#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ERC1	23085	genome.wustl.edu	37	12	1346062	1346062	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:1346062C>T	ENST00000397203.2	+	13	2885	c.2479C>T	c.(2479-2481)Cag>Tag	p.Q827*	ERC1_ENST00000355446.5_Nonsense_Mutation_p.Q827*|ERC1_ENST00000360905.4_Nonsense_Mutation_p.Q827*|ERC1_ENST00000589028.1_Nonsense_Mutation_p.Q827*|ERC1_ENST00000536573.2_3'UTR|ERC1_ENST00000546231.2_Nonsense_Mutation_p.Q831*|ERC1_ENST00000543086.3_Nonsense_Mutation_p.Q799*			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	827					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.Q827*(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CAGCTCTCAGCAGCTACAGGT	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	12											94.0	82.0	86.0					12																	1346062		2203	4300	6503	1216323	SO:0001587	stop_gained	23085			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2479C>T	12.37:g.1346062C>T	ENSP00000380386:p.Gln827*	Somatic		Capture	Illumina GAIIx	4	1216323	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Nonsense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	39	7.866192	0.98534	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971;ENST00000536573	.	.	.	5.81	5.81	0.92471	.	0.111999	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-24.9711	20.0656	0.97703	0.0:1.0:0.0:0.0	.	.	.	.	X	803;827;803;803;531;799;803;531;827;827;827;803;579;467	.	ENSP00000299183:Q531X	Q	+	1	0	ERC1	1216323	1.000000	0.71417	0.988000	0.46212	0.768000	0.43524	5.732000	0.68563	2.747000	0.94245	0.650000	0.86243	CAG		0.448	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064		Nonsense_Mutation
HTT	3064	genome.wustl.edu	37	4	3129256	3129256	+	Silent	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr4:3129256G>A	ENST00000355072.5	+	12	1813	c.1668G>A	c.(1666-1668)tcG>tcA	p.S556S		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	556					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.S556S(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGGCCTCGTCGCCCATCAGCG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	4											53.0	58.0	57.0					4																	3129256		2054	4188	6242	3099054	SO:0001819	synonymous_variant	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.1668G>A	4.37:g.3129256G>A		Somatic		Capture	Illumina GAIIx	4	3099054	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1	SNP	38	WashU																																																																																				0.587	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		Silent
MXRA5	25878	genome.wustl.edu	37	X	3248743	3248743	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:3248743T>G	ENST00000217939.6	-	3	414	c.260A>C	c.(259-261)cAc>cCc	p.H87P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	87						extracellular vesicular exosome (GO:0070062)		p.H87P(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTCATTGCCGTGAATCATAAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											118.0	103.0	108.0					X																	3248743		2203	4300	6503	3258743	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.260A>C	X.37:g.3248743T>G	ENSP00000217939:p.His87Pro	Somatic		Capture	Illumina GAIIx	4	3258743	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	SNP	59	WashU	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597973	0.46318	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.02395	4.31	3.68	3.68	0.42216	.	0.000000	0.38111	U	0.001813	T	0.09949	0.0244	L	0.46614	1.455	0.38045	D	0.935585	D	0.89917	1.0	D	0.91635	0.999	T	0.05305	-1.0893	10	0.87932	D	0	.	12.2165	0.54410	0.0:0.0:0.0:1.0	.	87	Q9NR99	MXRA5_HUMAN	P	87	ENSP00000217939:H87P	ENSP00000217939:H87P	H	-	2	0	MXRA5	3258743	1.000000	0.71417	0.010000	0.14722	0.300000	0.27592	6.421000	0.73353	1.309000	0.44985	0.341000	0.21757	CAC		0.423	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		Missense_Mutation
CDC25B	994	genome.wustl.edu	37	20	3783558	3783558	+	Splice_Site	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr20:3783558C>G	ENST00000245960.5	+	12	1893	c.1196C>G	c.(1195-1197)gCc>gGc	p.A399G	CDC25B_ENST00000344256.6_Splice_Site_p.A335G|CDC25B_ENST00000340833.4_Splice_Site_p.A358G|CDC25B_ENST00000379598.5_Splice_Site_p.A308G|CDC25B_ENST00000439880.2_Splice_Site_p.A385G|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	399					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.A420G(1)		NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						TCCCTTCAGGCCTTCCTCCTA	0.483																																																1	Substitution - Missense(1)	ovary(1)	20											128.0	99.0	109.0					20																	3783558		2203	4300	6503	3731558	SO:0001630	splice_region_variant	994				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1195-1C>G	20.37:g.3783558C>G		Somatic		Capture	Illumina GAIIx	4	3731558	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	CCDS13067.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211941	0.39102	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	4.96	4.96	0.65561	Rhodanese-like (2);	0.118487	0.56097	D	0.000031	T	0.22859	0.0552	L	0.34521	1.04	0.58432	D	0.999999	P;P;P;P;P;P	0.38863	0.511;0.511;0.511;0.644;0.644;0.65	B;B;B;B;B;B	0.35899	0.106;0.163;0.106;0.213;0.213;0.106	T	0.03566	-1.1024	10	0.13853	T	0.58	-15.9991	16.0693	0.80911	0.0:1.0:0.0:0.0	.	308;321;335;358;385;399	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	G	335;308;399;385;358	ENSP00000339125:A335G;ENSP00000368918:A308G;ENSP00000245960:A399G;ENSP00000405972:A385G;ENSP00000339170:A358G	ENSP00000245960:A399G	A	+	2	0	CDC25B	3731558	0.986000	0.35501	1.000000	0.80357	0.979000	0.70002	2.701000	0.47094	2.490000	0.84030	0.561000	0.74099	GCC		0.483	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874	Missense_Mutation	Missense_Mutation
TRIM21	6737	genome.wustl.edu	37	11	4406634	4406634	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:4406634C>T	ENST00000254436.7	-	7	1421	c.1309G>A	c.(1309-1311)Gcc>Acc	p.A437T	TRIM21_ENST00000543625.1_Missense_Mutation_p.A437T	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	437	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A437T(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		CCTGTAAAGGCACATTCAGAG	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											77.0	76.0	77.0					11																	4406634		1966	4160	6126	4363210	SO:0001583	missense	6737			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.1309G>A	11.37:g.4406634C>T	ENSP00000254436:p.Ala437Thr	Somatic		Capture	Illumina GAIIx	4	4363210	Q5XPV5|Q96RF8	Missense_Mutation	SNP	ENST00000254436.7	37	CCDS44525.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432411	0.25813	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.67698	-0.28;-0.28	4.32	2.42	0.29668	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.638874	0.13897	N	0.355197	T	0.41351	0.1155	N	0.11698	0.16	0.23162	N	0.998191	B	0.17038	0.02	B	0.11329	0.006	T	0.17107	-1.0380	10	0.23891	T	0.37	.	3.7587	0.08595	0.1947:0.606:0.0:0.1992	.	437	P19474	RO52_HUMAN	T	437	ENSP00000254436:A437T;ENSP00000444045:A437T	ENSP00000254436:A437T	A	-	1	0	TRIM21	4363210	0.002000	0.14202	0.934000	0.37439	0.957000	0.61999	0.054000	0.14205	0.736000	0.32559	0.655000	0.94253	GCC		0.493	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385842.1	NM_003141		Missense_Mutation
ADAMTS16	170690	genome.wustl.edu	37	5	5186163	5186163	+	Splice_Site	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr5:5186163A>G	ENST00000274181.7	+	5	901		c.e5-1		ADAMTS16_ENST00000511368.1_Splice_Site	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16						branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.?(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTCCCTCCATAGACATGCCCC	0.468																																																2	Unknown(2)	ovary(2)	5											175.0	173.0	174.0					5																	5186163		1957	4160	6117	5239163	SO:0001630	splice_region_variant	170690			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.764-1A>G	5.37:g.5186163A>G		Somatic		Capture	Illumina GAIIx	4	5239163	C6G490|Q8IVE2	Splice_Site_SNP	SNP	ENST00000274181.7	37	CCDS43299.1	SNP	15	WashU	.	.	.	.	.	.	.	.	.	.	A	18.85	3.711677	0.68730	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3756	0.66874	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS16	5239163	1.000000	0.71417	0.989000	0.46669	0.721000	0.41392	8.152000	0.89638	2.034000	0.60081	0.533000	0.62120	.		0.468	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	Intron	Splice_Site_SNP
TP53	7157	genome.wustl.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	17	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	7514728	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*	Somatic		Capture	Illumina GAIIx	4	7514728	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
C1orf127	148345	genome.wustl.edu	37	1	11017680	11017680	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr1:11017680C>G	ENST00000377008.4	-	7	685	c.239G>C	c.(238-240)aGg>aCg	p.R80T	C1orf127_ENST00000377004.4_Missense_Mutation_p.R229T			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	80								p.R80T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		GACCTCCCACCTCTGAAGAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	50.0	50.0					1																	11017680		2203	4300	6503	10940267	SO:0001583	missense	148345			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.239G>C	1.37:g.11017680C>G	ENSP00000366207:p.Arg80Thr	Somatic		Capture	Illumina GAIIx	4	10940267	A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	ENST00000377008.4	37		SNP	24	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.59|12.59	1.983705|1.983705	0.35036|0.35036	.|.	.|.	ENSG00000175262|ENSG00000175262	ENST00000418570;ENST00000520253|ENST00000377004;ENST00000377008	.|T;T	.|0.37235	.|1.56;1.21	5.25|5.25	4.33|4.33	0.51752|0.51752	.|.	.|0.199257	.|0.31697	.|N	.|0.007202	T|T	0.38532|0.38532	0.1044|0.1044	L|L	0.29908|0.29908	0.895|0.895	0.23243|0.23243	N|N	0.998051|0.998051	.|P;P;P	.|0.50943	.|0.94;0.94;0.94	.|P;P;P	.|0.53450	.|0.726;0.726;0.726	T|T	0.17592|0.17592	-1.0364|-1.0364	5|10	.|0.56958	.|D	.|0.05	-8.6686|-8.6686	11.8313|11.8313	0.52297|0.52297	0.0:0.8231:0.1769:0.0|0.0:0.8231:0.1769:0.0	.|.	.|80;80;80	.|B7ZLG7;Q8N9H9-2;Q8N9H9	.|.;.;CA127_HUMAN	R|T	82;207|229;80	.|ENSP00000366203:R229T;ENSP00000366207:R80T	.|ENSP00000366203:R229T	G|R	-|-	1|2	0|0	C1orf127|C1orf127	10940267|10940267	0.611000|0.611000	0.26992|0.26992	0.975000|0.975000	0.42487|0.42487	0.536000|0.536000	0.34869|0.34869	1.205000|1.205000	0.32308|0.32308	1.181000|1.181000	0.42912|0.42912	-0.175000|-0.175000	0.13238|0.13238	GGT|AGG		0.597	C1orf127-202	KNOWN	basic	protein_coding	protein_coding		NM_173507		Missense_Mutation
GSPT1	2935	genome.wustl.edu	37	16	11990467	11990467	+	Silent	SNP	C	C	A	rs187177338		TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr16:11990467C>A	ENST00000563468.1	-	2	224	c.198G>T	c.(196-198)ccG>ccT	p.P66P	GSPT1_ENST00000434724.2_Silent_p.P204P|RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000420576.2_Silent_p.P66P|GSPT1_ENST00000439887.2_Silent_p.P203P			P15170	ERF3A_HUMAN	G1 to S phase transition 1	66					G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)	p.P66P(1)		breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						GAGCACCTGGCGGTGCAACCA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	16											87.0	83.0	84.0					16																	11990467		1932	4134	6066	11897968	SO:0001819	synonymous_variant	2935			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.198G>T	16.37:g.11990467C>A		Somatic		Capture	Illumina GAIIx	4	11897968	J3KQG6|Q96GF2	Silent	SNP	ENST00000563468.1	37	CCDS45414.1	SNP	27	WashU																																																																																				0.468	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421513.1	NM_002094		Silent
SLC1A6	6511	genome.wustl.edu	37	19	15067395	15067395	+	Silent	SNP	G	G	A	rs140480842	byFrequency	TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr19:15067395G>A	ENST00000221742.3	-	6	1069	c.1062C>T	c.(1060-1062)gcC>gcT	p.A354A	SLC1A6_ENST00000430939.2_Silent_p.A290A|SLC1A6_ENST00000600144.1_Intron	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	354					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.A354A(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GGACAATGCCGGCATGGAGGA	0.587													N|||	5	0.000998403	0.0038	0.0	5008	,	,		19889	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19								12,4394	19.1+/-41.9	0,12,2191	191.0	153.0	166.0		1062	-6.6	0.0	19	dbSNP_134	166	0,8600		0,0,4300	no	coding-synonymous	SLC1A6	NM_005071.1		0,12,6491	AA,AG,GG		0.0,0.2724,0.0923		354/565	15067395	12,12994	2203	4300	6503	14928395	SO:0001819	synonymous_variant	6511				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1062C>T	19.37:g.15067395G>A		Somatic		Capture	Illumina GAIIx	4	14928395	Q8N753	Silent	SNP	ENST00000221742.3	37	CCDS12321.1	SNP	39	WashU																																																																																				0.587	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071		Silent
