#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCD2	225	hgsc.bcm.edu	37	12	39979968	39979968	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0762-01	TCGA-13-0762-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:39979968A>T	ENST00000308666.3	-	7	1913	c.1778T>A	c.(1777-1779)gTt>gAt	p.V593D		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	593	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)	p.V593D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						TTCTCTTTGAACTATGTGATA	0.338																																																1	Substitution - Missense(1)	ovary(1)	12											165.0	140.0	149.0					12																	39979968		2203	4300	6503	38266235	SO:0001583	missense	225			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1778T>A	12.37:g.39979968A>T	ENSP00000310688:p.Val593Asp	Somatic		Capture	SOLID	Phase_IV	38266235	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984950	0.74474	.	.	ENSG00000173208	ENST00000308666	D	0.99857	-7.22	4.63	4.63	0.57726	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000001	D	0.99822	0.9921	M	0.80746	2.51	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.96715	0.9528	9	.	.	.	-12.3638	14.3336	0.66574	1.0:0.0:0.0:0.0	.	593	Q9UBJ2	ABCD2_HUMAN	D	593	ENSP00000310688:V593D	.	V	-	2	0	ABCD2	38266235	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	8.576000	0.90770	1.840000	0.53500	0.402000	0.26972	GTT		0.338	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164		Missense_Mutation
ACTR1B	10120	hgsc.bcm.edu	37	2	98274480	98274480	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr2:98274480T>G	ENST00000289228.5	-	8	1067	c.851A>C	c.(850-852)cAc>cCc	p.H284P		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	284					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						GTCGGACTTGTGTATGGCGAA	0.617																																																0			2											83.0	77.0	79.0					2																	98274480		2203	4300	6503	97640912	SO:0001583	missense	10120			X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.851A>C	2.37:g.98274480T>G	ENSP00000289228:p.His284Pro	Somatic		Capture	SOLID	Phase_IV	97640912	D3DVH2|Q53SK5|Q9BRB7	Missense_Mutation	SNP	ENST00000289228.5	37	CCDS2033.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	.	11.99	1.804494	0.31869	.	.	ENSG00000115073	ENST00000289228	D	0.94330	-3.4	4.46	4.46	0.54185	.	0.071480	0.64402	D	0.000020	D	0.90466	0.7014	L	0.44542	1.39	0.40702	D	0.982496	B	0.17852	0.024	B	0.28465	0.09	D	0.88838	0.3310	10	0.87932	D	0	.	11.7232	0.51693	0.0:0.0:0.0:1.0	.	284	P42025	ACTY_HUMAN	P	284	ENSP00000289228:H284P	ENSP00000289228:H284P	H	-	2	0	ACTR1B	97640912	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.776000	0.62354	1.867000	0.54127	0.533000	0.62120	CAC		0.617	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735		Missense_Mutation
ASGR2	433	hgsc.bcm.edu	37	17	7010404	7010404	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr17:7010404T>C	ENST00000380952.2	-	7	842	c.578A>G	c.(577-579)cAc>cGc	p.H193R	ASGR2_ENST00000446679.2_Missense_Mutation_p.H174R|ASGR2_ENST00000254850.7_Missense_Mutation_p.H169R|ASGR2_ENST00000355035.5_Missense_Mutation_p.H193R	NM_001181.4|NM_001201352.1|NM_080912.3	NP_001172|NP_001188281.1|NP_550434	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2	193	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				bone mineralization (GO:0030282)|cell surface receptor signaling pathway (GO:0007166)|glycoprotein metabolic process (GO:0009100)|lipid homeostasis (GO:0055088)|receptor-mediated endocytosis (GO:0006898)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|skin(3)|stomach(4)	18					Antihemophilic Factor(DB00025)	CTTCCCGGAGTGAGAGAACCA	0.632																																																0			17											106.0	94.0	98.0					17																	7010404		2203	4300	6503	6951128	SO:0001583	missense	433			M11025	CCDS11088.1, CCDS32544.1, CCDS45598.1	17p	2011-08-30			ENSG00000161944	ENSG00000161944		"""C-type lectin domain containing"""	743	protein-coding gene	gene with protein product		108361				3863106	Standard	NM_080912		Approved	CLEC4H2	uc002ger.3	P07307	OTTHUMG00000102158	ENST00000380952.2:c.578A>G	17.37:g.7010404T>C	ENSP00000370339:p.His193Arg	Somatic		Capture	SOLID	Phase_IV	6951128	A6NLV8|A8MT12|D3DTM9|D3DTN0|O00448|Q03969	Missense_Mutation	SNP	ENST00000380952.2	37	CCDS32544.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.283425	0.00251	.	.	ENSG00000161944	ENST00000355035;ENST00000254850;ENST00000380952;ENST00000446679	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	4.45	0.0601	0.14334	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	1.052620	0.07497	N	0.906679	T	0.04861	0.0131	N	0.01679	-0.765	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.38373	-0.9664	10	0.02654	T	1	.	6.7477	0.23470	0.0:0.5817:0.0:0.4183	.	169;193;188;174;193	P07307-3;P07307;Q7Z4G9;P07307-2;D3DTN0	.;ASGR2_HUMAN;.;.;.	R	193;169;193;174	ENSP00000347140:H193R;ENSP00000254850:H169R;ENSP00000370339:H193R;ENSP00000405844:H174R	ENSP00000254850:H169R	H	-	2	0	ASGR2	6951128	0.000000	0.05858	0.004000	0.12327	0.341000	0.28922	-0.804000	0.04535	-0.121000	0.11787	-0.180000	0.13094	CAC		0.632	ASGR2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000220003.1	NM_080914		Missense_Mutation
BBS10	79738	hgsc.bcm.edu	37	12	76740392	76740392	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:76740392G>C	ENST00000393262.3	-	2	1456	c.1373C>G	c.(1372-1374)cCa>cGa	p.P458R		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	458					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)	p.P458R(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						ACCAGGATCTGGTGCTTGATA	0.343									Bardet-Biedl syndrome																																							1	Substitution - Missense(1)	ovary(1)	12											85.0	90.0	88.0					12																	76740392		2203	4300	6503	75264523	SO:0001583	missense	79738	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.1373C>G	12.37:g.76740392G>C	ENSP00000376946:p.Pro458Arg	Somatic		Capture	SOLID	Phase_IV	75264523	Q96CW2|Q9H5D2	Missense_Mutation	SNP	ENST00000393262.3	37	CCDS9014.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.387110	0.01194	.	.	ENSG00000179941	ENST00000393262	D	0.85629	-2.01	4.68	-0.403	0.12400	.	0.784648	0.11208	N	0.588025	T	0.76371	0.3978	M	0.62723	1.935	0.09310	N	1	B	0.21905	0.062	B	0.15870	0.014	T	0.58025	-0.7709	10	0.22109	T	0.4	0.0105	1.1495	0.01783	0.233:0.1241:0.3893:0.2536	.	458	Q8TAM1	BBS10_HUMAN	R	458	ENSP00000376946:P458R	ENSP00000376946:P458R	P	-	2	0	BBS10	75264523	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-0.322000	0.08007	0.029000	0.15352	-0.182000	0.12963	CCA		0.343	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2	NM_024685		Missense_Mutation
BCORL1	63035	hgsc.bcm.edu	37	X	129149485	129149485	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:129149485A>G	ENST00000218147.7	+	4	2934	c.2737A>G	c.(2737-2739)Aag>Gag	p.K913E	BCORL1_ENST00000540052.1_Missense_Mutation_p.K913E|BCORL1_ENST00000359304.2_Missense_Mutation_p.K913E|BCORL1_ENST00000303743.5_Missense_Mutation_p.K913E			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	913					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.K913E(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GATTGCTGCCAAGCCTTATGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	X											79.0	65.0	70.0					X																	129149485		2203	4300	6503	128977166	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2737A>G	X.37:g.129149485A>G	ENSP00000218147:p.Lys913Glu	Somatic		Capture	SOLID	Phase_IV	128977166	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	SNP	5	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.92|16.92	3.254935|3.254935	0.59321|0.59321	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.60299|.	0.25;0.69;0.2;0.25;0.79|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.38492|.	N|.	0.001662|.	T|T	0.54303|0.54303	0.1850|0.1850	L|L	0.29908|0.29908	0.895|0.895	0.42532|0.42532	D|D	0.99304|0.99304	D;D|.	0.71674|.	0.998;0.997|.	D;D|.	0.78314|.	0.991;0.985|.	T|T	0.52403|0.52403	-0.8580|-0.8580	10|5	0.42905|.	T|.	0.14|.	-17.9789|-17.9789	14.3746|14.3746	0.66865|0.66865	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	913;913|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	E|R	913;913;913;913;513|348	ENSP00000218147:K913E;ENSP00000307541:K913E;ENSP00000352253:K913E;ENSP00000437775:K913E;ENSP00000399483:K513E|.	ENSP00000218147:K913E|.	K|Q	+|+	1|2	0|0	BCORL1|BCORL1	128977166|128977166	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.501000|4.501000	0.60393|0.60393	1.774000|1.774000	0.52232|0.52232	0.430000|0.430000	0.28490|0.28490	AAG|CAA		0.567	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Missense_Mutation
KANSL2	54934	hgsc.bcm.edu	37	12	49072884	49072884	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:49072884C>G	ENST00000420613.2	-	4	527	c.480G>C	c.(478-480)caG>caC	p.Q160H	KANSL2_ENST00000553086.1_Missense_Mutation_p.Q160H|KANSL2_ENST00000550347.1_Missense_Mutation_p.Q343H|KANSL2_ENST00000357861.3_5'UTR	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	160					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)		p.Q160H(1)									CTCTCCATGTCTGATCCACAG	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											105.0	101.0	102.0					12																	49072884		2032	4203	6235	47359151	SO:0001583	missense	54934			AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.480G>C	12.37:g.49072884C>G	ENSP00000415436:p.Gln160His	Somatic		Capture	SOLID	Phase_IV	47359151	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	ENST00000420613.2	37	CCDS44869.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267430	0.80469	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000553086;ENST00000550931	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.84206	0.5421	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.956	D	0.84829	0.0801	10	0.72032	D	0.01	-15.8215	12.3253	0.55007	0.0:0.9218:0.0:0.0782	.	343;160	F8VX10;Q9H9L4	.;CL041_HUMAN	H	343;160;160;97	ENSP00000449747:Q343H;ENSP00000415436:Q160H;ENSP00000448833:Q160H;ENSP00000448129:Q97H	ENSP00000415436:Q160H	Q	-	3	2	C12orf41	47359151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.166000	0.50785	2.767000	0.95098	0.563000	0.77884	CAG		0.473	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822		Missense_Mutation
C16orf89	146556	hgsc.bcm.edu	37	16	5115850	5115850	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr16:5115850G>A	ENST00000315997.5	-	1	261	c.60C>T	c.(58-60)tcC>tcT	p.S20S	ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000422873.1_Silent_p.S58S|C16orf89_ENST00000472572.3_Silent_p.S20S|C16orf89_ENST00000350219.4_Silent_p.S58S|C16orf89_ENST00000474471.3_Silent_p.S20S	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89	20						cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)	p.S58S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						GCAGTGAGGAGGACCACAGCG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	16											45.0	51.0	49.0					16																	5115850		2115	4241	6356	5055851	SO:0001819	synonymous_variant	146556				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.60C>T	16.37:g.5115850G>A		Somatic		Capture	SOLID	Phase_IV	5055851	B4DUM5|Q8N2I3|Q8N4T1	Silent	SNP	ENST00000315997.5	37	CCDS42116.2	SNP	35	Baylor																																																																																				0.617	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354524.1	NM_152459		Silent
C17orf49	124944	hgsc.bcm.edu	37	17	6919981	6919981	+	Missense_Mutation	SNP	C	C	A	rs61750465		TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr17:6919981C>A	ENST00000439424.2	+	4	462	c.386C>A	c.(385-387)cCc>cAc	p.P129H	MIR497HG_ENST00000443997.1_RNA|AC040977.1_ENST00000593646.1_5'Flank|MIR497HG_ENST00000385056.1_RNA|C17orf49_ENST00000547709.1_3'UTR|RNASEK-C17orf49_ENST00000547302.2_Missense_Mutation_p.P170T|C17orf49_ENST00000552402.1_Missense_Mutation_p.P95H|RP11-589P10.7_ENST00000572547.1_RNA|MIR497HG_ENST00000572453.1_RNA|C17orf49_ENST00000546495.1_Missense_Mutation_p.P129H|MIR497HG_ENST00000385194.1_RNA|C17orf49_ENST00000546760.1_Missense_Mutation_p.P129H|C17orf49_ENST00000552775.1_Missense_Mutation_p.P103H	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49	129					chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P129H(1)		kidney(1)|large_intestine(2)|ovary(1)	4						GCCGGGGGTCCCCCCATAAAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											53.0	58.0	57.0					17																	6919981		2203	4300	6503	6860705	SO:0001583	missense	124944			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147	ENST00000439424.2:c.386C>A	17.37:g.6919981C>A	ENSP00000411851:p.Pro129His	Somatic		Capture	SOLID	Phase_IV	6860705	B4DIV3|C9J4G0|E9PB29	Missense_Mutation	SNP	ENST00000439424.2	37	CCDS32542.1	SNP	22	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.46|17.46	3.394940|3.394940	0.62066|0.62066	.|.	.|.	ENSG00000161939;ENSG00000161939;ENSG00000258315;ENSG00000258315;ENSG00000258315;ENSG00000258315;ENSG00000258315|ENSG00000161939	ENST00000293804;ENST00000455303;ENST00000546495;ENST00000546760;ENST00000552402;ENST00000439424;ENST00000552775|ENST00000547302	.|.	.|.	.|.	5.07|5.07	4.03|4.03	0.46877|0.46877	.|.	0.246883|0.246883	0.39146|0.39146	N|N	0.001449|0.001449	T|T	0.39384|0.39384	0.1076|0.1076	L|L	0.35854|0.35854	1.095|1.095	.|.	.|.	.|.	B;D;B;D|.	0.89917|.	0.01;1.0;0.051;1.0|.	B;D;B;D|.	0.85130|.	0.01;0.997;0.015;0.997|.	T|T	0.49031|0.49031	-0.8981|-0.8981	8|6	0.52906|0.30078	T|T	0.07|0.28	-13.4409|-13.4409	6.3778|6.3778	0.21517|0.21517	0.0:0.7144:0.1876:0.098|0.0:0.7144:0.1876:0.098	.|.	95;129;129;103|.	E9PB29;C9J4G0;Q8IXM2;F8W1H0|.	.;.;BAP18_HUMAN;.|.	H|T	129;95;129;129;95;129;103|170	.|.	ENSP00000411851:P129H|ENSP00000450085:P170T	P|P	+|+	2|1	0|0	AC040977.1;C17orf49|C17orf49	6860705|6860705	0.989000|0.989000	0.36119|0.36119	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.826000|2.826000	0.48104|0.48104	2.335000|2.335000	0.79485|0.79485	0.655000|0.655000	0.94253|0.94253	CCC|CCC		0.582	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407666.1	NM_174893		Missense_Mutation
SMDT1	91689	hgsc.bcm.edu	37	22	42475927	42475927	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr22:42475927G>A	ENST00000331479.3	+	1	229	c.155G>A	c.(154-156)cGc>cAc	p.R52H		NM_033318.4	NP_201575.3	Q9H4I9	EMRE_HUMAN	single-pass membrane protein with aspartate-rich tail 1	52					calcium ion transmembrane import into mitochondrion (GO:0036444)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	integral component of mitochondrial inner membrane (GO:0031305)|uniplex complex (GO:1990246)		p.R52H(1)									ATCGTTACCCGCAGCGGCGCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	22											69.0	70.0	70.0					22																	42475927		2203	4300	6503	40805873	SO:0001583	missense	91689			BC024237	CCDS14031.1	22q13.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000183172	ENSG00000183172			25055	protein-coding gene	gene with protein product		615588	"""chromosome 22 open reading frame 32"""	C22orf32		12477932	Standard	NM_033318		Approved	dJ186O1.1, DDDD	uc003bca.3	Q9H4I9	OTTHUMG00000151286	ENST00000331479.3:c.155G>A	22.37:g.42475927G>A	ENSP00000327467:p.Arg52His	Somatic		Capture	SOLID	Phase_IV	40805873	B2R5D1|Q8TAB9	Missense_Mutation	SNP	ENST00000331479.3	37	CCDS14031.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.176092	0.94846	.	.	ENSG00000183172	ENST00000331479	T	0.50548	0.74	6.08	5.06	0.68205	.	0.277859	0.43110	D	0.000616	T	0.59376	0.2189	M	0.65498	2.005	0.43214	D	0.995088	D	0.63046	0.992	P	0.52598	0.703	T	0.64829	-0.6315	10	0.62326	D	0.03	-5.8922	16.2382	0.82393	0.0:0.2502:0.7498:0.0	.	52	Q9H4I9	CV032_HUMAN	H	52	ENSP00000327467:R52H	ENSP00000327467:R52H	R	+	2	0	C22orf32	40805873	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.763000	0.62257	1.575000	0.49775	0.591000	0.81541	CGC		0.647	SMDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322086.1	NM_033318		Missense_Mutation
