO:0001583	missense	3175			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.1270T>A	15.37:g.53049880A>T	ENSP00000302630:p.Leu424Met	Somatic		Capture	SOLID	Phase_IV	50837172	B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	ENST00000305901.5	37	CCDS10150.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.93	2.979276	0.53827	.	.	ENSG00000169856	ENST00000305901	D	0.98296	-4.85	6.16	1.4	0.22301	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	M	0.86178	2.8	0.80722	D	1	P	0.51537	0.946	D	0.77557	0.99	D	0.98237	1.0486	10	0.87932	D	0	-9.1088	8.9906	0.36022	0.6465:0.0:0.3535:0.0	.	424	Q9UBC0	HNF6_HUMAN	M	424	ENSP00000302630:L424M	ENSP00000302630:L424M	L	-	1	2	ONECUT1	50837172	1.000000	0.71417	0.974000	0.42286	0.981000	0.71138	2.779000	0.47734	-0.005000	0.14395	-0.263000	0.10527	TTG		0.493	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2			Missense_Mutation
PARP10	84875	hgsc.bcm.edu	37	8	145057868	145057868	+	Missense_Mutation	SNP	A	A	G	rs11544989	byFrequency	TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr8:145057868A>G	ENST00000313028.7	-	8	1983	c.1889T>C	c.(1888-1890)gTg>gCg	p.V630A	PARP10_ENST00000533665.1_5'Flank|PARP10_ENST00000525773.1_Missense_Mutation_p.V642A|PARP10_ENST00000524918.1_Missense_Mutation_p.V621A	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	630	Glu-rich.		V -> A (in dbSNP:rs11544989). {ECO:0000269|PubMed:14702039}.		negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCTGGGGTCACCTCCTCCTC	0.692													G|||	2961	0.591254	0.9198	0.4914	5008	,	,		16220	0.1994		0.5755	False		,,,				2504	0.638															0			8							ALA/VAL	3847,539		1690,467,36	22.0	20.0	21.0		1889	-6.9	0.0	8	dbSNP_120	21	4916,3616		1442,2032,792	yes	missense	PARP10	NM_032789.3	64	3132,2499,828	GG,GA,AA		42.3816,12.2891,32.1644	benign	630/1026	145057868	8763,4155	2193	4266	6459	145129856	SO:0001583	missense	84875			AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1889T>C	8.37:g.145057868A>G	ENSP00000325618:p.Val630Ala	Somatic		Capture	SOLID	Phase_IV	145129856	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	SNP	6	Baylor	1178	0.5393772893772893	445	0.9044715447154471	187	0.5165745856353591	108	0.1888111888111888	438	0.5778364116094987	G	0.089	-1.169639	0.01660	0.877109	0.576184	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.09817	2.94;2.94;2.94	3.8	-6.93	0.01638	.	1.544600	0.05087	N	0.484573	T	0.00012	0.0000	N	0.04508	-0.205	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18903	-1.0322	9	0.24483	T	0.36	.	0.563	0.00682	0.3749:0.1777:0.262:0.1855	rs11544989;rs58764065	642;630	E9PNI7;Q53GL7	.;PAR10_HUMAN	A	621;336;630;642	ENSP00000431620:V621A;ENSP00000325618:V630A;ENSP00000434776:V642A	ENSP00000325618:V630A	V	-	2	0	PARP10	145129856	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-3.615000	0.00414	-1.560000	0.01686	-2.796000	0.00114	GTG		0.692	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	NM_032789		Missense_Mutation
PCDHGB4	8641	hgsc.bcm.edu	37	5	140768861	140768861	+	Silent	SNP	A	A	G			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr5:140768861A>G	ENST00000519479.1	+	1	1410	c.1410A>G	c.(1408-1410)tcA>tcG	p.S470S	PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCTATTTCACAAGTCAGGG	0.547																																																0			5											76.0	85.0	82.0					5																	140768861		1894	4106	6000	140749045	SO:0001819	synonymous_variant	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1410A>G	5.37:g.140768861A>G		Somatic		Capture	SOLID	Phase_IV	140749045	O15099|Q2M267|Q9UN64	Silent	SNP	ENST00000519479.1	37	CCDS54928.1	SNP	6	Baylor																																																																																				0.547	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		Silent