OR4N5	390437	genome.wustl.edu	37	14	20612745	20612745	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr14:20612745C>A	ENST00000333629.1	+	1	851	c.851C>A	c.(850-852)cCt>cAt	p.P284H	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P284H(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TTGATGAACCCTGTTATTTAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											117.0	117.0	117.0					14																	20612745		2203	4300	6503	19682585	SO:0001583	missense	390437				CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.851C>A	14.37:g.20612745C>A	ENSP00000332110:p.Pro284His	Somatic		Capture	Illumina GAIIx	4	19682585	Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	CCDS32031.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299926	0.60195	.	.	ENSG00000184394	ENST00000333629	T	0.64260	-0.09	4.0	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000563	D	0.83672	0.5305	H	0.94658	3.565	0.37603	D	0.92065	D	0.89917	1.0	D	0.91635	0.999	D	0.89908	0.4049	10	0.87932	D	0	.	13.9851	0.64328	0.0:1.0:0.0:0.0	.	284	Q8IXE1	OR4N5_HUMAN	H	284	ENSP00000332110:P284H	ENSP00000332110:P284H	P	+	2	0	OR4N5	19682585	0.975000	0.34042	1.000000	0.80357	0.959000	0.62525	4.159000	0.58157	2.219000	0.72066	0.655000	0.94253	CCT		0.408	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1			Missense_Mutation
ACSM5	54988	genome.wustl.edu	37	16	20448643	20448643	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr16:20448643T>C	ENST00000331849.4	+	12	1637	c.1490T>C	c.(1489-1491)gTc>gCc	p.V497A	CTD-2194A8.2_ENST00000574654.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	497					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.V497A(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CATCCTGCTGTCCTGGAGTCG	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											64.0	65.0	64.0					16																	20448643		2203	4300	6503	20356144	SO:0001583	missense	54988				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1490T>C	16.37:g.20448643T>C	ENSP00000327916:p.Val497Ala	Somatic		Capture	Illumina GAIIx	4	20356144	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	18.78	3.697859	0.68386	.	.	ENSG00000183549	ENST00000331849	T	0.72282	-0.64	4.89	4.89	0.63831	AMP-dependent synthetase/ligase (1);	0.000000	0.53938	D	0.000055	D	0.88851	0.6549	H	0.96720	3.87	0.46167	D	0.9989	D	0.76494	0.999	D	0.80764	0.994	D	0.92320	0.5865	10	0.87932	D	0	-28.1269	13.7725	0.63034	0.0:0.0:0.0:1.0	.	497	Q6NUN0	ACSM5_HUMAN	A	497	ENSP00000327916:V497A	ENSP00000327916:V497A	V	+	2	0	ACSM5	20356144	1.000000	0.71417	0.986000	0.45419	0.603000	0.37013	4.903000	0.63272	1.954000	0.56735	0.528000	0.53228	GTC		0.577	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		Missense_Mutation
ACSM5	54988	genome.wustl.edu	37	16	20448680	20448680	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr16:20448680C>G	ENST00000331849.4	+	12	1674	c.1527C>G	c.(1525-1527)atC>atG	p.I509M	CTD-2194A8.2_ENST00000574654.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	509					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.I509M(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CAGACCCCATCAGGGGAGAGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											41.0	42.0	41.0					16																	20448680		2203	4297	6500	20356181	SO:0001583	missense	54988				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1527C>G	16.37:g.20448680C>G	ENSP00000327916:p.Ile509Met	Somatic		Capture	Illumina GAIIx	4	20356181	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345772	0.41599	.	.	ENSG00000183549	ENST00000331849	T	0.58210	0.35	4.89	2.89	0.33648	.	0.195307	0.35708	N	0.003024	T	0.45256	0.1333	L	0.42744	1.35	0.27199	N	0.960215	P	0.42785	0.79	B	0.42422	0.387	T	0.38972	-0.9636	10	0.62326	D	0.03	-11.161	9.448	0.38710	0.0:0.7742:0.1447:0.0811	.	509	Q6NUN0	ACSM5_HUMAN	M	509	ENSP00000327916:I509M	ENSP00000327916:I509M	I	+	3	3	ACSM5	20356181	0.455000	0.25736	0.998000	0.56505	0.991000	0.79684	0.166000	0.16583	0.552000	0.29026	0.650000	0.86243	ATC		0.567	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888		Missense_Mutation
DNAH3	55567	genome.wustl.edu	37	16	20974772	20974772	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr16:20974772A>C	ENST00000261383.3	-	53	10433	c.10434T>G	c.(10432-10434)tgT>tgG	p.C3478W	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3478					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.C3478W(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGGCCGCAAACATCGAAGGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	16											97.0	82.0	87.0					16																	20974772		2201	4300	6501	20882273	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10434T>G	16.37:g.20974772A>C	ENSP00000261383:p.Cys3478Trp	Somatic		Capture	Illumina GAIIx	4	20882273	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	2	WashU	.	.	.	.	.	.	.	.	.	.	A	12.44	1.938800	0.34189	.	.	ENSG00000158486	ENST00000261383	T	0.09073	3.02	5.39	1.92	0.25849	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.42137	-0.9469	10	0.87932	D	0	.	9.8806	0.41231	0.6575:0.0:0.3425:0.0	.	3478	Q8TD57	DYH3_HUMAN	W	3478	ENSP00000261383:C3478W	ENSP00000261383:C3478W	C	-	3	2	DNAH3	20882273	0.996000	0.38824	0.873000	0.34254	0.890000	0.51754	1.442000	0.35046	0.053000	0.16036	0.460000	0.39030	TGT		0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
HSPG2	3339	genome.wustl.edu	37	1	22202240	22202240	+	Splice_Site	SNP	G	G	T			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr1:22202240G>T	ENST00000374695.3	-	25	3263	c.3184C>A	c.(3184-3186)Caa>Aaa	p.Q1062K		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1062	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.Q1062K(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGCCATGCTTGCTGCCAAGGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	1											79.0	84.0	82.0					1																	22202240		2203	4300	6503	22074827	SO:0001630	splice_region_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3184-1C>A	1.37:g.22202240G>T		Somatic		Capture	Illumina GAIIx	4	22074827	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	5.526	0.281992	0.10458	.	.	ENSG00000142798	ENST00000374695	T	0.34472	1.36	5.51	1.21	0.21127	Laminin B type IV (2);Laminin B, subgroup (1);	0.395100	0.18641	N	0.135288	T	0.25005	0.0607	L	0.28556	0.865	0.32091	N	0.591888	B	0.14805	0.011	B	0.14023	0.01	T	0.19712	-1.0297	10	0.38643	T	0.18	.	10.8779	0.46921	0.0:0.3898:0.4761:0.1341	.	1062	P98160	PGBM_HUMAN	K	1062	ENSP00000363827:Q1062K	ENSP00000363827:Q1062K	Q	-	1	0	HSPG2	22074827	0.651000	0.27340	0.998000	0.56505	0.142000	0.21351	1.015000	0.29963	0.271000	0.22005	-1.303000	0.01326	CAA		0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	Missense_Mutation	Missense_Mutation
PTCHD1	139411	genome.wustl.edu	37	X	23411370	23411370	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:23411370A>G	ENST00000379361.4	+	3	2595	c.1735A>G	c.(1735-1737)Acc>Gcc	p.T579A		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	579					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.T474A(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TCTAGAATACACCAAGGGGTT	0.388																																																1	Substitution - Missense(1)	ovary(1)	X											107.0	106.0	106.0					X																	23411370		2203	4300	6503	23321291	SO:0001583	missense	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1735A>G	X.37:g.23411370A>G	ENSP00000368666:p.Thr579Ala	Somatic		Capture	Illumina GAIIx	4	23321291	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	3.489	-0.104233	0.06967	.	.	ENSG00000165186	ENST00000379361	D	0.84944	-1.92	5.69	5.69	0.88448	.	0.114888	0.64402	D	0.000010	T	0.69269	0.3092	N	0.08118	0	0.33307	D	0.565603	B	0.10296	0.003	B	0.14023	0.01	T	0.68743	-0.5328	10	0.15499	T	0.54	.	10.9815	0.47497	0.8463:0.1537:0.0:0.0	.	579	Q96NR3	PTHD1_HUMAN	A	579	ENSP00000368666:T579A	ENSP00000368666:T579A	T	+	1	0	PTCHD1	23321291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.883000	0.69721	1.904000	0.55121	0.486000	0.48141	ACC		0.388	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495		Missense_Mutation
SOX5	6660	genome.wustl.edu	37	12	23893901	23893901	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:23893901T>A	ENST00000451604.2	-	5	742	c.641A>T	c.(640-642)gAg>gTg	p.E214V	SOX5_ENST00000545921.1_Missense_Mutation_p.E204V|SOX5_ENST00000541536.1_Missense_Mutation_p.E201V|SOX5_ENST00000537393.1_Missense_Mutation_p.E179V|SOX5_ENST00000546136.1_Missense_Mutation_p.E201V|SOX5_ENST00000309359.1_Missense_Mutation_p.E201V|SOX5_ENST00000381381.2_Missense_Mutation_p.E201V|SOX5_ENST00000541847.1_Missense_Mutation_p.E204V			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	214					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E214V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CAACAGCTGCTCTCGGAGGCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	75.0	78.0					12																	23893901		2203	4300	6503	23785168	SO:0001583	missense	6660			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.641A>T	12.37:g.23893901T>A	ENSP00000398273:p.Glu214Val	Somatic		Capture	Illumina GAIIx	4	23785168	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	32	5.167896	0.94768	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847	D;D;D;D;D;D;D	0.98684	-5.05;-5.05;-5.07;-5.05;-5.01;-5.07;-5.05	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.99118	0.9696	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.989;1.0	D;D;D	0.78314	0.991;0.978;0.987	D	0.99701	1.1004	10	0.87932	D	0	.	16.1416	0.81528	0.0:0.0:0.0:1.0	.	179;201;214	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	V	201;201;201;214;166;179;201;204;204	ENSP00000437487:E201V;ENSP00000308927:E201V;ENSP00000370788:E201V;ENSP00000398273:E214V;ENSP00000439832:E179V;ENSP00000441973:E201V;ENSP00000443520:E204V	ENSP00000308927:E201V	E	-	2	0	SOX5	23785168	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.559000	0.82265	2.209000	0.71365	0.482000	0.46254	GAG		0.493	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940		Missense_Mutation
SLC34A2	10568	genome.wustl.edu	37	4	25671403	25671403	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr4:25671403G>C	ENST00000382051.3	+	7	820	c.770G>C	c.(769-771)gGa>gCa	p.G257A	SLC34A2_ENST00000504570.1_Missense_Mutation_p.G256A|SLC34A2_ENST00000503434.1_Missense_Mutation_p.G256A	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	257					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.G257A(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				TTCAAGAATGGAGAAGATGCC	0.493			T	ROS1	NSCLC																																		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	1	Substitution - Missense(1)	ovary(1)	4											200.0	196.0	197.0					4																	25671403		2203	4300	6503	25280501	SO:0001583	missense	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.770G>C	4.37:g.25671403G>C	ENSP00000371483:p.Gly257Ala	Somatic		Capture	Illumina GAIIx	4	25280501	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007825	0.54361	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	T;T;T	0.26223	1.75;1.75;1.75	5.39	3.66	0.41972	.	0.048173	0.85682	D	0.000000	T	0.54029	0.1833	M	0.88775	2.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.983	T	0.57051	-0.7877	10	0.37606	T	0.19	-5.1239	11.9635	0.53021	0.1413:0.0:0.8587:0.0	.	256;257	O95436-2;O95436	.;NPT2B_HUMAN	A	256;257;256	ENSP00000425501:G256A;ENSP00000371483:G257A;ENSP00000423021:G256A	ENSP00000371483:G257A	G	+	2	0	SLC34A2	25280501	1.000000	0.71417	0.974000	0.42286	0.198000	0.23893	9.491000	0.97954	0.766000	0.33244	0.561000	0.74099	GGA		0.493	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424		Missense_Mutation
ASUN	55726	genome.wustl.edu	37	12	27089631	27089631	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:27089631T>C	ENST00000261191.7	-	2	642	c.106A>G	c.(106-108)Aat>Gat	p.N36D	FGFR1OP2_ENST00000229395.3_5'Flank|FGFR1OP2_ENST00000546072.1_5'Flank|ASUN_ENST00000539625.1_Intron|FGFR1OP2_ENST00000327214.5_5'Flank	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	36					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.N36D(1)									TGGGTTCTATTCTTCACCAGC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	81.0	81.0					12																	27089631		2203	4300	6503	26980898	SO:0001583	missense	55726			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.106A>G	12.37:g.27089631T>C	ENSP00000261191:p.Asn36Asp	Somatic		Capture	Illumina GAIIx	4	26980898	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	ENST00000261191.7	37	CCDS8708.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	13.59	2.283521	0.40394	.	.	ENSG00000064102	ENST00000261191;ENST00000544548;ENST00000537336	T;T;T	0.42513	0.97;0.97;0.97	5.38	5.38	0.77491	.	0.046656	0.85682	D	0.000000	T	0.29882	0.0747	N	0.11427	0.14	0.80722	D	1	B	0.33000	0.393	B	0.37731	0.257	T	0.16188	-1.0411	10	0.32370	T	0.25	-25.845	15.696	0.77499	0.0:0.0:0.0:1.0	.	36	Q9NVM9	M89BB_HUMAN	D	36	ENSP00000261191:N36D;ENSP00000446183:N36D;ENSP00000443066:N36D	ENSP00000261191:N36D	N	-	1	0	C12orf11	26980898	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.629000	0.83207	2.165000	0.68154	0.460000	0.39030	AAT		0.383	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164		Missense_Mutation