C8orf4	56892	hgsc.bcm.edu	37	8	40011118	40011118	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr8:40011118C>T	ENST00000315792.3	+	1	130	c.67C>T	c.(67-69)Cat>Tat	p.H23Y		NM_020130.4	NP_064515	Q9NR00	CH004_HUMAN	chromosome 8 open reading frame 4	23					apoptotic process (GO:0006915)			p.H23Y(1)		breast(1)|large_intestine(1)|ovary(1)	3	Ovarian(28;0.0173)	all_cancers(7;5.34e-21)|all_epithelial(6;1.04e-14)|Lung NSC(58;9.35e-06)|all_lung(54;1.39e-05)|Hepatocellular(245;0.00745)|Breast(189;0.0334)|Colorectal(162;0.0815)|Myeloproliferative disorder(644;0.116)|Esophageal squamous(32;0.141)	LUSC - Lung squamous cell carcinoma(45;0.000149)	KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)		CCCATCCATCCATGGCTACCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	8											119.0	94.0	103.0					8																	40011118		2203	4300	6503	40130275	SO:0001583	missense	56892			AF268037	CCDS6115.1	8p11.2	2014-07-11			ENSG00000176907	ENSG00000176907			1357	protein-coding gene	gene with protein product	"""human thyroid cancer 1"""	607702				11056052, 24937306	Standard	NM_020130		Approved	TC-1, hTC-1	uc003xnq.2	Q9NR00	OTTHUMG00000164045	ENST00000315792.3:c.67C>T	8.37:g.40011118C>T	ENSP00000319914:p.His23Tyr	Somatic		Capture	SOLID	Phase_IV	40130275		Missense_Mutation	SNP	ENST00000315792.3	37	CCDS6115.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333327	0.60853	.	.	ENSG00000176907	ENST00000315792	T	0.32988	1.43	6.08	6.08	0.98989	.	0.130080	0.64402	D	0.000001	T	0.36110	0.0955	L	0.50333	1.59	0.58432	D	0.999999	P	0.51537	0.946	B	0.43018	0.405	T	0.13926	-1.0491	10	0.87932	D	0	-12.0007	19.6529	0.95825	0.0:1.0:0.0:0.0	.	23	Q9NR00	CH004_HUMAN	Y	23	ENSP00000319914:H23Y	ENSP00000319914:H23Y	H	+	1	0	C8orf4	40130275	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.184000	0.58323	2.890000	0.99128	0.655000	0.94253	CAT		0.517	C8orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376943.1	NM_020130		Missense_Mutation
CACNA1C	775	hgsc.bcm.edu	37	12	2760846	2760846	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0762-01	TCGA-13-0762-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:2760846G>T	ENST00000347598.4	+	34	4130	c.4130G>T	c.(4129-4131)cGc>cTc	p.R1377L	CACNA1C_ENST00000399591.1_Missense_Mutation_p.R1318L|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R1351L|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R1318L|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R1346L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R1316L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R1349L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R1357L|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R1329L|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.R1329L|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R1354L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1377					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R864L(1)|p.R1407L(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCTTCTTCCGCCTGTTCCGG	0.607																																																2	Substitution - Missense(2)	ovary(2)	12											78.0	91.0	86.0					12																	2760846		2200	4300	6500	2631107	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4130G>T	12.37:g.2760846G>T	ENSP00000266376:p.Arg1377Leu	Somatic		Capture	SOLID	Phase_IV	2631107	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	35	5.422344	0.96111	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93	5.17	5.17	0.71159	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99375	0.9780	H	0.96805	3.885	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;0.998;0.998;0.999;0.998;0.995;0.999;0.998;0.999;0.986;0.998;0.999;0.998;0.997;1.0;0.999;0.974;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D	0.91635	0.999;0.993;0.997;0.995;0.993;0.997;0.997;0.998;0.981;0.977;0.997;0.997;0.922;0.998;0.997;0.999;0.986;0.991;0.997;0.82;0.997;0.997;0.997;0.997;0.997	D	0.98512	1.0619	10	0.87932	D	0	.	18.6538	0.91441	0.0:0.0:1.0:0.0	.	20;1351;1326;1377;1329;1329;1329;1346;1357;1329;1349;1329;1289;1377;1329;1329;1329;1318;1316;1318;1318;1329;1329;1329;1329	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	1354;1329;1329;1357;1329;1329;1329;1318;1329;1377;1349;1329;1351;1346;1329;1316;1329;1329;1329;1329;1329;1318;1159	ENSP00000336982:R1354L;ENSP00000382563:R1329L;ENSP00000382552:R1329L;ENSP00000382547:R1357L;ENSP00000382506:R1329L;ENSP00000382530:R1329L;ENSP00000382546:R1329L;ENSP00000382500:R1318L;ENSP00000382549:R1329L;ENSP00000266376:R1377L;ENSP00000382515:R1349L;ENSP00000382510:R1329L;ENSP00000341092:R1351L;ENSP00000382537:R1346L;ENSP00000329877:R1329L;ENSP00000382557:R1316L;ENSP00000385724:R1329L;ENSP00000382512:R1329L;ENSP00000382542:R1329L;ENSP00000382526:R1329L;ENSP00000385896:R1329L;ENSP00000382504:R1318L	ENSP00000323129:R1159L	R	+	2	0	CACNA1C	2631107	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.805000	0.99149	2.412000	0.81896	0.491000	0.48974	CGC		0.607	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		Missense_Mutation
CADPS2	93664	hgsc.bcm.edu	37	7	122269374	122269374	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr7:122269374G>A	ENST00000449022.2	-	4	814	c.795C>T	c.(793-795)aaC>aaT	p.N265N	CADPS2_ENST00000313070.7_Silent_p.N265N|CADPS2_ENST00000412584.2_Silent_p.N265N|CADPS2_ENST00000334010.7_Silent_p.N265N	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	265					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.N265N(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						GTTCATCTGCGTTATCCAGCT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	7											63.0	58.0	60.0					7																	122269374		1863	4100	5963	122056610	SO:0001819	synonymous_variant	93664				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.795C>T	7.37:g.122269374G>A		Somatic		Capture	SOLID	Phase_IV	122056610	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Silent	SNP	ENST00000449022.2	37	CCDS55158.1	SNP	40	Baylor																																																																																				0.398	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954		Silent
CASP7	840	hgsc.bcm.edu	37	10	115489258	115489258	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr10:115489258G>T	ENST00000345633.4	+	8	1255	c.871G>T	c.(871-873)Gtg>Ttg	p.V291L	CASP7_ENST00000369315.1_Missense_Mutation_p.V291L|CASP7_ENST00000452490.2_Missense_Mutation_p.V266L|CASP7_ENST00000369331.4_3'UTR|CASP7_ENST00000369318.3_Missense_Mutation_p.V291L|CASP7_ENST00000369321.2_Missense_Mutation_p.V324L	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	291					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.V324L(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		GATCCCCTGTGTGGTCTCCAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											125.0	115.0	119.0					10																	115489258		2203	4300	6503	115479248	SO:0001583	missense	840			U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.871G>T	10.37:g.115489258G>T	ENSP00000298701:p.Val291Leu	Somatic		Capture	SOLID	Phase_IV	115479248	B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Missense_Mutation	SNP	ENST00000345633.4	37	CCDS7581.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058706	0.55325	.	.	ENSG00000165806	ENST00000369321;ENST00000345633;ENST00000369318;ENST00000442393;ENST00000369315;ENST00000452490	T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39	5.85	1.42	0.22433	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.235823	0.43110	D	0.000606	T	0.13586	0.0329	L	0.46947	1.48	0.51233	D	0.999914	B;B;B;B	0.26483	0.036;0.032;0.15;0.062	B;B;B;B	0.22753	0.022;0.034;0.035;0.041	T	0.08006	-1.0743	10	0.54805	T	0.06	.	7.8626	0.29517	0.2273:0.1223:0.6505:0.0	.	266;299;324;291	B4DQU7;B4DWA2;P55210-3;P55210	.;.;.;CASP7_HUMAN	L	324;291;291;252;291;266	ENSP00000358327:V324L;ENSP00000298701:V291L;ENSP00000358324:V291L;ENSP00000358321:V291L;ENSP00000398107:V266L	ENSP00000298701:V291L	V	+	1	0	CASP7	115479248	0.613000	0.27009	0.800000	0.32199	0.962000	0.63368	0.938000	0.28965	0.792000	0.33850	0.655000	0.94253	GTG		0.468	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050439.1	NM_033338		Missense_Mutation
CCDC64	92558	hgsc.bcm.edu	37	12	120436405	120436405	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:120436405G>A	ENST00000397558.2	+	2	510	c.510G>A	c.(508-510)ctG>ctA	p.L170L		NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	170					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)	p.L170L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTCAGAGCTGGAGAGTGATG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	12											77.0	85.0	82.0					12																	120436405		2036	4185	6221	118920788	SO:0001819	synonymous_variant	92558			U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.510G>A	12.37:g.120436405G>A		Somatic		Capture	SOLID	Phase_IV	118920788	A8MUC8|B4DWL0|B5MDJ0|O95000	Silent	SNP	ENST00000397558.2	37	CCDS41845.1	SNP	47	Baylor																																																																																				0.512	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311		Silent
CCNG2	901	hgsc.bcm.edu	37	4	78085511	78085511	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr4:78085511G>C	ENST00000316355.5	+	7	1146	c.790G>C	c.(790-792)Gat>Cat	p.D264H	CCNG2_ENST00000354403.5_Missense_Mutation_p.D264H|CCNG2_ENST00000395640.1_Missense_Mutation_p.D264H|CCNG2_ENST00000497512.1_3'UTR|CCNG2_ENST00000502280.1_Missense_Mutation_p.D264H|CCNG2_ENST00000509972.1_Missense_Mutation_p.D264H	NM_004354.2	NP_004345.1	Q16589	CCNG2_HUMAN	cyclin G2	264					cell cycle checkpoint (GO:0000075)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)		p.D264H(1)		breast(1)|kidney(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TTGCAAACCAGATCTTAAGAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	4											91.0	91.0	91.0					4																	78085511		2203	4300	6503	78304535	SO:0001583	missense	901			BC032518	CCDS3581.1	4q21.22	2009-05-07			ENSG00000138764	ENSG00000138764			1593	protein-coding gene	gene with protein product		603203				8806701	Standard	NM_004354		Approved		uc003hkq.4	Q16589	OTTHUMG00000130100	ENST00000316355.5:c.790G>C	4.37:g.78085511G>C	ENSP00000315743:p.Asp264His	Somatic		Capture	SOLID	Phase_IV	78304535	B4DF25|Q6FGA7|Q6FGC6	Missense_Mutation	SNP	ENST00000316355.5	37	CCDS3581.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990873	0.54041	.	.	ENSG00000138764	ENST00000316355;ENST00000354403;ENST00000502280;ENST00000395640;ENST00000509972	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.7	5.7	0.88788	.	0.097704	0.64402	D	0.000001	T	0.50292	0.1607	L	0.57536	1.79	0.48395	D	0.999641	D;D	0.89917	0.992;1.0	P;D	0.70227	0.887;0.968	T	0.37911	-0.9685	10	0.09084	T	0.74	-27.0351	13.0814	0.59115	0.0731:0.0:0.9269:0.0	.	264;264	B4DF25;Q16589	.;CCNG2_HUMAN	H	264	ENSP00000315743:D264H;ENSP00000346379:D264H;ENSP00000424665:D264H;ENSP00000379002:D264H;ENSP00000426476:D264H	ENSP00000315743:D264H	D	+	1	0	CCNG2	78304535	1.000000	0.71417	0.998000	0.56505	0.738000	0.42128	3.441000	0.52893	2.701000	0.92244	0.561000	0.74099	GAT		0.438	CCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252404.3	NM_004354		Missense_Mutation
CDH17	1015	hgsc.bcm.edu	37	8	95158222	95158222	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr8:95158222G>T	ENST00000027335.3	-	15	2225	c.2101C>A	c.(2101-2103)Ccc>Acc	p.P701T	CDH17_ENST00000441892.2_Missense_Mutation_p.P487T|CDH17_ENST00000450165.2_Missense_Mutation_p.P701T	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	701	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.P701T(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GTAAAATGGGGACCCCGAAAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	8											96.0	90.0	92.0					8																	95158222		2203	4300	6503	95227398	SO:0001583	missense	1015			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.2101C>A	8.37:g.95158222G>T	ENSP00000027335:p.Pro701Thr	Somatic		Capture	SOLID	Phase_IV	95227398	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.260	1.043083	0.19748	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.37752	1.18;1.18;1.18	5.9	3.13	0.36017	Cadherin (1);Cadherin-like (1);	1.138720	0.06577	N	0.749524	T	0.39600	0.1084	M	0.76433	2.335	0.09310	N	1	B;P	0.42409	0.291;0.779	B;B	0.39299	0.058;0.296	T	0.25916	-1.0118	10	0.21540	T	0.41	1.4625	9.0703	0.36488	0.2347:0.0:0.7653:0.0	.	487;701	E7EN24;Q12864	.;CAD17_HUMAN	T	701;487;701	ENSP00000027335:P701T;ENSP00000392811:P487T;ENSP00000401468:P701T	ENSP00000027335:P701T	P	-	1	0	CDH17	95227398	0.019000	0.18553	0.019000	0.16419	0.672000	0.39443	1.210000	0.32370	0.831000	0.34780	0.563000	0.77884	CCC		0.453	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		Missense_Mutation
CDH6	1004	hgsc.bcm.edu	37	5	31323415	31323415	+	Silent	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr5:31323415A>G	ENST00000265071.2	+	12	2638	c.2373A>G	c.(2371-2373)taA>taG	p.*791*		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	0					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AAGACTCCTAATCTGTTGCCT	0.413																																																0			5											75.0	71.0	72.0					5																	31323415		2202	4298	6500	31359172	SO:0001819	synonymous_variant	1004			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2373A>G	5.37:g.31323415A>G		Somatic		Capture	SOLID	Phase_IV	31359172	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	CCDS3894.1	SNP	4	Baylor																																																																																				0.413	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		Silent
CLEC4C	170482	hgsc.bcm.edu	37	12	7894105	7894105	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:7894105G>C	ENST00000542353.1	-	4	637	c.147C>G	c.(145-147)agC>agG	p.S49R	CLEC4C_ENST00000540085.1_Missense_Mutation_p.S18R|CLEC4C_ENST00000354629.5_Missense_Mutation_p.S18R|CLEC4C_ENST00000360345.3_Missense_Mutation_p.S49R	NM_130441.2	NP_569708.1	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C	49					innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S49R(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				Kidney(36;0.0915)		TGACAGTTTTGCTATACATAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	12											154.0	132.0	139.0					12																	7894105		2203	4300	6503	7785372	SO:0001583	missense	170482			AF325460	CCDS8583.1, CCDS8584.1	12p13.2-p12.3	2008-02-05	2004-02-13	2005-02-11	ENSG00000198178	ENSG00000198178		"""C-type lectin domain containing"", ""CD molecules"""	13258	protein-coding gene	gene with protein product		606677	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 7"""	CLECSF11, CLECSF7		11031109, 11536172	Standard	NM_130441		Approved	HECL, DLEC, BDCA2, CD303	uc001qth.1	Q8WTT0	OTTHUMG00000168441	ENST00000542353.1:c.147C>G	12.37:g.7894105G>C	ENSP00000440428:p.Ser49Arg	Somatic		Capture	SOLID	Phase_IV	7785372	D3DUU3|Q3T1C3|Q6UXS8|Q8WXX8	Missense_Mutation	SNP	ENST00000542353.1	37	CCDS8583.1	SNP	46	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.043	0.193538	0.09599	.	.	ENSG00000198178	ENST00000542353;ENST00000354629;ENST00000540085;ENST00000360345	T;T;T;T	0.02280	4.41;4.36;4.36;4.41	1.61	1.61	0.23674	.	.	.	.	.	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	P;D	0.71674	0.946;0.998	B;P	0.62649	0.361;0.905	T	0.53251	-0.8465	9	0.16420	T	0.52	.	6.6803	0.23117	0.0:0.0:1.0:0.0	.	18;49	Q8WTT0-2;Q8WTT0	.;CLC4C_HUMAN	R	49;18;18;49	ENSP00000440428:S49R;ENSP00000346648:S18R;ENSP00000445338:S18R;ENSP00000353500:S49R	ENSP00000346648:S18R	S	-	3	2	CLEC4C	7785372	0.098000	0.21812	0.036000	0.18154	0.046000	0.14306	0.382000	0.20635	1.193000	0.43086	0.514000	0.50259	AGC		0.413	CLEC4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399750.1	NM_203503		Missense_Mutation
