#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
GLDC	2731	genome.wustl.edu	37	9	6589283	6589283	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr9:6589283C>G	ENST00000321612.6	-	12	1642	c.1492G>C	c.(1492-1494)Gct>Cct	p.A498P		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	498					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)	p.A498P(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	ATGCTTTCAGCAACCAGTTCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	9											105.0	83.0	90.0					9																	6589283		2203	4300	6503	6579283	SO:0001583	missense	2731			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1492G>C	9.37:g.6589283C>G	ENSP00000370737:p.Ala498Pro	Somatic		Capture	Illumina GAIIx	4	6579283	Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	37	CCDS34987.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827254	0.71143	.	.	ENSG00000178445	ENST00000321612	D	0.99220	-5.58	5.37	5.37	0.77165	.	0.101272	0.64402	D	0.000002	D	0.98115	0.9378	L	0.29908	0.895	0.80722	D	1	P	0.50443	0.935	P	0.48627	0.584	D	0.98316	1.0526	10	0.33940	T	0.23	-12.7695	19.0949	0.93246	0.0:1.0:0.0:0.0	.	498	P23378	GCSP_HUMAN	P	498	ENSP00000370737:A498P	ENSP00000370737:A498P	A	-	1	0	GLDC	6579283	1.000000	0.71417	0.999000	0.59377	0.380000	0.30137	7.051000	0.76627	2.510000	0.84645	0.557000	0.71058	GCT		0.537	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170		Missense_Mutation
GPS2	2874	genome.wustl.edu	37	17	7216433	7216433	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr17:7216433C>T	ENST00000380728.2	-	10	1115	c.815G>A	c.(814-816)cGc>cAc	p.R272H	RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000389167.5_Missense_Mutation_p.R272H|GPS2_ENST00000391950.3_Missense_Mutation_p.R272H			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	272					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)	p.R272H(2)		breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GTGCATGGGGCGCAGAGAGGA	0.572																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	17											64.0	73.0	70.0					17																	7216433		2203	4300	6503	7157157	SO:0001583	missense	2874			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.815G>A	17.37:g.7216433C>T	ENSP00000370104:p.Arg272His	Somatic		Capture	Illumina GAIIx	4	7157157	B4DXA1|Q6FHM8	Missense_Mutation	SNP	ENST00000380728.2	37	CCDS11100.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	21.4	4.140663	0.77775	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.55052	0.54;0.54	4.74	4.74	0.60224	.	0.066295	0.56097	U	0.000033	T	0.61311	0.2337	L	0.27053	0.805	0.54753	D	0.999985	D	0.76494	0.999	D	0.78314	0.991	T	0.66380	-0.5938	10	0.87932	D	0	-4.4764	16.6678	0.85257	0.0:1.0:0.0:0.0	.	272	Q13227	GPS2_HUMAN	H	272	ENSP00000370104:R272H;ENSP00000379841:R272H	ENSP00000319371:R272H	R	-	2	0	GPS2	7157157	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.250000	0.72435	2.459000	0.83118	0.655000	0.94253	CGC		0.572	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7577112	7577112	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr17:7577112C>G	ENST00000269305.4	-	8	1015	c.826G>C	c.(826-828)Gcc>Ccc	p.A276P	TP53_ENST00000455263.2_Missense_Mutation_p.A276P|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.A276P|TP53_ENST00000359597.4_Missense_Mutation_p.A276P|TP53_ENST00000445888.2_Missense_Mutation_p.A276P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	276	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A276P(15)|p.A276S(9)|p.0?(8)|p.A276T(7)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.A276fs*70(1)|p.A276fs*31(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGGACAGGCACAAACACGC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	56	Substitution - Missense(31)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(5)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(13)|bone(6)|upper_aerodigestive_tract(4)|biliary_tract(4)|large_intestine(4)|breast(4)|stomach(3)|central_nervous_system(3)|thymus(3)|urinary_tract(3)|ovary(2)|soft_tissue(1)|kidney(1)|endometrium(1)|oesophagus(1)|skin(1)|lung(1)|prostate(1)	17											72.0	62.0	65.0					17																	7577112		2203	4300	6503	7517837	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.826G>C	17.37:g.7577112C>G	ENSP00000269305:p.Ala276Pro	Somatic		Capture	Illumina GAIIx	4	7517837	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925704	0.92319	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.77103	2.36	0.80722	D	1	P;D;P;P	0.89917	0.768;1.0;0.909;0.455	P;D;P;P	0.77557	0.498;0.99;0.631;0.5	D	0.96498	0.9369	10	0.87932	D	0	-17.5913	15.662	0.77193	0.0:1.0:0.0:0.0	.	276;276;276;276	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	P	276;276;276;276;276;265;144	ENSP00000352610:A276P;ENSP00000269305:A276P;ENSP00000398846:A276P;ENSP00000391127:A276P;ENSP00000391478:A276P;ENSP00000425104:A144P	ENSP00000269305:A276P	A	-	1	0	TP53	7517837	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	GCC		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
MYH1	4619	genome.wustl.edu	37	17	10415500	10415500	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr17:10415500T>C	ENST00000226207.5	-	13	1251	c.1157A>G	c.(1156-1158)aAg>aGg	p.K386R	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	386	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K386R(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						ATAGGCTGCCTTGTCAGCAAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	17											167.0	161.0	163.0					17																	10415500		2203	4300	6503	10356225	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1157A>G	17.37:g.10415500T>C	ENSP00000226207:p.Lys386Arg	Somatic		Capture	Illumina GAIIx	4	10356225	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280519	0.80692	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	D	0.87809	-2.3	5.49	5.49	0.81192	Myosin head, motor domain (2);	0.000000	0.45361	U	0.000378	D	0.93083	0.7798	M	0.79343	2.45	0.54753	D	0.999983	D	0.76494	0.999	D	0.79108	0.992	D	0.93046	0.6461	10	0.46703	T	0.11	.	15.8844	0.79232	0.0:0.0:0.0:1.0	.	386	P12882	MYH1_HUMAN	R	386	ENSP00000226207:K386R	ENSP00000226207:K386R	K	-	2	0	MYH1	10356225	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	7.908000	0.87438	2.218000	0.71995	0.533000	0.62120	AAG		0.433	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963		Missense_Mutation
CCDC3	83643	genome.wustl.edu	37	10	12940645	12940645	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr10:12940645T>A	ENST00000378825.3	-	3	710	c.584A>T	c.(583-585)gAg>gTg	p.E195V	CCDC3_ENST00000378839.1_Missense_Mutation_p.E70V	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	195						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)		p.E195V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			GTCCTCCTCCTCAAACAAGGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	10											63.0	54.0	57.0					10																	12940645		2203	4300	6503	12980651	SO:0001583	missense	83643			BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.584A>T	10.37:g.12940645T>A	ENSP00000368102:p.Glu195Val	Somatic		Capture	Illumina GAIIx	4	12980651	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	37	CCDS7093.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497907	0.85069	.	.	ENSG00000151468	ENST00000378839;ENST00000378825	T	0.18657	2.2	5.42	5.42	0.78866	.	0.240857	0.40302	N	0.001135	T	0.46405	0.1391	M	0.69823	2.125	0.58432	D	0.999993	D	0.89917	1.0	D	0.83275	0.996	T	0.47873	-0.9083	10	0.87932	D	0	-21.4331	14.6402	0.68717	0.0:0.0:0.0:1.0	.	195	Q9BQI4	CCDC3_HUMAN	V	70;195	ENSP00000368116:E70V	ENSP00000368102:E195V	E	-	2	0	CCDC3	12980651	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.529000	0.81952	2.062000	0.61559	0.459000	0.35465	GAG		0.607	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046829.1	NM_031455		Missense_Mutation
EMR3	84658	genome.wustl.edu	37	19	14765803	14765803	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:14765803C>T	ENST00000253673.5	-	6	668	c.568G>A	c.(568-570)Gat>Aat	p.D190N	EMR3_ENST00000344373.4_Missense_Mutation_p.D138N|EMR3_ENST00000443157.2_Intron|EMR3_ENST00000599900.1_Intron	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	190					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.D190N(1)		NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						CCTACACTATCGTTTTGGATT	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											140.0	128.0	132.0					19																	14765803		2202	4300	6502	14626803	SO:0001583	missense	84658			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.568G>A	19.37:g.14765803C>T	ENSP00000253673:p.Asp190Asn	Somatic		Capture	Illumina GAIIx	4	14626803		Missense_Mutation	SNP	ENST00000253673.5	37	CCDS12315.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	3.549	-0.092148	0.07053	.	.	ENSG00000131355	ENST00000253673;ENST00000344373	T;T	0.10192	2.9;2.9	3.65	0.363	0.16118	.	.	.	.	.	T	0.03136	0.0092	N	0.02011	-0.69	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.06405	0.002;0.002	T	0.44967	-0.9293	9	0.21540	T	0.41	.	3.019	0.06069	0.0:0.249:0.2296:0.5215	.	138;190	Q9BY15-2;Q9BY15	.;EMR3_HUMAN	N	190;138	ENSP00000253673:D190N;ENSP00000340758:D138N	ENSP00000253673:D190N	D	-	1	0	EMR3	14626803	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.198000	0.17217	0.117000	0.18138	-0.238000	0.12139	GAT		0.413	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466488.1	NM_032571		Missense_Mutation
CYP2R1	120227	genome.wustl.edu	37	11	14902270	14902270	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:14902270G>A	ENST00000334636.5	-	3	458	c.412C>T	c.(412-414)Cga>Tga	p.R138*	CYP2R1_ENST00000532378.1_Intron|CYP2R1_ENST00000526489.1_5'UTR	NM_024514.4	NP_078790.2	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R, polypeptide 1	138					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.R138*(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	ACAGCTAATCGTCTGTGATCA	0.313																																					NSCLC(173;1584 2058 26117 29365 41534)											1	Substitution - Nonsense(1)	ovary(1)	11											37.0	38.0	38.0					11																	14902270		2197	4292	6489	14858846	SO:0001587	stop_gained	120227			AY323817	CCDS7818.1	11p15.2	2008-02-05			ENSG00000186104	ENSG00000186104		"""Cytochrome P450s"""	20580	protein-coding gene	gene with protein product		608713				12464240, 12867411	Standard	XM_005252788		Approved		uc001mlr.3	Q6VVX0	OTTHUMG00000165900	ENST00000334636.5:c.412C>T	11.37:g.14902270G>A	ENSP00000334592:p.Arg138*	Somatic		Capture	Illumina GAIIx	4	14858846	Q2M3H3|Q5RT65	Nonsense_Mutation	SNP	ENST00000334636.5	37	CCDS7818.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	38	7.030988	0.98013	.	.	ENSG00000186104	ENST00000334636	.	.	.	5.9	4.76	0.60689	.	0.180133	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3731	0.60723	0.0:0.0:0.1337:0.8663	.	.	.	.	X	138	.	ENSP00000334592:R138X	R	-	1	2	CYP2R1	14858846	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	6.303000	0.72794	1.048000	0.40298	-0.410000	0.06199	CGA		0.313	CYP2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386985.1	NM_024514		Nonsense_Mutation
CIB3	117286	genome.wustl.edu	37	19	16275555	16275555	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:16275555C>T	ENST00000269878.4	-	5	565	c.516G>A	c.(514-516)atG>atA	p.M172I	CIB3_ENST00000379859.3_Missense_Mutation_p.M123I|CIB3_ENST00000541493.1_5'UTR	NM_054113.2	NP_473454.1	Q96Q77	CIB3_HUMAN	calcium and integrin binding family member 3	172	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.M172I(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16						CCCGGAGGATCATGTTCTGGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	19											123.0	111.0	115.0					19																	16275555		2203	4300	6503	16136555	SO:0001583	missense	117286			AB050868	CCDS12340.1, CCDS74305.1	19p13.12	2013-01-10						"""EF-hand domain containing"""	24580	protein-coding gene	gene with protein product		610645					Standard	XM_005259728		Approved	KIP3	uc002nds.3	Q96Q77		ENST00000269878.4:c.516G>A	19.37:g.16275555C>T	ENSP00000269878:p.Met172Ile	Somatic		Capture	Illumina GAIIx	4	16136555	E7EUX1|Q2M1W0|Q6ISP1	Missense_Mutation	SNP	ENST00000269878.4	37	CCDS12340.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404499	0.62288	.	.	ENSG00000141977	ENST00000269878;ENST00000379859	T;T	0.69685	-0.42;-0.42	4.78	4.78	0.61160	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.64583	0.2611	L	0.47078	1.49	0.80722	D	1	P;B	0.42871	0.792;0.242	B;B	0.43194	0.411;0.145	T	0.65734	-0.6096	10	0.38643	T	0.18	-46.1456	17.1514	0.86779	0.0:1.0:0.0:0.0	.	123;172	E7EUX1;Q96Q77	.;CIB3_HUMAN	I	172;123	ENSP00000269878:M172I;ENSP00000369188:M123I	ENSP00000269878:M172I	M	-	3	0	CIB3	16136555	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	5.750000	0.68712	2.385000	0.81259	0.462000	0.41574	ATG		0.572	CIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460351.1	NM_054113		Missense_Mutation