LNX2	222484	genome.wustl.edu	37	13	28141953	28141953	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr13:28141953G>A	ENST00000316334.3	-	4	808	c.679C>T	c.(679-681)Cca>Tca	p.P227S		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	227					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)	p.P227S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TCTCCTTCTGGTAAACTAAGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	13											113.0	113.0	113.0					13																	28141953		2203	4300	6503	27039953	SO:0001583	missense	222484			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.679C>T	13.37:g.28141953G>A	ENSP00000325929:p.Pro227Ser	Somatic		Capture	Illumina GAIIx	4	27039953	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	ENST00000316334.3	37	CCDS9323.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130867	0.56828	.	.	ENSG00000139517	ENST00000316334	T	0.29917	1.55	5.57	5.57	0.84162	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.54118	-0.8341	10	0.44086	T	0.13	.	19.5508	0.95319	0.0:0.0:1.0:0.0	.	227	Q8N448	LNX2_HUMAN	S	227	ENSP00000325929:P227S	ENSP00000325929:P227S	P	-	1	0	LNX2	27039953	1.000000	0.71417	1.000000	0.80357	0.052000	0.14988	9.476000	0.97823	2.617000	0.88574	0.655000	0.94253	CCA		0.358	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2			Missense_Mutation
FLT1	2321	genome.wustl.edu	37	13	29008235	29008235	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr13:29008235A>T	ENST00000282397.4	-	5	887	c.636T>A	c.(634-636)aaT>aaA	p.N212K	FLT1_ENST00000539099.1_Missense_Mutation_p.N212K|FLT1_ENST00000541932.1_Missense_Mutation_p.N212K	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	212	Ig-like C2-type 2.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.N212K(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAAATGCCCATTGACTGTTG	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											155.0	129.0	138.0					13																	29008235		2203	4300	6503	27906235	SO:0001583	missense	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.636T>A	13.37:g.29008235A>T	ENSP00000282397:p.Asn212Lys	Somatic		Capture	Illumina GAIIx	4	27906235	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	19.77	3.888421	0.72524	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.16597	2.33;2.33;2.33	5.78	-1.01	0.10169	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.399284	0.28442	N	0.015333	T	0.27697	0.0681	L	0.53249	1.67	0.38002	D	0.934241	P;P;P;P	0.51449	0.945;0.945;0.945;0.863	P;P;P;P	0.59357	0.856;0.856;0.856;0.627	T	0.05146	-1.0903	10	0.40728	T	0.16	.	11.792	0.52075	0.7416:0.0:0.2584:0.0	.	212;212;212;212	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	K	212	ENSP00000282397:N212K;ENSP00000437631:N212K;ENSP00000442630:N212K	ENSP00000282397:N212K	N	-	3	2	FLT1	27906235	0.881000	0.30235	0.693000	0.30195	0.916000	0.54674	0.170000	0.16663	-0.101000	0.12219	0.528000	0.53228	AAT		0.398	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1			Missense_Mutation
GPX6	257202	genome.wustl.edu	37	6	28474135	28474135	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr6:28474135C>A	ENST00000474923.1	-	3	356	c.313G>T	c.(313-315)Gga>Tga	p.G105*	GPX6_ENST00000361902.1_Nonsense_Mutation_p.G105*|GPX6_ENST00000483058.1_5'UTR			P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	105					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.G105*(1)		NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	TCTTGTTTTCCAAACTGGTTG	0.468																																																1	Substitution - Nonsense(1)	ovary(1)	6											96.0	107.0	103.0					6																	28474135		2077	4258	6335	28582114	SO:0001587	stop_gained	257202				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000474923.1:c.313G>T	6.37:g.28474135C>A	ENSP00000417364:p.Gly105*	Somatic		Capture	Illumina GAIIx	4	28582114	Q4PJ17	Nonsense_Mutation	SNP	ENST00000474923.1	37		SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936978	0.73557	.	.	ENSG00000198704	ENST00000361902;ENST00000474923	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	12.6776	0.56903	0.0:1.0:0.0:0.0	.	.	.	.	X	105	.	ENSP00000354581:G105X	G	-	1	0	GPX6	28582114	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.644000	0.74338	2.687000	0.91594	0.655000	0.94253	GGA		0.468	GPX6-002	PUTATIVE	basic|exp_conf|seleno	protein_coding	protein_coding	OTTHUMT00000356246.5			Nonsense_Mutation
PLAGL2	5326	genome.wustl.edu	37	20	30789743	30789743	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr20:30789743G>A	ENST00000246229.4	-	2	503	c.239C>T	c.(238-240)gCt>gTt	p.A80V		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	80					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A80V(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GTATTTGGAAGCAAAAGCCTT	0.522																																					Colon(163;15 1893 11280 16306 47518)											1	Substitution - Missense(1)	ovary(1)	20											70.0	61.0	64.0					20																	30789743		2203	4300	6503	30253404	SO:0001583	missense	5326				CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.239C>T	20.37:g.30789743G>A	ENSP00000246229:p.Ala80Val	Somatic		Capture	Illumina GAIIx	4	30253404	A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	ENST00000246229.4	37	CCDS13197.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315880	0.23908	.	.	ENSG00000126003	ENST00000246229	T	0.15256	2.44	4.44	4.44	0.53790	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.123193	0.56097	D	0.000033	T	0.10078	0.0247	N	0.25060	0.705	0.31511	N	0.663577	B	0.15141	0.012	B	0.11329	0.006	T	0.12915	-1.0529	10	0.08599	T	0.76	.	10.8328	0.46669	0.0863:0.0:0.9137:0.0	.	80	Q9UPG8	PLAL2_HUMAN	V	80	ENSP00000246229:A80V	ENSP00000246229:A80V	A	-	2	0	PLAGL2	30253404	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.445000	0.60007	2.286000	0.76751	0.655000	0.94253	GCT		0.522	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078615.2	NM_002657		Missense_Mutation
BPIFB6	128859	genome.wustl.edu	37	20	31622567	31622567	+	Splice_Site	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr20:31622567A>G	ENST00000349552.1	+	4	302		c.e4-1			NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6							extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.?(1)									TCTGTCCTCCAGCTTCATGGG	0.587																																																1	Unknown(1)	ovary(1)	20											95.0	82.0	86.0					20																	31622567		2203	4300	6503	31086228	SO:0001630	splice_region_variant	128859			AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.303-1A>G	20.37:g.31622567A>G		Somatic		Capture	Illumina GAIIx	4	31086228		Splice_Site_SNP	SNP	ENST00000349552.1	37	CCDS13211.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	15.99	2.994626	0.54041	.	.	ENSG00000167104	ENST00000349552	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.958	0.41680	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BPIFB6	31086228	0.997000	0.39634	0.999000	0.59377	0.879000	0.50718	2.695000	0.47043	1.663000	0.50791	0.418000	0.28097	.		0.587	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897	Intron	Splice_Site_SNP
CNBD2	140894	genome.wustl.edu	37	20	34568441	34568441	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0884-01	TCGA-13-0884-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr20:34568441G>T	ENST00000373973.3	+	4	477	c.304G>T	c.(304-306)Gat>Tat	p.D102Y	CNBD2_ENST00000538900.1_Missense_Mutation_p.D102Y|CNBD2_ENST00000349339.1_Missense_Mutation_p.D102Y			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	102								p.D102Y(1)									GAGAACAGAGGATGAGATCCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	20											105.0	87.0	93.0					20																	34568441		2203	4300	6503	34031855	SO:0001583	missense	140894			AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.304G>T	20.37:g.34568441G>T	ENSP00000363084:p.Asp102Tyr	Somatic		Capture	Illumina GAIIx	4	34031855	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	ENST00000373973.3	37		SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327299	0.24080	.	.	ENSG00000149646	ENST00000373973;ENST00000349339;ENST00000538900	D;D;D	0.84223	-1.82;-1.82;-1.82	5.15	-3.86	0.04230	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	3.546850	0.00481	N	0.000130	T	0.72771	0.3502	N	0.22421	0.69	0.09310	N	1	B;B	0.30511	0.185;0.282	B;B	0.24394	0.024;0.053	T	0.62086	-0.6928	10	0.59425	D	0.04	6.1039	4.7829	0.13211	0.243:0.2601:0.4218:0.0751	.	102;102	Q96M20;Q96M20-2	CT152_HUMAN;.	Y	102	ENSP00000363084:D102Y;ENSP00000340954:D102Y;ENSP00000442729:D102Y	ENSP00000340954:D102Y	D	+	1	0	C20orf152	34031855	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.924000	0.03996	-0.652000	0.05408	-1.291000	0.01355	GAT		0.542	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834		Missense_Mutation
MEIS2	4212	genome.wustl.edu	37	15	37390181	37390181	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr15:37390181C>T	ENST00000561208.1	-	2	650	c.232G>A	c.(232-234)Gac>Aac	p.D78N	MEIS2_ENST00000559085.1_Missense_Mutation_p.D65N|RP11-128A17.1_ENST00000559509.1_RNA|MEIS2_ENST00000424352.2_Missense_Mutation_p.D78N|MEIS2_ENST00000397624.3_5'UTR|MEIS2_ENST00000444725.1_Missense_Mutation_p.D78N|MEIS2_ENST00000397620.2_5'UTR|MEIS2_ENST00000219869.9_5'UTR|MEIS2_ENST00000557796.2_Missense_Mutation_p.D65N|MEIS2_ENST00000382766.2_Missense_Mutation_p.D78N|MEIS2_ENST00000340545.5_Missense_Mutation_p.D65N|MEIS2_ENST00000338564.5_Missense_Mutation_p.D78N|MEIS2_ENST00000559561.1_Missense_Mutation_p.D78N			O14770	MEIS2_HUMAN	Meis homeobox 2	78	Required for interaction with PBX1. {ECO:0000250}.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.D78N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TAGATCGCGTCCTTGTCCCGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	15											67.0	59.0	62.0					15																	37390181		2201	4297	6498	35177473	SO:0001583	missense	4212			AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.232G>A	15.37:g.37390181C>T	ENSP00000453793:p.Asp78Asn	Somatic		Capture	Illumina GAIIx	4	35177473	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	CCDS10044.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	37	6.026942	0.97216	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624	T;T;T;T;T;T	0.35236	1.58;1.32;1.32;1.58;1.58;1.58	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.987;0.991;0.949;0.987;0.974;1.0	T	0.64326	-0.6434	10	0.49607	T	0.09	-6.873	19.0381	0.92987	0.0:1.0:0.0:0.0	.	65;78;78;78;78;65	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP98	.;.;MEIS2_HUMAN;.;.;.	N	78;78;78;78;78;65;65	ENSP00000326296:D78N;ENSP00000341400:D78N;ENSP00000372216:D78N;ENSP00000404185:D78N;ENSP00000391887:D78N;ENSP00000339549:D65N	ENSP00000326296:D78N	D	-	1	0	MEIS2	35177473	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.387000	0.79785	2.568000	0.86640	0.655000	0.94253	GAC		0.607	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677		Missense_Mutation
FAM98B	283742	genome.wustl.edu	37	15	38757484	38757484	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr15:38757484G>C	ENST00000491535.1	+	3	240	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	FAM98B_ENST00000397609.2_Missense_Mutation_p.E78Q	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B	78						cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)	p.E78Q(1)		endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		AGATGATCTAGAGAGCTTCCA	0.294																																																1	Substitution - Missense(1)	ovary(1)	15											50.0	53.0	52.0					15																	38757484		2199	4288	6487	36544776	SO:0001583	missense	283742				CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831	ENST00000491535.1:c.232G>C	15.37:g.38757484G>C	ENSP00000453166:p.Glu78Gln	Somatic		Capture	Illumina GAIIx	4	36544776	A8MUW5|Q8N935	Missense_Mutation	SNP	ENST00000491535.1	37	CCDS42015.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439130	0.83885	.	.	ENSG00000171262	ENST00000397609;ENST00000305752	T	0.51325	0.71	4.71	4.71	0.59529	.	0.050594	0.85682	D	0.000000	T	0.69886	0.3161	M	0.77486	2.375	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.73380	0.977;0.98	T	0.73395	-0.3996	10	0.59425	D	0.04	-31.5945	18.2052	0.89852	0.0:0.0:1.0:0.0	.	78;78	A8MUW5;Q52LJ0	.;FA98B_HUMAN	Q	78	ENSP00000380734:E78Q	ENSP00000303412:E78Q	E	+	1	0	FAM98B	36544776	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.040000	0.93783	2.622000	0.88805	0.585000	0.79938	GAG		0.294	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611		Missense_Mutation