CMYA5	202333	hgsc.bcm.edu	37	5	79034473	79034473	+	Silent	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr5:79034473G>C	ENST00000446378.2	+	2	9916	c.9885G>C	c.(9883-9885)ctG>ctC	p.L3295L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3295					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.L3295L(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGAAGAGTCTGGAAGAACAGA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	5											124.0	121.0	122.0					5																	79034473		1933	4146	6079	79070229	SO:0001819	synonymous_variant	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9885G>C	5.37:g.79034473G>C		Somatic		Capture	SOLID	Phase_IV	79070229	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	37	CCDS47238.1	SNP	47	Baylor																																																																																				0.463	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610		Silent
CROT	54677	hgsc.bcm.edu	37	7	87011450	87011450	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr7:87011450A>G	ENST00000331536.3	+	12	1308	c.1123A>G	c.(1123-1125)Aaa>Gaa	p.K375E	CROT_ENST00000419147.2_Missense_Mutation_p.K403E|CROT_ENST00000442291.1_Missense_Mutation_p.K375E	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	375					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)	p.K375E(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TGTGGATGAGAAAGTTTTAAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	7											68.0	69.0	68.0					7																	87011450		2203	4298	6501	86849386	SO:0001583	missense	54677				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1123A>G	7.37:g.87011450A>G	ENSP00000331981:p.Lys375Glu	Somatic		Capture	SOLID	Phase_IV	86849386	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	CCDS5604.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.246	1.039426	0.19669	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.88586	-2.4;-2.4;-2.4	5.3	5.3	0.74995	.	0.095061	0.64402	D	0.000001	T	0.80813	0.4695	N	0.25647	0.755	0.49130	D	0.999753	B;B	0.21452	0.056;0.028	B;B	0.23419	0.046;0.013	T	0.74618	-0.3605	10	0.02654	T	1	-27.0211	15.5342	0.75990	1.0:0.0:0.0:0.0	.	403;375	E7EQF2;Q9UKG9	.;OCTC_HUMAN	E	403;375;375	ENSP00000413575:K403E;ENSP00000331981:K375E;ENSP00000411983:K375E	ENSP00000331981:K375E	K	+	1	0	CROT	86849386	1.000000	0.71417	0.992000	0.48379	0.386000	0.30323	6.767000	0.74975	2.134000	0.65973	0.383000	0.25322	AAA		0.318	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151		Missense_Mutation
CTDSP1	58190	hgsc.bcm.edu	37	2	219266373	219266373	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr2:219266373G>A	ENST00000273062.2	+	2	490	c.154G>A	c.(154-156)Gag>Aag	p.E52K	CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Missense_Mutation_p.E52K|RP11-378A13.2_ENST00000608367.1_RNA|MIR26B_ENST00000362251.2_RNA	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	52					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGATGATGGGGAGGCCCTGCC	0.667																																																0			2											41.0	40.0	41.0					2																	219266373		2203	4300	6503	218974617	SO:0001583	missense	58190			AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.154G>A	2.37:g.219266373G>A	ENSP00000273062:p.Glu52Lys	Somatic		Capture	SOLID	Phase_IV	218974617	C9IYG0|Q7Z5Q3|Q7Z5Q4	Missense_Mutation	SNP	ENST00000273062.2	37	CCDS2416.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.14	2.743808	0.49151	.	.	ENSG00000144579	ENST00000443891;ENST00000273062	T;T	0.13901	2.55;2.57	5.08	4.2	0.49525	.	0.324267	0.31404	N	0.007707	T	0.13114	0.0318	L	0.48877	1.53	0.40290	D	0.978492	B;B	0.13594	0.008;0.004	B;B	0.13407	0.009;0.009	T	0.06826	-1.0805	10	0.19590	T	0.45	-17.8557	13.1318	0.59387	0.0781:0.0:0.9219:0.0	.	52;52	Q9GZU7;C9IYG0	CTDS1_HUMAN;.	K	52	ENSP00000392248:E52K;ENSP00000273062:E52K	ENSP00000273062:E52K	E	+	1	0	CTDSP1	218974617	1.000000	0.71417	0.955000	0.39395	0.776000	0.43924	5.572000	0.67411	1.145000	0.42336	0.655000	0.94253	GAG		0.667	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198		Missense_Mutation
CTSA	5476	hgsc.bcm.edu	37	20	44522691	44522691	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr20:44522691G>C	ENST00000372459.2	+	7	950	c.757G>C	c.(757-759)Gac>Cac	p.D253H	NEURL2_ENST00000372518.4_5'Flank|CTSA_ENST00000372484.3_Missense_Mutation_p.D271H|RP3-337O18.9_ENST00000607703.1_RNA|CTSA_ENST00000354880.5_Missense_Mutation_p.D254H|CTSA_ENST00000191018.5_Missense_Mutation_p.D253H			P10619	PPGB_HUMAN	cathepsin A	253					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.D271H(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TGACAACAAAGACCTGGAATG	0.498																																																1	Substitution - Missense(1)	ovary(1)	20											163.0	131.0	142.0					20																	44522691		2203	4300	6503	43956098	SO:0001583	missense	5476			M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.757G>C	20.37:g.44522691G>C	ENSP00000361537:p.Asp253His	Somatic		Capture	SOLID	Phase_IV	43956098	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Missense_Mutation	SNP	ENST00000372459.2	37	CCDS46609.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207290	0.58343	.	.	ENSG00000064601	ENST00000354880;ENST00000372484;ENST00000191018;ENST00000419493;ENST00000372459	D;D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0;-3.0	4.65	3.7	0.42460	.	0.187040	0.56097	D	0.000023	D	0.92348	0.7572	L	0.61387	1.9	0.58432	D	0.999994	P;P;P	0.44478	0.836;0.836;0.836	P;P;P	0.52309	0.581;0.695;0.581	D	0.91663	0.5344	10	0.62326	D	0.03	-13.6078	8.4891	0.33089	0.1951:0.0:0.8049:0.0	.	253;253;270	B4E324;P10619;Q59EV6	.;PPGB_HUMAN;.	H	254;271;253;236;253	ENSP00000346952:D254H;ENSP00000361562:D271H;ENSP00000191018:D253H;ENSP00000408533:D236H;ENSP00000361537:D253H	ENSP00000191018:D253H	D	+	1	0	CTSA	43956098	1.000000	0.71417	0.996000	0.52242	0.933000	0.57130	4.114000	0.57858	1.315000	0.45114	0.561000	0.74099	GAC		0.498	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308		Missense_Mutation
CYP4A11	1579	hgsc.bcm.edu	37	1	47401277	47401277	+	Missense_Mutation	SNP	C	C	A	rs62618709		TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:47401277C>A	ENST00000310638.4	-	5	584	c.553G>T	c.(553-555)Gtc>Ttc	p.V185F	CYP4A11_ENST00000371904.4_Missense_Mutation_p.V185F|CYP4A11_ENST00000457840.2_Missense_Mutation_p.V81F|CYP4A11_ENST00000462347.1_Missense_Mutation_p.V185F|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371905.1_Missense_Mutation_p.V185F	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	185					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)	p.V185F(3)		endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	TGCTGAAAGACCTCCAGAGGG	0.542																																																3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	1											84.0	69.0	74.0					1																	47401277		2203	4298	6501	47173864	SO:0001583	missense	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.553G>T	1.37:g.47401277C>A	ENSP00000311095:p.Val185Phe	Somatic		Capture	SOLID	Phase_IV	47173864	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	37	CCDS543.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	N	17.32	3.360913	0.61403	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905;ENST00000457840	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.45	5.14	-6.37	0.01963	.	0.621999	0.16471	N	0.212985	T	0.65523	0.2699	M	0.65975	2.015	0.26764	N	0.969943	P	0.41947	0.766	P	0.45794	0.493	T	0.64063	-0.6495	10	0.59425	D	0.04	.	8.6725	0.34159	0.0:0.3111:0.2715:0.4174	rs62618709	185	Q02928	CP4AB_HUMAN	F	185;185;185;81	ENSP00000311095:V185F;ENSP00000360971:V185F;ENSP00000360972:V185F;ENSP00000406272:V81F	ENSP00000311095:V185F	V	-	1	0	CYP4A11	47173864	0.000000	0.05858	0.343000	0.25615	0.146000	0.21551	-0.730000	0.04915	-0.867000	0.04063	-0.827000	0.03088	GTC		0.542	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778		Missense_Mutation
DNAJC18	202052	hgsc.bcm.edu	37	5	138773237	138773237	+	Silent	SNP	G	G	A	rs200798738		TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr5:138773237G>A	ENST00000302060.5	-	2	131	c.51C>T	c.(49-51)gaC>gaT	p.D17D		NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18	17						integral component of membrane (GO:0016021)		p.D17D(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCTAACTGCGTCAATGTAAG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	5						A		1,4405	826.1+/-416.6	0,1,2202	143.0	130.0	135.0		51	3.0	1.0	5		135	1,8599	819.2+/-406.8	0,1,4299	no	coding-synonymous	DNAJC18	NM_152686.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		17/359	138773237	2,13004	2203	4300	6503	138801136	SO:0001819	synonymous_variant	202052			AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225	ENST00000302060.5:c.51C>T	5.37:g.138773237G>A		Somatic		Capture	SOLID	Phase_IV	138801136		Silent	SNP	ENST00000302060.5	37	CCDS4214.1	SNP	40	Baylor																																																																																				0.483	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374191.1	NM_152686		Silent
EDA	1896	hgsc.bcm.edu	37	X	68836336	68836336	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:68836336C>A	ENST00000374552.4	+	1	426	c.184C>A	c.(184-186)Cta>Ata	p.L62I	EDA_ENST00000374553.2_Missense_Mutation_p.L62I|EDA_ENST00000525810.1_Missense_Mutation_p.L62I|EDA_ENST00000524573.1_Missense_Mutation_p.L62I|EDA_ENST00000338901.3_Missense_Mutation_p.L62I|EDA_ENST00000502251.1_3'UTR|EDA_ENST00000527388.1_Missense_Mutation_p.L62I	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	62					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.L62I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						GTGCTGCTACCTAGAGTTGCG	0.692																																																1	Substitution - Missense(1)	ovary(1)	X											57.0	45.0	49.0					X																	68836336		2203	4300	6503	68753061	SO:0001583	missense	1896			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.184C>A	X.37:g.68836336C>A	ENSP00000363680:p.Leu62Ile	Somatic		Capture	SOLID	Phase_IV	68753061	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	CCDS14394.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245747	0.59103	.	.	ENSG00000158813	ENST00000513754;ENST00000338901;ENST00000374552;ENST00000374553;ENST00000525810;ENST00000527388;ENST00000524573	D;D;D;D;D;D	0.98947	-5.26;-4.43;-4.47;-5.25;-5.26;-4.31	4.8	4.8	0.61643	.	0.000000	0.56097	D	0.000040	D	0.98248	0.9420	L	0.32530	0.975	0.41451	D	0.987988	D;D;D;D;D;D;D;D	0.76494	0.996;0.993;0.996;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D;D	0.80764	0.978;0.952;0.978;0.994;0.994;0.994;0.994;0.994	D	0.99806	1.1038	10	0.87932	D	0	-5.111	14.1043	0.65078	0.0:1.0:0.0:0.0	.	62;62;62;62;62;62;62;62	Q92838-9;Q92838;Q92838-3;Q92838-8;Q92838-6;Q92838-2;Q92838-7;Q92838-5	.;EDA_HUMAN;.;.;.;.;.;.	I	62	ENSP00000340611:L62I;ENSP00000363680:L62I;ENSP00000363681:L62I;ENSP00000434195:L62I;ENSP00000434861:L62I;ENSP00000432585:L62I	ENSP00000340611:L62I	L	+	1	2	EDA	68753061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.160000	0.42348	2.199000	0.70637	0.600000	0.82982	CTA		0.692	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399		Missense_Mutation
EIF2B2	8892	hgsc.bcm.edu	37	14	75472569	75472569	+	Splice_Site	SNP	G	G	A	rs149784396		TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr14:75472569G>A	ENST00000266126.5	+	5	678	c.598G>A	c.(598-600)Ggt>Agt	p.G200S	RP11-950C14.3_ENST00000554430.1_RNA	NM_014239.3	NP_055054.1	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	200			G -> V (in VWM). {ECO:0000269|PubMed:15776425}.		cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|central nervous system development (GO:0007417)|gene expression (GO:0010467)|myelination (GO:0042552)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.00661)		CCCATTGCAGGGTCATGAAAT	0.438																																																0			14						G	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	220.0	216.0	217.0		598	5.5	1.0	14	dbSNP_134	217	0,8600		0,0,4300	no	missense-near-splice	EIF2B2	NM_014239.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	200/352	75472569	1,13005	2203	4300	6503	74542322	SO:0001630	splice_region_variant	8892				CCDS9836.1	14q24.3	2008-08-11	2002-08-29			ENSG00000119718			3258	protein-coding gene	gene with protein product		606454	"""eukaryotic translation initiation factor 2B, subunit 2 (beta, 39kD)"""			8887689	Standard	NM_014239		Approved	EIF2B, EIF-2Bbeta	uc001xrc.2	P49770		ENST00000266126.5:c.598-1G>A	14.37:g.75472569G>A		Somatic		Capture	SOLID	Phase_IV	74542322	O43201	Missense_Mutation	SNP	ENST00000266126.5	37	CCDS9836.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210578	0.58343	2.27E-4	0.0	ENSG00000119718	ENST00000266126	D	0.97303	-4.33	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.98529	0.9509	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98532	1.0628	9	.	.	.	-11.4517	19.6556	0.95837	0.0:0.0:1.0:0.0	.	200	P49770	EI2BB_HUMAN	S	200	ENSP00000266126:G200S	.	G	+	1	0	EIF2B2	74542322	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.501000	0.97979	2.882000	0.98803	0.655000	0.94253	GGT		0.438	EIF2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414993.1	NM_014239	Missense_Mutation	Missense_Mutation
FAM13A	10144	hgsc.bcm.edu	37	4	89671058	89671058	+	Missense_Mutation	SNP	C	C	T	rs114727657	byFrequency	TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr4:89671058C>T	ENST00000264344.5	-	16	2150	c.1943G>A	c.(1942-1944)cGg>cAg	p.R648Q	FAM13A_ENST00000508369.1_Missense_Mutation_p.R322Q|FAM13A_ENST00000395002.2_Missense_Mutation_p.R322Q|FAM13A_ENST00000503556.1_Missense_Mutation_p.R308Q|FAM13A_ENST00000513837.1_Missense_Mutation_p.R294Q|FAM13A_ENST00000511976.1_Missense_Mutation_p.R234Q	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	648					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R648Q(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						GGAGCTTCGCCGCCTGTGAAG	0.572													C|||	2	0.000399361	0.0	0.0	5008	,	,		17001	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	4						C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	62.0	60.0	61.0		965,1943	3.9	0.8	4	dbSNP_132	61	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	FAM13A	NM_001015045.1,NM_014883.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	322/698,648/1024	89671058	1,13005	2203	4300	6503	89890081	SO:0001583	missense	10144			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1943G>A	4.37:g.89671058C>T	ENSP00000264344:p.Arg648Gln	Somatic		Capture	SOLID	Phase_IV	89890081	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	37	CCDS34029.1	SNP	23	Baylor	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	14.48	2.548762	0.45383	0.0	1.16E-4	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T;T	0.46451	0.87;2.14;1.45;1.48;1.45;1.46	5.64	3.93	0.45458	.	0.159954	0.53938	N	0.000047	T	0.32285	0.0824	L	0.54323	1.7	0.80722	D	1	B;B;P;B;B;B;B	0.36249	0.316;0.392;0.545;0.4;0.392;0.266;0.316	B;B;B;B;B;B;B	0.26614	0.054;0.071;0.039;0.032;0.071;0.039;0.054	T	0.07385	-1.0775	10	0.21540	T	0.41	.	12.0744	0.53634	0.0:0.8629:0.0:0.1371	.	294;327;234;648;322;308;322	O94988-6;E7ENS3;E9PGM7;O94988;O94988-3;O94988-5;O94988-1	.;.;.;FA13A_HUMAN;.;.;.	Q	322;648;308;234;322;294	ENSP00000378450:R322Q;ENSP00000264344:R648Q;ENSP00000427189:R308Q;ENSP00000421914:R234Q;ENSP00000421562:R322Q;ENSP00000423252:R294Q	ENSP00000264344:R648Q	R	-	2	0	FAM13A	89890081	0.980000	0.34600	0.761000	0.31378	0.870000	0.49936	2.541000	0.45735	0.943000	0.37553	0.650000	0.86243	CGG		0.572	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1			Missense_Mutation
FAM78A	286336	hgsc.bcm.edu	37	9	134136565	134136565	+	Missense_Mutation	SNP	C	C	T	rs137934281		TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr9:134136565C>T	ENST00000372271.3	-	2	863	c.496G>A	c.(496-498)Gtc>Atc	p.V166I	FAM78A_ENST00000372269.3_Missense_Mutation_p.V163I|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	166								p.V166I(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		GCCCATGTGACGCTGGGGTAA	0.592																																																1	Substitution - Missense(1)	ovary(1)	9						C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	130.0	119.0	123.0		496	4.8	1.0	9	dbSNP_134	123	0,8600		0,0,4300	no	missense	FAM78A	NM_033387.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	166/284	134136565	1,13005	2203	4300	6503	133126386	SO:0001583	missense	286336			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.496G>A	9.37:g.134136565C>T	ENSP00000361345:p.Val166Ile	Somatic		Capture	SOLID	Phase_IV	133126386	Q86VQ9|Q9H7P4	Missense_Mutation	SNP	ENST00000372271.3	37	CCDS6941.2	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.2	4.903158	0.92035	2.27E-4	0.0	ENSG00000126882	ENST00000372269;ENST00000372271;ENST00000464831	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.78381	0.4274	M	0.75777	2.31	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.73380	0.98;0.979	T	0.79344	-0.1842	9	0.45353	T	0.12	-57.7356	17.1064	0.86664	0.0:1.0:0.0:0.0	.	166;163	Q5JUQ0;Q5JUQ2	FA78A_HUMAN;.	I	163;166;135	.	ENSP00000361343:V163I	V	-	1	0	FAM78A	133126386	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.776000	0.85560	2.337000	0.79520	0.462000	0.41574	GTC		0.592	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054720.1	NM_033387		Missense_Mutation