KRT16P3	644945	genome.wustl.edu	37	17	20417937	20417937	+	RNA	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr17:20417937G>T	ENST00000580113.1	-	0	0				AC025627.9_ENST00000581013.1_RNA					keratin 16 pseudogene 3																		TTCTCATACTGCTCACGTATC	0.602																																																0			17																																								20358529						BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20417937G>T		Somatic		Capture	Illumina GAIIx	4	20358529		Silent	SNP	ENST00000580113.1	37		SNP	46	WashU																																																																																				0.602	KRT16P3-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000443764.1	NR_029393		Silent
UBXN10	127733	genome.wustl.edu	37	1	20517093	20517093	+	Silent	SNP	G	G	A	rs534420264		TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr1:20517093G>A	ENST00000375099.3	+	2	123	c.39G>A	c.(37-39)gaG>gaA	p.E13E		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	13								p.E13E(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						CACCACCTGAGTGTAGCACTG	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		17848	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1											92.0	88.0	89.0					1																	20517093		2203	4300	6503	20389680	SO:0001819	synonymous_variant	127733			AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.39G>A	1.37:g.20517093G>A		Somatic		Capture	Illumina GAIIx	4	20389680	Q5R386	Silent	SNP	ENST00000375099.3	37	CCDS205.1	SNP	36	WashU																																																																																				0.502	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007693.1	NM_152376		Silent
DNAH3	55567	genome.wustl.edu	37	16	20944760	20944760	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr16:20944760C>G	ENST00000261383.3	-	62	12066	c.12067G>C	c.(12067-12069)Gaa>Caa	p.E4023Q	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4023					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E4023Q(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CGGGCACCTTCTAAGAAGAGC	0.493																																																1	Substitution - Missense(1)	ovary(1)	16											112.0	112.0	112.0					16																	20944760		2201	4300	6501	20852261	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.12067G>C	16.37:g.20944760C>G	ENSP00000261383:p.Glu4023Gln	Somatic		Capture	Illumina GAIIx	4	20852261	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992615	0.93167	.	.	ENSG00000158486	ENST00000261383	T	0.12879	2.64	5.24	5.24	0.73138	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60657	-0.7220	10	0.72032	D	0.01	.	18.8244	0.92111	0.0:1.0:0.0:0.0	.	4023	Q8TD57	DYH3_HUMAN	Q	4023	ENSP00000261383:E4023Q	ENSP00000261383:E4023Q	E	-	1	0	DNAH3	20852261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.629000	0.83207	2.451000	0.82905	0.563000	0.77884	GAA		0.493	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
IFNA1	3439	genome.wustl.edu	37	9	21440948	21440948	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr9:21440948C>G	ENST00000276927.1	+	1	509	c.442C>G	c.(442-444)Cga>Gga	p.R148G		NM_024013.2	NP_076918.1	P01562	IFNA1_HUMAN	interferon, alpha 1	148					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)	p.R148G(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(2)	7				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GAAATACTTCCGAAGAATCAC	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											31.0	38.0	35.0					9																	21440948		2135	4234	6369	21430948	SO:0001583	missense	3439				CCDS6508.1	9p22	2010-12-10			ENSG00000197919	ENSG00000197919		"""Interferons"""	5417	protein-coding gene	gene with protein product	"""IFN-alpha 1b"", ""interferon alpha 1b"""	147660				1385305	Standard	NM_024013		Approved	IFNA@, IFL, IFN, IFN-ALPHA, IFNA13, IFN-alphaD	uc003zpd.2	P01562	OTTHUMG00000019673	ENST00000276927.1:c.442C>G	9.37:g.21440948C>G	ENSP00000276927:p.Arg148Gly	Somatic		Capture	Illumina GAIIx	4	21430948	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	ENST00000276927.1	37	CCDS6508.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117491	0.37339	.	.	ENSG00000197919	ENST00000276927	T	0.05649	3.41	3.12	1.2	0.21068	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.522676	0.20658	N	0.088072	T	0.07728	0.0194	L	0.31752	0.955	0.24151	N	0.995692	B	0.31009	0.303	B	0.44224	0.444	T	0.29427	-1.0012	10	0.87932	D	0	.	6.5509	0.22433	0.0:0.7352:0.0:0.2648	.	148	P01562	IFNA1_HUMAN	G	148	ENSP00000276927:R148G	ENSP00000276927:R148G	R	+	1	2	IFNA1	21430948	0.195000	0.23338	0.666000	0.29783	0.610000	0.37248	0.300000	0.19156	0.632000	0.30432	0.536000	0.68110	CGA		0.478	IFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051902.1	NM_024013		Missense_Mutation
PHEX	5251	genome.wustl.edu	37	X	22115157	22115157	+	Splice_Site	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chrX:22115157G>T	ENST00000379374.4	+	8	1498		c.e8+1		PHEX_ENST00000535894.1_Splice_Site|PHEX_ENST00000475778.1_Splice_Site|PHEX_ENST00000537599.1_Splice_Site|PHEX_ENST00000418858.3_5'Flank	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked						bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.?(2)		breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						GATTCCCCAGGTTGGTGAAAA	0.378																																																2	Unknown(2)	ovary(1)|lung(1)	X	GRCh37	CS971857	PHEX	S							124.0	105.0	111.0					X																	22115157		2203	4300	6503	22025078	SO:0001630	splice_region_variant	5251			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.933+1G>T	X.37:g.22115157G>T		Somatic		Capture	Illumina GAIIx	4	22025078	O00678|Q13646|Q2M325|Q93032|Q99827	Splice_Site_SNP	SNP	ENST00000379374.4	37	CCDS14204.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758454	0.69763	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0784	0.89435	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHEX	22025078	1.000000	0.71417	0.993000	0.49108	0.971000	0.66376	7.201000	0.77847	2.293000	0.77203	0.436000	0.28706	.		0.378	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	Intron	Splice_Site_SNP
SLFN12L	100506736	genome.wustl.edu	37	17	33806779	33806779	+	Silent	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr17:33806779C>T	ENST00000260908.7	-	2	567	c.450G>A	c.(448-450)acG>acA	p.T150T	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000449046.1_Silent_p.T181T|SLFN12L_ENST00000361112.4_Silent_p.T179T	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	150						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)	p.T181T(1)		breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						CTTTTGCAGACGTTACATCTC	0.428																																																1	Substitution - coding silent(1)	ovary(1)	17											63.0	51.0	55.0					17																	33806779		692	1591	2283	30830892	SO:0001819	synonymous_variant	342615			AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.450G>A	17.37:g.33806779C>T		Somatic		Capture	Illumina GAIIx	4	30830892	F5H6G3	Silent	SNP	ENST00000260908.7	37	CCDS56026.1	SNP	19	WashU																																																																																				0.428	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206		Silent
NBEA	26960	genome.wustl.edu	37	13	35735998	35735998	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr13:35735998C>T	ENST00000400445.3	+	23	4507	c.3973C>T	c.(3973-3975)Cgg>Tgg	p.R1325W	NBEA_ENST00000310336.4_Missense_Mutation_p.R1325W|NBEA_ENST00000540320.1_Missense_Mutation_p.R1325W|NBEA_ENST00000379939.2_Missense_Mutation_p.R1325W	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1325					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R1325W(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CCCAGGTCCACGGACTACAAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	13											98.0	96.0	97.0					13																	35735998		1956	4140	6096	34633998	SO:0001583	missense	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.3973C>T	13.37:g.35735998C>T	ENSP00000383295:p.Arg1325Trp	Somatic		Capture	Illumina GAIIx	4	34633998	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723729	0.68959	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.04	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.69940	0.3167	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.973	T	0.74206	-0.3740	10	0.87932	D	0	.	14.8784	0.70513	0.1449:0.8551:0.0:0.0	.	1325;1325	Q8NFP9;Q5T321	NBEA_HUMAN;.	W	1325	ENSP00000440951:R1325W;ENSP00000383295:R1325W;ENSP00000369271:R1325W;ENSP00000308534:R1325W	ENSP00000308534:R1325W	R	+	1	2	NBEA	34633998	1.000000	0.71417	0.041000	0.18516	0.484000	0.33280	4.793000	0.62474	1.213000	0.43380	0.591000	0.81541	CGG		0.453	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		Missense_Mutation
FAM47B	170062	genome.wustl.edu	37	X	34962306	34962306	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chrX:34962306C>G	ENST00000329357.5	+	1	1394	c.1358C>G	c.(1357-1359)tCt>tGt	p.S453C		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	453								p.S453C(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GTTTCTGACTCTCTTCAACGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	X											123.0	110.0	114.0					X																	34962306		2202	4300	6502	34872227	SO:0001583	missense	170062			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1358C>G	X.37:g.34962306C>G	ENSP00000328307:p.Ser453Cys	Somatic		Capture	Illumina GAIIx	4	34872227	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	c	6.320	0.427211	0.11987	.	.	ENSG00000189132	ENST00000329357	T	0.16457	2.34	0.789	-1.58	0.08479	.	.	.	.	.	T	0.31670	0.0804	M	0.78049	2.395	0.09310	N	1	D	0.76494	0.999	D	0.67382	0.951	T	0.29671	-1.0004	8	0.62326	D	0.03	.	.	.	.	.	453	Q8NA70	FA47B_HUMAN	C	453	ENSP00000328307:S453C	ENSP00000328307:S453C	S	+	2	0	FAM47B	34872227	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	-3.031000	0.00637	-1.926000	0.01061	-2.044000	0.00415	TCT		0.483	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		Missense_Mutation
TCP11	6954	genome.wustl.edu	37	6	35088057	35088057	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr6:35088057C>A	ENST00000512012.1	-	7	1150	c.994G>T	c.(994-996)Gtc>Ttc	p.V332F	TCP11_ENST00000444780.2_Missense_Mutation_p.V340F|TCP11_ENST00000311875.5_Missense_Mutation_p.V345F|TCP11_ENST00000418521.2_Missense_Mutation_p.V269F|TCP11_ENST00000373974.4_Missense_Mutation_p.V299F|TCP11_ENST00000244645.3_Missense_Mutation_p.V270F|TCP11_ENST00000412155.2_Missense_Mutation_p.V294F|TCP11_ENST00000373979.2_Missense_Mutation_p.V270F			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	332					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.V270I(1)|p.V270F(1)		breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GAGGCCATGACGGTTAACTGG	0.532																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	6											71.0	72.0	71.0					6																	35088057		2203	4300	6503	35196035	SO:0001583	missense	6954				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.994G>T	6.37:g.35088057C>A	ENSP00000425995:p.Val332Phe	Somatic		Capture	Illumina GAIIx	4	35196035	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	ENST00000512012.1	37		SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.88|10.88	1.475028|1.475028	0.26511|0.26511	.|.	.|.	ENSG00000124678|ENSG00000124678	ENST00000502480|ENST00000373979;ENST00000412155;ENST00000244645;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000486638	.|T;T;T;T;T;T;T;T;T	.|0.13089	.|2.62;2.62;2.62;2.62;2.62;2.62;2.62;2.62;2.62	5.03|5.03	-3.11|-3.11	0.05299|0.05299	.|.	.|0.711091	.|0.13681	.|N	.|0.370211	T|T	0.10078|0.10078	0.0247|0.0247	M|M	0.72894|0.72894	2.215|2.215	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P;B	.|0.45986	.|0.87;0.87;0.87;0.87;0.87;0.446	.|P;P;P;P;P;B	.|0.48454	.|0.578;0.578;0.578;0.578;0.45;0.385	T|T	0.07654|0.07654	-1.0761|-1.0761	5|10	.|0.49607	.|T	.|0.09	.|.	12.8627|12.8627	0.57922|0.57922	0.0:0.4997:0.0:0.5003|0.0:0.4997:0.0:0.5003	.|.	.|299;294;340;405;332;270	.|B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.|.;.;.;.;TCP11_HUMAN;.	L|F	139|270;294;270;345;340;299;269;332;191	.|ENSP00000363091:V270F;ENSP00000402816:V294F;ENSP00000244645:V270F;ENSP00000308708:V345F;ENSP00000404479:V340F;ENSP00000363085:V299F;ENSP00000415320:V269F;ENSP00000425995:V332F;ENSP00000421103:V191F	.|ENSP00000244645:V270F	R|V	-|-	2|1	0|0	TCP11|TCP11	35196035|35196035	0.008000|0.008000	0.16893|0.16893	0.778000|0.778000	0.31720|0.31720	0.098000|0.098000	0.18820|0.18820	-1.191000|-1.191000	0.03055|0.03055	-0.824000|-0.824000	0.04295|0.04295	-1.266000|-1.266000	0.01441|0.01441	CGT|GTC		0.532	TCP11-014	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000370354.1	NM_001093728		Missense_Mutation