PEX16	9409	hgsc.bcm.edu	37	11	45937074	45937074	+	Silent	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr11:45937074G>T	ENST00000378750.5	-	5	648	c.405C>A	c.(403-405)ctC>ctA	p.L135L	PEX16_ENST00000532681.1_Silent_p.L40L|PEX16_ENST00000532554.1_5'UTR|PEX16_ENST00000241041.3_Silent_p.L135L			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	135					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)	p.L135L(1)		large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		GTGAAGTCTGGAGGCCAGCCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	11											77.0	78.0	78.0					11																	45937074		2203	4299	6502	45893650	SO:0001819	synonymous_variant	9409			AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.405C>A	11.37:g.45937074G>T		Somatic		Capture	SOLID	Phase_IV	45893650	Q9BWB9	Silent	SNP	ENST00000378750.5	37	CCDS31472.1	SNP	41	Baylor																																																																																				0.647	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392398.1	NM_057174		Silent
PHACTR4	65979	hgsc.bcm.edu	37	1	28785730	28785730	+	Frame_Shift_Del	DEL	A	A	-	rs550399400		TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:28785730delA	ENST00000373839.3	+	3	412	c.151delA	c.(151-153)aaafs	p.K53fs	PHACTR4_ENST00000373836.3_Frame_Shift_Del_p.K63fs|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	53					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)	p.S64fs*12(3)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GAAATGGAGGAAAAAAAAAAG	0.393																																																3	Deletion - Frameshift(3)	ovary(2)|breast(1)	1							,	74,3472		1,72,1700	69.0	66.0	67.0		,	4.4	1.0	1		71	172,7652		3,166,3743	no	frameshift,frameshift	PHACTR4	NM_023923.3,NM_001048183.1	,	4,238,5443	A1A1,A1R,RR		2.1984,2.0869,2.1636	,	,	28785730	246,11124	1842	4093	5935	28658317	SO:0001589	frameshift_variant	65979			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.151delA	1.37:g.28785730delA	ENSP00000362945:p.Lys53fs	Somatic		Capture	SOLID	Phase_IV	28658317	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Frame_Shift_Del	DEL	ENST00000373839.3	37	CCDS41293.1	DEL	9	Baylor																																																																																				0.393	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923		Frame_Shift_Del
PHLPP1	23239	hgsc.bcm.edu	37	18	60625876	60625876	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0761-01	TCGA-13-0761-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr18:60625876C>A	ENST00000262719.5	+	13	3573	c.3339C>A	c.(3337-3339)agC>agA	p.S1113R	PHLPP1_ENST00000400316.4_Missense_Mutation_p.S601R			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1113					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.S600R(1)		endometrium(2)|kidney(2)|lung(13)	17						TGGACCTGAGCTGTAATGAGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	18											142.0	136.0	138.0					18																	60625876		1919	4130	6049	58776856	SO:0001583	missense	23239			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3339C>A	18.37:g.60625876C>A	ENSP00000262719:p.Ser1113Arg	Somatic		Capture	SOLID	Phase_IV	58776856	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	31	5.101047	0.94245	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.21191	2.02;2.02	5.36	5.36	0.76844	.	.	.	.	.	T	0.45316	0.1336	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.20240	-1.0281	9	0.54805	T	0.06	-20.9905	19.2852	0.94067	0.0:1.0:0.0:0.0	.	1113	O60346	PHLP1_HUMAN	R	601;1113	ENSP00000383170:S601R;ENSP00000262719:S1113R	ENSP00000262719:S1113R	S	+	3	2	PHLPP1	58776856	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.786000	0.62425	2.800000	0.96347	0.650000	0.86243	AGC		0.448	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449		Missense_Mutation
PNLIPRP2	5408	hgsc.bcm.edu	37	10	118383463	118383463	+	RNA	SNP	A	A	G	rs56189579|rs201271480		TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr10:118383463A>G	ENST00000298771.7	+	0	82				PNLIPRP2_ENST00000537242.1_RNA|PNLIPRP2_ENST00000433618.4_RNA	NR_103727.1		P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2						galactolipid catabolic process (GO:0019376)|lipid digestion (GO:0044241)|phospholipid catabolic process (GO:0009395)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	acylglycerol lipase activity (GO:0047372)|calcium ion binding (GO:0005509)|galactolipase activity (GO:0047714)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			endometrium(1)|large_intestine(1)|lung(11)|prostate(3)	16				all cancers(201;0.015)		CTAGGAAAAGAGTCTGCTACG	0.488																																																