FAT2	2196	hgsc.bcm.edu	37	5	150886855	150886855	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr5:150886855T>A	ENST00000261800.5	-	22	12389	c.12377A>T	c.(12376-12378)aAt>aTt	p.N4126I	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4126					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACGAGTTCATTTGGAACAGA	0.572																																																0			5											137.0	142.0	140.0					5																	150886855		2203	4300	6503	150867048	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12377A>T	5.37:g.150886855T>A	ENSP00000261800:p.Asn4126Ile	Somatic		Capture	SOLID	Phase_IV	150867048	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	SNP	52	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.646|5.646	0.303918|0.303918	0.10678|0.10678	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000520200|ENST00000261800	.|T	.|0.71222	.|-0.55	4.63|4.63	-0.732|-0.732	0.11147|0.11147	.|.	.|0.513188	.|0.19219	.|N	.|0.119731	T|T	0.50497|0.50497	0.1619|0.1619	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|B;B	.|0.33379	.|0.41;0.01	.|B;B	.|0.26517	.|0.07;0.002	T|T	0.40739|0.40739	-0.9547|-0.9547	5|10	.|0.52906	.|T	.|0.07	.|.	5.0562|5.0562	0.14533|0.14533	0.0:0.3352:0.2743:0.3905|0.0:0.3352:0.2743:0.3905	.|.	.|4126;1231	.|Q9NYQ8;E9PDJ8	.|FAT2_HUMAN;.	N|I	898|4126	.|ENSP00000261800:N4126I	.|ENSP00000261800:N4126I	K|N	-|-	3|2	2|0	FAT2|FAT2	150867048|150867048	0.006000|0.006000	0.16342|0.16342	0.302000|0.302000	0.25058|0.25058	0.011000|0.011000	0.07611|0.07611	0.509000|0.509000	0.22707|0.22707	0.070000|0.070000	0.16634|0.16634	-0.250000|-0.250000	0.11733|0.11733	AAA|AAT		0.572	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		Missense_Mutation
FNDC4	64838	hgsc.bcm.edu	37	2	27717266	27717266	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr2:27717266C>A	ENST00000264703.3	-	3	592	c.201G>T	c.(199-201)tgG>tgT	p.W67C	GCKR_ENST00000424318.2_5'Flank|GCKR_ENST00000264717.2_5'Flank	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	67	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					CTGGGACGTCCCAGGACACAG	0.562																																																0			2											90.0	85.0	87.0					2																	27717266		2203	4300	6503	27570770	SO:0001583	missense	64838			AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787	ENST00000264703.3:c.201G>T	2.37:g.27717266C>A	ENSP00000264703:p.Trp67Cys	Somatic		Capture	SOLID	Phase_IV	27570770	D6W560	Missense_Mutation	SNP	ENST00000264703.3	37	CCDS1756.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170170	0.78452	.	.	ENSG00000115226	ENST00000264703	D	0.97598	-4.45	5.16	5.16	0.70880	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97854	0.9295	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99038	1.0823	10	0.87932	D	0	-20.5095	17.1862	0.86867	0.0:1.0:0.0:0.0	.	67	Q9H6D8	FNDC4_HUMAN	C	67	ENSP00000264703:W67C	ENSP00000264703:W67C	W	-	3	0	FNDC4	27570770	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.818000	0.75257	2.396000	0.81511	0.462000	0.41574	TGG		0.562	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215031.1	NM_022823		Missense_Mutation
GLB1	2720	hgsc.bcm.edu	37	3	33099620	33099621	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-13-0762-01	TCGA-13-0762-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr3:33099620_33099621delCC	ENST00000399402.3	-	6	734_735	c.603_604delGG	c.(601-606)ggggccfs	p.A202fs	GLB1_ENST00000445488.2_Frame_Shift_Del_p.A280fs|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Frame_Shift_Del_p.A232fs	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	232					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)	p.A232fs*27(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CCCTGCAGGGCCCCACATTTCA	0.485																																																1	Deletion - Frameshift(1)	ovary(1)	3																																								33074625	SO:0001589	frameshift_variant	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.603_604delGG	3.37:g.33099622_33099623delCC	ENSP00000382333:p.Ala202fs	Somatic		Capture	SOLID	Phase_IV	33074624	B2R7H8|B7Z6B0|P16279	Frame_Shift_Del	DEL	ENST00000399402.3	37	CCDS43062.1	DEL	26	Baylor																																																																																				0.485	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404		Frame_Shift_Del
GPR128	84873	hgsc.bcm.edu	37	3	100413700	100413700	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr3:100413700T>C	ENST00000273352.3	+	16	2517	c.2249T>C	c.(2248-2250)gTg>gCg	p.V750A	GPR128_ENST00000475887.1_Missense_Mutation_p.V455A|GPR128_ENST00000481506.1_3'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	750					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						TTGCCTTCAGTGACGCGGCCG	0.453																																					Pancreas(87;185 1975 7223 18722)											0			3											131.0	128.0	129.0					3																	100413700		2203	4300	6503	101896390	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.2249T>C	3.37:g.100413700T>C	ENSP00000273352:p.Val750Ala	Somatic		Capture	SOLID	Phase_IV	101896390	Q14D94|Q86SQ2	Missense_Mutation	SNP	ENST00000273352.3	37	CCDS2938.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.685	1.150325	0.21371	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.38722	1.12;1.49	5.01	-1.61	0.08399	.	1.439480	0.04506	N	0.382002	T	0.29914	0.0748	L	0.44542	1.39	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.06405	0.001;0.002	T	0.15723	-1.0427	10	0.33141	T	0.24	.	0.8244	0.01118	0.1581:0.2693:0.164:0.4086	.	455;750	E9PHI0;Q96K78	.;GP128_HUMAN	A	750;455	ENSP00000273352:V750A;ENSP00000419788:V455A	ENSP00000273352:V750A	V	+	2	0	GPR128	101896390	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.422000	0.07043	-0.129000	0.11620	0.533000	0.62120	GTG		0.453	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353236.1			Missense_Mutation
GPR174	84636	hgsc.bcm.edu	37	X	78427172	78427172	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:78427172G>A	ENST00000276077.1	+	1	704	c.668G>A	c.(667-669)gGa>gAa	p.G223E		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G223E(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CAAGATCTTGGAGAGAAACAG	0.408										HNSCC(63;0.18)																																						1	Substitution - Missense(1)	ovary(1)	X											93.0	91.0	92.0					X																	78427172		2203	4300	6503	78313828	SO:0001583	missense	84636			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.668G>A	X.37:g.78427172G>A	ENSP00000276077:p.Gly223Glu	Somatic		Capture	SOLID	Phase_IV	78313828	Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	g	17.86	3.492033	0.64074	.	.	ENSG00000147138	ENST00000276077	T	0.34859	1.34	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.40670	0.1126	L	0.46157	1.445	0.80722	D	1	P	0.43352	0.804	P	0.51297	0.665	T	0.19160	-1.0314	10	0.02654	T	1	.	16.0106	0.80399	0.0:0.0:1.0:0.0	.	223	Q9BXC1	GP174_HUMAN	E	223	ENSP00000276077:G223E	ENSP00000276077:G223E	G	+	2	0	GPR174	78313828	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	9.175000	0.94831	2.085000	0.62840	0.488000	0.48403	GGA		0.408	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553		Missense_Mutation
GRID1	2894	hgsc.bcm.edu	37	10	87484287	87484287	+	Silent	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr10:87484287T>C	ENST00000327946.7	-	11	1765	c.1680A>G	c.(1678-1680)ccA>ccG	p.P560P	GRID1_ENST00000536331.1_Silent_p.P131P	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	560					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.P560P(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGAAATCAAATGGAGCAAAGA	0.498										Multiple Myeloma(13;0.14)																																						1	Substitution - coding silent(1)	ovary(1)	10											88.0	79.0	82.0					10																	87484287		2203	4300	6503	87474267	SO:0001819	synonymous_variant	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1680A>G	10.37:g.87484287T>C		Somatic		Capture	SOLID	Phase_IV	87474267	B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1	SNP	51	Baylor																																																																																				0.498	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		Silent
GSPT2	23708	hgsc.bcm.edu	37	X	51488456	51488456	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:51488456A>T	ENST00000340438.4	+	1	1976	c.1734A>T	c.(1732-1734)caA>caT	p.Q578H		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	578					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.Q578H(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					TCGTGAAACAAGATCAAGTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	94.0	99.0					X																	51488456		2203	4300	6503	51505196	SO:0001583	missense	23708			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.1734A>T	X.37:g.51488456A>T	ENSP00000341247:p.Gln578His	Somatic		Capture	SOLID	Phase_IV	51505196	Q9H909|Q9NVY0|Q9NY44	Missense_Mutation	SNP	ENST00000340438.4	37	CCDS14336.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550888	0.45383	.	.	ENSG00000189369	ENST00000340438;ENST00000502175	T	0.33216	1.42	4.75	3.6	0.41247	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.60136	-0.7322	10	0.72032	D	0.01	-14.0533	7.9285	0.29889	0.901:0.0:0.099:0.0	.	578	Q8IYD1	ERF3B_HUMAN	H	578;495	ENSP00000341247:Q578H	ENSP00000341247:Q578H	Q	+	3	2	GSPT2	51505196	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.596000	0.54024	0.928000	0.37168	0.483000	0.47432	CAA		0.413	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1			Missense_Mutation
HMCN1	83872	hgsc.bcm.edu	37	1	185987407	185987407	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:185987407C>G	ENST00000271588.4	+	34	5622	c.5393C>G	c.(5392-5394)tCa>tGa	p.S1798*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.S1798*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1798	Ig-like C2-type 15.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S1798*(1)|p.S1798L(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCTCAAGTGTCAAACACAGGC	0.433																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|lung(1)	1											153.0	151.0	151.0					1																	185987407		2203	4300	6503	184254030	SO:0001587	stop_gained	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5393C>G	1.37:g.185987407C>G	ENSP00000271588:p.Ser1798*	Somatic		Capture	SOLID	Phase_IV	184254030	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	48	14.037834	0.99776	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.89	4.98	0.66077	.	0.061332	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	14.7816	0.69772	0.0:0.9311:0.0:0.0689	.	.	.	.	X	1798	.	ENSP00000271588:S1798X	S	+	2	0	HMCN1	184254030	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.507000	0.66999	1.496000	0.48567	0.563000	0.77884	TCA		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Nonsense_Mutation
HMCN1	83872	hgsc.bcm.edu	37	1	186007066	186007066	+	Splice_Site	SNP	A	A	T			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:186007066A>T	ENST00000271588.4	+	37	5979	c.5750A>T	c.(5749-5751)gAa>gTa	p.E1917V	HMCN1_ENST00000367492.2_Splice_Site_p.E1917V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1917					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.E1917V(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTCTTGTAGAACCACCTAGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											104.0	99.0	100.0					1																	186007066		2203	4300	6503	184273689	SO:0001630	splice_region_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5750-1A>T	1.37:g.186007066A>T		Somatic		Capture	SOLID	Phase_IV	184273689	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634417	0.47049	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.72394	-0.65;-0.65	5.52	5.52	0.82312	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68035	0.2957	N	0.05306	-0.075	0.80722	D	1	D	0.64830	0.994	D	0.75020	0.985	T	0.70263	-0.4920	9	.	.	.	.	15.3069	0.73998	1.0:0.0:0.0:0.0	.	1917	Q96RW7	HMCN1_HUMAN	V	1917	ENSP00000271588:E1917V;ENSP00000356462:E1917V	.	E	+	2	0	HMCN1	184273689	1.000000	0.71417	0.979000	0.43373	0.010000	0.07245	6.594000	0.74104	2.100000	0.63781	0.454000	0.30748	GAA		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Missense_Mutation	Missense_Mutation
HYDIN	54768	hgsc.bcm.edu	37	16	70896038	70896038	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr16:70896038C>T	ENST00000393567.2	-	69	11840	c.11690G>A	c.(11689-11691)gGa>gAa	p.G3897E		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3897					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.G3848E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CGGCACGATTCCCGAAGAGGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											49.0	47.0	48.0					16																	70896038		1888	4112	6000	69453539	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11690G>A	16.37:g.70896038C>T	ENSP00000377197:p.Gly3897Glu	Somatic		Capture	SOLID	Phase_IV	69453539	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847730	0.71603	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.02345	4.33	5.97	5.97	0.96955	.	0.000000	0.33553	U	0.004782	T	0.19005	0.0456	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00018	-1.2372	10	0.87932	D	0	.	18.9942	0.92806	0.0:1.0:0.0:0.0	.	3896	F8WD23	.	E	3897;3896	ENSP00000377197:G3897E	ENSP00000313052:G3896E	G	-	2	0	HYDIN	69453539	1.000000	0.71417	0.238000	0.24106	0.326000	0.28443	5.759000	0.68785	2.838000	0.97847	0.511000	0.50034	GGA		0.542	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Missense_Mutation
IL1RAPL1	11141	hgsc.bcm.edu	37	X	29972757	29972757	+	Silent	SNP	G	G	A	rs377412690		TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:29972757G>A	ENST00000378993.1	+	10	1993	c.1320G>A	c.(1318-1320)aaG>aaA	p.K440K	IL1RAPL1_ENST00000302196.4_Silent_p.K440K	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	440	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.K440K(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGCTTGAAAAGCATTATGGAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	X						G		1,3832		0,1,1630,571	93.0	82.0	86.0		1320	2.8	1.0	X		86	0,6728		0,0,2428,1872	no	coding-synonymous	IL1RAPL1	NM_014271.3		0,1,4058,2443	AA,AG,GG,G		0.0,0.0261,0.0095		440/697	29972757	1,10560	2202	4300	6502	29882678	SO:0001819	synonymous_variant	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1320G>A	X.37:g.29972757G>A		Somatic		Capture	SOLID	Phase_IV	29882678	A0AVG4|Q9UJ53	Silent	SNP	ENST00000378993.1	37	CCDS14218.1	SNP	34	Baylor																																																																																				0.373	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271		Silent