XYLB	9942	genome.wustl.edu	37	3	38407184	38407184	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr3:38407184G>T	ENST00000207870.3	+	6	554	c.464G>T	c.(463-465)gGt>gTt	p.G155V	XYLB_ENST00000542835.1_Missense_Mutation_p.G18V	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	155					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)	p.G155V(1)		endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCTGTGGGTGGTGCTCAGGCT	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											35.0	34.0	34.0					3																	38407184		2203	4300	6503	38382188	SO:0001583	missense	9942			AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.464G>T	3.37:g.38407184G>T	ENSP00000207870:p.Gly155Val	Somatic		Capture	Illumina GAIIx	4	38382188	B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	ENST00000207870.3	37	CCDS2678.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	19.82	3.899106	0.72754	.	.	ENSG00000093217	ENST00000207870;ENST00000542835	T;T	0.49432	0.78;0.78	4.73	4.73	0.59995	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75095	0.3803	M	0.93016	3.37	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.72338	0.977;0.967	T	0.82390	-0.0481	10	0.87932	D	0	.	15.5831	0.76462	0.0:0.0:1.0:0.0	.	18;155	B4DDT2;O75191	.;XYLB_HUMAN	V	155;18	ENSP00000207870:G155V;ENSP00000443659:G18V	ENSP00000207870:G155V	G	+	2	0	XYLB	38382188	1.000000	0.71417	0.715000	0.30552	0.644000	0.38419	8.666000	0.91149	2.331000	0.79229	0.555000	0.69702	GGT		0.657	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108		Missense_Mutation
SGSM3	27352	genome.wustl.edu	37	22	40802177	40802177	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr22:40802177G>A	ENST00000248929.9	+	9	1099	c.910G>A	c.(910-912)Gag>Aag	p.E304K	SGSM3_ENST00000454798.2_Missense_Mutation_p.E237K	NM_015705.4	NP_056520.2			small G protein signaling modulator 3									p.E304K(1)		cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						GTTTTTCTACGAGGGCTCCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	22											84.0	73.0	77.0					22																	40802177		2203	4300	6503	39132123	SO:0001583	missense	27352			AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.910G>A	22.37:g.40802177G>A	ENSP00000248929:p.Glu304Lys	Somatic		Capture	Illumina GAIIx	4	39132123		Missense_Mutation	SNP	ENST00000248929.9	37	CCDS14002.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313007	0.81358	.	.	ENSG00000100359	ENST00000457767;ENST00000248929;ENST00000545416;ENST00000454798	T;T;T	0.14391	2.51;2.51;2.51	5.25	4.17	0.49024	Rab-GAP/TBC domain (4);	0.107661	0.64402	D	0.000006	T	0.31071	0.0785	M	0.88450	2.955	0.51482	D	0.999927	P;P;P;P;P	0.49185	0.746;0.535;0.903;0.92;0.92	B;B;P;P;P	0.48189	0.183;0.228;0.559;0.57;0.57	T	0.37009	-0.9724	10	0.72032	D	0.01	.	14.8355	0.70180	0.0:0.3278:0.6722:0.0	.	241;237;304;304;304	B4DVE3;B4DMS2;Q96HU1-2;B9A6J5;Q96HU1	.;.;.;.;SGSM3_HUMAN	K	237;304;247;237	ENSP00000399249:E237K;ENSP00000248929:E304K;ENSP00000390998:E237K	ENSP00000248929:E304K	E	+	1	0	SGSM3	39132123	0.984000	0.35163	1.000000	0.80357	0.787000	0.44495	2.012000	0.40932	2.636000	0.89361	0.313000	0.20887	GAG		0.622	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2	NM_015705		Missense_Mutation
KCNK16	83795	genome.wustl.edu	37	6	39282850	39282850	+	Silent	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr6:39282850G>C	ENST00000373229.5	-	6	871	c.858C>G	c.(856-858)ggC>ggG	p.G286G	KCNK16_ENST00000425054.2_3'UTR|KCNK16_ENST00000507712.1_Silent_p.G174G|KCNK17_ENST00000373231.4_5'Flank|KCNK17_ENST00000453413.2_5'Flank|KCNK16_ENST00000373227.4_Silent_p.G239G	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	286					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.G286G(1)		large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CTGCTGTAGAGCCTCTCCTGG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	6											146.0	135.0	139.0					6																	39282850		2203	4300	6503	39390828	SO:0001819	synonymous_variant	83795			AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.858C>G	6.37:g.39282850G>C		Somatic		Capture	Illumina GAIIx	4	39390828	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Silent	SNP	ENST00000373229.5	37	CCDS4843.1	SNP	34	WashU																																																																																				0.592	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115		Silent
UBA2	10054	genome.wustl.edu	37	19	34949673	34949673	+	Splice_Site	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:34949673G>T	ENST00000246548.4	+	13	1315		c.e13-1		UBA2_ENST00000592791.1_5'UTR|UBA2_ENST00000439527.2_Splice_Site	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2						cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)	p.?(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CTCCTCCAAAGATTTTTTTGA	0.388																																																1	Unknown(1)	ovary(1)	19											87.0	89.0	88.0					19																	34949673		2203	4300	6503	39641513	SO:0001630	splice_region_variant	10054			BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.1246-1G>T	19.37:g.34949673G>T		Somatic		Capture	Illumina GAIIx	4	39641513	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Splice_Site_SNP	SNP	ENST00000246548.4	37	CCDS12439.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.460474|4.460474	0.84317|0.84317	.|.	.|.	ENSG00000126261|ENSG00000126261	ENST00000246548;ENST00000439527|ENST00000542624	.|.	.|.	.|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74520	.|0.3727	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72827	.|-0.4175	.|4	.|.	.|.	.|.	.|.	18.2814|18.2814	0.90099|0.90099	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|Y	-1|289	.|.	.|.	.|D	+|+	.|1	.|0	UBA2|UBA2	39641513|39641513	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	9.333000|9.333000	0.96459|0.96459	2.661000|2.661000	0.90470|0.90470	0.650000|0.650000	0.86243|0.86243	.|GAT		0.388	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	Intron	Splice_Site_SNP
UBASH3A	53347	genome.wustl.edu	37	21	43867232	43867232	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr21:43867232C>G	ENST00000319294.6	+	15	1945	c.1914C>G	c.(1912-1914)aaC>aaG	p.N638K	UBASH3A_ENST00000291535.6_Missense_Mutation_p.N600K|UBASH3A_ENST00000398367.1_3'UTR	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	638	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.N638K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						AGTTGGTGAACCCACCGGTGA	0.478																																																1	Substitution - Missense(1)	ovary(1)	21											140.0	145.0	144.0					21																	43867232		2203	4300	6503	42740301	SO:0001583	missense	53347			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1914C>G	21.37:g.43867232C>G	ENSP00000317327:p.Asn638Lys	Somatic		Capture	Illumina GAIIx	4	42740301	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	ENST00000319294.6	37	CCDS13687.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	7.678	0.688408	0.14973	.	.	ENSG00000160185	ENST00000291535;ENST00000319294	T;T	0.07688	3.17;3.17	4.46	1.24	0.21308	.	0.913169	0.09331	N	0.816921	T	0.04861	0.0131	L	0.27053	0.805	0.38737	D	0.953792	P;P	0.39831	0.684;0.69	B;B	0.30943	0.122;0.057	T	0.49062	-0.8978	10	0.26408	T	0.33	-15.1292	6.6252	0.22826	0.0:0.5181:0.0:0.4819	.	600;638	P57075-2;P57075	.;UBS3A_HUMAN	K	600;638	ENSP00000291535:N600K;ENSP00000317327:N638K	ENSP00000291535:N600K	N	+	3	2	UBASH3A	42740301	0.951000	0.32395	0.072000	0.20136	0.308000	0.27856	0.455000	0.21843	0.374000	0.24650	0.563000	0.77884	AAC		0.478	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895		Missense_Mutation
MAST2	23139	genome.wustl.edu	37	1	46494576	46494576	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr1:46494576C>T	ENST00000361297.2	+	18	2472	c.2189C>T	c.(2188-2190)cCg>cTg	p.P730L	MAST2_ENST00000372009.2_Missense_Mutation_p.P660L	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.P730L(2)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGAGATACTCCGGAGGAGCTC	0.547																																																2	Substitution - Missense(2)	ovary(2)	1											182.0	182.0	182.0					1																	46494576		1977	4172	6149	46267163	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2189C>T	1.37:g.46494576C>T	ENSP00000354671:p.Pro730Leu	Somatic		Capture	Illumina GAIIx	4	46267163		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	28.4	4.913380	0.92178	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.64618	-0.11;-0.11;-0.11	4.24	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	N	0.16016	0.355	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;1.0;1.0	D;D;D;D	0.91635	0.992;0.913;0.999;0.986	T	0.74100	-0.3774	10	0.87932	D	0	-15.8602	16.9858	0.86339	0.0:1.0:0.0:0.0	.	660;404;660;730	Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;MAST2_HUMAN	L	730;660;404;615	ENSP00000354671:P730L;ENSP00000361079:P660L;ENSP00000361078:P615L	ENSP00000354671:P730L	P	+	2	0	MAST2	46267163	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.772000	0.85439	2.045000	0.60652	0.561000	0.74099	CCG		0.547	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112		Missense_Mutation
AKAP4	8852	genome.wustl.edu	37	X	49958492	49958492	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chrX:49958492T>G	ENST00000376056.2	-	5	995	c.845A>C	c.(844-846)gAg>gCg	p.E282A	AKAP4_ENST00000376064.3_Missense_Mutation_p.E282A|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.E291A					A kinase (PRKA) anchor protein 4									p.E291A(1)		NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CCTGGACTCCTCTCCAGTGCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	X											58.0	52.0	54.0					X																	49958492		2203	4300	6503	49845232	SO:0001583	missense	8852			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.845A>C	X.37:g.49958492T>G	ENSP00000365224:p.Glu282Ala	Somatic		Capture	Illumina GAIIx	4	49845232		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	2.007	-0.427964	0.04701	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.08193	3.12;3.12;3.12	4.88	3.56	0.40772	A-kinase anchor 110kDa, C-terminal (1);	0.309766	0.22625	N	0.057651	T	0.07143	0.0181	L	0.46157	1.445	0.21064	N	0.999794	P	0.38300	0.626	B	0.34489	0.184	T	0.27123	-1.0083	9	.	.	.	-19.366	7.3446	0.26656	0.2144:0.0:0.0:0.7856	.	291	Q5JQC9	AKAP4_HUMAN	A	282;291;282	ENSP00000365224:E282A;ENSP00000351327:E291A;ENSP00000365232:E282A	.	E	-	2	0	AKAP4	49845232	0.040000	0.19996	0.034000	0.17996	0.056000	0.15407	2.937000	0.48979	1.596000	0.50062	0.229000	0.17801	GAG		0.478	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886		Missense_Mutation
INTS6	26512	genome.wustl.edu	37	13	51943315	51943316	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-13-0807-01	TCGA-13-0807-10	CC	CC	CC	TT	CC	CC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr13:51943315_51943316CC>TT	ENST00000311234.4	-	16	2707_2708	c.2235_2236GG>AA	c.(2233-2238)ctGGaa>ctAAaa	p.E746K	INTS6_ENST00000463928.1_3'UTR|INTS6_ENST00000398119.2_Missense_Mutation_p.E733K|INTS6_ENST00000490542.1_Missense_Mutation_p.E430K|INTS6_ENST00000425000.1_Missense_Mutation_p.E314K|INTS6_ENST00000497989.1_Missense_Mutation_p.E568K	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	746					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		GTTGGCCGTTCCAGTAAACTGG	0.421																																																0			13																																								50841317	SO:0001583	missense	26512			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.2235_2236delinsTT	13.37:g.51943315_51943316delinsTT	ENSP00000310260:p.Glu746Lys	Somatic		Capture	Illumina GAIIx	4	50841316	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense	DNP	ENST00000311234.4	37	CCDS9428.1	DNP	30	WashU																																																																																				0.421	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141		Missense