0			10											78.0	78.0	78.0					10																	118383463		1893	4133	6026	118373453			5408			M93284		10q26.12	2014-03-14				ENSG00000266200	3.1.1.3		9157	protein-coding gene	gene with protein product		604423				1379598	Standard	NM_005396		Approved	PLRP2	uc001lcq.3	P54317			10.37:g.118383463A>G		Somatic		Capture	SOLID	Phase_IV	118373453	A8K627|Q6IB55	Missense_Mutation	SNP	ENST00000298771.7	37		SNP	11	Baylor																																																																																				0.488	PNLIPRP2-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000050546.6	NM_005396		Missense_Mutation
PTPRT	11122	hgsc.bcm.edu	37	20	40727161	40727161	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr20:40727161G>T	ENST00000373187.1	-	27	3745	c.3746C>A	c.(3745-3747)aCc>aAc	p.T1249N	PTPRT_ENST00000356100.2_Missense_Mutation_p.T1258N|PTPRT_ENST00000373198.4_Missense_Mutation_p.T1268N|PTPRT_ENST00000373193.3_Missense_Mutation_p.T1252N|PTPRT_ENST00000373184.1_Missense_Mutation_p.T1259N|PTPRT_ENST00000373201.1_Missense_Mutation_p.T1239N|PTPRT_ENST00000373190.1_Missense_Mutation_p.T1248N			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1249	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.T1271N(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGGGTGCTGGGTGACCACGAA	0.527																																																1	Substitution - Missense(1)	ovary(1)	20											69.0	75.0	73.0					20																	40727161		2107	4250	6357	40160575	SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3746C>A	20.37:g.40727161G>T	ENSP00000362283:p.Thr1249Asn	Somatic		Capture	SOLID	Phase_IV	40160575	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.106645	0.94292	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	5.79	5.79	0.91817	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.97943	1.0327	10	0.87932	D	0	.	20.0207	0.97499	0.0:0.0:1.0:0.0	.	1271;1249	O14522-1;O14522	.;PTPRT_HUMAN	N	1248;1249;1252;1258;1271;1259;1239	ENSP00000362286:T1248N;ENSP00000362283:T1249N;ENSP00000362289:T1252N;ENSP00000348408:T1258N;ENSP00000362294:T1271N;ENSP00000362280:T1259N;ENSP00000362297:T1239N	ENSP00000348408:T1258N	T	-	2	0	PTPRT	40160575	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.739000	0.93911	0.563000	0.77884	ACC		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			Missense_Mutation
RAB3D	9545	hgsc.bcm.edu	37	19	11436141	11436141	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Biotage_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr19:11436141C>T	ENST00000222120.3	-	5	853	c.593G>A	c.(592-594)gGc>gAc	p.G198D	CTC-510F12.6_ENST00000586051.1_RNA|TSPAN16_ENST00000316737.1_Intron|CTC-510F12.4_ENST00000586356.1_RNA|RAB3D_ENST00000589655.1_Missense_Mutation_p.G198D	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	198					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.G198D(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						CCCGTTGCTGCCTGAGCTGGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	19											60.0	54.0	56.0					19																	11436141		2203	4300	6503	11297141	SO:0001583	missense	9545			AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.593G>A	19.37:g.11436141C>T	ENSP00000222120:p.Gly198Asp	Somatic		Capture	SOLID	Phase_IV	11297141		Missense_Mutation	SNP	ENST00000222120.3	37	CCDS12257.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081732	0.36758	.	.	ENSG00000105514	ENST00000222120	T	0.63255	-0.03	4.99	3.91	0.45181	.	0.710719	0.13984	N	0.349289	T	0.45458	0.1343	N	0.19112	0.55	0.41518	D	0.988386	B	0.20550	0.046	B	0.23275	0.045	T	0.37478	-0.9704	10	0.33141	T	0.24	.	9.8214	0.40885	0.1589:0.7017:0.1393:0.0	.	198	O95716	RAB3D_HUMAN	D	198	ENSP00000222120:G198D	ENSP00000222120:G198D	G	-	2	0	RAB3D	11297141	0.031000	0.19500	0.995000	0.50966	0.972000	0.66771	-0.028000	0.12350	2.591000	0.87537	0.455000	0.32223	GGC		0.637	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283		Missense_Mutation