IGSF1	3547	hgsc.bcm.edu	37	X	130412650	130412650	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:130412650G>T	ENST00000361420.3	-	12	1905	c.1826C>A	c.(1825-1827)aCc>aAc	p.T609N	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.T600N|IGSF1_ENST00000370904.1_Missense_Mutation_p.T600N|IGSF1_ENST00000370903.3_Missense_Mutation_p.T614N			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	609	Ig-like C2-type 6.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.T609N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GCACCAGAGGGTTAAGTTCTT	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											66.0	66.0	66.0					X																	130412650		2203	4299	6502	130240331	SO:0001583	missense	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1826C>A	X.37:g.130412650G>T	ENSP00000355010:p.Thr609Asn	Somatic		Capture	SOLID	Phase_IV	130240331	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	g	16.03	3.008423	0.54361	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.15718	2.4;2.4;2.4;2.4	5.09	5.09	0.68999	Immunoglobulin-like fold (1);	1.078380	0.07119	N	0.843515	T	0.56031	0.1958	M	0.93283	3.4	0.32294	N	0.565949	D;D;D	0.89917	0.978;1.0;0.997	P;D;D	0.91635	0.882;0.999;0.994	T	0.56896	-0.7903	10	0.87932	D	0	.	13.1782	0.59639	0.0:0.0:1.0:0.0	.	600;53;609	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	N	600;609;600;614	ENSP00000359947:T600N;ENSP00000355010:T609N;ENSP00000359941:T600N;ENSP00000359940:T614N	ENSP00000355010:T609N	T	-	2	0	IGSF1	130240331	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.598000	0.61069	2.262000	0.75019	0.597000	0.82753	ACC		0.552	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			Missense_Mutation
INSC	387755	hgsc.bcm.edu	37	11	15134022	15134022	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr11:15134022C>T	ENST00000379554.3	+	1	53	c.7C>T	c.(7-9)Cgg>Tgg	p.R3W	INSC_ENST00000424273.1_5'Flank|INSC_ENST00000379556.3_5'Flank	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	3					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)		p.R3W(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						AGCCATGAGACGGCCCCCTGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											48.0	59.0	55.0					11																	15134022		1952	4123	6075	15090598	SO:0001583	missense	387755			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.7C>T	11.37:g.15134022C>T	ENSP00000368872:p.Arg3Trp	Somatic		Capture	SOLID	Phase_IV	15090598	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.657	1.143100	0.21205	.	.	ENSG00000188487	ENST00000379554	T	0.37235	1.21	4.07	2.07	0.26955	.	.	.	.	.	T	0.22475	0.0542	N	0.08118	0	0.80722	D	1	D	0.59767	0.986	P	0.47102	0.537	T	0.05869	-1.0859	9	0.72032	D	0.01	-15.3977	8.7581	0.34658	0.4471:0.5529:0.0:0.0	.	3	Q1MX18	INSC_HUMAN	W	3	ENSP00000368872:R3W	ENSP00000368872:R3W	R	+	1	2	INSC	15090598	0.359000	0.24955	0.964000	0.40570	0.134000	0.20937	-0.460000	0.06720	0.592000	0.29728	0.561000	0.74099	CGG		0.627	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853		Missense_Mutation
IRF3	3661	hgsc.bcm.edu	37	19	50166654	50166654	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr19:50166654C>T	ENST00000597198.1	-	3	664	c.283G>A	c.(283-285)Gac>Aac	p.D95N	IRF3_ENST00000442265.2_Intron|BCL2L12_ENST00000441864.2_5'Flank|IRF3_ENST00000599223.1_Missense_Mutation_p.D95N|BCL2L12_ENST00000246784.3_5'Flank|IRF3_ENST00000598808.1_5'UTR|IRF3_ENST00000600911.1_Missense_Mutation_p.D95N|IRF3_ENST00000600022.1_5'UTR|IRF3_ENST00000377135.4_Missense_Mutation_p.D95N|BCL2L12_ENST00000246785.3_5'Flank|IRF3_ENST00000596822.1_5'UTR|IRF3_ENST00000599680.1_5'Flank|IRF3_ENST00000309877.7_Missense_Mutation_p.D95N|IRF3_ENST00000593922.1_5'UTR|IRF3_ENST00000599144.1_Intron|IRF3_ENST00000601291.1_Missense_Mutation_p.D95N|IRF3_ENST00000596765.1_Intron|IRF3_ENST00000377139.3_Missense_Mutation_p.D95N			Q14653	IRF3_HUMAN	interferon regulatory factor 3	95					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTGCTCCGGTCCTCTGCTAAA	0.567																																																0			19											76.0	69.0	72.0					19																	50166654		2203	4300	6503	54858466	SO:0001583	missense	3661				CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.283G>A	19.37:g.50166654C>T	ENSP00000469113:p.Asp95Asn	Somatic		Capture	SOLID	Phase_IV	54858466	A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	ENST00000597198.1	37	CCDS12775.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242612	0.22796	.	.	ENSG00000126456	ENST00000377139;ENST00000309877;ENST00000377135	D;D;D	0.98400	-4.91;-4.91;-4.91	4.92	1.56	0.23342	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.304109	0.31809	N	0.007031	D	0.96531	0.8868	L	0.53617	1.68	0.28038	N	0.933865	P;B;B;B;B	0.41345	0.746;0.312;0.312;0.276;0.404	B;B;B;B;B	0.44315	0.446;0.082;0.082;0.057;0.145	D	0.92990	0.6414	10	0.54805	T	0.06	-21.4474	9.274	0.37688	0.0:0.7395:0.0:0.2605	.	95;95;95;95;95	B2RAZ3;Q96GL3;Q7Z5G6;Q14653;Q5FBY1	.;.;.;IRF3_HUMAN;.	N	95	ENSP00000366344:D95N;ENSP00000310127:D95N;ENSP00000366339:D95N	ENSP00000310127:D95N	D	-	1	0	IRF3	54858466	0.993000	0.37304	0.001000	0.08648	0.009000	0.06853	3.264000	0.51553	0.610000	0.30035	-0.136000	0.14681	GAC		0.567	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465962.1	NM_001571		Missense_Mutation
KIF2A	3796	hgsc.bcm.edu	37	5	61676951	61676951	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr5:61676951A>G	ENST00000401507.3	+	19	2217	c.1906A>G	c.(1906-1908)Att>Gtt	p.I636V	KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000506857.1_Missense_Mutation_p.I590V|KIF2A_ENST00000381103.2_Missense_Mutation_p.I616V|KIF2A_ENST00000407818.3_Missense_Mutation_p.I674V	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	636					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I609V(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		GTAGGAATCTATTCGGTGGTT	0.333																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	106.0	103.0					5																	61676951		2203	4300	6503	61712708	SO:0001583	missense	3796			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1906A>G	5.37:g.61676951A>G	ENSP00000385622:p.Ile636Val	Somatic		Capture	SOLID	Phase_IV	61712708	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	ENST00000401507.3	37	CCDS3980.2	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.24	2.178957	0.38511	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000407818;ENST00000506857	T;T;T;T	0.73469	-0.59;-0.59;-0.75;-0.59	5.87	4.7	0.59300	.	0.049518	0.85682	D	0.000000	T	0.62282	0.2415	N	0.22421	0.69	0.58432	D	0.999997	B;B;B;B	0.17038	0.012;0.02;0.016;0.003	B;B;B;B	0.26517	0.032;0.07;0.009;0.009	T	0.55205	-0.8177	10	0.31617	T	0.26	.	12.4022	0.55420	0.8739:0.0:0.0:0.1261	.	674;674;636;616	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	V	636;616;674;590	ENSP00000385622:I636V;ENSP00000370493:I616V;ENSP00000385000:I674V;ENSP00000423772:I590V	ENSP00000370493:I616V	I	+	1	0	KIF2A	61712708	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	7.131000	0.77243	1.019000	0.39547	0.533000	0.62120	ATT		0.333	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520		Missense_Mutation
MID1	4281	hgsc.bcm.edu	37	X	10463677	10463677	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chrX:10463677C>G	ENST00000317552.4	-	4	1211	c.811G>C	c.(811-813)Gag>Cag	p.E271Q	MID1_ENST00000380780.1_Missense_Mutation_p.E271Q|MID1_ENST00000453318.2_Missense_Mutation_p.E271Q|MID1_ENST00000380787.1_Missense_Mutation_p.E271Q|MID1_ENST00000380785.1_Missense_Mutation_p.E271Q|MID1_ENST00000380779.1_Missense_Mutation_p.E271Q|MID1_ENST00000380782.2_Missense_Mutation_p.E271Q	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	271					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E271Q(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						TGAATGATCTCAATGAGAAGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	X											237.0	181.0	200.0					X																	10463677		2203	4300	6503	10423677	SO:0001583	missense	4281			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.811G>C	X.37:g.10463677C>G	ENSP00000312678:p.Glu271Gln	Somatic		Capture	SOLID	Phase_IV	10423677	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	ENST00000317552.4	37	CCDS14138.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709611	0.48517	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;1.03;1.02	5.57	5.57	0.84162	B-box, C-terminal (1);	0.210963	0.48767	D	0.000172	T	0.49677	0.1571	L	0.43152	1.355	0.46241	D	0.998941	B;B;B	0.33345	0.409;0.136;0.136	B;B;B	0.34652	0.187;0.12;0.12	T	0.47711	-0.9096	10	0.41790	T	0.15	.	18.2928	0.90136	0.0:1.0:0.0:0.0	.	271;271;271	O15344-2;A8K5A0;O15344	.;.;TRI18_HUMAN	Q	271;271;271;271;271;271;271;221;271	ENSP00000414521:E271Q;ENSP00000312678:E271Q;ENSP00000370162:E271Q;ENSP00000370156:E271Q;ENSP00000370164:E271Q;ENSP00000370157:E271Q;ENSP00000370159:E271Q;ENSP00000391154:E271Q	ENSP00000312678:E271Q	E	-	1	0	MID1	10423677	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.128000	0.50492	2.360000	0.80028	0.600000	0.82982	GAG		0.383	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1			Missense_Mutation
MUC17	140453	hgsc.bcm.edu	37	7	100679043	100679043	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr7:100679043C>G	ENST00000306151.4	+	3	4410	c.4346C>G	c.(4345-4347)aCt>aGt	p.T1449S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1449	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T1449S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAACCTCAACTCCTAGTGAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	7											205.0	222.0	216.0					7																	100679043		2203	4300	6503	100465763	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4346C>G	7.37:g.100679043C>G	ENSP00000302716:p.Thr1449Ser	Somatic		Capture	SOLID	Phase_IV	100465763	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	1.742	-0.491508	0.04322	.	.	ENSG00000169876	ENST00000306151	T	0.02323	4.34	1.08	1.08	0.20341	.	.	.	.	.	T	0.01905	0.0060	N	0.19112	0.55	0.09310	N	1	B	0.20459	0.045	B	0.11329	0.006	T	0.48456	-0.9034	9	0.18276	T	0.48	.	5.6532	0.17629	0.0:1.0:0.0:0.0	.	1449	Q685J3	MUC17_HUMAN	S	1449	ENSP00000302716:T1449S	ENSP00000302716:T1449S	T	+	2	0	MUC17	100465763	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.135000	0.15952	0.934000	0.37316	0.134000	0.15878	ACT		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Missense_Mutation
NEUROD4	58158	hgsc.bcm.edu	37	12	55420443	55420443	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:55420443A>T	ENST00000242994.3	+	2	598	c.220A>T	c.(220-222)Aaa>Taa	p.K74*		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	74					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K74*(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						GGGTCCCAAGAAAAAGAAGAT	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	12											56.0	53.0	54.0					12																	55420443		2203	4300	6503	53706710	SO:0001587	stop_gained	58158			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.220A>T	12.37:g.55420443A>T	ENSP00000242994:p.Lys74*	Somatic		Capture	SOLID	Phase_IV	53706710	B2RAC9	Nonsense_Mutation	SNP	ENST00000242994.3	37	CCDS8886.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	39	7.578908	0.98371	.	.	ENSG00000123307	ENST00000242994	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8693	13.6467	0.62286	1.0:0.0:0.0:0.0	.	.	.	.	X	74	.	ENSP00000242994:K74X	K	+	1	0	NEUROD4	53706710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.168000	0.68352	0.533000	0.62120	AAA		0.493	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406104.1			Nonsense_Mutation
MYBPC1	4604	hgsc.bcm.edu	37	12	102071130	102071130	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:102071130G>C	ENST00000550270.1	+	26	3046	c.3046G>C	c.(3046-3048)Gat>Cat	p.D1016H	MYBPC1_ENST00000360610.2_Missense_Mutation_p.D1016H|MYBPC1_ENST00000553190.1_Missense_Mutation_p.D998H|MYBPC1_ENST00000441232.1_Missense_Mutation_p.D1016H|MYBPC1_ENST00000392934.3_Missense_Mutation_p.D985H|MYBPC1_ENST00000551300.1_Missense_Mutation_p.D899H|MYBPC1_ENST00000541119.1_Missense_Mutation_p.D986H|MYBPC1_ENST00000547405.1_Missense_Mutation_p.D972H|MYBPC1_ENST00000361466.2_Missense_Mutation_p.D1023H|MYBPC1_ENST00000547509.1_Missense_Mutation_p.D984H|MYBPC1_ENST00000545503.2_Missense_Mutation_p.D998H|MYBPC1_ENST00000549145.1_Missense_Mutation_p.D1029H|MYBPC1_ENST00000452455.2_Missense_Mutation_p.D1016H|MYBPC1_ENST00000361685.2_Missense_Mutation_p.D1023H|MYBPC1_ENST00000536007.1_Missense_Mutation_p.D979H|MYBPC1_ENST00000550501.1_Intron			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	1016	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.D1023H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						CCTCAGTGAGGATGCCACCAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	12											111.0	98.0	102.0					12																	102071130		2203	4300	6503	100595261	SO:0001583	missense	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.3046G>C	12.37:g.102071130G>C	ENSP00000449702:p.Asp1016His	Somatic		Capture	SOLID	Phase_IV	100595261	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919785	0.73098	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.32	5.32	0.75619	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.135912	0.32719	N	0.005729	T	0.53769	0.1817	L	0.40543	1.245	0.45852	D	0.998713	B;P;B;B;B;B;P;B;P;B	0.38148	0.252;0.581;0.263;0.386;0.121;0.283;0.525;0.431;0.62;0.335	P;P;P;P;B;P;P;P;P;P	0.52514	0.604;0.701;0.608;0.485;0.372;0.555;0.576;0.701;0.52;0.468	T	0.55276	-0.8166	10	0.72032	D	0.01	.	18.9927	0.92800	0.0:0.0:1.0:0.0	.	979;986;1016;998;985;972;998;1016;1023;1023	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	H	972;1016;1016;1016;985;984;1023;1029;998;998;979;986;1023;899;1016	ENSP00000448175:D972H;ENSP00000400908:D1016H;ENSP00000388989:D1016H;ENSP00000353822:D1016H;ENSP00000376665:D985H;ENSP00000447362:D984H;ENSP00000354845:D1023H;ENSP00000447660:D1029H;ENSP00000447900:D998H;ENSP00000440034:D998H;ENSP00000446128:D979H;ENSP00000442847:D986H;ENSP00000354849:D1023H;ENSP00000447116:D899H;ENSP00000449702:D1016H	ENSP00000353822:D1016H	D	+	1	0	MYBPC1	100595261	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	2.694000	0.47035	2.480000	0.83734	0.650000	0.86243	GAT		0.458	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1			Missense_Mutation
NFATC2	4773	hgsc.bcm.edu	37	20	50090672	50090672	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr20:50090672A>G	ENST00000396009.3	-	5	1772	c.1553T>C	c.(1552-1554)aTc>aCc	p.I518T	NFATC2_ENST00000609943.1_Missense_Mutation_p.I498T|NFATC2_ENST00000609507.1_Missense_Mutation_p.I299T|NFATC2_ENST00000414705.1_Missense_Mutation_p.I498T|NFATC2_ENST00000371564.3_Missense_Mutation_p.I518T|NFATC2_ENST00000610033.1_Missense_Mutation_p.I299T	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	518	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I518T(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					AAGCTTCAAGATCCCCGCACA	0.532																																																1	Substitution - Missense(1)	ovary(1)	20											141.0	118.0	126.0					20																	50090672		2203	4300	6503	49524079	SO:0001583	missense	4773			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1553T>C	20.37:g.50090672A>G	ENSP00000379330:p.Ile518Thr	Somatic		Capture	SOLID	Phase_IV	49524079	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110856	0.77210	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.62788	-0.0;-0.0;-0.0	5.3	5.3	0.74995	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.099244	0.64402	D	0.000004	T	0.82167	0.4978	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86058	0.1530	10	0.87932	D	0	-10.3629	15.2604	0.73617	1.0:0.0:0.0:0.0	.	498;498;518;518	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	T	518;518;498	ENSP00000360619:I518T;ENSP00000379330:I518T;ENSP00000396471:I498T	ENSP00000360619:I518T	I	-	2	0	NFATC2	49524079	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	9.210000	0.95106	1.998000	0.58463	0.374000	0.22700	ATC		0.532	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340		Missense_Mutation