FRMPD1	22844	genome.wustl.edu	37	9	37744774	37744774	+	Silent	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr9:37744774C>T	ENST00000539465.1	+	16	3338	c.2745C>T	c.(2743-2745)aaC>aaT	p.N915N	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Silent_p.N915N			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	915						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.N915N(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGAGCACAAACCCAGCCTCCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	9											73.0	68.0	70.0					9																	37744774		2203	4300	6503	37734774	SO:0001819	synonymous_variant	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2745C>T	9.37:g.37744774C>T		Somatic		Capture	Illumina GAIIx	4	37734774	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	CCDS6612.1	SNP	18	WashU																																																																																				0.567	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		Silent
CNTNAP1	8506	genome.wustl.edu	37	17	40842770	40842770	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr17:40842770G>A	ENST00000264638.4	+	13	2086	c.1869G>A	c.(1867-1869)tgG>tgA	p.W623*	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	623	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.W623*(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		ACCGAGCGTGGACAGTTGTGC	0.597																																																1	Substitution - Nonsense(1)	ovary(1)	17											124.0	118.0	120.0					17																	40842770		2203	4300	6503	38096296	SO:0001587	stop_gained	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1869G>A	17.37:g.40842770G>A	ENSP00000264638:p.Trp623*	Somatic		Capture	Illumina GAIIx	4	38096296		Nonsense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	41	8.739603	0.98935	.	.	ENSG00000108797	ENST00000264638	.	.	.	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	.	.	.	X	623	.	ENSP00000264638:W623X	W	+	3	0	CNTNAP1	38096296	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.744000	0.98853	2.769000	0.95229	0.655000	0.94253	TGG		0.597	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632		Nonsense_Mutation
ATL2	64225	genome.wustl.edu	37	2	38570462	38570462	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:38570462C>G	ENST00000378954.4	-	2	312	c.311G>C	c.(310-312)cGt>cCt	p.R104P	ATL2_ENST00000402054.1_Intron|ATL2_ENST00000546051.1_Intron|ATL2_ENST00000419554.2_Missense_Mutation_p.R104P|ATL2_ENST00000406122.1_Intron|ATL2_ENST00000486927.1_5'UTR|ATL2_ENST00000539122.1_Intron|ATL2_ENST00000452935.2_Missense_Mutation_p.R86P|ATL2_ENST00000332337.4_Missense_Mutation_p.R86P	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	104	GB1/RHD3-type G.				endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.R104P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						CTTCCCTTTACGAAAAGCTCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	80.0	81.0					2																	38570462		2203	4300	6503	38423966	SO:0001583	missense	64225				CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.311G>C	2.37:g.38570462C>G	ENSP00000368237:p.Arg104Pro	Somatic		Capture	Illumina GAIIx	4	38423966	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	CCDS46260.1	SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	30|30	5.055452|5.055452	0.93793|0.93793	.|.	.|.	ENSG00000119787|ENSG00000119787	ENST00000378954;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000451483|ENST00000443098	T;T;T;T;T|.	0.62498|.	0.02;0.02;0.02;0.02;0.02|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Guanylate-binding protein, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88392|0.88392	0.6424|0.6424	H|H	0.97186|0.97186	3.955|3.955	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	D|D	0.91792|0.91792	0.5444|0.5444	10|5	0.87932|.	D|.	0|.	-14.1802|-14.1802	18.2906|18.2906	0.90129|0.90129	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	86;86;104;104|.	B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9|.	.;.;.;ATLA2_HUMAN|.	P|L	104;86;104;86;141|103	ENSP00000368237:R104P;ENSP00000333393:R86P;ENSP00000415336:R104P;ENSP00000390743:R86P;ENSP00000404921:R141P|.	ENSP00000333393:R86P|.	R|V	-|-	2|1	0|0	ATL2|ATL2	38423966|38423966	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.502000|7.502000	0.81614|0.81614	2.788000|2.788000	0.95919|0.95919	0.650000|0.650000	0.86243|0.86243	CGT|GTA		0.358	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374		Missense_Mutation
ADAM32	203102	genome.wustl.edu	37	8	39068780	39068780	+	Silent	SNP	G	G	A	rs201298341		TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:39068780G>A	ENST00000379907.4	+	12	1297	c.1170G>A	c.(1168-1170)ccG>ccA	p.P390P	ADAM32_ENST00000437682.2_Intron|ADAM32_ENST00000519315.1_Intron	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	390						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P389P(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			AAAAATCTCCGAAACCAGTCT	0.358													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15934	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	8											59.0	56.0	57.0					8																	39068780		1819	4084	5903	39187937	SO:0001819	synonymous_variant	203102			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1170G>A	8.37:g.39068780G>A		Somatic		Capture	Illumina GAIIx	4	39187937	Q8TC42	Silent	SNP	ENST00000379907.4	37	CCDS47846.1	SNP	37	WashU																																																																																				0.358	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004		Silent
XIRP1	165904	genome.wustl.edu	37	3	39229303	39229303	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr3:39229303C>G	ENST00000340369.3	-	2	1862	c.1634G>C	c.(1633-1635)gGg>gCg	p.G545A	XIRP1_ENST00000396251.1_Missense_Mutation_p.G545A|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	545	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.G545A(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GCCAACGTCCCCAGCCACCAC	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											52.0	52.0	52.0					3																	39229303		2203	4300	6503	39204307	SO:0001583	missense	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1634G>C	3.37:g.39229303C>G	ENSP00000343140:p.Gly545Ala	Somatic		Capture	Illumina GAIIx	4	39204307	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839466	0.71488	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.68479	-0.33;-0.33	5.17	4.28	0.50868	.	0.111989	0.64402	D	0.000010	T	0.79986	0.4541	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.81745	-0.0792	10	0.87932	D	0	.	11.0691	0.47993	0.0:0.9097:0.0:0.0903	.	545;545	Q702N8;Q702N8-2	XIRP1_HUMAN;.	A	545	ENSP00000379550:G545A;ENSP00000343140:G545A	ENSP00000343140:G545A	G	-	2	0	XIRP1	39204307	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	3.735000	0.55044	2.583000	0.87209	0.655000	0.94253	GGG		0.602	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522		Missense_Mutation
DSCAM	1826	genome.wustl.edu	37	21	41725485	41725485	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr21:41725485C>T	ENST00000400454.1	-	5	1318	c.841G>A	c.(841-843)Gag>Aag	p.E281K		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	281	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E281K(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGAATGTTCTCAATGAGCAGC	0.552																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Missense(1)	ovary(1)	21											73.0	71.0	72.0					21																	41725485		1953	4145	6098	40647355	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.841G>A	21.37:g.41725485C>T	ENSP00000383303:p.Glu281Lys	Somatic		Capture	Illumina GAIIx	4	40647355	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163803	0.57476	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.66460	-0.21;-0.21	5.32	5.32	0.75619	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.62527	0.2435	N	0.03903	-0.33	0.58432	D	0.999993	D	0.71674	0.998	D	0.79108	0.992	T	0.61461	-0.7058	10	0.10377	T	0.69	.	19.3377	0.94326	0.0:1.0:0.0:0.0	.	281	O60469	DSCAM_HUMAN	K	281;33	ENSP00000383303:E281K;ENSP00000385342:E33K	ENSP00000383303:E281K	E	-	1	0	DSCAM	40647355	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.354000	0.79424	2.634000	0.89283	0.655000	0.94253	GAG		0.552	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Missense_Mutation
TCF20	6942	genome.wustl.edu	37	22	42605820	42605820	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr22:42605820G>C	ENST00000359486.3	-	1	5628	c.5492C>G	c.(5491-5493)aCt>aGt	p.T1831S	TCF20_ENST00000335626.4_Missense_Mutation_p.T1831S|TCF20_ENST00000404876.1_Missense_Mutation_p.T132S	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1831					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.T1831S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ACCTTCTGAAGTGGTGGGCAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	22											125.0	128.0	127.0					22																	42605820		2203	4300	6503	40935764	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.5492C>G	22.37:g.42605820G>C	ENSP00000352463:p.Thr1831Ser	Somatic		Capture	Illumina GAIIx	4	40935764	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	37	CCDS14033.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	2.025	-0.423903	0.04734	.	.	ENSG00000100207	ENST00000359486;ENST00000335626;ENST00000404876	T;T;T	0.67698	0.34;0.34;-0.28	6.07	4.87	0.63330	.	0.147419	0.46758	D	0.000275	T	0.49184	0.1542	N	0.11560	0.145	0.35667	D	0.812983	B;B	0.16166	0.016;0.01	B;B	0.16289	0.015;0.007	T	0.54221	-0.8326	10	0.42905	T	0.14	-11.2034	16.2658	0.82579	0.073:0.0:0.927:0.0	.	1831;1831	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	S	1831;1831;132	ENSP00000352463:T1831S;ENSP00000335561:T1831S;ENSP00000385531:T132S	ENSP00000335561:T1831S	T	-	2	0	TCF20	40935764	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	2.105000	0.41825	2.884000	0.98904	0.655000	0.94253	ACT		0.542	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492		Missense_Mutation
EPSTI1	94240	genome.wustl.edu	37	13	43462622	43462622	+	IGR	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr13:43462622A>G	ENST00000398762.3	-	0	957				EPSTI1_ENST00000313624.7_3'UTR|EPSTI1_ENST00000313640.7_Silent_p.L333L			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)									p.L333L(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		ATAGGAGTCAATATTTTCTCA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	13											60.0	65.0	63.0					13																	43462622		2203	4300	6503	42360622	SO:0001628	intergenic_variant	94240			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814		13.37:g.43462622A>G		Somatic		Capture	Illumina GAIIx	4	42360622	Q8IVC7|Q8NDQ7	Silent	SNP	ENST00000398762.3	37	CCDS9387.1	SNP	4	WashU																																																																																				0.343	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264		Silent
TDRD6	221400	genome.wustl.edu	37	6	46658791	46658791	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr6:46658791T>C	ENST00000316081.6	+	1	2926	c.2926T>C	c.(2926-2928)Ttc>Ctc	p.F976L	TDRD6_ENST00000544460.1_Missense_Mutation_p.F976L|RP11-446F17.3_ENST00000434329.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	976					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)		p.F976L(1)		NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			ACATTCCTACTTCTATTCTAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											55.0	61.0	59.0					6																	46658791		2203	4300	6503	46766750	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2926T>C	6.37:g.46658791T>C	ENSP00000346065:p.Phe976Leu	Somatic		Capture	Illumina GAIIx	4	46766750	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111415	0.56398	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.13657	2.57;2.58	5.74	5.74	0.90152	.	0.435822	0.27206	N	0.020422	T	0.06371	0.0164	L	0.46157	1.445	0.37724	D	0.92501	B;B	0.31274	0.317;0.212	B;B	0.30572	0.117;0.055	T	0.18935	-1.0321	10	0.15066	T	0.55	-1.6617	16.0326	0.80588	0.0:0.0:0.0:1.0	.	976;976	F5H5M3;O60522	.;TDRD6_HUMAN	L	976	ENSP00000443299:F976L;ENSP00000346065:F976L	ENSP00000346065:F976L	F	+	1	0	TDRD6	46766750	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.579000	0.82511	2.185000	0.69588	0.528000	0.53228	TTC		0.393	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443		Missense_Mutation