RYR1	6261	hgsc.bcm.edu	37	19	38959774	38959774	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr19:38959774G>T	ENST00000359596.3	+	26	3550	c.3550G>T	c.(3550-3552)Ggg>Tgg	p.G1184W	RYR1_ENST00000355481.4_Missense_Mutation_p.G1184W|RYR1_ENST00000360985.3_Missense_Mutation_p.G1184W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1184	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.G1184W(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GATTGAGATTGGGGACGGTGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	83.0	87.0					19																	38959774		2203	4300	6503	43651614	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3550G>T	19.37:g.38959774G>T	ENSP00000352608:p.Gly1184Trp	Somatic		Capture	SOLID	Phase_IV	43651614	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	g	12.87	2.066286	0.36470	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.76709	-1.04;-1.04;-1.04	3.84	1.65	0.23941	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.179118	0.33290	U	0.005077	D	0.86644	0.5982	M	0.87900	2.915	0.42377	D	0.992473	D;P	0.89917	1.0;0.774	D;P	0.78314	0.991;0.463	D	0.85082	0.0946	10	0.72032	D	0.01	.	7.7496	0.28890	0.0888:0.0:0.7497:0.1616	.	1184;1184	P21817-2;P21817	.;RYR1_HUMAN	W	1184	ENSP00000352608:G1184W;ENSP00000347667:G1184W;ENSP00000354254:G1184W	ENSP00000347667:G1184W	G	+	1	0	RYR1	43651614	1.000000	0.71417	0.993000	0.49108	0.841000	0.47740	6.243000	0.72384	0.310000	0.22990	0.377000	0.23210	GGG		0.542	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Missense_Mutation
PPP6R3	55291	hgsc.bcm.edu	37	11	68377471	68377471	+	Silent	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr11:68377471C>T	ENST00000393800.2	+	23	2804	c.2550C>T	c.(2548-2550)ccC>ccT	p.P850P	PPP6R3_ENST00000529710.1_Silent_p.P770P|PPP6R3_ENST00000534534.1_Silent_p.P618P|PPP6R3_ENST00000524904.1_Silent_p.P844P|PPP6R3_ENST00000524845.1_Silent_p.P821P|PPP6R3_ENST00000265637.4_Silent_p.P804P|PPP6R3_ENST00000265636.5_Silent_p.P770P|PPP6R3_ENST00000393799.2_Silent_p.P856P|PPP6R3_ENST00000393801.3_Silent_p.P856P|PPP6R3_ENST00000527403.2_Silent_p.P815P	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	850					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CCAGGCCTCCCAGCAGCAGTC	0.617																																																0			11											56.0	54.0	55.0					11																	68377471		2200	4294	6494	68134047	SO:0001819	synonymous_variant	55291			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2550C>T	11.37:g.68377471C>T		Somatic		Capture	SOLID	Phase_IV	68134047	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	ENST00000393800.2	37	CCDS53672.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.981	-0.006349	0.07773	.	.	ENSG00000110075	ENST00000530734	T	0.63744	-0.06	5.2	2.16	0.27623	.	0.407493	0.25475	N	0.030417	T	0.58623	0.2135	.	.	.	0.28999	N	0.887599	.	.	.	.	.	.	T	0.57682	-0.7769	7	0.87932	D	0	.	5.9656	0.19322	0.0:0.5411:0.1425:0.3165	.	.	.	.	L	18	ENSP00000433853:P18L	ENSP00000433853:P18L	P	+	2	0	PPP6R3	68134047	0.997000	0.39634	0.992000	0.48379	0.326000	0.28443	1.061000	0.30542	1.181000	0.42912	0.561000	0.74099	CCA		0.617	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312		Silent
SCIN	85477	hgsc.bcm.edu	37	7	12691521	12691521	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr7:12691521A>C	ENST00000297029.5	+	15	2116	c.2015A>C	c.(2014-2016)aAg>aCg	p.K672T	AC011891.5_ENST00000437088.1_lincRNA|SCIN_ENST00000519209.1_Missense_Mutation_p.K425T|SCIN_ENST00000445618.2_Missense_Mutation_p.K425T	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	672	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.K672T(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GAATCTCTGAAGTCTGGTAAG	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											125.0	114.0	118.0					7																	12691521		1852	4098	5950	12658046	SO:0001583	missense	85477			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.2015A>C	7.37:g.12691521A>C	ENSP00000297029:p.Lys672Thr	Somatic		Capture	SOLID	Phase_IV	12658046	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.09	1.833667	0.32421	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.54071	0.59;0.59;0.59	5.74	5.74	0.90152	Gelsolin domain (1);	0.047430	0.85682	D	0.000000	T	0.64450	0.2599	L	0.55481	1.735	0.80722	D	1	D	0.55605	0.972	D	0.65987	0.94	T	0.58912	-0.7552	10	0.11182	T	0.66	-26.9178	16.0395	0.80654	1.0:0.0:0.0:0.0	.	672	Q9Y6U3	ADSV_HUMAN	T	672;425;425	ENSP00000297029:K672T;ENSP00000430997:K425T;ENSP00000390189:K425T	ENSP00000297029:K672T	K	+	2	0	SCIN	12658046	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.602000	0.74141	2.188000	0.69820	0.533000	0.62120	AAG		0.373	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128		Missense_Mutation