ATF7	11016	genome.wustl.edu	37	12	53931309	53931309	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr12:53931309G>C	ENST00000548446.2	-	5	437	c.325C>G	c.(325-327)Ctg>Gtg	p.L109V	ATF7_ENST00000456903.4_Missense_Mutation_p.L98V|ATF7_ENST00000420353.2_Missense_Mutation_p.L98V|RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.L98V|ATF7_ENST00000328463.7_Missense_Mutation_p.L109V|ATF7_ENST00000415113.1_Missense_Mutation_p.L98V			P17544	ATF7_HUMAN	activating transcription factor 7	109	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.L109V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GTGGAAGGCAGAGACATGTCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	86.0	85.0					12																	53931309		1911	4133	6044	52217576	SO:0001583	missense	11016			X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.325C>G	12.37:g.53931309G>C	ENSP00000449938:p.Leu109Val	Somatic		Capture	Illumina GAIIx	4	52217576	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750493	0.49257	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.46451	0.9;0.9;0.89;0.87;0.87	4.99	4.07	0.47477	.	0.146323	0.47455	D	0.000230	T	0.29223	0.0727	L	0.40543	1.245	0.47737	D	0.999504	B;P;B	0.37955	0.206;0.612;0.215	B;B;B	0.32533	0.086;0.147;0.146	T	0.05402	-1.0887	10	0.15499	T	0.54	-26.2247	11.9464	0.52930	0.0896:0.0:0.9104:0.0	.	98;98;109	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	V	109;109;98;98;98;98	ENSP00000449938:L109V;ENSP00000329212:L109V;ENSP00000404880:L98V;ENSP00000399465:L98V;ENSP00000387406:L98V	ENSP00000304187:L98V	L	-	1	2	ATF7	52217576	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.256000	0.51492	1.416000	0.47057	0.650000	0.86243	CTG		0.473	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059		Missense_Mutation
OR5D14	219436	genome.wustl.edu	37	11	55563272	55563272	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:55563272C>A	ENST00000335605.1	+	1	241	c.241C>A	c.(241-243)Ccc>Acc	p.P81T		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P81T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CATTGTCACTCCCAAGCTGCT	0.403																																																1	Substitution - Missense(1)	ovary(1)	11											181.0	158.0	166.0					11																	55563272		2200	4296	6496	55319848	SO:0001583	missense	219436			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.241C>A	11.37:g.55563272C>A	ENSP00000334456:p.Pro81Thr	Somatic		Capture	Illumina GAIIx	4	55319848	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	37	CCDS31508.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	c	13.83	2.355042	0.41700	.	.	ENSG00000186113	ENST00000335605	T	0.01854	4.6	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000396	T	0.27832	0.0685	H	0.99475	4.585	0.41837	D	0.990105	D	0.67145	0.996	D	0.72625	0.978	T	0.59306	-0.7479	10	0.87932	D	0	-25.316	17.0729	0.86579	0.0:1.0:0.0:0.0	.	81	Q8NGL3	OR5DE_HUMAN	T	81	ENSP00000334456:P81T	ENSP00000334456:P81T	P	+	1	0	OR5D14	55319848	0.998000	0.40836	0.542000	0.28115	0.080000	0.17528	4.326000	0.59241	2.363000	0.80096	0.643000	0.83706	CCC		0.403	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735		Missense_Mutation
VN1R4	317703	genome.wustl.edu	37	19	53770598	53770598	+	Silent	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:53770598G>T	ENST00000311170.4	-	1	374	c.321C>A	c.(319-321)atC>atA	p.I107I	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	107					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.I107I(1)		central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		AGCTGACCGTGATCACCTGGA	0.507										HNSCC(26;0.072)																																						1	Substitution - coding silent(1)	ovary(1)	19											35.0	28.0	30.0					19																	53770598		2203	4300	6503	58462410	SO:0001819	synonymous_variant	317703			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.321C>A	19.37:g.53770598G>T		Somatic		Capture	Illumina GAIIx	4	58462410	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	ENST00000311170.4	37	CCDS33099.1	SNP	45	WashU																																																																																				0.507	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857		Silent
VN1R4	317703	genome.wustl.edu	37	19	53770850	53770850	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:53770850G>C	ENST00000311170.4	-	1	122	c.69C>G	c.(67-69)ttC>ttG	p.F23L	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	23					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.F23L(1)		central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GAAGAACAGAGAAGCTCCCCA	0.488										HNSCC(26;0.072)																																						1	Substitution - Missense(1)	ovary(1)	19											57.0	63.0	61.0					19																	53770850		2203	4300	6503	58462662	SO:0001583	missense	317703			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.69C>G	19.37:g.53770850G>C	ENSP00000310856:p.Phe23Leu	Somatic		Capture	Illumina GAIIx	4	58462662	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	37	CCDS33099.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	7.983	0.751645	0.15778	.	.	ENSG00000228567	ENST00000311170	T	0.31510	1.49	2.28	-3.19	0.05171	GPCR, rhodopsin-like superfamily (1);	1.476590	0.04844	N	0.440975	T	0.14614	0.0353	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.21151	0.033	T	0.23511	-1.0186	10	0.40728	T	0.16	.	4.5614	0.12161	0.2412:0.3446:0.4143:0.0	.	23	Q7Z5H5	VN1R4_HUMAN	L	23	ENSP00000310856:F23L	ENSP00000310856:F23L	F	-	3	2	VN1R4	58462662	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.267000	0.08619	-0.606000	0.05746	-0.281000	0.10026	TTC		0.488	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857		Missense_Mutation
DHRS7	51635	genome.wustl.edu	37	14	60616107	60616107	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr14:60616107C>T	ENST00000216500.5	-	7	1391	c.936G>A	c.(934-936)atG>atA	p.M312I	DHRS7_ENST00000536410.2_Missense_Mutation_p.M262I|PCNXL4_ENST00000553898.1_Intron|DHRS7_ENST00000557185.1_Missense_Mutation_p.M312I|PCNXL4_ENST00000406949.1_Intron|DHRS7_ENST00000553986.1_5'Flank			Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7	312						membrane (GO:0016020)	oxidoreductase activity (GO:0016491)	p.M312I(1)		endometrium(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.121)		TTTTCTTCCCCATCTTGTTGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	14											134.0	135.0	135.0					14																	60616107		2203	4300	6503	59685860	SO:0001583	missense	51635			AF151844	CCDS9743.1	14q23.1	2011-09-20			ENSG00000100612	ENSG00000100612		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	21524	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 4"", ""short chain dehydrogenase/reductase family 34C, member 1"""	612833				10800688, 10810093, 19027726	Standard	NM_016029		Approved	retDSR4, SDR34C1	uc001xes.3	Q9Y394	OTTHUMG00000140331	ENST00000216500.5:c.936G>A	14.37:g.60616107C>T	ENSP00000216500:p.Met312Ile	Somatic		Capture	Illumina GAIIx	4	59685860	B2R896|Q9UKU2	Nonsense_Mutation	SNP	ENST00000216500.5	37	CCDS9743.1	SNP	21	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.53|11.53	1.667460|1.667460	0.29604|0.29604	.|.	.|.	ENSG00000100612|ENSG00000100612	ENST00000216500;ENST00000557185;ENST00000536410|ENST00000360557;ENST00000554101	T;T;T|.	0.49139|.	0.79;0.79;0.79|.	5.7|5.7	-7.7|-7.7	0.01259|0.01259	NAD(P)-binding domain (1);|.	.|1.175050	.|0.06117	.|N	.|0.668160	T|.	0.07638|.	0.0192|.	N|N	0.01874|0.01874	-0.695|-0.695	0.18873|0.18873	N|N	0.999985|0.999985	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.20107|.	-1.0285|.	9|.	0.22109|0.22109	T|T	0.4|0.4	.|.	0.9025|0.9025	0.01277|0.01277	0.3595:0.2711:0.181:0.1884|0.3595:0.2711:0.181:0.1884	.|.	312|.	Q9Y394|.	DHRS7_HUMAN|.	I|X	312;312;262|311;307	ENSP00000216500:M312I;ENSP00000451882:M312I;ENSP00000442993:M262I|.	ENSP00000216500:M312I|ENSP00000353759:W311X	M|W	-|-	3|2	0|0	DHRS7|DHRS7	59685860|59685860	0.024000|0.024000	0.19004|0.19004	0.001000|0.001000	0.08648|0.08648	0.884000|0.884000	0.51177|0.51177	-0.827000|-0.827000	0.04424|0.04424	-0.930000|-0.930000	0.03752|0.03752	-0.345000|-0.345000	0.07892|0.07892	ATG|TGG		0.378	DHRS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276947.2	NM_016029		Nonsense_Mutation
CDH1	999	genome.wustl.edu	37	16	68842671	68842671	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr16:68842671G>A	ENST00000261769.5	+	5	798	c.607G>A	c.(607-609)Ggt>Agt	p.G203S	CDH1_ENST00000422392.2_Missense_Mutation_p.G203S|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	203	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACCCCCTGTTGGTGTCTTTAT	0.423			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	2	Unknown(2)	breast(2)	16											61.0	59.0	60.0					16																	68842671		2198	4300	6498	67400172	SO:0001583	missense	999	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.607G>A	16.37:g.68842671G>A	ENSP00000261769:p.Gly203Ser	Somatic		Capture	Illumina GAIIx	4	67400172	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	37	CCDS10869.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684083	0.29872	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.53857	0.6;0.6	5.78	4.82	0.62117	Cadherin (5);Cadherin-like (1);	0.000000	0.52532	D	0.000079	T	0.71375	0.3332	M	0.68952	2.095	0.30547	N	0.765899	D;D	0.89917	0.999;1.0	D;D	0.97110	0.989;1.0	T	0.74402	-0.3677	10	0.66056	D	0.02	.	16.9883	0.86346	0.0:0.1276:0.8724:0.0	.	203;203	Q9UII8;P12830	.;CADH1_HUMAN	S	203	ENSP00000261769:G203S;ENSP00000414946:G203S	ENSP00000261769:G203S	G	+	1	0	CDH1	67400172	1.000000	0.71417	0.971000	0.41717	0.503000	0.33858	3.881000	0.56152	1.583000	0.49898	0.655000	0.94253	GGT		0.423	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360		Missense_Mutation
SLC8A3	6547	genome.wustl.edu	37	14	70512826	70512826	+	Silent	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr14:70512826G>A	ENST00000381269.2	-	8	3375	c.2622C>T	c.(2620-2622)gtC>gtT	p.V874V	SLC8A3_ENST00000533541.1_3'UTR|SLC8A3_ENST00000216568.7_Silent_p.V245V|SLC8A3_ENST00000394330.2_Silent_p.V231V|SLC8A3_ENST00000357887.3_Silent_p.V872V|SLC8A3_ENST00000356921.2_Silent_p.V868V|SLC8A3_ENST00000528359.1_Silent_p.V872V|SLC8A3_ENST00000534137.1_Silent_p.V871V	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	874					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CGCTGATGCAGACAAATGCAA	0.632											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											46.0	44.0	44.0					14																	70512826		2203	4300	6503	69582579	SO:0001819	synonymous_variant	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2622C>T	14.37:g.70512826G>A		Somatic	1122	Capture	Illumina GAIIx	4	69582579	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1	SNP	33	WashU																																																																																				0.632	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1			Silent
BAI3	577	genome.wustl.edu	37	6	69772906	69772906	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr6:69772906T>C	ENST00000370598.1	+	16	3235	c.2414T>C	c.(2413-2415)aTa>aCa	p.I805T		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	805					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I805T(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTTCTGGAGATAGAACTAGCT	0.378																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	123.0	131.0					6																	69772906		2203	4300	6503	69829627	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2414T>C	6.37:g.69772906T>C	ENSP00000359630:p.Ile805Thr	Somatic		Capture	Illumina GAIIx	4	69829627	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	16.18	3.050575	0.55218	.	.	ENSG00000135298	ENST00000370598	T	0.09723	2.95	5.07	5.07	0.68467	Domain of unknown function DUF3497 (1);	0.000000	0.85682	D	0.000000	T	0.08802	0.0218	M	0.64404	1.975	0.80722	D	1	B	0.21381	0.055	B	0.29353	0.101	T	0.02751	-1.1115	10	0.72032	D	0.01	.	15.1156	0.72397	0.0:0.0:0.0:1.0	.	805	O60242	BAI3_HUMAN	T	805	ENSP00000359630:I805T	ENSP00000359630:I805T	I	+	2	0	BAI3	69829627	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.681000	0.74523	2.009000	0.58944	0.397000	0.26171	ATA		0.378	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			Missense_Mutation