ACP2	53	genome.wustl.edu	37	11	47266885	47266885	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:47266885A>G	ENST00000256997.3	-	6	726	c.610T>C	c.(610-612)Tgg>Cgg	p.W204R	ACP2_ENST00000533929.1_Missense_Mutation_p.W176R|ACP2_ENST00000527256.1_Missense_Mutation_p.W172R|ACP2_ENST00000525230.1_5'Flank|ACP2_ENST00000529444.1_Intron|ACP2_ENST00000530453.1_Intron|ACP2_ENST00000537863.1_Missense_Mutation_p.W17R	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	204					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)	p.W204R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						TAGACATTCCAGACGGTCTCC	0.537																																					Melanoma(90;262 1440 11488 44828 48531)											1	Substitution - Missense(1)	ovary(1)	11											161.0	156.0	158.0					11																	47266885		2201	4298	6499	47223461	SO:0001583	missense	53			X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.610T>C	11.37:g.47266885A>G	ENSP00000256997:p.Trp204Arg	Somatic		Capture	Illumina GAIIx	4	47223461	E9PCI1|Q561W5|Q9BTU7	Missense_Mutation	SNP	ENST00000256997.3	37	CCDS7928.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	16.33	3.092456	0.55968	.	.	ENSG00000134575	ENST00000256997;ENST00000527256;ENST00000537863;ENST00000540414;ENST00000533929;ENST00000529663	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	4.67	4.67	0.58626	.	0.106321	0.64402	D	0.000001	T	0.56587	0.1995	M	0.86343	2.81	0.80722	D	1	B;B;P;B	0.36144	0.401;0.141;0.539;0.264	P;B;P;B	0.47402	0.546;0.263;0.495;0.356	T	0.64812	-0.6319	10	0.87932	D	0	.	14.2691	0.66140	1.0:0.0:0.0:0.0	.	172;176;194;204	B7Z7D2;E9PQY3;F5H1S6;P11117	.;.;.;PPAL_HUMAN	R	204;172;17;194;176;171	ENSP00000256997:W204R;ENSP00000432205:W172R;ENSP00000441933:W17R;ENSP00000432439:W176R;ENSP00000436487:W171R	ENSP00000256997:W204R	W	-	1	0	ACP2	47223461	1.000000	0.71417	0.996000	0.52242	0.952000	0.60782	8.435000	0.90297	1.954000	0.56735	0.379000	0.24179	TGG		0.537	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392022.2	NM_001610		Missense_Mutation
MADD	8567	genome.wustl.edu	37	11	47333386	47333386	+	Missense_Mutation	SNP	C	C	T	rs146118440		TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:47333386C>T	ENST00000311027.5	+	29	4427	c.4262C>T	c.(4261-4263)gCg>gTg	p.A1421V	MADD_ENST00000395344.3_Missense_Mutation_p.A1315V|MADD_ENST00000402799.1_Missense_Mutation_p.A1319V|MADD_ENST00000406482.1_Missense_Mutation_p.A1319V|MADD_ENST00000342922.4_Missense_Mutation_p.A1362V|MADD_ENST00000405573.2_Missense_Mutation_p.A231V|MADD_ENST00000402192.2_Missense_Mutation_p.A1361V|MADD_ENST00000407859.3_Missense_Mutation_p.A1339V|MADD_ENST00000349238.3_Missense_Mutation_p.A1382V|MADD_ENST00000395336.3_Missense_Mutation_p.A1421V	NM_003682.3	NP_003673.3			MAP-kinase activating death domain									p.A1421V(1)		breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		GATCAGCTGGCGAACCTGGTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	11						C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4402		0,0,2201	81.0	70.0	74.0		3953,3944,4262,4085,4016,3956,4145,3956,4262,4082	2.2	0.3	11	dbSNP_134	74	1,8595		0,1,4297	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MADD	NM_001135943.1,NM_001135944.1,NM_003682.3,NM_130470.2,NM_130471.2,NM_130472.2,NM_130473.2,NM_130474.2,NM_130475.2,NM_130476.2	64,64,64,64,64,64,64,64,64,64	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	1318/1545,1315/1542,1421/1648,1362/1589,1339/1566,1319/1546,1382/1609,1319/1480,1421/1582,1361/1588	47333386	1,12997	2201	4298	6499	47289962	SO:0001583	missense	8567			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4262C>T	11.37:g.47333386C>T	ENSP00000310933:p.Ala1421Val	Somatic		Capture	Illumina GAIIx	4	47289962		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816461	0.32145	0.0	1.16E-4	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.46451	3.49;3.37;3.37;3.49;3.47;3.37;3.37;3.47;3.49;0.87	5.14	2.25	0.28309	.	0.242700	0.41001	N	0.000973	T	0.18964	0.0455	N	0.08118	0	0.41751	D	0.98966	B;B;B;B;B;B;B;B;B;B;B	0.31290	0.039;0.081;0.047;0.003;0.079;0.132;0.132;0.001;0.318;0.002;0.001	B;B;B;B;B;B;B;B;B;B;B	0.26693	0.018;0.017;0.033;0.002;0.072;0.072;0.038;0.003;0.072;0.001;0.003	T	0.06041	-1.0849	10	0.30854	T	0.27	-1.985	8.0317	0.30470	0.1294:0.7317:0.0:0.1389	.	231;1315;1315;1421;1319;1319;1319;1382;1339;1421;1362	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	V	1362;1319;1319;1319;1382;1421;1339;1315;1421;1361;231	ENSP00000343902:A1362V;ENSP00000385585:A1319V;ENSP00000384435:A1319V;ENSP00000304505:A1382V;ENSP00000310933:A1421V;ENSP00000384204:A1339V;ENSP00000378753:A1315V;ENSP00000378745:A1421V;ENSP00000384287:A1361V;ENSP00000384483:A231V	ENSP00000310933:A1421V	A	+	2	0	MADD	47289962	0.916000	0.31088	0.254000	0.24359	0.691000	0.40173	1.947000	0.40293	0.185000	0.20105	-0.222000	0.12452	GCG		0.502	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317746.1			Missense_Mutation
KRT6B	3854	genome.wustl.edu	37	12	52845636	52845636	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:52845636C>G	ENST00000252252.3	-	1	274	c.227G>C	c.(226-228)aGc>aCc	p.S76T		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	76	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.S76T(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GATGGCACAGCTGCCCCCTCC	0.652																																																1	Substitution - Missense(1)	ovary(1)	12											3.0	4.0	4.0					12																	52845636		1778	3631	5409	51131903	SO:0001583	missense	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.227G>C	12.37:g.52845636C>G	ENSP00000252252:p.Ser76Thr	Somatic		Capture	Illumina GAIIx	4	51131903	P48669	Missense_Mutation	SNP	ENST00000252252.3	37	CCDS8828.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638720	0.29157	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	T	0.35236	1.32	2.97	2.07	0.26955	.	0.093959	0.48286	D	0.000198	T	0.23965	0.0580	L	0.54323	1.7	0.28537	N	0.912285	P	0.37781	0.608	B	0.24701	0.055	T	0.16748	-1.0392	10	0.45353	T	0.12	.	6.0496	0.19779	0.0:0.8549:0.0:0.1451	.	76	P04259	K2C6B_HUMAN	T	76	ENSP00000252252:S76T	ENSP00000252252:S76T	S	-	2	0	KRT6B	51131903	0.087000	0.21565	0.996000	0.52242	0.740000	0.42216	1.611000	0.36879	0.831000	0.34780	0.298000	0.19748	AGC		0.652	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555		Missense_Mutation
CCDC8	83987	genome.wustl.edu	37	19	46915369	46915369	+	Silent	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr19:46915369G>A	ENST00000307522.3	-	1	1472	c.699C>T	c.(697-699)agC>agT	p.S233S		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	233					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S233S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		ATACCCCTGCGCTCTCCACTG	0.711																																																1	Substitution - coding silent(1)	ovary(1)	19											20.0	23.0	22.0					19																	46915369		2194	4284	6478	51607209	SO:0001819	synonymous_variant	83987			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.699C>T	19.37:g.46915369G>A		Somatic		Capture	Illumina GAIIx	4	51607209	Q8TB26	Silent	SNP	ENST00000307522.3	37	CCDS12685.1	SNP	38	WashU																																																																																				0.711	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040		Silent
ANKRD52	283373	genome.wustl.edu	37	12	56641394	56641394	+	Splice_Site	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:56641394C>T	ENST00000267116.7	-	20	2188	c.2067G>A	c.(2065-2067)caG>caA	p.Q689Q	ANKRD52_ENST00000548241.1_5'Flank	NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	689										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						TCAGTGGGGTCCTACAGAAGG	0.577																																																0			12											44.0	47.0	46.0					12																	56641394		2131	4273	6404	54927661	SO:0001630	splice_region_variant	0			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.2067-1G>A	12.37:g.56641394C>T		Somatic		Capture	Illumina GAIIx	4	54927661	A6NE79|B1Q2K2	Silent	SNP	ENST00000267116.7	37	CCDS44920.1	SNP	30	WashU																																																																																				0.577	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595	Silent	Silent
OR5M3	219482	genome.wustl.edu	37	11	56237502	56237502	+	Missense_Mutation	SNP	T	T	C	rs148100298	byFrequency	TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:56237502T>C	ENST00000312240.2	-	1	512	c.472A>G	c.(472-474)Aca>Gca	p.T158A		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T158A(1)|p.T158P(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					GTCCATAATGTTGCTGCCAGA	0.428																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	11											122.0	112.0	115.0					11																	56237502		2201	4295	6496	55994078	SO:0001583	missense	219482			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.472A>G	11.37:g.56237502T>C	ENSP00000312208:p.Thr158Ala	Somatic		Capture	Illumina GAIIx	4	55994078	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	ENST00000312240.2	37	CCDS31532.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	12.21	1.870782	0.33069	.	.	ENSG00000174937	ENST00000312240	T	0.00256	8.42	5.22	4.07	0.47477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000173	T	0.00412	0.0013	L	0.60904	1.88	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51411	-0.8709	10	0.48119	T	0.1	-6.2895	10.3656	0.44021	0.1471:0.0:0.0:0.8529	.	158	Q8NGP4	OR5M3_HUMAN	A	158	ENSP00000312208:T158A	ENSP00000312208:T158A	T	-	1	0	OR5M3	55994078	0.000000	0.05858	0.015000	0.15790	0.560000	0.35617	0.095000	0.15127	0.796000	0.33947	0.448000	0.29417	ACA		0.428	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742		Missense_Mutation
OR9Q2	219957	genome.wustl.edu	37	11	57958276	57958276	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:57958276C>A	ENST00000311591.3	+	1	371	c.314C>A	c.(313-315)aCc>aAc	p.T105N		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T105N(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				TTCCTCTTCACCTTCTTTGCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											205.0	159.0	175.0					11																	57958276		2201	4296	6497	57714852	SO:0001583	missense	219957			AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.314C>A	11.37:g.57958276C>A	ENSP00000308714:p.Thr105Asn	Somatic		Capture	Illumina GAIIx	4	57714852		Missense_Mutation	SNP	ENST00000311591.3	37	CCDS31544.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404690	0.42613	.	.	ENSG00000186513	ENST00000311591	T	0.00557	6.62	5.54	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000144	T	0.00524	0.0017	L	0.43646	1.37	0.30725	N	0.747794	B	0.26577	0.153	B	0.25614	0.062	T	0.24977	-1.0145	10	0.62326	D	0.03	-28.3165	6.9541	0.24562	0.157:0.7098:0.0:0.1332	.	105	Q8NGE9	OR9Q2_HUMAN	N	105	ENSP00000308714:T105N	ENSP00000308714:T105N	T	+	2	0	OR9Q2	57714852	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.125000	0.10579	2.765000	0.95021	0.655000	0.94253	ACC		0.577	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283		Missense_Mutation
DDX42	11325	genome.wustl.edu	37	17	61895513	61895513	+	Missense_Mutation	SNP	C	C	T	rs533590615		TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr17:61895513C>T	ENST00000578681.1	+	19	3173	c.2572C>T	c.(2572-2574)Cgg>Tgg	p.R858W	DDX42_ENST00000582985.1_Intron|DDX42_ENST00000583590.1_Missense_Mutation_p.R858W|DDX42_ENST00000359353.5_Missense_Mutation_p.R739W|DDX42_ENST00000457800.2_Missense_Mutation_p.R858W|DDX42_ENST00000389924.2_Missense_Mutation_p.R858W	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	858	Gly-rich.|His-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.R858W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TGATGGCCATCGGCACGGGGA	0.567													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18490	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											82.0	81.0	82.0					17																	61895513		2203	4300	6503	59249245	SO:0001583	missense	11325			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2572C>T	17.37:g.61895513C>T	ENSP00000464050:p.Arg858Trp	Somatic		Capture	Illumina GAIIx	4	59249245	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092523	0.36952	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.22539	1.95;1.95	5.06	4.09	0.47781	.	0.978663	0.08392	N	0.952792	T	0.37705	0.1013	L	0.56769	1.78	0.52099	D	0.999944	D;D	0.69078	0.997;0.99	P;B	0.59889	0.865;0.336	T	0.06267	-1.0836	10	0.87932	D	0	-1.8055	7.7976	0.29156	0.1605:0.7579:0.0:0.0817	.	404;858	B3KV84;Q86XP3	.;DDX42_HUMAN	W	858;858;575	ENSP00000374574:R858W;ENSP00000390121:R858W	ENSP00000352308:R575W	R	+	1	2	DDX42	59249245	0.996000	0.38824	0.999000	0.59377	0.646000	0.38490	3.394000	0.52551	1.353000	0.45828	0.467000	0.42956	CGG		0.567	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372		Missense_Mutation
NLRP9	338321	genome.wustl.edu	37	19	56241220	56241220	+	Silent	SNP	A	A	T			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr19:56241220A>T	ENST00000332836.2	-	3	1998	c.1971T>A	c.(1969-1971)ccT>ccA	p.P657P		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	657						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.P657P(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GTTTACAAACAGGCTGAGCCA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	19											82.0	81.0	81.0					19																	56241220		2203	4300	6503	60933032	SO:0001819	synonymous_variant	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1971T>A	19.37:g.56241220A>T		Somatic		Capture	Illumina GAIIx	4	60933032	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1	SNP	7	WashU																																																																																				0.418	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820		Silent