SERPINB1	1992	hgsc.bcm.edu	37	6	2836140	2836140	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr6:2836140C>T	ENST00000380739.5	-	6	887	c.685G>A	c.(685-687)Gtc>Atc	p.V229I	SERPINB1_ENST00000537185.1_Missense_Mutation_p.V78I|SERPINB1_ENST00000476896.1_5'Flank	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	229					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V229I(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		AGCAGGATGACCATGCTGAGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											102.0	89.0	93.0					6																	2836140		2203	4300	6503	2781139	SO:0001583	missense	1992			M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.685G>A	6.37:g.2836140C>T	ENSP00000370115:p.Val229Ile	Somatic		Capture	SOLID	Phase_IV	2781139	A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Missense_Mutation	SNP	ENST00000380739.5	37	CCDS4477.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	7.276	0.608209	0.14002	.	.	ENSG00000021355	ENST00000380739;ENST00000542771;ENST00000537185	D;D	0.84442	-1.85;-1.85	5.36	-7.22	0.01485	Serpin domain (3);	0.535990	0.20811	N	0.085246	T	0.38692	0.1050	L	0.28115	0.83	0.27856	N	0.940581	B	0.09022	0.002	B	0.16289	0.015	T	0.53802	-0.8387	10	0.06365	T	0.9	.	3.4533	0.07506	0.0868:0.2171:0.3591:0.337	.	229	P30740	ILEU_HUMAN	I	229;191;78	ENSP00000370115:V229I;ENSP00000444543:V78I	ENSP00000370115:V229I	V	-	1	0	SERPINB1	2781139	0.008000	0.16893	0.038000	0.18304	0.518000	0.34316	-1.121000	0.03270	-1.616000	0.01572	-0.867000	0.03001	GTC		0.507	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039637.1			Missense_Mutation
SIAH2	6478	hgsc.bcm.edu	37	3	150460047	150460047	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr3:150460047C>T	ENST00000312960.3	-	2	1383	c.856G>A	c.(856-858)Ggt>Agt	p.G286S		NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	286	SBD.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G286S(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCAGCCACACCGTCATGAATC	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											90.0	74.0	80.0					3																	150460047		2203	4300	6503	151942737	SO:0001583	missense	6478			U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.856G>A	3.37:g.150460047C>T	ENSP00000322457:p.Gly286Ser	Somatic		Capture	SOLID	Phase_IV	151942737	O43270	Missense_Mutation	SNP	ENST00000312960.3	37	CCDS3152.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529817	0.64860	.	.	ENSG00000181788	ENST00000312960	T	0.24723	1.84	5.81	4.94	0.65067	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	L	0.35793	1.09	0.80722	D	1	D	0.54601	0.967	P	0.47402	0.546	T	0.03025	-1.1081	10	0.05620	T	0.96	.	14.874	0.70481	0.0:0.9315:0.0:0.0685	.	286	O43255	SIAH2_HUMAN	S	286	ENSP00000322457:G286S	ENSP00000322457:G286S	G	-	1	0	SIAH2	151942737	1.000000	0.71417	0.896000	0.35187	0.390000	0.30446	7.802000	0.85969	1.468000	0.48064	-0.229000	0.12294	GGT		0.527	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357697.1	NM_005067		Missense_Mutation
SMARCA1	6594	hgsc.bcm.edu	37	X	128649709	128649709	+	Silent	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:128649709G>T	ENST00000371122.4	-	5	714	c.585C>A	c.(583-585)atC>atA	p.I195I	SMARCA1_ENST00000478420.1_5'UTR|SMARCA1_ENST00000371123.1_Silent_p.I195I|SMARCA1_ENST00000371121.3_Silent_p.I195I	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	195	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.I195I(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CATATAAAGAGATCAACCAAT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	X											86.0	83.0	84.0					X																	128649709		2203	4300	6503	128477390	SO:0001819	synonymous_variant	6594			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.585C>A	X.37:g.128649709G>T		Somatic		Capture	SOLID	Phase_IV	128477390	Q5JV41|Q5JV42	Silent	SNP	ENST00000371122.4	37	CCDS14612.1	SNP	33	Baylor																																																																																				0.348	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069		Silent