ODF1	4956	hgsc.bcm.edu	37	8	103572733	103572733	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr8:103572733T>C	ENST00000285402.3	+	2	530	c.374T>C	c.(373-375)aTt>aCt	p.I125T	ODF1_ENST00000518835.1_5'UTR	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	125					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.I125T(1)|p.S123fs*9(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AGCAGTAACATTTTAGGATCG	0.473																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|NS(1)	8											134.0	124.0	127.0					8																	103572733		2203	4300	6503	103641909	SO:0001583	missense	4956			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.374T>C	8.37:g.103572733T>C	ENSP00000285402:p.Ile125Thr	Somatic		Capture	SOLID	Phase_IV	103641909	Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	CCDS6293.1	SNP	52	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.29	2.789965	0.50102	.	.	ENSG00000155087	ENST00000285402	T	0.34072	1.38	5.8	5.8	0.92144	Heat shock protein Hsp20 (1);	0.254839	0.28612	N	0.014724	T	0.22513	0.0543	N	0.08118	0	0.80722	D	1	B	0.28801	0.223	B	0.31016	0.123	T	0.11518	-1.0584	10	0.59425	D	0.04	-15.7754	12.5275	0.56096	0.0:0.0:0.0:1.0	.	125	Q14990	ODFP1_HUMAN	T	125	ENSP00000285402:I125T	ENSP00000285402:I125T	I	+	2	0	ODF1	103641909	1.000000	0.71417	0.999000	0.59377	0.859000	0.49053	3.851000	0.55926	2.212000	0.71576	0.528000	0.53228	ATT		0.473	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			Missense_Mutation
OLFML2A	169611	hgsc.bcm.edu	37	9	127557314	127557314	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr9:127557314G>A	ENST00000373580.3	+	3	366	c.366G>A	c.(364-366)atG>atA	p.M122I		NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	122					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)	p.M122I(1)		endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						TGCAGTCCATGGTGGATCTCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	9											21.0	23.0	22.0					9																	127557314		2023	4169	6192	126597135	SO:0001583	missense	169611			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.366G>A	9.37:g.127557314G>A	ENSP00000362682:p.Met122Ile	Somatic		Capture	SOLID	Phase_IV	126597135	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	37	CCDS6857.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	6.787	0.514190	0.12944	.	.	ENSG00000185585	ENST00000373580	T	0.39056	1.1	4.97	4.05	0.47172	.	0.089861	0.85682	N	0.000000	T	0.27900	0.0687	L	0.36672	1.1	0.80722	D	1	B	0.31581	0.329	B	0.27887	0.084	T	0.08953	-1.0697	10	0.02654	T	1	.	13.9144	0.63887	0.0:0.0:0.846:0.154	.	122	Q68BL7	OLM2A_HUMAN	I	122	ENSP00000362682:M122I	ENSP00000362682:M122I	M	+	3	0	OLFML2A	126597135	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.305000	0.65750	1.360000	0.45960	0.563000	0.77884	ATG		0.572	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487		Missense_Mutation
OR8B12	219858	hgsc.bcm.edu	37	11	124412940	124412940	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr11:124412940A>G	ENST00000306842.2	-	1	635	c.611T>C	c.(610-612)gTt>gCt	p.V204A		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V204A(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		TCCAACGTCAACAGCCACCAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											99.0	77.0	85.0					11																	124412940		2201	4299	6500	123918150	SO:0001583	missense	219858				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.611T>C	11.37:g.124412940A>G	ENSP00000307159:p.Val204Ala	Somatic		Capture	SOLID	Phase_IV	123918150	B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	ENST00000306842.2	37	CCDS31711.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	2.483	-0.319245	0.05386	.	.	ENSG00000170953	ENST00000306842	T	0.38722	1.12	3.89	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.619950	0.15089	N	0.281212	T	0.27384	0.0672	L	0.28054	0.825	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.20706	-1.0267	10	0.66056	D	0.02	.	5.3493	0.16026	0.6392:0.0:0.3608:0.0	.	204	Q8NGG6	OR8BC_HUMAN	A	204	ENSP00000307159:V204A	ENSP00000307159:V204A	V	-	2	0	OR8B12	123918150	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.249000	0.08842	0.791000	0.33826	0.528000	0.53228	GTT		0.453	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387061.1			Missense_Mutation
PIK3CG	5294	hgsc.bcm.edu	37	7	106509338	106509338	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr7:106509338G>A	ENST00000359195.3	+	2	1642	c.1332G>A	c.(1330-1332)aaG>aaA	p.K444K	PIK3CG_ENST00000496166.1_Silent_p.K444K|PIK3CG_ENST00000440650.2_Silent_p.K444K	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	444	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						TGTCCAGCAAGGCCTCTGCAG	0.517																																																0			7											64.0	67.0	66.0					7																	106509338		2203	4300	6503	106296574	SO:0001819	synonymous_variant	5294				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.1332G>A	7.37:g.106509338G>A		Somatic		Capture	SOLID	Phase_IV	106296574	A4D0Q6|Q8IV23|Q9BZC8	Silent	SNP	ENST00000359195.3	37	CCDS5739.1	SNP	35	Baylor																																																																																				0.517	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1			Silent
PIK3R5	23533	hgsc.bcm.edu	37	17	8784976	8784976	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr17:8784976T>C	ENST00000447110.1	-	17	2477	c.2353A>G	c.(2353-2355)Aac>Gac	p.N785D	PIK3R5_ENST00000584803.1_Missense_Mutation_p.N784D|PIK3R5_ENST00000581552.1_Missense_Mutation_p.N785D	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	785					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GATTTGGAGTTCTGCCTTTTC	0.547																																					NSCLC(18;589 615 7696 20311 50332)											0			17											203.0	177.0	186.0					17																	8784976		2203	4300	6503	8725701	SO:0001583	missense	23533			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.2353A>G	17.37:g.8784976T>C	ENSP00000392812:p.Asn785Asp	Somatic		Capture	SOLID	Phase_IV	8725701	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	ENST00000447110.1	37	CCDS11147.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.91	2.379458	0.42207	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	D	0.83591	-1.74	4.71	4.71	0.59529	.	0.048133	0.85682	D	0.000000	T	0.77987	0.4213	L	0.34521	1.04	0.53688	D	0.999978	P	0.35493	0.505	B	0.39738	0.308	T	0.80398	-0.1399	10	0.72032	D	0.01	-36.1945	13.1357	0.59407	0.0:0.0:0.0:1.0	.	785	Q8WYR1	PI3R5_HUMAN	D	785	ENSP00000392812:N785D	ENSP00000269300:N785D	N	-	1	0	PIK3R5	8725701	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.851000	0.75425	1.983000	0.57843	0.379000	0.24179	AAC		0.547	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000227003.2	NM_014308		Missense_Mutation
PKP1	5317	hgsc.bcm.edu	37	1	201286873	201286873	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:201286873A>T	ENST00000352845.3	+	5	1020	c.1020A>T	c.(1018-1020)agA>agT	p.R340S	PKP1_ENST00000367324.3_Missense_Mutation_p.R340S|PKP1_ENST00000475988.1_3'UTR|PKP1_ENST00000263946.3_Missense_Mutation_p.R340S			Q13835	PKP1_HUMAN	plakophilin 1	340					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)	p.R340S(1)		NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						TCCTGAGGAGAACCGGGAACG	0.652																																																1	Substitution - Missense(1)	ovary(1)	1											32.0	34.0	33.0					1																	201286873		2203	4300	6503	199553496	SO:0001583	missense	5317			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1020A>T	1.37:g.201286873A>T	ENSP00000295597:p.Arg340Ser	Somatic		Capture	SOLID	Phase_IV	199553496	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	ENST00000352845.3	37	CCDS30966.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440317	0.43326	.	.	ENSG00000081277	ENST00000367324;ENST00000263946;ENST00000352845	T;T;T	0.39406	1.08;1.08;1.08	5.24	-2.17	0.07059	Armadillo-like helical (1);Armadillo-type fold (1);	0.297519	0.42172	D	0.000749	T	0.28200	0.0696	L	0.56280	1.765	0.32181	N	0.580348	B;B	0.23058	0.01;0.079	B;B	0.21151	0.033;0.031	T	0.06643	-1.0815	10	0.49607	T	0.09	-11.3622	2.1977	0.03915	0.3006:0.1419:0.417:0.1405	.	340;340	Q13835-2;Q13835	.;PKP1_HUMAN	S	340	ENSP00000356293:R340S;ENSP00000263946:R340S;ENSP00000295597:R340S	ENSP00000263946:R340S	R	+	3	2	PKP1	199553496	0.252000	0.23972	0.910000	0.35882	0.795000	0.44927	-0.304000	0.08199	-0.252000	0.09528	0.451000	0.29950	AGA		0.652	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299		Missense_Mutation
PRICKLE2	166336	hgsc.bcm.edu	37	3	64133000	64133000	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr3:64133000T>A	ENST00000295902.6	-	7	1751	c.1166A>T	c.(1165-1167)aAc>aTc	p.N389I	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.N445I	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	389					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.N389I(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGGGTCCCGGTTGAGGCTGGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	79.0	77.0					3																	64133000		2203	4300	6503	64108040	SO:0001583	missense	166336			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.1166A>T	3.37:g.64133000T>A	ENSP00000295902:p.Asn389Ile	Somatic		Capture	SOLID	Phase_IV	64108040	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	SNP	60	Baylor	.	.	.	.	.	.	.	.	.	.	T	11.50	1.657328	0.29425	.	.	ENSG00000163637	ENST00000295902	T	0.60171	0.21	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	L	0.53249	1.67	0.51482	D	0.999928	D	0.56521	0.976	P	0.45577	0.486	T	0.60747	-0.7202	10	0.52906	T	0.07	-54.4535	12.0535	0.53520	0.0:0.0688:0.0:0.9312	.	389	Q7Z3G6	PRIC2_HUMAN	I	389	ENSP00000295902:N389I	ENSP00000295902:N389I	N	-	2	0	PRICKLE2	64108040	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	2.842000	0.48230	2.242000	0.73789	0.402000	0.26972	AAC		0.607	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859		Missense_Mutation
POPDC2	64091	hgsc.bcm.edu	37	3	119367387	119367387	+	Silent	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr3:119367387C>T	ENST00000264231.3	-	3	895	c.729G>A	c.(727-729)gaG>gaA	p.E243E	POPDC2_ENST00000468801.1_Silent_p.E243E|POPDC2_ENST00000538678.1_Silent_p.E243E|POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000493094.1_Silent_p.E243E	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	243					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		TGTAGAGCTTCTCTGAGATGT	0.527																																																0			3											84.0	79.0	81.0					3																	119367387		2203	4300	6503	120850077	SO:0001819	synonymous_variant	64091			AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.729G>A	3.37:g.119367387C>T		Somatic		Capture	SOLID	Phase_IV	120850077	Q86UE7	Silent	SNP	ENST00000264231.3	37	CCDS2992.1	SNP	32	Baylor																																																																																				0.527	POPDC2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355378.1	NM_022135		Silent
PRKDC	5591	hgsc.bcm.edu	37	8	48794060	48794060	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0762-01	TCGA-13-0762-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr8:48794060T>G	ENST00000314191.2	-	39	5037	c.4981A>C	c.(4981-4983)Aat>Cat	p.N1661H	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.N1661H	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1662					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.N1662H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGACTTGTATTAAAAGATACA	0.313								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											44.0	43.0	43.0					8																	48794060		1818	4062	5880	48956613	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.4981A>C	8.37:g.48794060T>G	ENSP00000313420:p.Asn1661His	Somatic		Capture	SOLID	Phase_IV	48956613	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		SNP	61	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820295	0.50633	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.65364	-0.15;-0.15	5.43	4.28	0.50868	Armadillo-like helical (1);Armadillo-type fold (1);	0.244417	0.40640	N	0.001041	T	0.65575	0.2704	M	0.65975	2.015	0.34965	D	0.752559	D;D	0.55385	0.971;0.971	P;P	0.50617	0.646;0.646	T	0.74940	-0.3493	10	0.66056	D	0.02	.	7.929	0.29891	0.0:0.1605:0.0:0.8395	.	1661;1662	E7EUY0;P78527	.;PRKDC_HUMAN	H	1661	ENSP00000313420:N1661H;ENSP00000345182:N1661H	ENSP00000313420:N1661H	N	-	1	0	PRKDC	48956613	1.000000	0.71417	0.787000	0.31911	0.598000	0.36846	2.036000	0.41165	0.914000	0.36822	0.523000	0.50628	AAT		0.313	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		Missense_Mutation
PRSS3	5646	hgsc.bcm.edu	37	9	33799033	33799033	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr9:33799033C>T	ENST00000361005.5	+	5	770	c.770C>T	c.(769-771)tCt>tTt	p.S257F	PRSS3_ENST00000495682.1_3'UTR|PRSS3_ENST00000342836.4_Missense_Mutation_p.S214F|PRSS3_ENST00000429677.3_Missense_Mutation_p.S193F|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Missense_Mutation_p.S200F	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	257	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S200F(1)		large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CAGCGTGACTCTGGTGGCCCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											85.0	83.0	84.0					9																	33799033		2203	4300	6503	33789033	SO:0001583	missense	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.770C>T	9.37:g.33799033C>T	ENSP00000354280:p.Ser257Phe	Somatic		Capture	SOLID	Phase_IV	33789033	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461656	0.63513	.	.	ENSG00000010438	ENST00000361005;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13	3.45	3.45	0.39498	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98748	0.9579	H	0.98111	4.15	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98908	1.0779	10	0.87932	D	0	.	13.2298	0.59936	0.0:1.0:0.0:0.0	.	200;257;214	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	F	257;214;193;200	ENSP00000354280:S257F;ENSP00000340889:S214F;ENSP00000401828:S193F;ENSP00000368715:S200F	ENSP00000340889:S214F	S	+	2	0	PRSS3	33789033	1.000000	0.71417	1.000000	0.80357	0.600000	0.36913	5.159000	0.64923	1.892000	0.54788	0.306000	0.20318	TCT		0.527	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771		Missense_Mutation
RASGEF1A	221002	hgsc.bcm.edu	37	10	43696279	43696279	+	Silent	SNP	A	A	G	rs41301585	byFrequency	TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr10:43696279A>G	ENST00000395809.1	-	5	3023	c.517T>C	c.(517-519)Ttg>Ctg	p.L173L	RASGEF1A_ENST00000472864.1_5'UTR|RASGEF1A_ENST00000374459.1_Silent_p.L181L|RASGEF1A_ENST00000395810.1_Silent_p.L173L			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	173					cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.L120L(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						CGGGCAGCCAAGGACAGCAAC	0.617													G|||	407	0.08127	0.0424	0.0317	5008	,	,		20684	0.1002		0.0646	False		,,,				2504	0.1667															1	Substitution - coding silent(1)	ovary(1)	10						G		192,4214	807.3+/-415.9	6,180,2017	98.0	92.0	94.0		517	5.2	1.0	10	dbSNP_127	94	516,8084	795.8+/-407.5	22,472,3806	no	coding-synonymous	RASGEF1A	NM_145313.2		28,652,5823	GG,GA,AA		6.0,4.3577,5.4436		173/482	43696279	708,12298	2203	4300	6503	43016285	SO:0001819	synonymous_variant	221002			AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.517T>C	10.37:g.43696279A>G		Somatic		Capture	SOLID	Phase_IV	43016285	Q8TBF1	Silent	SNP	ENST00000395809.1	37	CCDS7202.2	SNP	3	Baylor	172	0.07875457875457875	36	0.07317073170731707	19	0.052486187845303865	70	0.12237762237762238	47	0.06200527704485488	G	10.29	1.308387	0.23821	0.043577	0.06	ENSG00000198915	ENST00000374455	.	.	.	5.18	5.18	0.71444	.	0.000000	0.56097	D	0.000025	T	0.01835	0.0058	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.23797	-1.0178	4	.	.	.	.	13.9492	0.64106	0.0733:0.0:0.9267:0.0	rs41301585;rs61749172	.	.	.	P	74	.	.	L	-	2	0	RASGEF1A	43016285	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.180000	0.50895	1.191000	0.43056	-0.215000	0.12644	CTT		0.617	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313		Silent