CLVS1	157807	genome.wustl.edu	37	8	62212549	62212549	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:62212549C>G	ENST00000519846.1	+	3	635	c.163C>G	c.(163-165)Caa>Gaa	p.Q55E	CLVS1_ENST00000518592.1_Intron|RP11-787D18.1_ENST00000518064.1_RNA|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000325897.4_Missense_Mutation_p.Q55E			Q8IUQ0	CLVS1_HUMAN	clavesin 1	55					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.Q55E(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						GGATATTCAGCAAGTCAGGGA	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											118.0	102.0	108.0					8																	62212549		2203	4300	6503	62375103	SO:0001583	missense	157807			AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.163C>G	8.37:g.62212549C>G	ENSP00000428402:p.Gln55Glu	Somatic		Capture	Illumina GAIIx	4	62375103	B2R7M5|C8UZT3|Q8NB32	Missense_Mutation	SNP	ENST00000519846.1	37	CCDS6176.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298435	0.10622	.	.	ENSG00000177182	ENST00000522621;ENST00000519846;ENST00000325897	D;D	0.83992	-1.79;-1.79	5.79	5.79	0.91817	Phosphatidylinositol transfer protein-like, N-terminal (1);Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.68613	0.3020	N	0.11000	0.08	0.58432	D	0.999998	B;B;B	0.11235	0.004;0.001;0.0	B;B;B	0.11329	0.006;0.002;0.002	T	0.65475	-0.6159	10	0.02654	T	1	-1.9742	20.0313	0.97540	0.0:1.0:0.0:0.0	.	55;55;55	E5RK22;Q8IUQ0;Q8IUQ0-2	.;CLVS1_HUMAN;.	E	55	ENSP00000428402:Q55E;ENSP00000325506:Q55E	ENSP00000325506:Q55E	Q	+	1	0	CLVS1	62375103	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.417000	0.52714	2.746000	0.94184	0.655000	0.94253	CAA		0.463	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		Missense_Mutation
MTHFD1	4522	genome.wustl.edu	37	14	64886542	64886542	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr14:64886542G>C	ENST00000545908.1	+	8	1023	c.794G>C	c.(793-795)gGt>gCt	p.G265A	MTHFD1_ENST00000216605.8_Missense_Mutation_p.G209A			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	209	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)	p.G209A(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	GTAAATAAAGGTGACATCCTG	0.418																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)											1	Substitution - Missense(1)	ovary(1)	14											102.0	97.0	98.0					14																	64886542		2203	4300	6503	63956295	SO:0001583	missense	4522			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.794G>C	14.37:g.64886542G>C	ENSP00000438588:p.Gly265Ala	Somatic		Capture	Illumina GAIIx	4	63956295	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	3.318	-0.139452	0.06669	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.74	2.78	0.32641	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.113050	0.64402	N	0.000013	T	0.04363	0.0120	N	0.00003	-3.43	0.35521	D	0.801453	B;B;B	0.12630	0.006;0.002;0.002	B;B;B	0.12156	0.003;0.002;0.007	T	0.50996	-0.8761	10	0.02654	T	1	-6.8447	15.3814	0.74658	0.0:0.6357:0.3643:0.0	.	265;209;209	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	A	265;209;265;189	ENSP00000438588:G265A;ENSP00000450560:G209A;ENSP00000216605:G265A;ENSP00000451309:G189A	ENSP00000216605:G209A	G	+	2	0	MTHFD1	63956295	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.610000	0.61155	0.749000	0.32854	-0.182000	0.12963	GGT		0.418	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1			Missense_Mutation
SLC39A11	201266	genome.wustl.edu	37	17	71027735	71027735	+	Missense_Mutation	SNP	G	G	A	rs202154945		TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr17:71027735G>A	ENST00000542342.2	-	4	354	c.266C>T	c.(265-267)gCg>gTg	p.A89V	SLC39A11_ENST00000255559.3_Missense_Mutation_p.A89V|SLC39A11_ENST00000579732.1_Missense_Mutation_p.A89V	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	89					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.A89V(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GACAAAAGCCGCTCCAAGGGT	0.537																																					NSCLC(95;736 1527 12296 39625 41839)											1	Substitution - Missense(1)	ovary(1)	17											91.0	87.0	88.0					17																	71027735		2203	4300	6503	68539330	SO:0001583	missense	201266			AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.266C>T	17.37:g.71027735G>A	ENSP00000445829:p.Ala89Val	Somatic		Capture	Illumina GAIIx	4	68539330	B2R8H7|Q8WZ81	Missense_Mutation	SNP	ENST00000542342.2	37	CCDS54160.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957194	0.92726	.	.	ENSG00000133195	ENST00000542342;ENST00000255559	T;T	0.48201	0.82;0.82	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.61451	0.2348	L	0.45744	1.44	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.79784	0.993;0.79	T	0.53906	-0.8372	10	0.21540	T	0.41	.	17.6607	0.88192	0.0:0.0:1.0:0.0	.	89;89	Q8N1S5;Q8N1S5-2	S39AB_HUMAN;.	V	89	ENSP00000445829:A89V;ENSP00000255559:A89V	ENSP00000255559:A89V	A	-	2	0	SLC39A11	68539330	1.000000	0.71417	0.163000	0.22734	0.946000	0.59487	8.563000	0.90723	2.514000	0.84764	0.655000	0.94253	GCG		0.537	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1			Missense_Mutation
TET1	80312	genome.wustl.edu	37	10	70406107	70406107	+	Silent	SNP	T	T	G			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr10:70406107T>G	ENST00000373644.4	+	4	3830	c.3621T>G	c.(3619-3621)ccT>ccG	p.P1207P		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1207					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.P1207P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ATGATTTTCCTACTGTATTTG	0.388																																																1	Substitution - coding silent(1)	ovary(1)	10											55.0	56.0	56.0					10																	70406107		2203	4300	6503	70076113	SO:0001819	synonymous_variant	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.3621T>G	10.37:g.70406107T>G		Somatic		Capture	Illumina GAIIx	4	70076113	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1	SNP	53	WashU																																																																																				0.388	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		Silent
SENP8	123228	genome.wustl.edu	37	15	72432489	72432489	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr15:72432489T>A	ENST00000542035.2	+	2	858	c.525T>A	c.(523-525)tgT>tgA	p.C175*	SENP8_ENST00000544411.1_Nonsense_Mutation_p.C175*|SENP8_ENST00000544171.1_Nonsense_Mutation_p.C175*|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000340912.4_Nonsense_Mutation_p.C175*	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	175							cysteine-type peptidase activity (GO:0008234)	p.C175*(1)		breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						AGGCCTTGTGTCAGAACTTCT	0.468																																																1	Substitution - Nonsense(1)	ovary(1)	15											115.0	110.0	111.0					15																	72432489		2199	4297	6496	70219543	SO:0001587	stop_gained	123228			BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.525T>A	15.37:g.72432489T>A	ENSP00000446057:p.Cys175*	Somatic		Capture	Illumina GAIIx	4	70219543	Q96QA4	Nonsense_Mutation	SNP	ENST00000542035.2	37	CCDS10240.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	37	6.488930	0.97607	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	.	.	.	5.86	0.997	0.19851	.	0.048858	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3676	10.0397	0.42151	0.0:0.3912:0.0:0.6088	.	.	.	.	X	175	.	ENSP00000340505:C175X	C	+	3	2	SENP8	70219543	1.000000	0.71417	0.974000	0.42286	0.991000	0.79684	0.574000	0.23714	-0.071000	0.12886	0.528000	0.53228	TGT		0.468	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420036.1	NM_145204		Nonsense_Mutation
LMBRD1	55788	genome.wustl.edu	37	6	70407490	70407490	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr6:70407490G>A	ENST00000370577.3	-	14	1611	c.1382C>T	c.(1381-1383)tCt>tTt	p.S461F	LMBRD1_ENST00000370570.1_Missense_Mutation_p.S388F	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	461					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.S461F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						CTTTGGCACAGAAAGGGTTGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	6											106.0	106.0	106.0					6																	70407490		2203	4300	6503	70464211	SO:0001583	missense	55788			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1382C>T	6.37:g.70407490G>A	ENSP00000359609:p.Ser461Phe	Somatic		Capture	Illumina GAIIx	4	70464211	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	37	CCDS4969.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	9.318	1.057315	0.19907	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.18338	2.22;2.22	5.71	3.93	0.45458	.	0.590771	0.20063	N	0.100027	T	0.02418	0.0074	N	0.16478	0.41	0.21386	N	0.999709	B	0.02656	0.0	B	0.01281	0.0	T	0.44112	-0.9349	10	0.09338	T	0.73	-1.6191	7.3492	0.26680	0.1546:0.141:0.7044:0.0	.	461	Q9NUN5	LMBD1_HUMAN	F	461;388	ENSP00000359609:S461F;ENSP00000359602:S388F	ENSP00000359602:S388F	S	-	2	0	LMBRD1	70464211	0.058000	0.20735	0.928000	0.36995	0.920000	0.55202	0.553000	0.23391	1.432000	0.47375	-0.143000	0.13931	TCT		0.313	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368		Missense_Mutation
RGAG4	340526	genome.wustl.edu	37	X	71350666	71350666	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:71350666C>T	ENST00000545866.1	-	1	1092	c.725G>A	c.(724-726)cGc>cAc	p.R242H	NHSL2_ENST00000540800.1_Intron|RGAG4_ENST00000609883.1_Missense_Mutation_p.R242H|NHSL2_ENST00000373677.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	242								p.R315H(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CTTGAGCTTGCGAATGGCCTT	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											45.0	45.0	45.0					X																	71350666		1954	4142	6096	71267391	SO:0001583	missense	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.725G>A	X.37:g.71350666C>T	ENSP00000441366:p.Arg242His	Somatic		Capture	Illumina GAIIx	4	71267391	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	CCDS55446.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891711	0.52014	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.14391	2.51;2.51	4.23	3.31	0.37934	Retrotransposon gag protein (1);	.	.	.	.	T	0.07908	0.0198	N	0.20685	0.6	0.24268	N	0.995255	B	0.21753	0.06	B	0.17722	0.019	T	0.36696	-0.9737	8	.	.	.	-0.7865	5.6841	0.17792	0.0:0.8384:0.0:0.1616	.	242	Q5HYW3	RGAG4_HUMAN	H	242	ENSP00000441366:R242H;ENSP00000418667:R242H	.	R	-	2	0	RGAG4	71267391	0.216000	0.23585	0.776000	0.31678	0.981000	0.71138	0.207000	0.17395	1.041000	0.40125	0.529000	0.55759	CGC		0.552	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455		Missense_Mutation
HCCAT5	283902	genome.wustl.edu	37	16	73127104	73127104	+	lincRNA	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr16:73127104T>C	ENST00000569990.2	+	0	762					NR_027756.1				hepatocellular carcinoma associated transcript 5 (non-protein coding)									p.M50T(1)									ACCACGCGCATGCAGAGGTAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											38.0	38.0	38.0					16																	73127104		2018	4169	6187	71684605			283902					16q22.3	2014-06-20			ENSG00000260880	ENSG00000260880		"""Long non-coding RNAs"""	48612	non-coding RNA	RNA, long non-coding	"""hepatoma associated gene"""	615613				20130911, 23314567	Standard	NR_027756		Approved	HTA, FJ222407			OTTHUMG00000172964		16.37:g.73127104T>C		Somatic		Capture	Illumina GAIIx	4	71684605		Missense_Mutation	SNP	ENST00000569990.2	37		SNP	51	WashU																																																																																				0.542	HCCAT5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000440524.1	NR_027756		Missense_Mutation
CCDC33	80125	genome.wustl.edu	37	15	74560788	74560788	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr15:74560788A>T	ENST00000398814.3	+	5	966	c.535A>T	c.(535-537)Atg>Ttg	p.M179L	CCDC33_ENST00000321288.5_Missense_Mutation_p.M382L	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	382								p.M179L(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CTGCAACCACATGGCTCTGGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	15											39.0	44.0	42.0					15																	74560788		1921	4141	6062	72347841	SO:0001583	missense	80125			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.535A>T	15.37:g.74560788A>T	ENSP00000381795:p.Met179Leu	Somatic		Capture	Illumina GAIIx	4	72347841	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	ENST00000398814.3	37	CCDS42058.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	0.657	-0.807323	0.02819	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.19669	2.13;2.43	4.69	3.57	0.40892	.	0.596788	0.14684	N	0.304556	T	0.07908	0.0198	N	0.03608	-0.345	0.19575	N	0.999967	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.39683	-0.9602	10	0.11485	T	0.65	.	6.8736	0.24135	0.8925:0.0:0.1075:0.0	.	382;179	C9JFX2;Q8N5R6-6	.;.	L	382;179	ENSP00000325012:M382L;ENSP00000381795:M179L	ENSP00000325012:M382L	M	+	1	0	CCDC33	72347841	0.994000	0.37717	0.799000	0.32177	0.117000	0.20001	2.246000	0.43142	0.661000	0.30985	0.421000	0.28195	ATG		0.622	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791		Missense_Mutation