SNX16	64089	hgsc.bcm.edu	37	8	82736049	82736049	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr8:82736049C>G	ENST00000345957.4	-	4	867	c.589G>C	c.(589-591)Gct>Cct	p.A197P	SNX16_ENST00000396330.2_Missense_Mutation_p.A197P|SNX16_ENST00000353788.4_Missense_Mutation_p.A168P	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16	197	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)	p.A197P(1)		large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						TCCTTGTGAGCTACTAAATTT	0.318																																																1	Substitution - Missense(1)	ovary(1)	8											114.0	114.0	114.0					8																	82736049		2203	4300	6503	82898604	SO:0001583	missense	64089			AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.589G>C	8.37:g.82736049C>G	ENSP00000322652:p.Ala197Pro	Somatic		Capture	SOLID	Phase_IV	82898604	A8K4D8|Q658L0|Q8N4U3	Missense_Mutation	SNP	ENST00000345957.4	37	CCDS6234.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	33	5.204700	0.95033	.	.	ENSG00000104497	ENST00000353788;ENST00000396330;ENST00000345957;ENST00000523757;ENST00000521810	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.87	5.87	0.94306	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.67069	0.2854	M	0.79258	2.445	0.80722	D	1	D;D	0.69078	0.997;0.993	D;D	0.68483	0.958;0.956	T	0.65282	-0.6206	10	0.45353	T	0.12	-19.0209	20.2192	0.98319	0.0:1.0:0.0:0.0	.	168;197	Q658L0;P57768	.;SNX16_HUMAN	P	168;197;197;168;197	ENSP00000322631:A168P;ENSP00000379621:A197P;ENSP00000322652:A197P;ENSP00000430038:A168P;ENSP00000428734:A197P	ENSP00000322652:A197P	A	-	1	0	SNX16	82898604	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.780000	0.95670	0.655000	0.94253	GCT		0.318	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379929.1	NM_022133		Missense_Mutation
SPEN	23013	hgsc.bcm.edu	37	1	16254640	16254640	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0761-01	TCGA-13-0761-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr1:16254640T>G	ENST00000375759.3	+	11	2109	c.1905T>G	c.(1903-1905)agT>agG	p.S635R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	635	Arg-rich.|Tyr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.S635R(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATTATGAGAGTGTTCGAACTC	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	86.0	86.0					1																	16254640		2203	4300	6503	16127227	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1905T>G	1.37:g.16254640T>G	ENSP00000364912:p.Ser635Arg	Somatic		Capture	SOLID	Phase_IV	16127227	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	10.65	1.408539	0.25378	.	.	ENSG00000065526	ENST00000375759	T	0.07688	3.17	4.54	2.23	0.28157	.	.	.	.	.	T	0.04952	0.0133	N	0.14661	0.345	0.21290	N	0.999733	B	0.23735	0.09	B	0.19148	0.024	T	0.38457	-0.9660	9	0.56958	D	0.05	-10.4171	5.9124	0.19035	0.0:0.1525:0.1393:0.7082	.	635	Q96T58	MINT_HUMAN	R	635	ENSP00000364912:S635R	ENSP00000364912:S635R	S	+	3	2	SPEN	16127227	1.000000	0.71417	0.990000	0.47175	0.953000	0.61014	0.840000	0.27600	0.370000	0.24538	0.460000	0.39030	AGT		0.428	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001		Missense_Mutation
SRC	6714	hgsc.bcm.edu	37	20	36030940	36030940	+	Missense_Mutation	SNP	G	G	C	rs186207963		TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr20:36030940G>C	ENST00000373578.2	+	12	1568	c.1219G>C	c.(1219-1221)Gac>Cac	p.D407H	SRC_ENST00000358208.4_Missense_Mutation_p.D407H|SRC_ENST00000373558.2_Missense_Mutation_p.D413H|SRC_ENST00000373567.2_Missense_Mutation_p.D407H|SRC_ENST00000445403.1_Missense_Mutation_p.D407H|SRC_ENST00000360723.4_Missense_Mutation_p.D413H|SRC_ENST00000477066.1_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	407	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.D407H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CAAAGTGGCGGACTTTGGGCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											64.0	57.0	59.0					20																	36030940		2203	4300	6503	35464354	SO:0001583	missense	6714			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1219G>C	20.37:g.36030940G>C	ENSP00000362680:p.Asp407His	Somatic		Capture	SOLID	Phase_IV	35464354	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	CCDS13294.1	SNP	41	Baylor	263	0.12042124542124542	85	0.17276422764227642	28	0.07734806629834254	48	0.08391608391608392	102	0.1345646437994723	G	24.8	4.567860	0.86439	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.99	4.99	0.66335	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.00695	0.0023	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56080	-0.8038	10	0.87932	D	0	.	