DYSF	8291	genome.wustl.edu	37	2	71795139	71795139	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:71795139G>T	ENST00000258104.3	+	25	2847	c.2570G>T	c.(2569-2571)tGg>tTg	p.W857L	DYSF_ENST00000410041.1_Missense_Mutation_p.W875L|DYSF_ENST00000410020.3_Missense_Mutation_p.W875L|DYSF_ENST00000413539.2_Missense_Mutation_p.W888L|DYSF_ENST00000409762.1_Missense_Mutation_p.W874L|DYSF_ENST00000409366.1_Missense_Mutation_p.W858L|DYSF_ENST00000409744.1_Missense_Mutation_p.W844L|DYSF_ENST00000409651.1_Missense_Mutation_p.W889L|DYSF_ENST00000394120.2_Missense_Mutation_p.W858L|DYSF_ENST00000429174.2_Missense_Mutation_p.W857L|DYSF_ENST00000409582.3_Missense_Mutation_p.W874L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	857					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.W857L(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GTCAAGCTGTGGTTTGGGCTC	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											162.0	149.0	154.0					2																	71795139		2203	4300	6503	71648647	SO:0001583	missense	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2570G>T	2.37:g.71795139G>T	ENSP00000258104:p.Trp857Leu	Somatic		Capture	Illumina GAIIx	4	71648647	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	23.1	4.380946	0.82792	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	4.97	4.09	0.47781	Ferlin B-domain (1);	0.147984	0.52532	D	0.000069	D	0.90631	0.7062	M	0.91140	3.18	0.50467	D	0.999875	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999;0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;0.985;0.985;0.985;0.99;0.999;0.985;1.0;0.999;0.999;0.999	D	0.91420	0.5158	10	0.87932	D	0	-11.6246	10.8726	0.46891	0.0923:0.0:0.9077:0.0	.	889;875;858;844;875;844;874;843;888;874;857;843;858;857	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	L	888;874;874;857;857;889;858;844;858;875;875	ENSP00000407046:W888L;ENSP00000387137:W874L;ENSP00000386547:W874L;ENSP00000398305:W857L;ENSP00000258104:W857L;ENSP00000386683:W889L;ENSP00000377678:W858L;ENSP00000386285:W844L;ENSP00000386512:W858L;ENSP00000386881:W875L;ENSP00000386617:W875L	ENSP00000258104:W857L	W	+	2	0	DYSF	71648647	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	9.869000	0.99810	1.090000	0.41315	0.549000	0.68633	TGG		0.572	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		Missense_Mutation
ANKRD17	26057	genome.wustl.edu	37	4	73951027	73951027	+	Silent	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr4:73951027G>A	ENST00000358602.4	-	30	7214	c.7098C>T	c.(7096-7098)aaC>aaT	p.N2366N	ANKRD17_ENST00000330838.6_Silent_p.N2115N|ANKRD17_ENST00000509867.2_Silent_p.N2253N	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2366					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.N2366N(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTCTGTTAAAGTTAGCAGCTG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	4											177.0	188.0	185.0					4																	73951027		2203	4300	6503	74169891	SO:0001819	synonymous_variant	26057			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.7098C>T	4.37:g.73951027G>A		Somatic		Capture	Illumina GAIIx	4	74169891	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Silent	SNP	ENST00000358602.4	37	CCDS34004.1	SNP	36	WashU																																																																																				0.448	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217		Silent
SALL3	27164	genome.wustl.edu	37	18	76757179	76757179	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr18:76757179G>T	ENST00000537592.2	+	3	3760	c.3760G>T	c.(3760-3762)Ggc>Tgc	p.G1254C	SALL3_ENST00000536229.3_Missense_Mutation_p.G1049C|SALL3_ENST00000575389.2_Missense_Mutation_p.G1182C	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1254					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1254C(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCCCCTCTGGGCAGCATGGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	18											100.0	100.0	100.0					18																	76757179		2203	4300	6503	74858167	SO:0001583	missense	27164			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3760G>T	18.37:g.76757179G>T	ENSP00000441823:p.Gly1254Cys	Somatic		Capture	Illumina GAIIx	4	74858167	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	4.202	0.036295	0.08148	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.46451	0.87	5.32	4.25	0.50352	.	0.206709	0.33438	N	0.004920	T	0.54967	0.1891	M	0.67953	2.075	0.51233	D	0.999913	D;D	0.76494	0.997;0.999	P;P	0.60789	0.855;0.879	T	0.56486	-0.7971	10	0.56958	D	0.05	-43.4166	9.5978	0.39584	0.1621:0.0:0.8378:0.0	.	914;1254	F5GXY4;Q9BXA9	.;SALL3_HUMAN	C	1254;1182;914	ENSP00000441823:G1254C	ENSP00000299466:G1254C	G	+	1	0	SALL3	74858167	1.000000	0.71417	0.855000	0.33649	0.022000	0.10575	3.124000	0.50461	2.490000	0.84030	0.561000	0.74099	GGC		0.627	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999		Missense_Mutation
NFATC1	4772	genome.wustl.edu	37	18	77227620	77227620	+	Intron	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr18:77227620G>A	ENST00000427363.2	+	8	2092				NFATC1_ENST00000545796.1_Intron|NFATC1_ENST00000253506.5_Intron|NFATC1_ENST00000318065.5_Intron|NFATC1_ENST00000592223.1_Silent_p.E697E|NFATC1_ENST00000397790.2_Intron|NFATC1_ENST00000542384.1_Intron|NFATC1_ENST00000586434.1_Intron|NFATC1_ENST00000591814.1_Silent_p.E710E|NFATC1_ENST00000587635.1_3'UTR|NFATC1_ENST00000329101.4_Intron			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1						calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	GTGAACATGAGCGCGTGGGGT	0.532																																					GBM(151;1210 2593 28719 45011)											0			18											83.0	70.0	74.0					18																	77227620		2202	4300	6502	75328608	SO:0001627	intron_variant	4772			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.2092+38G>A	18.37:g.77227620G>A		Somatic		Capture	Illumina GAIIx	4	75328608	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Silent	SNP	ENST00000427363.2	37		SNP	34	WashU																																																																																				0.532	NFATC1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000450507.1	NM_172390		Silent
BRWD3	254065	genome.wustl.edu	37	X	79936995	79936995	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chrX:79936995G>C	ENST00000373275.4	-	40	4715	c.4499C>G	c.(4498-4500)tCa>tGa	p.S1500*	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1500					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.S1500*(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AGCAGCATCTGAAACTTACAT	0.348																																																1	Substitution - Nonsense(1)	ovary(1)	X											54.0	49.0	51.0					X																	79936995		2203	4300	6503	79823651	SO:0001587	stop_gained	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4499C>G	X.37:g.79936995G>C	ENSP00000362372:p.Ser1500*	Somatic		Capture	Illumina GAIIx	4	79823651	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Nonsense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	45	11.357013	0.99551	.	.	ENSG00000165288	ENST00000373275	.	.	.	4.3	4.3	0.51218	.	0.375142	0.24659	N	0.036651	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.95	14.4228	0.67196	0.0:0.0:1.0:0.0	.	.	.	.	X	1500	.	.	S	-	2	0	BRWD3	79823651	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.056000	0.71111	2.095000	0.63458	0.415000	0.27848	TCA		0.348	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252		Nonsense_Mutation
ALPK3	57538	genome.wustl.edu	37	15	85383903	85383903	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0807-01	TCGA-13-0807-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr15:85383903C>A	ENST00000258888.5	+	5	2166	c.1999C>A	c.(1999-2001)Cag>Aag	p.Q667K		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	667					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CGCTCCTGGCCAGCCCACACA	0.647																																																0			15											37.0	37.0	37.0					15																	85383903		2203	4299	6502	83184907	SO:0001583	missense	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1999C>A	15.37:g.85383903C>A	ENSP00000258888:p.Gln667Lys	Somatic		Capture	Illumina GAIIx	4	83184907	Q9P2L6	Missense_Mutation	SNP	ENST00000258888.5	37	CCDS10333.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975456	0.74360	.	.	ENSG00000136383	ENST00000258888	T	0.63417	-0.04	4.71	4.71	0.59529	.	1.862350	0.01985	N	0.045081	T	0.67439	0.2893	L	0.34521	1.04	0.26606	N	0.972927	D	0.55172	0.97	P	0.51833	0.681	T	0.60000	-0.7348	10	0.59425	D	0.04	-10.0608	13.0449	0.58920	0.0:1.0:0.0:0.0	.	667	Q96L96	ALPK3_HUMAN	K	667	ENSP00000258888:Q667K	ENSP00000258888:Q667K	Q	+	1	0	ALPK3	83184907	0.914000	0.31030	0.712000	0.30502	0.111000	0.19643	1.436000	0.34980	2.444000	0.82710	0.557000	0.71058	CAG		0.647	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778		Missense_Mutation
FOLH1B	219595	genome.wustl.edu	37	11	89413790	89413790	+	RNA	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:89413790G>A	ENST00000532352.1	+	0	1275							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.L154L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						ACTACACTCTGAGAGTTGATT	0.299																																																1	Substitution - coding silent(1)	ovary(1)	11											38.0	38.0	38.0					11																	89413790		2201	4292	6493	89053438			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89413790G>A		Somatic		Capture	Illumina GAIIx	4	89053438		Silent	SNP	ENST00000532352.1	37		SNP	45	WashU																																																																																				0.299	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		Silent
IGKV2D-29	28882	genome.wustl.edu	37	2	89987025	89987025	+	RNA	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:89987025G>C	ENST00000491977.1	+	0	336									immunoglobulin kappa variable 2D-29																		AAATCAGCCGGGTGGAGGCTG	0.517																																																0			2											56.0	61.0	59.0					2																	89987025		1868	4093	5961	89624330						M31952		2p11.2	2012-02-08			ENSG00000243264	ENSG00000243264		"""Immunoglobulins / IGK locus"""	5800	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151619		2.37:g.89987025G>C		Somatic		Capture	Illumina GAIIx	4	89624330		Silent	SNP	ENST00000491977.1	37		SNP	43	WashU																																																																																				0.517	IGKV2D-29-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000323291.1	NG_000833		Silent
GPR98	84059	genome.wustl.edu	37	5	89988572	89988572	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0807-01	TCGA-13-0807-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr5:89988572A>G	ENST00000405460.2	+	32	7198	c.7102A>G	c.(7102-7104)Agt>Ggt	p.S2368G		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2368					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S2368G(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCTGGAAAGAAGTTCCTGTGC	0.438																																																1	Substitution - Missense(1)	ovary(1)	5											84.0	83.0	83.0					5																	89988572		1890	4104	5994	90024328	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7102A>G	5.37:g.89988572A>G	ENSP00000384582:p.Ser2368Gly	Somatic		Capture	Illumina GAIIx	4	90024328	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	14.01	2.409121	0.42715	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.26223	1.75	5.95	4.77	0.60923	.	0.211714	0.64402	D	0.000020	T	0.22244	0.0536	L	0.38175	1.15	0.80722	D	1	D	0.54772	0.968	B	0.42062	0.374	T	0.01182	-1.1426	10	0.44086	T	0.13	.	13.529	0.61611	0.8702:0.1298:0.0:0.0	.	2368	Q8WXG9	GPR98_HUMAN	G	2368	ENSP00000384582:S2368G	ENSP00000296619:S2368G	S	+	1	0	GPR98	90024328	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.684000	0.61686	1.042000	0.40150	0.533000	0.62120	AGT		0.438	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Missense_Mutation