ALMS1	7840	genome.wustl.edu	37	2	73716958	73716958	+	Silent	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:73716958C>A	ENST00000264448.6	+	10	7980	c.7869C>A	c.(7867-7869)gcC>gcA	p.A2623A	ALMS1_ENST00000409009.1_Silent_p.A2581A|AC096546.1_ENST00000408160.1_RNA	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2623					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.A2623A(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CATGCAGAGCCAAGCATGTCA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	2											78.0	77.0	77.0					2																	73716958		1957	4149	6106	73570466	SO:0001819	synonymous_variant	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7869C>A	2.37:g.73716958C>A		Somatic		Capture	Illumina GAIIx	4	73570466	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1	SNP	21	WashU																																																																																				0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		Silent
PCNPP4	100874220	genome.wustl.edu	37	X	74758408	74758408	+	IGR	SNP	G	G	T			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:74758408G>T								ZDHHC15 (15071 upstream) : MAGEE2 (244414 downstream)																							GCGACCAGAAGTTTTCCCTCC	0.468																																																0			X																																								74675133	SO:0001628	intergenic_variant																																X.37:g.74758408G>T		Somatic		Capture	Illumina GAIIx	4	74675133		Missense_Mutation	SNP		37		SNP	36	WashU																																																																																			0	0.468									Missense_Mutation
ZFHX4	79776	genome.wustl.edu	37	8	77767042	77767042	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:77767042A>C	ENST00000521891.2	+	10	8333	c.7885A>C	c.(7885-7887)Aat>Cat	p.N2629H	ZFHX4_ENST00000455469.2_Missense_Mutation_p.N2584H|ZFHX4_ENST00000050961.6_Missense_Mutation_p.N2584H|ZFHX4_ENST00000518282.1_Missense_Mutation_p.N2603H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2584					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N2613H(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCTGGATTCCAATCCTACCAG	0.483										HNSCC(33;0.089)																																						1	Substitution - Missense(1)	ovary(1)	8											39.0	39.0	39.0					8																	77767042		1860	4095	5955	77929597	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7885A>C	8.37:g.77767042A>C	ENSP00000430497:p.Asn2629His	Somatic		Capture	Illumina GAIIx	4	77929597	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	11.17	1.559505	0.27827	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.47093	U	0.000246	D	0.96442	0.8839	L	0.39147	1.195	0.80722	D	1	D;D;P	0.57571	0.98;0.976;0.941	P;P;P	0.60473	0.875;0.802;0.755	D	0.96857	0.9629	10	0.59425	D	0.04	.	15.4359	0.75146	1.0:0.0:0.0:0.0	.	2584;2584;2629	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	H	2629;2613;2584;2584;2603	ENSP00000430497:N2629H;ENSP00000399605:N2584H;ENSP00000050961:N2584H;ENSP00000430848:N2603H	ENSP00000050961:N2584H	N	+	1	0	ZFHX4	77929597	1.000000	0.71417	1.000000	0.80357	0.179000	0.23085	9.139000	0.94554	2.230000	0.72887	0.528000	0.53228	AAT		0.483	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		Missense_Mutation
ANTXR2	118429	genome.wustl.edu	37	4	80952837	80952837	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr4:80952837G>A	ENST00000307333.7	-	10	808	c.806C>T	c.(805-807)cCa>cTa	p.P269L	ANTXR2_ENST00000295465.4_Missense_Mutation_p.P269L|ANTXR2_ENST00000346652.6_Intron|ANTXR2_ENST00000404191.1_Missense_Mutation_p.P192L|ANTXR2_ENST00000403729.2_Missense_Mutation_p.P269L	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	269					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)	p.P269L(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						TACACTTACTGGTTTTACACC	0.313									Juvenile Hyaline Fibromatosis																																							1	Substitution - Missense(1)	ovary(1)	4											47.0	46.0	46.0					4																	80952837		1816	4066	5882	81171861	SO:0001583	missense	118429	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.806C>T	4.37:g.80952837G>A	ENSP00000306185:p.Pro269Leu	Somatic		Capture	Illumina GAIIx	4	81171861	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Missense_Mutation	SNP	ENST00000307333.7	37	CCDS47086.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027456	0.54683	.	.	ENSG00000163297	ENST00000403729;ENST00000404191;ENST00000307333;ENST00000295465	D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49	5.05	5.05	0.67936	Anthrax toxin receptor, extracellular (1);	0.000000	0.85682	D	0.000000	D	0.97424	0.9157	M	0.83774	2.66	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98012	1.0366	10	0.72032	D	0.01	-6.3248	18.796	0.91994	0.0:0.0:1.0:0.0	.	269;269	P58335;P58335-4	ANTR2_HUMAN;.	L	269;192;269;269	ENSP00000385575:P269L;ENSP00000384028:P192L;ENSP00000306185:P269L;ENSP00000295465:P269L	ENSP00000295465:P269L	P	-	2	0	ANTXR2	81171861	1.000000	0.71417	0.961000	0.40146	0.160000	0.22226	7.349000	0.79376	2.491000	0.84063	0.557000	0.71058	CCA		0.313	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172		Missense_Mutation
GRID1	2894	genome.wustl.edu	37	10	87487708	87487708	+	Silent	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr10:87487708G>A	ENST00000327946.7	-	10	1522	c.1437C>T	c.(1435-1437)ggC>ggT	p.G479G	GRID1_ENST00000536331.1_Silent_p.G50G	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	479					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.G479G(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CATATTTAAAGCCCAGAGCCT	0.532										Multiple Myeloma(13;0.14)																																						1	Substitution - coding silent(1)	ovary(1)	10											169.0	162.0	164.0					10																	87487708		2203	4300	6503	87477688	SO:0001819	synonymous_variant	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1437C>T	10.37:g.87487708G>A		Somatic		Capture	Illumina GAIIx	4	87477688	B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1	SNP	34	WashU																																																																																				0.532	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		Silent
TRRAP	8295	genome.wustl.edu	37	7	98581113	98581113	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr7:98581113C>T	ENST00000359863.4	+	59	9241	c.9032C>T	c.(9031-9033)tCa>tTa	p.S3011L	TRRAP_ENST00000355540.3_Intron|TRRAP_ENST00000446306.3_Intron	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3011	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			atgcattcatcatgtaatttt	0.493																																																0			7											51.0	45.0	47.0					7																	98581113		2203	4300	6503	98419049	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.9032C>T	7.37:g.98581113C>T	ENSP00000352925:p.Ser3011Leu	Somatic		Capture	Illumina GAIIx	4	98419049	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114941	0.56505	.	.	ENSG00000196367	ENST00000359863	T	0.03065	4.06	5.24	5.24	0.73138	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.381500	0.24640	N	0.036811	T	0.03651	0.0104	.	.	.	0.80722	D	1	B	0.20988	0.05	B	0.19946	0.027	T	0.53858	-0.8379	9	0.18276	T	0.48	.	15.9674	0.79985	0.0:1.0:0.0:0.0	.	3011	Q9Y4A5	TRRAP_HUMAN	L	3011	ENSP00000352925:S3011L	ENSP00000352925:S3011L	S	+	2	0	TRRAP	98419049	.	.	1.000000	0.80357	0.999000	0.98932	.	.	2.455000	0.83008	0.650000	0.86243	TCA		0.493	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496		Missense_Mutation
RRP12	23223	genome.wustl.edu	37	10	99141485	99141485	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr10:99141485G>A	ENST00000370992.4	-	11	1418	c.1307C>T	c.(1306-1308)aCg>aTg	p.T436M	RRP12_ENST00000414986.1_Missense_Mutation_p.T375M|RRP12_ENST00000536831.1_Missense_Mutation_p.T154M|RRP12_ENST00000315563.6_Missense_Mutation_p.T336M	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	436						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.T436M(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		GAGGCTCTGCGTAGCAGCAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	58.0	62.0					10																	99141485		2203	4300	6503	99131475	SO:0001583	missense	23223				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1307C>T	10.37:g.99141485G>A	ENSP00000360031:p.Thr436Met	Somatic		Capture	Illumina GAIIx	4	99131475	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891743	0.72524	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	0.223488	0.48767	D	0.000171	T	0.73337	0.3574	L	0.56769	1.78	0.42336	D	0.992316	D;B;D;D	0.76494	0.999;0.139;0.998;0.998	P;B;P;P	0.59424	0.8;0.052;0.857;0.724	T	0.67699	-0.5603	10	0.22706	T	0.39	-17.4342	19.8221	0.96602	0.0:0.0:1.0:0.0	.	375;336;154;436	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	M	436;336;375;154	ENSP00000360031:T436M;ENSP00000324315:T336M;ENSP00000414863:T375M;ENSP00000446184:T154M	ENSP00000324315:T336M	T	-	2	0	RRP12	99131475	1.000000	0.71417	0.998000	0.56505	0.242000	0.25591	9.563000	0.98148	2.684000	0.91462	0.563000	0.77884	ACG		0.597	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179		Missense_Mutation
BIRC3	330	genome.wustl.edu	37	11	102195983	102195983	+	Missense_Mutation	SNP	C	C	G	rs373514370		TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr11:102195983C>G	ENST00000263464.3	+	2	3493	c.743C>G	c.(742-744)tCt>tGt	p.S248C	BIRC3_ENST00000532808.1_Missense_Mutation_p.S248C	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	248					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S248C(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TACACAGTTTCTAATCTGAGC	0.423			T	MALT1	MALT																																		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	1	Substitution - Missense(1)	ovary(1)	11						C	CYS/SER,CYS/SER	0,4406		0,0,2203	75.0	76.0	76.0		743,743	5.6	0.5	11		76	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	BIRC3	NM_182962.2,NM_001165.4	112,112	0,1,6501	GG,GC,CC		0.0116,0.0,0.0077	benign,benign	248/605,248/605	102195983	1,13003	2203	4299	6502	101701193	SO:0001583	missense	330			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.743C>G	11.37:g.102195983C>G	ENSP00000263464:p.Ser248Cys	Somatic		Capture	Illumina GAIIx	4	101701193	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	37	CCDS8315.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697410	0.48202	0.0	1.16E-4	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609;ENST00000527309	T;T;T	0.72505	3.73;3.73;-0.66	5.55	5.55	0.83447	Baculoviral inhibition of apoptosis protein repeat (1);	0.000000	0.85682	D	0.000000	T	0.70971	0.3285	M	0.67397	2.05	0.80722	D	1	B	0.26002	0.139	B	0.20767	0.031	T	0.67348	-0.5693	10	0.44086	T	0.13	.	19.6873	0.95984	0.0:1.0:0.0:0.0	.	248	Q13489	BIRC3_HUMAN	C	248;248;97;11	ENSP00000263464:S248C;ENSP00000432907:S248C;ENSP00000431718:S11C	ENSP00000263464:S248C	S	+	2	0	BIRC3	101701193	1.000000	0.71417	0.477000	0.27303	0.684000	0.39900	5.445000	0.66594	2.890000	0.99128	0.585000	0.79938	TCT		0.423	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1	NM_001165		Missense_Mutation
BANK1	55024	genome.wustl.edu	37	4	102751175	102751175	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr4:102751175C>T	ENST00000322953.4	+	2	555	c.281C>T	c.(280-282)aCt>aTt	p.T94I	BANK1_ENST00000444316.2_Missense_Mutation_p.T64I|BANK1_ENST00000504592.1_Missense_Mutation_p.T79I|BANK1_ENST00000428908.1_Intron|BANK1_ENST00000508653.1_Intron	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	94	Interaction with ITPR2.				B cell activation (GO:0042113)			p.T94I(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AGAGACCTAACTCCAAAGAAA	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											73.0	75.0	75.0					4																	102751175		2203	4300	6503	102970198	SO:0001583	missense	55024			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.281C>T	4.37:g.102751175C>T	ENSP00000320509:p.Thr94Ile	Somatic		Capture	Illumina GAIIx	4	102970198	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032478	0.54790	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000444316	T;T;T	0.09538	2.97;2.97;2.97	5.18	4.28	0.50868	.	0.355038	0.24405	N	0.038805	T	0.18087	0.0434	L	0.50333	1.59	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.58331	0.837;0.837	T	0.01090	-1.1455	10	0.25751	T	0.34	.	7.8461	0.29426	0.2853:0.574:0.1407:0.0	.	94;79	Q8NDB2;Q8NDB2-2	BANK1_HUMAN;.	I	79;94;64	ENSP00000421443:T79I;ENSP00000320509:T94I;ENSP00000388817:T64I	ENSP00000320509:T94I	T	+	2	0	BANK1	102970198	0.920000	0.31207	0.995000	0.50966	0.997000	0.91878	1.808000	0.38912	2.407000	0.81776	0.650000	0.86243	ACT		0.358	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935		Missense_Mutation