15.8235	0.78678	0.0:0.0:1.0:0.0	.	407	P12931	SRC_HUMAN	H	407;407;413;407;407;413	ENSP00000408503:D407H;ENSP00000362680:D407H;ENSP00000353950:D413H;ENSP00000350941:D407H;ENSP00000362668:D407H;ENSP00000362659:D413H	ENSP00000350941:D407H	D	+	1	0	SRC	35464354	1.000000	0.71417	0.984000	0.44739	0.788000	0.44548	9.657000	0.98554	2.586000	0.87340	0.561000	0.74099	GAC		0.622	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417		Missense_Mutation
TFDP1	7027	hgsc.bcm.edu	37	13	114288852	114288852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr13:114288852G>T	ENST00000375370.5	+	8	834	c.622G>T	c.(622-624)Gaa>Taa	p.E208*	TFDP1_ENST00000538138.1_Nonsense_Mutation_p.E113*|TFDP1_ENST00000544902.1_Nonsense_Mutation_p.E113*	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	208	Dimerization. {ECO:0000255}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E208*(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			TTTGAAGGTGGAAAGACAGAG	0.398										TSP Lung(29;0.18)																																						1	Substitution - Nonsense(1)	ovary(1)	13											135.0	143.0	140.0					13																	114288852		2203	4300	6503	113336853	SO:0001587	stop_gained	7027			BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.622G>T	13.37:g.114288852G>T	ENSP00000364519:p.Glu208*	Somatic		Capture	SOLID	Phase_IV	113336853	B4DLQ9|Q5JSB4|Q8IZL5	Nonsense_Mutation	SNP	ENST00000375370.5	37	CCDS9538.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	36	5.614558	0.96649	.	.	ENSG00000198176	ENST00000538138;ENST00000375370;ENST00000544902;ENST00000408980	.	.	.	4.07	4.07	0.47477	.	0.104805	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.6316	0.85035	0.0:0.0:1.0:0.0	.	.	.	.	X	113;208;113;208	.	ENSP00000364519:E208X	E	+	1	0	TFDP1	113336853	1.000000	0.71417	0.996000	0.52242	0.733000	0.41908	8.833000	0.92089	1.994000	0.58287	0.491000	0.48974	GAA		0.398	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045918.3	NM_007111		Nonsense_Mutation
TNK2	10188	hgsc.bcm.edu	37	3	195611842	195611842	+	Silent	SNP	C	C	T			TCGA-13-0761-01	TCGA-13-0761-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr3:195611842C>T	ENST00000333602.6	-	4	914	c.297G>A	c.(295-297)cgG>cgA	p.R99R	TNK2_ENST00000392400.1_Silent_p.R99R|TNK2_ENST00000316664.3_Silent_p.R99R|TNK2_ENST00000468819.1_5'UTR|TNK2_ENST00000381916.2_Silent_p.R162R|TNK2_ENST00000428187.1_Silent_p.R131R	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	99	SAM-like domain.		R -> Q (in an ovarian mucinous carcinoma sample; somatic mutation; undergoes autoactivation and causes phosphorylation on Tyr-284 leading to activation of AKT1). {ECO:0000269|PubMed:17344846}.|R -> W (in dbSNP:rs3747673). {ECO:0000269|PubMed:17344846}.		cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)	p.R99R(1)|p.R162R(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCGAGGTCTTCCGGAAGGTGC	0.642																																																2	Substitution - coding silent(2)	ovary(2)	3											45.0	45.0	45.0					3																	195611842		2203	4300	6503	197096239	SO:0001819	synonymous_variant	10188			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.297G>A	3.37:g.195611842C>T		Somatic		Capture	SOLID	Phase_IV	197096239	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	SNP	30	Baylor																																																																																				0.642	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781		Silent