RELN	5649	hgsc.bcm.edu	37	7	103276880	103276880	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0762-01	TCGA-13-0762-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr7:103276880A>G	ENST00000428762.1	-	18	2264	c.2105T>C	c.(2104-2106)aTg>aCg	p.M702T	RELN_ENST00000424685.2_Missense_Mutation_p.M702T|RELN_ENST00000343529.5_Missense_Mutation_p.M702T	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	702					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.M702T(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTGGGATGCCATCTCACAAGC	0.433																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7											44.0	47.0	46.0					7																	103276880		2203	4300	6503	103064116	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2105T>C	7.37:g.103276880A>G	ENSP00000392423:p.Met702Thr	Somatic		Capture	SOLID	Phase_IV	103064116	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.820	0.937447	0.18206	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.07216	3.21;3.21;3.21	5.76	5.76	0.90799	.	0.102069	0.64402	D	0.000001	T	0.06325	0.0163	N	0.19112	0.55	0.37401	D	0.912838	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.38134	-0.9675	10	0.27082	T	0.32	.	11.962	0.53013	0.9305:0.0:0.0695:0.0	.	702;702	P78509-2;P78509	.;RELN_HUMAN	T	702	ENSP00000392423:M702T;ENSP00000345694:M702T;ENSP00000388446:M702T	ENSP00000345694:M702T	M	-	2	0	RELN	103064116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.803000	0.47924	2.197000	0.70478	0.482000	0.46254	ATG		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
RSPO1	284654	hgsc.bcm.edu	37	1	38079872	38079872	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:38079872C>T	ENST00000401069.1	-	5	1132	c.420G>A	c.(418-420)atG>atA	p.M140I	RSPO1_ENST00000401068.1_Missense_Mutation_p.M140I|RSPO1_ENST00000401070.1_Missense_Mutation_p.M140I|RSPO1_ENST00000373059.1_Missense_Mutation_p.M113I|RSPO1_ENST00000401071.2_Missense_Mutation_p.M140I|RSPO1_ENST00000356545.2_Missense_Mutation_p.M140I	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	140					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TACTGCACTCCATGGTGCCAT	0.617																																					GBM(122;680 2230 27822 42821)											0			1											35.0	38.0	37.0					1																	38079872		1990	4170	6160	37852459	SO:0001583	missense	284654			AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.420G>A	1.37:g.38079872C>T	ENSP00000383847:p.Met140Ile	Somatic		Capture	SOLID	Phase_IV	37852459	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Missense_Mutation	SNP	ENST00000401069.1	37	CCDS41304.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065887	0.55539	.	.	ENSG00000169218	ENST00000373059;ENST00000401070;ENST00000356545;ENST00000401071;ENST00000401069;ENST00000401068	D;D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64;-1.64	5.17	4.26	0.50523	Growth factor, receptor (1);	0.121961	0.85682	D	0.000000	T	0.77315	0.4112	L	0.49640	1.575	0.58432	D	0.999999	B;B;B	0.27068	0.034;0.167;0.044	B;B;B	0.23716	0.022;0.048;0.022	T	0.75673	-0.3236	10	0.62326	D	0.03	-11.7474	10.2324	0.43262	0.0:0.8481:0.0:0.1519	.	140;113;140	Q0H8S6;Q2MKA7-2;Q2MKA7	.;.;RSPO1_HUMAN	I	113;140;140;140;140;140	ENSP00000362150:M113I;ENSP00000383848:M140I;ENSP00000348944:M140I;ENSP00000383849:M140I;ENSP00000383847:M140I;ENSP00000383846:M140I	ENSP00000348944:M140I	M	-	3	0	RSPO1	37852459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.091000	0.71406	1.324000	0.45282	0.655000	0.94253	ATG		0.617	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012477.2	NM_173640		Missense_Mutation
SCN3A	6328	hgsc.bcm.edu	37	2	165948840	165948840	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr2:165948840G>A	ENST00000360093.3	-	27	5222	c.4731C>T	c.(4729-4731)ctC>ctT	p.L1577L	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Silent_p.L1528L|SCN3A_ENST00000283254.7_Silent_p.L1577L|SCN3A_ENST00000465043.1_5'UTR|SCN3A_ENST00000540861.1_Silent_p.L60L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1577					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAGGGAGACGAGCTTCAGCA	0.443																																																0			2											154.0	131.0	138.0					2																	165948840		2203	4300	6503	165657086	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4731C>T	2.37:g.165948840G>A		Somatic		Capture	SOLID	Phase_IV	165657086	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37		SNP	37	Baylor																																																																																				0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		Silent
SEC16A	9919	hgsc.bcm.edu	37	9	139342342	139342342	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr9:139342342T>C	ENST00000371706.3	-	23	5909	c.5876A>G	c.(5875-5877)aAa>aGa	p.K1959R	SEC16A_ENST00000290037.6_Missense_Mutation_p.K1959R|SEC16A_ENST00000398335.1_3'UTR|SEC16A_ENST00000431893.2_Missense_Mutation_p.K1959R|SEC16A_ENST00000313050.7_Missense_Mutation_p.K2137R|SEC16A_ENST00000313084.5_Missense_Mutation_p.K143R			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1959	Pro-rich.|Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CCACTGGTTTTTCTTTTCATC	0.398																																																0			9											70.0	69.0	69.0					9																	139342342		1852	4089	5941	138462163	SO:0001583	missense	9919			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.5876A>G	9.37:g.139342342T>C	ENSP00000360771:p.Lys1959Arg	Somatic		Capture	SOLID	Phase_IV	138462163	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024115	0.75390	.	.	ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000313084;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348	T;T;T;T;T;T	0.54071	1.59;0.59;1.22;1.59;1.6;1.59	5.06	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.60843	0.2300	L	0.58510	1.815	0.80722	D	1	P;D;P;B;P;P	0.54772	0.935;0.968;0.736;0.246;0.482;0.933	P;P;B;B;B;P	0.59171	0.647;0.853;0.275;0.142;0.225;0.683	T	0.56878	-0.7906	10	0.31617	T	0.26	-21.5512	10.2435	0.43328	0.0:0.0789:0.0:0.9211	.	2137;1959;1959;1527;1959;143	F1T0I1;O15027-5;O15027-4;A4QN19;O15027;Q8N9G1	.;.;.;.;SC16A_HUMAN;.	R	2137;531;859;1959;143;1959;1959;1527;495	ENSP00000325827:K2137R;ENSP00000277537:K531R;ENSP00000403525:K859R;ENSP00000360771:K1959R;ENSP00000290037:K1959R;ENSP00000387583:K1959R	ENSP00000277537:K531R	K	-	2	0	SEC16A	138462163	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.641000	0.54360	0.859000	0.35456	0.454000	0.30748	AAA		0.398	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459		Missense_Mutation
SIGLEC11	114132	hgsc.bcm.edu	37	19	50453487	50453487	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr19:50453487G>A	ENST00000447370.2	-	11	1927	c.1837C>T	c.(1837-1839)Cag>Tag	p.Q613*	SIGLEC11_ENST00000426971.2_Nonsense_Mutation_p.Q517*|CTC-326K19.6_ENST00000451973.1_Intron|U3_ENST00000408198.1_RNA	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	613					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.Q601*(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CATTCATGCTGGTGACCCTGA	0.587																																																1	Substitution - Nonsense(1)	ovary(1)	19											15.0	17.0	16.0					19																	50453487		2203	4299	6502	55145299	SO:0001587	stop_gained	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1837C>T	19.37:g.50453487G>A	ENSP00000412361:p.Gln613*	Somatic		Capture	SOLID	Phase_IV	55145299		Nonsense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069225	0.76301	.	.	ENSG00000161640	ENST00000447370;ENST00000458019	.	.	.	3.97	-1.49	0.08718	.	2.606050	0.01507	N	0.017771	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	11.2611	0.49083	0.0:0.0:0.3674:0.6326	.	.	.	.	X	613;517	.	ENSP00000412361:Q613X	Q	-	1	0	SIGLEC11	55145299	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	1.032000	0.30178	-0.253000	0.09514	-0.169000	0.13324	CAG		0.587	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		Nonsense_Mutation
SLIT2	9353	hgsc.bcm.edu	37	4	20619085	20619085	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr4:20619085C>G	ENST00000504154.1	+	36	4412	c.4160C>G	c.(4159-4161)cCc>cGc	p.P1387R	SLIT2_ENST00000273739.5_Missense_Mutation_p.P1400R|SLIT2_ENST00000503823.1_Missense_Mutation_p.P1379R|SLIT2_ENST00000503837.1_Missense_Mutation_p.P1383R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1387					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.P1387R(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACCTGCTTGCCCATCAATGCG	0.507																																																1	Substitution - Missense(1)	ovary(1)	4											101.0	87.0	92.0					4																	20619085		2203	4300	6503	20228183	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4160C>G	4.37:g.20619085C>G	ENSP00000422591:p.Pro1387Arg	Somatic		Capture	SOLID	Phase_IV	20228183	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250751	0.80135	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	5.9	5.9	0.94986	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.255981	0.46442	D	0.000295	D	0.88262	0.6389	L	0.28740	0.885	0.80722	D	1	B;P	0.42248	0.025;0.774	B;B	0.41988	0.069;0.372	D	0.85718	0.1323	10	0.16896	T	0.51	.	18.4595	0.90734	0.0:1.0:0.0:0.0	.	1379;1387	O94813-3;O94813	.;SLIT2_HUMAN	R	1379;1387;1400;1383;1383	ENSP00000427548:P1379R;ENSP00000422591:P1387R;ENSP00000273739:P1400R;ENSP00000422261:P1383R	ENSP00000273739:P1400R	P	+	2	0	SLIT2	20228183	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.495000	0.81514	2.788000	0.95919	0.650000	0.86243	CCC		0.507	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			Missense_Mutation
SMARCB1	6598	hgsc.bcm.edu	37	22	24175823	24175823	+	Missense_Mutation	SNP	C	C	T	rs112118417		TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr22:24175823C>T	ENST00000263121.7	+	8	1247	c.1051C>T	c.(1051-1053)Cca>Tca	p.P351S	DERL3_ENST00000464023.1_5'Flank|SMARCB1_ENST00000407422.3_Missense_Mutation_p.P342S|SMARCB1_ENST00000344921.6_Missense_Mutation_p.P360S|SMARCB1_ENST00000407082.3_Missense_Mutation_p.P305S	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	351					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.P351S(1)|p.P351fs*5(1)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CCAGTGGTGCCCACTGCTGGA	0.612			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	5	Unknown(2)|Substitution - Missense(1)|Deletion - In frame(1)|Deletion - Frameshift(1)	central_nervous_system(3)|ovary(1)|soft_tissue(1)	22											145.0	127.0	133.0					22																	24175823		2203	4300	6503	22505823	SO:0001583	missense	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.1051C>T	22.37:g.24175823C>T	ENSP00000263121:p.Pro351Ser	Somatic		Capture	SOLID	Phase_IV	22505823	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	37	CCDS13817.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861127	0.91433	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.95014	0.8386	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96118	0.9082	10	0.72032	D	0.01	-22.6007	17.2148	0.86940	0.0:1.0:0.0:0.0	.	360;342;351	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	S	360;351;342;305	ENSP00000340883:P360S;ENSP00000263121:P351S;ENSP00000383984:P342S;ENSP00000385226:P305S	ENSP00000263121:P351S	P	+	1	0	SMARCB1	22505823	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	7.569000	0.82380	2.387000	0.81309	0.543000	0.68304	CCA		0.612	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073		Missense_Mutation
SPATA13	221178	hgsc.bcm.edu	37	13	24864949	24864949	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0762-01	TCGA-13-0762-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr13:24864949A>C	ENST00000382095.4	+	8	1539	c.1132A>C	c.(1132-1134)Aca>Cca	p.T378P	SPATA13_ENST00000399949.2_Missense_Mutation_p.T300P|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.T881P|SPATA13_ENST00000409126.1_Missense_Mutation_p.T238P|SPATA13_ENST00000382108.3_Missense_Mutation_p.T1003P|SPATA13_ENST00000343003.6_Missense_Mutation_p.T322P|SPATA13_ENST00000424834.2_Missense_Mutation_p.T1003P	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	378	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.T378P(1)		breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GTTCCTGCTCACACCAGTGCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											56.0	57.0	57.0					13																	24864949		2203	4300	6503	23762949	SO:0001583	missense	221178			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.1132A>C	13.37:g.24864949A>C	ENSP00000371527:p.Thr378Pro	Somatic		Capture	SOLID	Phase_IV	23762949	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	SNP	6	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.1|26.1	4.701727|4.701727	0.88924|0.88924	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000424834|ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694;ENST00000399949;ENST00000409126;ENST00000343003	.|T;T;T;T;T;T	.|0.69040	.|-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.44|5.44	5.44|5.44	0.79542|0.79542	.|Dbl homology (DH) domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84642|0.84642	0.5517|0.5517	M|M	0.90814|0.90814	3.15|3.15	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;0.998;1.0;0.998;0.997;0.999	D|D	0.87874|0.87874	0.2673|0.2673	5|10	.|0.72032	.|D	.|0.01	.|.	14.6948|14.6948	0.69113|0.69113	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|238;322;262;324;300;378	.|E9PFR9;Q96N96-3;Q96N96-5;Q96N96-4;Q96N96-2;Q96N96	.|.;.;.;.;.;SPT13_HUMAN	P|P	1040|1003;378;276;324;300;238;322	.|ENSP00000371542:T1003P;ENSP00000371527:T378P;ENSP00000401605:T276P;ENSP00000382830:T300P;ENSP00000386471:T238P;ENSP00000343631:T322P	.|ENSP00000343631:T322P	H|T	+|+	2|1	0|0	SPATA13|SPATA13	23762949|23762949	1.000000|1.000000	0.71417|0.71417	0.793000|0.793000	0.32043|0.32043	0.965000|0.965000	0.64279|0.64279	8.853000|8.853000	0.92222|0.92222	2.077000|2.077000	0.62373|0.62373	0.454000|0.454000	0.30748|0.30748	CAC|ACA		0.572	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023		Missense_Mutation
SUPT6H	6830	hgsc.bcm.edu	37	17	27011891	27011891	+	Missense_Mutation	SNP	A	A	G	rs190479497	byFrequency	TCGA-13-0762-01	TCGA-13-0762-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr17:27011891A>G	ENST00000314616.6	+	19	2682	c.2399A>G	c.(2398-2400)aAt>aGt	p.N800S	SUPT6H_ENST00000347486.4_Missense_Mutation_p.N800S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	800	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N800S(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GCCCTGGTCAATGGTGAAGGA	0.458													A|||	8	0.00159744	0.0	0.0	5008	,	,		24357	0.005		0.001	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	17						A	SER/ASN	0,4406		0,0,2203	99.0	88.0	92.0		2399	4.3	1.0	17		92	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SUPT6H	NM_003170.3	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	800/1727	27011891	1,13005	2203	4300	6503	24036018	SO:0001583	missense	6830			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.2399A>G	17.37:g.27011891A>G	ENSP00000319104:p.Asn800Ser	Somatic		Capture	SOLID	Phase_IV	24036018	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	SNP	4	Baylor	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	A	12.98	2.101843	0.37048	0.0	1.16E-4	ENSG00000109111	ENST00000314616	.	.	.	5.4	4.33	0.51752	YqgF/RNase H-like domain (1);	0.000000	0.85682	D	0.000000	T	0.45577	0.1349	L	0.36672	1.1	0.58432	D	0.999992	B	0.17268	0.021	B	0.08055	0.003	T	0.34254	-0.9836	9	0.44086	T	0.13	-20.7227	10.0778	0.42370	0.9236:0.0:0.0764:0.0	.	800	Q7KZ85	SPT6H_HUMAN	S	800	.	ENSP00000319104:N800S	N	+	2	0	SUPT6H	24036018	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.800000	0.91900	1.005000	0.39183	0.528000	0.53228	AAT		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170		Missense_Mutation
SYNPO2	171024	hgsc.bcm.edu	37	4	119948253	119948253	+	Silent	SNP	G	G	A			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr4:119948253G>A	ENST00000429713.2	+	3	911	c.729G>A	c.(727-729)tcG>tcA	p.S243S	SYNPO2_ENST00000307142.4_Silent_p.S243S|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Silent_p.S243S	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	243						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.S243S(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ACATAAATTCGATCCCTACTA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	4											50.0	54.0	53.0					4																	119948253		2203	4300	6503	120167701	SO:0001819	synonymous_variant	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.729G>A	4.37:g.119948253G>A		Somatic		Capture	SOLID	Phase_IV	120167701	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.300920	0.01364	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.26	-10.5	0.00291	.	.	.	.	.	T	0.14184	0.0343	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.09079	-1.0691	4	.	.	.	-4.6186	1.8079	0.03084	0.2446:0.0889:0.2981:0.3684	.	.	.	.	N	195	.	.	D	+	1	0	SYNPO2	120167701	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.816000	0.04477	-2.885000	0.00317	-1.113000	0.02065	GAT		0.493	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1			Silent