CLDN10	9071	genome.wustl.edu	37	13	96086272	96086272	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr13:96086272G>T	ENST00000376873.3	+	1	415	c.185G>T	c.(184-186)cGa>cTa	p.R62L		NM_001160100.1|NM_182848.3	NP_001153572.1|NP_878268.1	P78369	CLD10_HUMAN	claudin 10	64					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.R62L(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TTCCATTGCCGACCGCATTTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	13											109.0	105.0	107.0					13																	96086272		2203	4300	6503	94884273	SO:0001583	missense	9071			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000376873.3:c.185G>T	13.37:g.96086272G>T	ENSP00000366069:p.Arg62Leu	Somatic		Capture	Illumina GAIIx	4	94884273	Q6IBF9|Q96N78	Missense_Mutation	SNP	ENST00000376873.3	37	CCDS9475.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810408	0.90707	.	.	ENSG00000134873	ENST00000376873	D	0.88201	-2.35	5.24	5.24	0.73138	.	.	.	.	.	D	0.92479	0.7612	.	.	.	0.80722	D	1	P	0.51147	0.942	P	0.53593	0.73	D	0.93352	0.6719	8	0.87932	D	0	.	17.3606	0.87349	0.0:0.0:1.0:0.0	.	62	Q96N78	.	L	62	ENSP00000366069:R62L	ENSP00000366069:R62L	R	+	2	0	CLDN10	94884273	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	9.282000	0.95840	2.602000	0.87976	0.563000	0.77884	CGA		0.488	CLDN10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045483.3	NM_006984		Missense_Mutation
PROM2	150696	genome.wustl.edu	37	2	95940495	95940495	+	Silent	SNP	T	T	G			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:95940495T>G	ENST00000317620.9	+	1	295	c.162T>G	c.(160-162)gtT>gtG	p.V54V	PROM2_ENST00000317668.4_Silent_p.V54V|PROM2_ENST00000542147.1_Silent_p.V54V|PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000403131.2_Silent_p.V54V	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	54					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.V54V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CCCCTCGAGTTCGTGCGCCAG	0.662																																																1	Substitution - coding silent(1)	ovary(1)	2											73.0	84.0	80.0					2																	95940495		2203	4300	6503	95304222	SO:0001819	synonymous_variant	150696			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.162T>G	2.37:g.95940495T>G		Somatic		Capture	Illumina GAIIx	4	95304222	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	ENST00000317620.9	37	CCDS2012.1	SNP	62	WashU																																																																																				0.662	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707		Silent
PTCH1	5727	genome.wustl.edu	37	9	98239912	98239912	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr9:98239912C>T	ENST00000331920.6	-	10	1719	c.1420G>A	c.(1420-1422)Gtc>Atc	p.V474I	PTCH1_ENST00000429896.2_Missense_Mutation_p.V323I|PTCH1_ENST00000421141.1_Missense_Mutation_p.V323I|PTCH1_ENST00000548379.1_5'Flank|PTCH1_ENST00000375274.2_Missense_Mutation_p.V473I|PTCH1_ENST00000430669.2_Missense_Mutation_p.V408I|PTCH1_ENST00000437951.1_Missense_Mutation_p.V408I|PTCH1_ENST00000418258.1_Missense_Mutation_p.V323I	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	474	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.V474I(2)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				ACCAGCAGGACGCCAGCCAGC	0.572																																																2	Substitution - Missense(2)	ovary(2)	9	GRCh37	CI054492	PTCH1	I							41.0	42.0	42.0					9																	98239912		2203	4300	6503	97279733	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1420G>A	9.37:g.98239912C>T	ENSP00000332353:p.Val474Ile	Somatic		Capture	Illumina GAIIx	4	97279733	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.476877	0.96291	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81;-3.81;-3.81;-3.81	5.06	5.06	0.68205	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.96685	0.8918	L	0.52364	1.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.997;0.994	D	0.95315	0.8415	10	0.27082	T	0.32	-35.802	18.6256	0.91336	0.0:1.0:0.0:0.0	.	408;473;474	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	I	474;408;323;323;408;323;473	ENSP00000332353:V474I;ENSP00000389744:V408I;ENSP00000399981:V323I;ENSP00000396135:V323I;ENSP00000410287:V408I;ENSP00000414823:V323I;ENSP00000364423:V473I	ENSP00000332353:V474I	V	-	1	0	PTCH1	97279733	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.619000	0.88677	0.655000	0.94253	GTC		0.572	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		Missense_Mutation
RIMS2	9699	genome.wustl.edu	37	8	104955050	104955050	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0807-01	TCGA-13-0807-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr8:104955050A>C	ENST00000436393.2	+	12	2172	c.1931A>C	c.(1930-1932)tAc>tCc	p.Y644S	RIMS2_ENST00000262231.10_Missense_Mutation_p.Y705S|RIMS2_ENST00000507740.1_Missense_Mutation_p.Y658S|RIMS2_ENST00000406091.3_Missense_Mutation_p.Y866S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	928					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.Y644S(1)|p.Y658S(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCACATTGGTACAAACTTCAG	0.408										HNSCC(12;0.0054)																																						2	Substitution - Missense(2)	ovary(2)	8											78.0	73.0	74.0					8																	104955050		1890	4119	6009	105024226	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1931A>C	8.37:g.104955050A>C	ENSP00000390665:p.Tyr644Ser	Somatic		Capture	Illumina GAIIx	4	105024226	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662702	0.88251	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.17	5.17	0.71159	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	D	0.87509	0.6195	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	0.975;0.995;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.933;0.985;0.999;0.994;0.999;0.998	D	0.89149	0.3522	9	0.87932	D	0	.	15.3133	0.74053	1.0:0.0:0.0:0.0	.	928;928;644;705;658;866	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	S	866;881;866;928;658;705;658;658;644	ENSP00000427018:Y866S;ENSP00000384892:Y866S;ENSP00000425205:Y658S;ENSP00000262231:Y705S;ENSP00000423559:Y658S;ENSP00000386228:Y658S;ENSP00000390665:Y644S	ENSP00000262231:Y705S	Y	+	2	0	RIMS2	105024226	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.229000	0.95273	2.064000	0.61679	0.482000	0.46254	TAC		0.408	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		Missense_Mutation
EIF3E	3646	genome.wustl.edu	37	8	109241314	109241314	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr8:109241314C>G	ENST00000220849.5	-	6	644	c.582G>C	c.(580-582)gaG>gaC	p.E194D	EIF3E_ENST00000519030.1_Missense_Mutation_p.E101D|EIF3E_ENST00000519517.1_5'UTR|RP11-35G22.1_ENST00000520037.1_RNA	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E									p.E194D(1)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TATCTATGGTCTCTTTTAACC	0.383																																					GBM(15;360 410 8460 34179 52246)											1	Substitution - Missense(1)	ovary(1)	8											138.0	132.0	134.0					8																	109241314		2203	4300	6503	109310490	SO:0001583	missense	3646			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.582G>C	8.37:g.109241314C>G	ENSP00000220849:p.Glu194Asp	Somatic		Capture	Illumina GAIIx	4	109310490		Missense_Mutation	SNP	ENST00000220849.5	37	CCDS6308.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.082|9.082	0.999461|0.999461	0.19121|0.19121	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000522352|ENST00000220849;ENST00000519030;ENST00000519627	.|T;T;T	.|0.47177	.|0.85;0.85;0.85	5.48|5.48	3.66|3.66	0.41972|0.41972	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.30759|0.30759	0.0775|0.0775	L|L	0.28014|0.28014	0.82|0.82	0.53005|0.53005	D|D	0.999966|0.999966	.|B;B	.|0.19935	.|0.009;0.04	.|B;B	.|0.20955	.|0.003;0.032	T|T	0.05784|0.05784	-1.0864|-1.0864	5|10	.|0.16896	.|T	.|0.51	-19.8834|-19.8834	8.9435|8.9435	0.35745|0.35745	0.0:0.7133:0.0:0.2867|0.0:0.7133:0.0:0.2867	.|.	.|194;194	.|B2R806;P60228	.|.;EIF3E_HUMAN	H|D	18|194;101;67	.|ENSP00000220849:E194D;ENSP00000428796:E101D;ENSP00000430839:E67D	.|ENSP00000220849:E194D	D|E	-|-	1|3	0|2	EIF3E|EIF3E	109310490|109310490	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	1.272000|1.272000	0.33109|0.33109	0.773000|0.773000	0.33404|0.33404	-0.237000|-0.237000	0.12165|0.12165	GAC|GAG		0.383	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568		Missense_Mutation
C9orf84	158401	genome.wustl.edu	37	9	114476800	114476800	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr9:114476800C>A	ENST00000318737.4	-	15	2276	c.2148G>T	c.(2146-2148)aaG>aaT	p.K716N	C9orf84_ENST00000394779.3_Missense_Mutation_p.K677N|C9orf84_ENST00000394777.4_Missense_Mutation_p.K642N|C9orf84_ENST00000374287.3_Missense_Mutation_p.K716N	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	716								p.K677N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGGTTTCAGGCTTTTTCCCCC	0.383																																																1	Substitution - Missense(1)	ovary(1)	9											163.0	152.0	156.0					9																	114476800		2203	4300	6503	113516621	SO:0001583	missense	158401			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.2148G>T	9.37:g.114476800C>A	ENSP00000322108:p.Lys716Asn	Somatic		Capture	Illumina GAIIx	4	113516621	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	37	CCDS6781.3	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806894	0.31961	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000394778;ENST00000374287;ENST00000318737	T;T;T;T	0.05513	3.43;3.48;3.44;3.44	5.87	-0.684	0.11331	.	1.099650	0.06835	N	0.794716	T	0.03136	0.0092	N	0.08118	0	0.26192	N	0.979577	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.11329	0.006;0.006;0.006	T	0.44847	-0.9301	10	0.44086	T	0.13	0.5217	2.0751	0.03623	0.4487:0.2616:0.0975:0.1922	.	642;716;677	A6PVK7;Q5VXU9;A2A2V3	.;CI084_HUMAN;.	N	677;642;330;716;716	ENSP00000378259:K677N;ENSP00000378257:K642N;ENSP00000363405:K716N;ENSP00000322108:K716N	ENSP00000322108:K716N	K	-	3	2	C9orf84	113516621	0.997000	0.39634	0.608000	0.28969	0.963000	0.63663	0.301000	0.19174	-0.421000	0.07416	0.655000	0.94253	AAG		0.383	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521		Missense_Mutation
LRCH2	57631	genome.wustl.edu	37	X	114347848	114347848	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chrX:114347848T>A	ENST00000317135.8	-	21	2259	c.2229A>T	c.(2227-2229)aaA>aaT	p.K743N	LRCH2_ENST00000538422.1_Missense_Mutation_p.K726N	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	743	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.							p.K743N(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						TGACACCAACTTTCACAAGTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	57.0	59.0					X																	114347848		1839	4075	5914	114254104	SO:0001583	missense	57631			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.2229A>T	X.37:g.114347848T>A	ENSP00000325091:p.Lys743Asn	Somatic		Capture	Illumina GAIIx	4	114254104	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	ENST00000317135.8	37	CCDS48155.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	15.89	2.967075	0.53507	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	D;D	0.94613	-3.47;-3.47	5.15	5.15	0.70609	Calponin homology domain (5);	.	.	.	.	D	0.95579	0.8563	L	0.53780	1.695	0.48452	D	0.999656	D;P	0.76494	0.999;0.533	D;B	0.85130	0.997;0.293	D	0.95149	0.8271	9	0.62326	D	0.03	-10.6341	8.3158	0.32100	0.0:0.0951:0.0:0.9049	.	743;726	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	N	743;222;726	ENSP00000325091:K743N;ENSP00000439366:K726N	ENSP00000325091:K743N	K	-	3	2	LRCH2	114254104	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.849000	0.48286	1.703000	0.51240	0.430000	0.28490	AAA		0.343	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057971.2	NM_020871		Missense_Mutation
OR10G7	390265	genome.wustl.edu	37	11	123909674	123909674	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0807-01	TCGA-13-0807-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:123909674A>T	ENST00000330487.5	-	1	43	c.35T>A	c.(34-36)cTc>cAc	p.L12H		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L12H(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AAGGCCCGTGAGGATGAACGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											100.0	90.0	93.0					11																	123909674		2200	4299	6499	123414884	SO:0001583	missense	390265			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.35T>A	11.37:g.123909674A>T	ENSP00000329689:p.Leu12His	Somatic		Capture	Illumina GAIIx	4	123414884	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174487	0.57692	.	.	ENSG00000182634	ENST00000330487	T	0.00563	6.58	3.38	3.38	0.38709	.	0.000000	0.44097	D	0.000486	T	0.04092	0.0114	H	0.98936	4.375	0.33793	D	0.625666	D	0.64830	0.994	D	0.66602	0.945	T	0.04041	-1.0982	10	0.87932	D	0	.	10.492	0.44756	1.0:0.0:0.0:0.0	.	12	Q8NGN6	O10G7_HUMAN	H	12	ENSP00000329689:L12H	ENSP00000329689:L12H	L	-	2	0	OR10G7	123414884	1.000000	0.71417	0.791000	0.31998	0.054000	0.15201	8.055000	0.89453	1.538000	0.49270	0.455000	0.32223	CTC		0.542	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463		Missense_Mutation