TOP2A	7153	hgsc.bcm.edu	37	17	38569162	38569164	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-13-0761-01	TCGA-13-0761-10	TCT	TCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:38569162_38569164delTCT	ENST00000423485.1	-	7	794_796	c.636_638delAGA	c.(634-639)gaagat>gat	p.E212del		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	212					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	ACATGTATAATCTTCTCCATTGA	0.365																																																0			17																																								35822690	SO:0001651	inframe_deletion	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.636_638delAGA	17.37:g.38569165_38569167delTCT	ENSP00000411532:p.Glu212del	Somatic		Capture	SOLID	Phase_IV	35822688	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	In_Frame_Del	DEL	ENST00000423485.1	37	CCDS45672.1	DEL	50	Baylor																																																																																				0.365	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			In_Frame_Del
TP53	7157	hgsc.bcm.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-13-0761-01	TCGA-13-0761-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	SOLID	Phase_IV	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
ZNF169	169841	hgsc.bcm.edu	37	9	97062949	97062949	+	Missense_Mutation	SNP	G	G	A	rs138071298		TCGA-13-0761-01	TCGA-13-0761-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chr9:97062949G>A	ENST00000395395.2	+	5	1199	c.1109G>A	c.(1108-1110)gGg>gAg	p.G370E	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				TCACACACAGGGGAGAGGCCC	0.577																																																0			9						G	GLU/GLY	1,4405	2.1+/-5.4	0,1,2202	65.0	57.0	60.0		1109	1.8	0.0	9	dbSNP_134	60	0,8600		0,0,4300	yes	missense	ZNF169	NM_194320.2	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	370/604	97062949	1,13005	2203	4300	6503	96102770	SO:0001583	missense	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1109G>A	9.37:g.97062949G>A	ENSP00000378792:p.Gly370Glu	Somatic		Capture	SOLID	Phase_IV	96102770	A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	ENST00000395395.2	37	CCDS6709.2	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.14	1.269441	0.23221	2.27E-4	0.0	ENSG00000175787	ENST00000395395;ENST00000340911	T	0.25749	1.78	2.71	1.8	0.24995	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42314	0.1197	L	0.59967	1.855	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.31888	-0.9927	9	0.87932	D	0	.	9.7469	0.40453	0.0:0.2137:0.7863:0.0	.	370	Q14929	ZN169_HUMAN	E	370;179	ENSP00000378792:G370E	ENSP00000340711:G179E	G	+	2	0	ZNF169	96102770	0.950000	0.32346	0.003000	0.11579	0.043000	0.13939	1.551000	0.36233	0.707000	0.31934	0.603000	0.83216	GGG		0.577	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253714.1	NM_194320		Missense_Mutation
ZNF449	203523	hgsc.bcm.edu	37	X	134494391	134494391	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0761-01	TCGA-13-0761-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0761-01	TCGA-13-0761-10	g.chrX:134494391A>T	ENST00000339249.4	+	5	1087	c.947A>T	c.(946-948)aAg>aTg	p.K316M		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	316					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K316M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CACAAGAAAAAGAGTCCAGGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	X											57.0	57.0	57.0					X																	134494391		2202	4298	6500	134322057	SO:0001583	missense	203523			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.947A>T	X.37:g.134494391A>T	ENSP00000339585:p.Lys316Met	Somatic		Capture	SOLID	Phase_IV	134322057	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Missense_Mutation	SNP	ENST00000339249.4	37	CCDS14649.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.685	0.906155	0.17760	.	.	ENSG00000173275	ENST00000339249	T	0.07021	3.23	4.86	2.53	0.30540	.	0.136380	0.33938	N	0.004420	T	0.06872	0.0175	N	0.21142	0.635	0.26314	N	0.977772	B	0.31611	0.331	B	0.41299	0.353	T	0.23154	-1.0196	10	0.48119	T	0.1	.	3.3578	0.07176	0.5833:0.2058:0.2109:0.0	.	316	Q6P9G9	ZN449_HUMAN	M	316	ENSP00000339585:K316M	ENSP00000339585:K316M	K	+	2	0	ZNF449	134322057	0.004000	0.15560	0.719000	0.30619	0.084000	0.17831	0.336000	0.19823	0.781000	0.33589	0.481000	0.45027	AAG		0.463	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058411.1	NM_152695		Missense_Mutation