SYT6	148281	hgsc.bcm.edu	37	1	114641783	114641783	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:114641783T>A	ENST00000610222.1	-	5	1443	c.1297A>T	c.(1297-1299)Atc>Ttc	p.I433F	SYT6_ENST00000607941.1_Missense_Mutation_p.I348F|SYT6_ENST00000609117.1_Missense_Mutation_p.I348F|SYT6_ENST00000369547.1_Missense_Mutation_p.I348F|SYT6_ENST00000393296.1_Missense_Mutation_p.I433F			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	433	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.I348V(1)|p.I348F(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTCAAAGATGATGGCCTCA	0.463																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	1											288.0	224.0	246.0					1																	114641783		2203	4300	6503	114443306	SO:0001583	missense	148281				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1297A>T	1.37:g.114641783T>A	ENSP00000476396:p.Ile433Phe	Somatic		Capture	SOLID	Phase_IV	114443306	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	37		SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439247	0.83885	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.77	5.77	0.91146	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	N	0.17872	0.535	0.80722	D	1	P	0.50819	0.939	P	0.59825	0.864	T	0.68356	-0.5430	10	0.59425	D	0.04	.	16.0879	0.81070	0.0:0.0:0.0:1.0	.	433	Q5T7P8	SYT6_HUMAN	F	348;433;348;433	ENSP00000358560:I348F;ENSP00000376974:I433F;ENSP00000358559:I348F;ENSP00000358558:I433F	ENSP00000358558:I433F	I	-	1	0	SYT6	114443306	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.276000	0.72601	2.199000	0.70637	0.533000	0.62120	ATC		0.463	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848		Missense_Mutation
TAS2R20	259295	hgsc.bcm.edu	37	12	11150054	11150054	+	Missense_Mutation	SNP	C	C	T	rs79420812	byFrequency	TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr12:11150054C>T	ENST00000538986.1	-	1	420	c.421G>A	c.(421-423)Gtt>Att	p.V141I	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	141				VCH -> ICQ (in Ref. 3; AAU21140). {ECO:0000305}.	sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V141I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AGGTGACAAACCAAAAAGAAC	0.388													C|||	916	0.182907	0.0371	0.1225	5008	,	,		20886	0.3185		0.2227	False		,,,				2504	0.2423															1	Substitution - Missense(1)	ovary(1)	12						C	ILE/VAL	239,4167	139.6+/-175.2	7,225,1971	128.0	114.0	118.0		421	-5.9	0.0	12	dbSNP_131	118	1704,6896	311.7+/-310.5	167,1370,2763	yes	missense	TAS2R20	NM_176889.2	29	174,1595,4734	TT,TC,CC		19.814,5.4244,14.9393	benign	141/310	11150054	1943,11063	2203	4300	6503	11041321	SO:0001583	missense	259295			AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.421G>A	12.37:g.11150054C>T	ENSP00000441624:p.Val141Ile	Somatic		Capture	SOLID	Phase_IV	11041321	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	37	CCDS8639.1	SNP	18	Baylor	402	0.18406593406593408	19	0.03861788617886179	50	0.13812154696132597	171	0.29895104895104896	162	0.21372031662269128	C	2.515	-0.312165	0.05422	0.054244	0.19814	ENSG00000255837	ENST00000538986	T	0.36340	1.26	2.93	-5.87	0.02297	.	0.867467	0.09448	U	0.800842	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.12156	0.007	T	0.39078	-0.9631	9	0.25751	T	0.34	.	1.3021	0.02081	0.4189:0.2764:0.1245:0.1802	.	141	P59543	T2R20_HUMAN	I	141	ENSP00000441624:V141I	ENSP00000441624:V141I	V	-	1	0	TAS2R20	11041321	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.252000	0.00539	-1.958000	0.01019	-0.964000	0.02622	GTT		0.388	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889		Missense_Mutation
TET1	80312	hgsc.bcm.edu	37	10	70333677	70333677	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr10:70333677C>G	ENST00000373644.4	+	2	1791	c.1582C>G	c.(1582-1584)Ctg>Gtg	p.L528V		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	528	Sufficient for binding to genomic CpG islands.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCATGCTTCACTGGGTATAGC	0.498																																																0			10											71.0	64.0	66.0					10																	70333677		2203	4300	6503	70003683	SO:0001583	missense	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1582C>G	10.37:g.70333677C>G	ENSP00000362748:p.Leu528Val	Somatic		Capture	SOLID	Phase_IV	70003683	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	1.111	-0.658107	0.03454	.	.	ENSG00000138336	ENST00000373644	T	0.07327	3.2	4.98	-4.23	0.03789	.	4.302940	0.00832	N	0.001663	T	0.04092	0.0114	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.32666	-0.9898	10	0.16420	T	0.52	.	1.9837	0.03432	0.1092:0.3571:0.2135:0.3202	.	528	Q8NFU7	TET1_HUMAN	V	528	ENSP00000362748:L528V	ENSP00000362748:L528V	L	+	1	2	TET1	70003683	0.000000	0.05858	0.000000	0.03702	0.239000	0.25481	-0.026000	0.12392	-0.753000	0.04721	0.305000	0.20034	CTG		0.498	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		Missense_Mutation
THOC6	79228	hgsc.bcm.edu	37	16	3076879	3076879	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr16:3076879G>C	ENST00000326266.8	+	9	894	c.598G>C	c.(598-600)Gcc>Ccc	p.A200P	THOC6_ENST00000253952.9_Missense_Mutation_p.A200P|HCFC1R1_ENST00000574151.1_5'Flank|HCFC1R1_ENST00000574980.1_5'Flank|THOC6_ENST00000574549.1_Missense_Mutation_p.A176P|THOC6_ENST00000575576.1_Missense_Mutation_p.A176P|HCFC1R1_ENST00000572355.1_5'Flank|HCFC1R1_ENST00000354679.3_5'Flank|HCFC1R1_ENST00000396916.1_5'Flank|HCFC1R1_ENST00000248089.3_5'Flank	NM_024339.3	NP_077315.2	Q86W42	THOC6_HUMAN	THO complex 6 homolog (Drosophila)	200					apoptotic process (GO:0006915)|central nervous system development (GO:0007417)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.A200P(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	13						CCTGCGCACAGCCAAGGAGGT	0.582																																																1	Substitution - Missense(1)	ovary(1)	16											140.0	119.0	126.0					16																	3076879		2197	4300	6497	3016880	SO:0001583	missense	79228			BC050674	CCDS10491.1, CCDS45392.1	16p13.3	2013-02-11	2006-03-02	2006-03-02		ENSG00000131652		"""WD repeat domain containing"", ""THO complex subunits"""	28369	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 35"""	615403	"""WD repeat domain 58"""	WDR58		12477932	Standard	NM_024339		Approved	MGC2655, fSAP35	uc002ctb.2	Q86W42		ENST00000326266.8:c.598G>C	16.37:g.3076879G>C	ENSP00000326531:p.Ala200Pro	Somatic		Capture	SOLID	Phase_IV	3016880	B2RA85|Q8NBR1|Q9BTV9	Missense_Mutation	SNP	ENST00000326266.8	37	CCDS10491.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.908	0.958060	0.18507	.	.	ENSG00000131652	ENST00000326266;ENST00000253952	T;T	0.27890	1.64;1.64	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.314141	0.33110	N	0.005272	T	0.26557	0.0649	L	0.33485	1.01	0.42535	D	0.993053	P;P	0.48016	0.904;0.641	B;B	0.41088	0.347;0.188	T	0.06991	-1.0796	10	0.87932	D	0	-0.1143	14.4183	0.67165	0.0:0.0:1.0:0.0	.	200;200	Q86W42-3;Q86W42	.;THOC6_HUMAN	P	200	ENSP00000326531:A200P;ENSP00000253952:A200P	ENSP00000253952:A200P	A	+	1	0	THOC6	3016880	1.000000	0.71417	0.942000	0.38095	0.527000	0.34593	4.650000	0.61440	2.471000	0.83476	0.462000	0.41574	GCC		0.582	THOC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436981.1	NM_024339		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Biotage_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	17	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	7518996	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	Somatic		Capture	SOLID	Phase_IV	7518996	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TTLL3	26140	hgsc.bcm.edu	37	3	9868888	9868888	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0762-01	TCGA-13-0762-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr3:9868888T>C	ENST00000547186.1	+	9	1298	c.1082T>C	c.(1081-1083)tTt>tCt	p.F361S	TTLL3_ENST00000466245.1_Intron|TTLL3_ENST00000426895.4_Missense_Mutation_p.F504S|TTLL3_ENST00000397241.1_Missense_Mutation_p.F149S|TTLL3_ENST00000430793.1_Missense_Mutation_p.F149S|TTLL3_ENST00000455274.1_Missense_Mutation_p.F149S|TTLL3_ENST00000427853.3_Missense_Mutation_p.F149S|ARPC4-TTLL3_ENST00000397256.1_Missense_Mutation_p.F422S|TTLL3_ENST00000383827.1_Missense_Mutation_p.F149S	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	361	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.F361S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					TATATCCGCTTTTCCACGCAG	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	99.0	103.0					3																	9868888		2203	4300	6503	9843888	SO:0001583	missense	26140				CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1082T>C	3.37:g.9868888T>C	ENSP00000446659:p.Phe361Ser	Somatic		Capture	SOLID	Phase_IV	9843888	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	37		SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472901	0.84640	.	.	ENSG00000250151;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021	ENST00000397256;ENST00000426895;ENST00000547186;ENST00000397241;ENST00000427853;ENST00000443148;ENST00000383827;ENST00000455274;ENST00000430793	T;T;T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75;2.75	5.09	5.09	0.68999	.	0.000000	0.64402	U	0.000002	T	0.46464	0.1394	H	0.96489	3.83	0.58432	D	0.999996	D;D;P;D;D	0.89917	0.999;0.992;0.955;0.964;1.0	D;D;P;P;D	0.81914	0.995;0.925;0.772;0.714;0.995	T	0.64483	-0.6397	10	0.87932	D	0	.	14.562	0.68148	0.0:0.0:0.0:1.0	.	300;149;149;149;361	B4DM47;Q9Y4R7-2;B2RCJ2;Q9Y4R7-5;Q9Y4R7	.;.;.;.;TTLL3_HUMAN	S	422;504;361;149;149;299;149;149;149	ENSP00000380427:F422S;ENSP00000392549:F504S;ENSP00000446659:F361S;ENSP00000380416:F149S;ENSP00000394462:F149S;ENSP00000398097:F299S;ENSP00000373338:F149S;ENSP00000409632:F149S;ENSP00000403874:F149S	ENSP00000380416:F149S	F	+	2	0	ARPC4-TTLL3;TTLL3	9843888	1.000000	0.71417	0.998000	0.56505	0.812000	0.45895	7.699000	0.84547	1.908000	0.55244	0.455000	0.32223	TTT		0.567	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2		Missense_Mutation
USP46	64854	hgsc.bcm.edu	37	4	53492362	53492362	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr4:53492362delC	ENST00000441222.3	-	4	568	c.384delG	c.(382-384)ttgfs	p.L129fs	USP46_ENST00000451218.2_Frame_Shift_Del_p.L102fs|USP46_ENST00000508499.1_Frame_Shift_Del_p.L122fs	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	129	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L128fs*2(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TAGTGTTTAGCAAATAATTTA	0.358																																																1	Deletion - Frameshift(1)	ovary(1)	4											81.0	74.0	76.0					4																	53492362		1814	4085	5899	53187119	SO:0001589	frameshift_variant	64854			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.384delG	4.37:g.53492362delC	ENSP00000407818:p.Leu129fs	Somatic		Capture	SOLID	Phase_IV	53187119	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Frame_Shift_Del	DEL	ENST00000441222.3	37	CCDS47053.1	DEL	25	Baylor																																																																																				0.358	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361516.2	NM_022832		Frame_Shift_Del
VIL1	7429	hgsc.bcm.edu	37	2	219297657	219297657	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr2:219297657C>T	ENST00000248444.5	+	13	1571	c.1483C>T	c.(1483-1485)Cgc>Tgc	p.R495C	VIL1_ENST00000392114.2_Missense_Mutation_p.R184C	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	495	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.R495C(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTCAAGGGACGCATGGTGGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	89.0	103.0					2																	219297657		2203	4300	6503	219005901	SO:0001583	missense	7429			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1483C>T	2.37:g.219297657C>T	ENSP00000248444:p.Arg495Cys	Somatic		Capture	SOLID	Phase_IV	219005901	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	ENST00000248444.5	37	CCDS2417.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424212	0.25639	.	.	ENSG00000127831	ENST00000248444;ENST00000392114;ENST00000419986	T;T;T	0.17528	2.53;2.53;2.27	4.66	2.86	0.33363	.	1.245940	0.05445	N	0.548368	T	0.18841	0.0452	L	0.54323	1.7	0.23620	N	0.997273	B	0.10296	0.003	B	0.09377	0.004	T	0.31138	-0.9954	10	0.72032	D	0.01	-0.0374	5.0913	0.14710	0.26:0.5732:0.0:0.1668	.	495	P09327	VILI_HUMAN	C	495;184;64	ENSP00000248444:R495C;ENSP00000375962:R184C;ENSP00000394030:R64C	ENSP00000248444:R495C	R	+	1	0	VIL1	219005901	0.878000	0.30173	0.565000	0.28409	0.668000	0.39293	3.634000	0.54302	0.591000	0.29711	0.561000	0.74099	CGC		0.562	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256778.3	NM_007127		Missense_Mutation
ZMYM4	9202	hgsc.bcm.edu	37	1	35855647	35855647	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0762-01	TCGA-13-0762-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr1:35855647G>C	ENST00000314607.6	+	15	2615	c.2535G>C	c.(2533-2535)ttG>ttC	p.L845F	ZMYM4_ENST00000373297.2_Missense_Mutation_p.L756F	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	845					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.L845F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTTGTATCTTGATGTTCTGTA	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											140.0	132.0	135.0					1																	35855647		2203	4300	6503	35628234	SO:0001583	missense	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2535G>C	1.37:g.35855647G>C	ENSP00000322915:p.Leu845Phe	Somatic		Capture	SOLID	Phase_IV	35628234	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	SNP	45	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.181473|3.181473	0.57800|0.57800	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.34072	.|1.38;1.6	5.39|5.39	3.51|3.51	0.40186|0.40186	.|TRASH (1);	.|0.084603	.|0.49305	.|D	.|0.000159	T|T	0.58864|0.58864	0.2152|0.2152	M|M	0.76838|0.76838	2.35|2.35	0.37663|0.37663	D|D	0.922846|0.922846	.|D	.|0.89917	.|1.0	.|D	.|0.76071	.|0.987	T|T	0.64330|0.64330	-0.6433|-0.6433	5|10	.|0.66056	.|D	.|0.02	-5.5677|-5.5677	12.017|12.017	0.53319|0.53319	0.1988:0.0:0.8012:0.0|0.1988:0.0:0.8012:0.0	.|.	.|845	.|Q5VZL5	.|ZMYM4_HUMAN	H|F	505|845;756	.|ENSP00000322915:L845F;ENSP00000362394:L756F	.|ENSP00000322915:L845F	D|L	+|+	1|3	0|2	ZMYM4|ZMYM4	35628234|35628234	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	1.624000|1.624000	0.37018|0.37018	0.274000|0.274000	0.22072|0.22072	-1.936000|-1.936000	0.00505|0.00505	GAT|TTG		0.408	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095		Missense_Mutation
ZW10	9183	hgsc.bcm.edu	37	11	113610105	113610105	+	Splice_Site	SNP	C	C	G			TCGA-13-0762-01	TCGA-13-0762-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0762-01	TCGA-13-0762-10	g.chr11:113610105C>G	ENST00000200135.3	-	12	1728		c.e12-1			NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein						ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)	p.?(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AAGGTTCTCCCTAGGCCAGAA	0.443																																																1	Unknown(1)	ovary(1)	11											88.0	81.0	83.0					11																	113610105		2201	4296	6497	113115315	SO:0001630	splice_region_variant	9183			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.1584-1G>C	11.37:g.113610105C>G		Somatic		Capture	SOLID	Phase_IV	113115315	A1A528	Splice_Site_SNP	SNP	ENST00000200135.3	37	CCDS8363.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004953	0.74932	.	.	ENSG00000086827	ENST00000200135	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.813	0.96554	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZW10	113115315	1.000000	0.71417	0.998000	0.56505	0.810000	0.45777	7.487000	0.81328	2.683000	0.91414	0.591000	0.81541	.		0.443	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	Intron	Splice_Site_SNP