OR8B8	26493	genome.wustl.edu	37	11	124310489	124310489	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:124310489C>G	ENST00000328064.2	-	1	565	c.493G>C	c.(493-495)Ggt>Cgt	p.G165R		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	165					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G165R(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AAGGTCACACCCATCATGCAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											147.0	122.0	130.0					11																	124310489		2201	4299	6500	123815699	SO:0001583	missense	26493			AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.493G>C	11.37:g.124310489C>G	ENSP00000330280:p.Gly165Arg	Somatic		Capture	Illumina GAIIx	4	123815699	A1L446|Q96RC8	Missense_Mutation	SNP	ENST00000328064.2	37	CCDS8446.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.012414	0.00042	.	.	ENSG00000197125	ENST00000328064	T	0.00032	8.88	3.52	2.41	0.29592	GPCR, rhodopsin-like superfamily (1);	0.647619	0.14163	N	0.337224	T	0.00039	0.0001	N	0.00058	-2.35	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42865	-0.9426	10	0.02654	T	1	.	2.8541	0.05566	0.2795:0.1253:0.0:0.5952	.	165	Q15620	OR8B8_HUMAN	R	165	ENSP00000330280:G165R	ENSP00000330280:G165R	G	-	1	0	OR8B8	123815699	0.000000	0.05858	0.015000	0.15790	0.244000	0.25665	-1.110000	0.03306	0.725000	0.32318	-0.484000	0.04775	GGT		0.517	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387056.1	NM_012378		Missense_Mutation
CDON	50937	genome.wustl.edu	37	11	125873858	125873858	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr11:125873858C>A	ENST00000392693.3	-	10	2092	c.1965G>T	c.(1963-1965)atG>atT	p.M655I	CDON_ENST00000531738.1_Missense_Mutation_p.M32I|CDON_ENST00000263577.7_Missense_Mutation_p.M655I	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	655	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M655I(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTCTTGCTACCATCAAGACTT	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											94.0	80.0	85.0					11																	125873858		2201	4299	6500	125379068	SO:0001583	missense	50937			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1965G>T	11.37:g.125873858C>A	ENSP00000376458:p.Met655Ile	Somatic		Capture	Illumina GAIIx	4	125379068	O14631	Missense_Mutation	SNP	ENST00000392693.3	37	CCDS58192.1	SNP	21	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.940900|4.940900	0.92526|0.92526	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000534661|ENST00000392693;ENST00000531738;ENST00000263577	.|T;T;T	.|0.50548	.|0.74;3.87;0.74	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Fibronectin, type III (4);	.|0.000000	.|0.64402	.|D	.|0.000007	T|T	0.65760|0.65760	0.2722|0.2722	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.76494	.|0.999;0.999;0.94	.|D;D;P	.|0.87578	.|0.998;0.997;0.833	T|T	0.65080|0.65080	-0.6255|-0.6255	5|10	.|0.72032	.|D	.|0.01	-31.8085|-31.8085	20.3409|20.3409	0.98764|0.98764	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|655;655;32	.|Q4KMG0;Q4KMG0-2;E9PN78	.|CDON_HUMAN;.;.	C|I	631|655;32;655	.|ENSP00000376458:M655I;ENSP00000432901:M32I;ENSP00000263577:M655I	.|ENSP00000263577:M655I	G|M	-|-	1|3	0|0	CDON|CDON	125379068|125379068	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.901000|0.901000	0.52897|0.52897	7.440000|7.440000	0.80464|0.80464	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GGT|ATG		0.532	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952		Missense_Mutation
PTPN18	26469	genome.wustl.edu	37	2	131128838	131128838	+	Missense_Mutation	SNP	C	C	T	rs375251896		TCGA-13-0807-01	TCGA-13-0807-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:131128838C>T	ENST00000175756.5	+	12	1092	c.991C>T	c.(991-993)Cgc>Tgc	p.R331C	PTPN18_ENST00000347849.3_Missense_Mutation_p.R224C	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	331					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.R331C(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					CGCCATACCCCGCCCACCAGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	2						C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	59.0	59.0	59.0		670,991	1.0	0.0	2		59	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PTPN18	NM_001142370.1,NM_014369.3	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	224/354,331/461	131128838	1,13005	2203	4300	6503	130845308	SO:0001583	missense	26469			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.991C>T	2.37:g.131128838C>T	ENSP00000175756:p.Arg331Cys	Somatic		Capture	Illumina GAIIx	4	130845308	B4E1E6|Q53P42	Missense_Mutation	SNP	ENST00000175756.5	37	CCDS2161.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617597	0.28801	0.0	1.16E-4	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	T;T	0.12361	3.44;2.69	4.05	1.04	0.20106	.	0.627186	0.13346	N	0.394799	T	0.12561	0.0305	L	0.51422	1.61	0.18873	N	0.999984	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.01281	0.0;0.0;0.0	T	0.22730	-1.0208	10	0.62326	D	0.03	.	7.1204	0.25442	0.1874:0.4485:0.3641:0.0	.	310;331;224	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	C	331;224;310	ENSP00000175756:R331C;ENSP00000310092:R224C	ENSP00000175756:R331C	R	+	1	0	PTPN18	130845308	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	-0.055000	0.11807	0.210000	0.20664	0.591000	0.81541	CGC		0.597	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2			Missense_Mutation
ACTR3C	653857	genome.wustl.edu	37	7	149983504	149983504	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr7:149983504G>T	ENST00000539352.1	-	5	674	c.423C>A	c.(421-423)gaC>gaA	p.D141E	ACTR3C_ENST00000252071.4_Missense_Mutation_p.D141E	NM_001164458.1	NP_001157930.1	Q9C0K3	ARP3C_HUMAN	ARP3 actin-related protein 3 homolog C (yeast)	141						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.D141E(1)									CGTAACCAACGTCTATAACAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	100.0	95.0					7																	149983504		692	1590	2282	149614437	SO:0001583	missense					CCDS47744.1	7q36.1	2009-09-23			ENSG00000106526	ENSG00000106526			37282	protein-coding gene	gene with protein product						11162478, 14651955	Standard	NM_001164458		Approved	ARP11	uc022aps.1	Q9C0K3	OTTHUMG00000158323	ENST00000539352.1:c.423C>A	7.37:g.149983504G>T	ENSP00000440990:p.Asp141Glu	Somatic		Capture	Illumina GAIIx	4	149614437	Q5CZI4	Missense_Mutation	SNP	ENST00000539352.1	37	CCDS47744.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	8.720	0.914048	0.17907	.	.	ENSG00000106526	ENST00000478393;ENST00000252071;ENST00000539352	T;T;T	0.07800	3.16;3.16;3.16	2.3	-1.46	0.08800	.	0.000000	0.64402	D	0.000002	T	0.08179	0.0204	L	0.58510	1.815	0.24732	N	0.993082	B	0.23540	0.087	B	0.28991	0.097	T	0.30563	-0.9974	9	.	.	.	.	7.1633	0.25677	0.4134:0.0:0.5866:0.0	.	141	Q9C0K3	ARP3C_HUMAN	E	139;141;141	ENSP00000417426:D139E;ENSP00000252071:D141E;ENSP00000440990:D141E	.	D	-	3	2	ACTR3C	149614437	0.992000	0.36948	0.962000	0.40283	0.366000	0.29705	0.445000	0.21677	-0.302000	0.08869	0.184000	0.17185	GAC		0.433	ACTR3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350676.2			Missense_Mutation
MNDA	4332	genome.wustl.edu	37	1	158812137	158812137	+	Missense_Mutation	SNP	T	T	G	rs200437746		TCGA-13-0807-01	TCGA-13-0807-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr1:158812137T>G	ENST00000368141.4	+	2	455	c.194T>G	c.(193-195)cTa>cGa	p.L65R	MNDA_ENST00000491210.1_3'UTR	NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	65	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L65R(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CTAGACAAACTAATAGAACTT	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	120.0	117.0					1																	158812137		2202	4300	6502	157078761	SO:0001583	missense	4332			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.194T>G	1.37:g.158812137T>G	ENSP00000357123:p.Leu65Arg	Somatic		Capture	Illumina GAIIx	4	157078761		Missense_Mutation	SNP	ENST00000368141.4	37	CCDS1177.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	13.91	2.376736	0.42105	.	.	ENSG00000163563	ENST00000368141	T	0.54479	0.57	3.35	3.35	0.38373	Pyrin (2);	.	.	.	.	T	0.57213	0.2038	M	0.72894	2.215	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.46105	-0.9215	9	0.87932	D	0	-2.6941	8.3033	0.32027	0.0:0.0:0.0:1.0	.	65	P41218	MNDA_HUMAN	R	65	ENSP00000357123:L65R	ENSP00000357123:L65R	L	+	2	0	MNDA	157078761	0.014000	0.17966	0.002000	0.10522	0.002000	0.02628	2.896000	0.48656	1.507000	0.48752	0.455000	0.32223	CTA		0.343	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		Missense_Mutation
DOCK2	1794	genome.wustl.edu	37	5	169230068	169230068	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr5:169230068G>A	ENST00000256935.8	+	26	2641	c.2561G>A	c.(2560-2562)cGg>cAg	p.R854Q	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.R346Q|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	854					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.R854Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGAATGCCGGGACATTCTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	79.0	81.0					5																	169230068		2203	4300	6503	169162646	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2561G>A	5.37:g.169230068G>A	ENSP00000256935:p.Arg854Gln	Somatic		Capture	Illumina GAIIx	4	169162646	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774093	0.90108	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T;T	0.68331	-0.32;-0.32;-0.32	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.82518	0.5054	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.79108	0.992;0.968	D	0.83927	0.0304	10	0.87932	D	0	.	19.6391	0.95749	0.0:0.0:1.0:0.0	.	346;854	E7ERW7;Q92608	.;DOCK2_HUMAN	Q	854;235;346;58	ENSP00000256935:R854Q;ENSP00000429283:R346Q;ENSP00000428841:R58Q	ENSP00000256935:R854Q	R	+	2	0	DOCK2	169162646	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.688000	0.74557	2.715000	0.92844	0.655000	0.94253	CGG		0.403	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		Missense_Mutation
C4orf27	54969	genome.wustl.edu	37	4	170663135	170663135	+	Silent	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr4:170663135G>A	ENST00000393381.2	-	5	696	c.621C>T	c.(619-621)acC>acT	p.T207T		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	207						nucleus (GO:0005634)		p.T207T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		TCATCTTCACGGTTCTCTGTT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	4											143.0	134.0	137.0					4																	170663135		2203	4300	6503	170899710	SO:0001819	synonymous_variant	54969			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.621C>T	4.37:g.170663135G>A		Somatic		Capture	Illumina GAIIx	4	170899710		Silent	SNP	ENST00000393381.2	37	CCDS3813.1	SNP	39	WashU																																																																																				0.373	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363140.1	NM_017867		Silent
TTN	7273	genome.wustl.edu	37	2	179397613	179397613	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:179397613G>C	ENST00000591111.1	-	308	99030	c.98806C>G	c.(98806-98808)Cag>Gag	p.Q32936E	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q25637E|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q25512E|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q25704E|TTN_ENST00000589042.1_Missense_Mutation_p.Q34577E|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q32009E|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA			Q8WZ42	TITIN_HUMAN	titin	32936					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Q25512E(1)|p.Q32007E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTCATACTGATCACGTATC	0.463																																																2	Substitution - Missense(2)	ovary(2)	2											114.0	109.0	111.0					2																	179397613		1993	4172	6165	179105859	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98806C>G	2.37:g.179397613G>C	ENSP00000465570:p.Gln32936Glu	Somatic		Capture	Illumina GAIIx	4	179105859	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.70	2.313996	0.40996	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65549	-0.16;0.06;0.04;0.03	5.94	5.94	0.96194	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.57755	0.2075	N	0.19112	0.55	0.46609	D	0.999128	P;P;P;P	0.52170	0.905;0.905;0.905;0.951	B;B;B;P	0.46718	0.3;0.3;0.3;0.525	T	0.63134	-0.6705	9	0.87932	D	0	.	19.9583	0.97232	0.0:0.0:1.0:0.0	.	25512;25637;25704;32936	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	32009;25512;25704;25637;25509	ENSP00000343764:Q32009E;ENSP00000434586:Q25512E;ENSP00000340554:Q25704E;ENSP00000352154:Q25637E	ENSP00000340554:Q25704E	Q	-	1	0	TTN	179105859	1.000000	0.71417	0.986000	0.45419	0.921000	0.55340	7.832000	0.86757	2.826000	0.97356	0.561000	0.74099	CAG		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
ANKRD44	91526	genome.wustl.edu	37	2	197953512	197953512	+	5'UTR	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:197953512G>A	ENST00000477852.1	-	0	87				ANKRD44_ENST00000539527.1_Intron|ANKRD44_ENST00000337207.5_Intron|ANKRD44_ENST00000409153.1_Intron|ANKRD44_ENST00000450567.1_Intron|ANKRD44_ENST00000282272.8_Intron|ANKRD44_ENST00000328737.2_Intron			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44											NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CAGACAGCACGTGCTCATTAC	0.403																																																0			2											90.0	82.0	85.0					2																	197953512		2203	4300	6503	197661757	SO:0001623	5_prime_UTR_variant	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000477852.1:c.-323C>T	2.37:g.197953512G>A		Somatic		Capture	Illumina GAIIx	4	197661757	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000477852.1	37		SNP	40	WashU																																																																																				0.403	ANKRD44-010	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000335146.1	NM_153697		Silent
RBM44	375316	genome.wustl.edu	37	2	238726221	238726221	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr2:238726221G>A	ENST00000409864.1	+	3	916	c.662G>A	c.(661-663)gGa>gAa	p.G221E	RBM44_ENST00000444524.2_Intron|RBM44_ENST00000316997.4_Missense_Mutation_p.G221E			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	220						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.G221E(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GTTGAATTAGGAAATTCGGGT	0.328																																																1	Substitution - Missense(1)	ovary(1)	2											38.0	39.0	39.0					2																	238726221		1835	4092	5927	238390960	SO:0001583	missense	375316			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.662G>A	2.37:g.238726221G>A	ENSP00000386727:p.Gly221Glu	Somatic		Capture	Illumina GAIIx	4	238390960	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	8.632	0.893897	0.17613	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.29142	1.58;1.58	5.64	0.595	0.17490	.	0.796166	0.11591	N	0.548739	T	0.12305	0.0299	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.32745	-0.9895	10	0.02654	T	1	-6.3038	1.2823	0.02043	0.3196:0.1385:0.3994:0.1425	.	220	Q6ZP01	RBM44_HUMAN	E	221	ENSP00000321179:G221E;ENSP00000386727:G221E	ENSP00000321179:G221E	G	+	2	0	RBM44	238390960	0.000000	0.05858	0.001000	0.08648	0.143000	0.21401	0.128000	0.15810	0.034000	0.15491	0.655000	0.94253	GGA		0.328	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504		Missense_Mutation
RGS7	6000	genome.wustl.edu	37	1	241033371	241033371	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0807-01	TCGA-13-0807-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr1:241033371A>T	ENST00000407727.1	-	6	433	c.434T>A	c.(433-435)cTc>cAc	p.L145H	RGS7_ENST00000366564.1_Missense_Mutation_p.L145H|RGS7_ENST00000366563.1_Missense_Mutation_p.L145H|RGS7_ENST00000331110.7_Missense_Mutation_p.L119H|RGS7_ENST00000366565.1_Missense_Mutation_p.L145H|RGS7_ENST00000348120.2_Missense_Mutation_p.L92H|RGS7_ENST00000401882.1_Missense_Mutation_p.L92H|RGS7_ENST00000366562.4_Missense_Mutation_p.L145H|RGS7_ENST00000446183.2_Missense_Mutation_p.L61H			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	145					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.L145H(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ATAGTCTGCGAGCTCCAGTCG	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											242.0	203.0	216.0					1																	241033371		2203	4300	6503	239099994	SO:0001583	missense	6000			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.434T>A	1.37:g.241033371A>T	ENSP00000384428:p.Leu145His	Somatic		Capture	Illumina GAIIx	4	239099994	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307252	0.81247	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T	0.55052	0.72;0.7;0.72;0.73;0.54;0.71;0.72;0.7;0.54	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000001	T	0.71846	0.3388	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D	0.89917	0.987;1.0;1.0;0.992;1.0;0.999	P;D;D;D;D;D	0.97110	0.803;0.999;1.0;0.929;1.0;0.987	T	0.74408	-0.3675	10	0.62326	D	0.03	-9.7281	15.4321	0.75108	1.0:0.0:0.0:0.0	.	61;119;92;145;145;145	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.;.	H	119;145;145;145;92;61;145;145;92	ENSP00000331485:L119H;ENSP00000355523:L145H;ENSP00000355522:L145H;ENSP00000355521:L145H;ENSP00000341242:L92H;ENSP00000390138:L61H;ENSP00000355520:L145H;ENSP00000384428:L145H;ENSP00000385508:L92H	ENSP00000331485:L119H	L	-	2	0	RGS7	239099994	1.000000	0.71417	0.371000	0.25978	0.940000	0.58332	9.203000	0.95033	2.232000	0.73038	0.482000	0.46254	CTC		0.453	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		Missense_Mutation
SH3GL1	6455	genome.wustl.edu	37	19	4362368	4362368	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0807-01	TCGA-13-0807-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:4362368G>A	ENST00000269886.3	-	9	1046	c.868C>T	c.(868-870)Cga>Tga	p.R290*	AC007292.6_ENST00000594444.1_RNA|SH3GL1_ENST00000417295.2_Nonsense_Mutation_p.R242*|SH3GL1_ENST00000598564.1_Nonsense_Mutation_p.R226*	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	290					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.R290*(1)		NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		TCGGAAGATCGGAAAGACGAT	0.632			T	MLL	AL																																NSCLC(94;1152 2133 30346 33362)		Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	1	Substitution - Nonsense(1)	ovary(1)	19											73.0	73.0	73.0					19																	4362368		2203	4300	6503	4313368	SO:0001587	stop_gained	6455				CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.868C>T	19.37:g.4362368G>A	ENSP00000269886:p.Arg290*	Somatic		Capture	Illumina GAIIx	Phase_III	4313368	B4DRA1|E7EVZ4|M0QZV5|Q99668	Nonsense_Mutation	SNP	ENST00000269886.3	37	CCDS32874.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	.	37	6.301186	0.97453	.	.	ENSG00000141985	ENST00000269886;ENST00000417295	.	.	.	4.81	3.73	0.42828	.	0.115700	0.36778	N	0.002406	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-1.0338	11.1259	0.48317	0.0:0.0:0.8147:0.1853	.	.	.	.	X	290;242	.	ENSP00000269886:R290X	R	-	1	2	SH3GL1	4313368	1.000000	0.71417	0.999000	0.59377	0.914000	0.54420	3.090000	0.50191	0.948000	0.37687	0.561000	0.74099	CGA		0.632	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	NM_003025		Nonsense_Mutation
TP73	7161	genome.wustl.edu	37	1	3624325	3624325	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr1:3624325G>T	ENST00000378295.4	+	4	554	c.399G>T	c.(397-399)caG>caT	p.Q133H	TP73_ENST00000346387.4_Missense_Mutation_p.Q133H|TP73_ENST00000378280.1_Missense_Mutation_p.Q84H|TP73_ENST00000378288.4_Missense_Mutation_p.Q84H|TP73_ENST00000354437.4_Missense_Mutation_p.Q133H|TP73_ENST00000604074.1_Missense_Mutation_p.Q133H|TP73_ENST00000378290.4_Missense_Mutation_p.Q62H|TP73_ENST00000378285.1_Missense_Mutation_p.Q84H|TP73_ENST00000604479.1_Missense_Mutation_p.Q133H|TP73_ENST00000357733.3_Missense_Mutation_p.Q133H|TP73_ENST00000603362.1_Missense_Mutation_p.Q133H	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	133	DNA-binding. {ECO:0000255}.				activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q133H(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CTTTCCAGCAGTCCAGCACGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	46.0	48.0					1																	3624325		2202	4300	6502	3614185	SO:0001583	missense	7161			AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.399G>T	1.37:g.3624325G>T	ENSP00000367545:p.Gln133His	Somatic		Capture	Illumina GAIIx	PhaseIII	3614185	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	ENST00000378295.4	37	CCDS49.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565391	0.45694	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378285;ENST00000378280;ENST00000378290	D;D;D;D;D;D;D;D	0.99795	-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78	4.6	3.68	0.42216	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99480	0.9815	L	0.53617	1.68	0.54753	D	0.999986	D;D;D;D;D;D;D	0.89917	0.995;0.996;0.996;0.999;0.995;1.0;0.998	D;D;D;D;D;D;D	0.85130	0.993;0.992;0.996;0.992;0.985;0.997;0.994	D	0.98701	1.0700	10	0.42905	T	0.14	-19.9436	7.9762	0.30155	0.2631:0.0:0.7369:0.0	.	84;62;84;84;84;133;133	B7Z8Z1;B7Z7J4;O15350-10;O15350-9;O15350-8;O15350-2;O15350	.;.;.;.;.;.;P73_HUMAN	H	133;133;133;133;84;84;84;62	ENSP00000367545:Q133H;ENSP00000346423:Q133H;ENSP00000350366:Q133H;ENSP00000340740:Q133H;ENSP00000367537:Q84H;ENSP00000367534:Q84H;ENSP00000367529:Q84H;ENSP00000367539:Q62H	ENSP00000340740:Q133H	Q	+	3	2	TP73	3614185	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	2.737000	0.47393	0.916000	0.36871	0.491000	0.48974	CAG		0.662	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001468.4	NM_005427		Missense_Mutation
OR7C2	26658	genome.wustl.edu	37	19	15052973	15052973	+	Missense_Mutation	SNP	G	G	A	rs113508813	byFrequency	TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr19:15052973G>A	ENST00000248072.3	+	1	673	c.673G>A	c.(673-675)Gtc>Atc	p.V225I		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V225I(1)		large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					TTTCTCCTCCGTCCTAAGAGT	0.473													.|||	4	0.000798722	0.0023	0.0	5008	,	,		20706	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						G	ILE/VAL	15,4391	22.3+/-47.3	0,15,2188	176.0	163.0	168.0		673	2.0	0.0	19	dbSNP_132	168	0,8600		0,0,4300	yes	missense	OR7C2	NM_012377.1	29	0,15,6488	AA,AG,GG		0.0,0.3404,0.1153	benign	225/320	15052973	15,12991	2203	4300	6503	14913973	SO:0001583	missense	26658			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.673G>A	19.37:g.15052973G>A	ENSP00000248072:p.Val225Ile	Somatic		Capture	Illumina GAIIx	4	14913973	O43881|Q6IFP9	Missense_Mutation	SNP	ENST00000248072.3	37	CCDS12320.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.716668	0.00706	0.003404	0.0	ENSG00000127529	ENST00000248072	T	0.00224	8.51	4.19	2.04	0.26737	GPCR, rhodopsin-like superfamily (1);	0.163089	0.26859	N	0.022135	T	0.00073	0.0002	N	0.02765	-0.5	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.33675	-0.9859	10	0.02654	T	1	.	4.8872	0.13708	0.7419:0.0:0.0949:0.1631	.	225	O60412	OR7C2_HUMAN	I	225	ENSP00000248072:V225I	ENSP00000248072:V225I	V	+	1	0	OR7C2	14913973	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-0.250000	0.08830	0.238000	0.21222	-2.089000	0.00373	GTC		0.473	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			Missense_Mutation
RP1L1	94137	genome.wustl.edu	37	8	10466880	10466880	+	Silent	SNP	G	G	T			TCGA-13-0807-01	TCGA-13-0807-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0807-01	TCGA-13-0807-10	g.chr8:10466880G>T	ENST00000382483.3	-	4	4951	c.4728C>A	c.(4726-4728)ctC>ctA	p.L1576L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1656					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.L1576L(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGAGCTTCTGGAGCTCTCTCT	0.677																																																1	Substitution - coding silent(1)	ovary(1)	8											12.0	15.0	14.0					8																	10466880		2022	4152	6174	10504290	SO:0001819	synonymous_variant	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4728C>A	8.37:g.10466880G>T		Somatic		Capture	Illumina GAIIx	4	10504290	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	41	WashU																																																																																				0.677	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Silent