RPH3A	22895	genome.wustl.edu	37	12	113321126	113321126	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:113321126G>A	ENST00000389385.4	+	16	1852	c.1355G>A	c.(1354-1356)cGg>cAg	p.R452Q	RPH3A_ENST00000447659.2_Missense_Mutation_p.R403Q|RPH3A_ENST00000548866.1_Missense_Mutation_p.R403Q|RPH3A_ENST00000415485.3_Missense_Mutation_p.R452Q|RPH3A_ENST00000420983.2_Missense_Mutation_p.R452Q|RPH3A_ENST00000543106.2_Missense_Mutation_p.R452Q|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000551052.1_Missense_Mutation_p.R448Q	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	452	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.R448Q(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AAAACTCTGCGGAATACCCGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											76.0	61.0	66.0					12																	113321126		2203	4300	6503	111805509	SO:0001583	missense	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1355G>A	12.37:g.113321126G>A	ENSP00000374036:p.Arg452Gln	Somatic		Capture	Illumina GAIIx	4	111805509	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	31	5.098000	0.94197	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000038	T	0.73521	0.3597	L	0.41027	1.25	0.58432	D	0.999992	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	P;P;P;P	0.59424	0.817;0.857;0.857;0.817	T	0.75022	-0.3464	10	0.56958	D	0.05	.	18.0287	0.89276	0.0:0.0:1.0:0.0	.	403;452;452;448	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	Q	452;452;403;448;452;403;452;104;104	ENSP00000440384:R452Q;ENSP00000374036:R452Q;ENSP00000413254:R403Q;ENSP00000448297:R448Q;ENSP00000405357:R452Q;ENSP00000450347:R403Q;ENSP00000408889:R452Q	ENSP00000374036:R452Q	R	+	2	0	RPH3A	111805509	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.394000	0.73223	2.546000	0.85860	0.551000	0.68910	CGG		0.562	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		Missense_Mutation
SVEP1	79987	genome.wustl.edu	37	9	113149588	113149588	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr9:113149588C>T	ENST00000401783.2	-	42	10373	c.10037G>A	c.(10036-10038)aGc>aAc	p.S3346N	SVEP1_ENST00000374469.1_Missense_Mutation_p.S3323N|SVEP1_ENST00000297826.5_Missense_Mutation_p.S1272N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3346	Sushi 32. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.S3349N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GACTGGGTGGCTCCAGGTTCC	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											146.0	142.0	143.0					9																	113149588		1918	4122	6040	112189409	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10037G>A	9.37:g.113149588C>T	ENSP00000384917:p.Ser3346Asn	Somatic		Capture	Illumina GAIIx	4	112189409	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089730	0.55968	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.67865	-0.29;-0.29;-0.29	5.09	3.07	0.35406	Complement control module (2);Sushi/SCR/CCP (3);	0.079584	0.85682	N	0.000000	T	0.60843	0.2300	L	0.57130	1.785	0.80722	D	1	B	0.15719	0.014	B	0.20767	0.031	T	0.60752	-0.7201	10	0.46703	T	0.11	.	10.7475	0.46189	0.0:0.796:0.1312:0.0729	.	3346	Q4LDE5	SVEP1_HUMAN	N	3346;3323;1272	ENSP00000384917:S3346N;ENSP00000363593:S3323N;ENSP00000297826:S1272N	ENSP00000297826:S1272N	S	-	2	0	SVEP1	112189409	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.070000	0.50033	1.246000	0.43901	0.650000	0.86243	AGC		0.478	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
CSMD3	114788	genome.wustl.edu	37	8	113694760	113694760	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:113694760C>T	ENST00000297405.5	-	16	2832	c.2588G>A	c.(2587-2589)gGa>gAa	p.G863E	CSMD3_ENST00000352409.3_Missense_Mutation_p.G863E|CSMD3_ENST00000343508.3_Missense_Mutation_p.G823E|CSMD3_ENST00000455883.2_Missense_Mutation_p.G759E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	863	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G863E(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTAATAAATCCTTCTTCACA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											125.0	123.0	124.0					8																	113694760		2203	4300	6503	113763936	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2588G>A	8.37:g.113694760C>T	ENSP00000297405:p.Gly863Glu	Somatic		Capture	Illumina GAIIx	4	113763936	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002593	0.93227	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	5.68	5.68	0.88126	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.91901	0.7436	H	0.94264	3.515	0.52501	D	0.999951	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93134	0.6535	10	0.59425	D	0.04	.	19.7925	0.96464	0.0:1.0:0.0:0.0	.	759;863;823	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	823;863;203;759;863	ENSP00000345799:G823E;ENSP00000297405:G863E;ENSP00000341558:G203E;ENSP00000412263:G759E;ENSP00000343124:G863E	ENSP00000297405:G863E	G	-	2	0	CSMD3	113763936	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.681000	0.91329	0.650000	0.86243	GGA		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
CTTNBP2	83992	genome.wustl.edu	37	7	117351733	117351733	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr7:117351733C>G	ENST00000160373.3	-	23	4941	c.4850G>C	c.(4849-4851)aGa>aCa	p.R1617T	CFTR_ENST00000608965.1_Intron	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1617					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.R1617T(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GACTTTACTTCTAGGAACAGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											184.0	164.0	171.0					7																	117351733		2203	4300	6503	117138969	SO:0001583	missense	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4850G>C	7.37:g.117351733C>G	ENSP00000160373:p.Arg1617Thr	Somatic		Capture	Illumina GAIIx	4	117138969	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	SNP	32	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.38|15.38	2.815233|2.815233	0.50527|0.50527	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.67865|.	-0.29|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.096825|.	0.64402|.	D|.	0.000001|.	T|.	0.77785|.	0.4182|.	M|M	0.83483|0.83483	2.645|2.645	0.44643|0.44643	D|D	0.997625|0.997625	P|.	0.42078|.	0.77|.	B|.	0.37550|.	0.253|.	T|.	0.78868|.	-0.2034|.	10|.	0.72032|.	D|.	0.01|.	-13.1014|-13.1014	14.3844|14.3844	0.66934|0.66934	0.0:0.9298:0.0:0.0702|0.0:0.9298:0.0:0.0702	.|.	1617|.	Q8WZ74|.	CTTB2_HUMAN|.	T|Y	1617|1104	ENSP00000160373:R1617T|.	ENSP00000160373:R1617T|.	R|X	-|-	2|3	0|2	CTTNBP2|CTTNBP2	117138969|117138969	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.888000|1.888000	0.39708|0.39708	2.770000|2.770000	0.95276|0.95276	0.650000|0.650000	0.86243|0.86243	AGA|TAG		0.408	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		Missense_Mutation
SRRM4	84530	genome.wustl.edu	37	12	119592167	119592167	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr12:119592167T>G	ENST00000267260.4	+	12	1899	c.1511T>G	c.(1510-1512)cTg>cGg	p.L504R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	504	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.L504R(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CCGAGCCACCTGGAGGCCCGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	12											15.0	19.0	18.0					12																	119592167		1855	4083	5938	118076550	SO:0001583	missense	84530			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1511T>G	12.37:g.119592167T>G	ENSP00000267260:p.Leu504Arg	Somatic		Capture	Illumina GAIIx	4	118076550	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	34	5.357097	0.95854	.	.	ENSG00000139767	ENST00000267260	T	0.43688	0.94	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000017	T	0.60314	0.2259	L	0.59436	1.845	0.48975	D	0.99973	D	0.89917	1.0	D	0.79108	0.992	T	0.59616	-0.7421	9	.	.	.	-10.9185	15.3222	0.74132	0.0:0.0:0.0:1.0	.	504	A7MD48	SRRM4_HUMAN	R	504	ENSP00000267260:L504R	.	L	+	2	0	SRRM4	118076550	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.501000	0.81600	2.027000	0.59764	0.533000	0.62120	CTG		0.642	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286		Missense_Mutation
C5	727	genome.wustl.edu	37	9	123780131	123780131	+	Splice_Site	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr9:123780131C>G	ENST00000223642.1	-	13	1536		c.e13-1			NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5						activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.?(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TGGATAAAATCTAAAAATAAA	0.353																																																1	Unknown(1)	ovary(1)	9											47.0	50.0	49.0					9																	123780131		2203	4300	6503	122819952	SO:0001630	splice_region_variant	727			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1507-1G>C	9.37:g.123780131C>G		Somatic		Capture	Illumina GAIIx	4	122819952	Q14CJ0|Q27I61	Splice_Site_SNP	SNP	ENST00000223642.1	37	CCDS6826.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285578	0.80803	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3388	0.94332	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C5	122819952	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.335000	0.72949	2.808000	0.96608	0.655000	0.94253	.		0.353	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	Intron	Splice_Site_SNP
TENM1	10178	genome.wustl.edu	37	X	123517890	123517890	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:123517890C>A	ENST00000371130.3	-	29	6933	c.6870G>T	c.(6868-6870)gaG>gaT	p.E2290D	TENM1_ENST00000422452.2_Missense_Mutation_p.E2297D|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2290					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.E2292D(1)									GAGATGTAATCTCCGAGCTTG	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											130.0	125.0	126.0					X																	123517890		2203	4300	6503	123345571	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6870G>T	X.37:g.123517890C>A	ENSP00000360171:p.Glu2290Asp	Somatic		Capture	Illumina GAIIx	4	123345571	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117001	0.56505	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86230	-2.09;-2.06	5.66	1.93	0.25924	.	0.185501	0.46145	D	0.000307	D	0.85609	0.5736	M	0.64260	1.97	0.48236	D	0.999616	P;D;D	0.59767	0.931;0.986;0.968	B;P;P	0.48270	0.388;0.572;0.504	T	0.82020	-0.0664	10	0.45353	T	0.12	.	8.9734	0.35921	0.0:0.4562:0.0:0.5437	.	2296;2297;2290	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	D	2290;2297	ENSP00000360171:E2290D;ENSP00000403954:E2297D	ENSP00000360171:E2290D	E	-	3	2	ODZ1	123345571	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	1.459000	0.35234	0.191000	0.20236	0.600000	0.82982	GAG		0.443	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
ZNF608	57507	genome.wustl.edu	37	5	123984308	123984308	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr5:123984308T>A	ENST00000306315.5	-	4	2204	c.1769A>T	c.(1768-1770)gAc>gTc	p.D590V	ZNF608_ENST00000504926.1_Missense_Mutation_p.D163V	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	590							metal ion binding (GO:0046872)	p.D590V(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GTCCTCACTGTCAGGCTCGAA	0.483																																																1	Substitution - Missense(1)	ovary(1)	5											234.0	199.0	210.0					5																	123984308		2203	4300	6503	124012207	SO:0001583	missense	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1769A>T	5.37:g.123984308T>A	ENSP00000307746:p.Asp590Val	Somatic		Capture	Illumina GAIIx	4	124012207	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454512	0.63290	.	.	ENSG00000168916	ENST00000504926;ENST00000306315;ENST00000509799;ENST00000513986	T;T	0.61510	0.1;0.12	5.6	5.6	0.85130	.	0.196214	0.52532	D	0.000078	T	0.69584	0.3127	M	0.67397	2.05	0.80722	D	1	P	0.50272	0.933	P	0.55303	0.773	T	0.71998	-0.4423	10	0.54805	T	0.06	-28.9427	15.8007	0.78453	0.0:0.0:0.0:1.0	.	590	Q9ULD9	ZN608_HUMAN	V	163;590;590;590	ENSP00000427657:D163V;ENSP00000307746:D590V	ENSP00000307746:D590V	D	-	2	0	ZNF608	124012207	1.000000	0.71417	0.938000	0.37757	0.951000	0.60555	8.023000	0.88764	2.126000	0.65437	0.445000	0.29226	GAC		0.483	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		Missense_Mutation
FAM24A	118670	genome.wustl.edu	37	10	124672396	124672396	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr10:124672396T>C	ENST00000368894.1	+	3	365	c.244T>C	c.(244-246)Tgt>Cgt	p.C82R		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	82						extracellular region (GO:0005576)		p.C82R(1)		large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		TCTCCAGTGCTGTGAAGGTTG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											174.0	123.0	140.0					10																	124672396		2203	4300	6503	124662386	SO:0001583	missense	118670				CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.244T>C	10.37:g.124672396T>C	ENSP00000357889:p.Cys82Arg	Somatic		Capture	Illumina GAIIx	4	124662386		Missense_Mutation	SNP	ENST00000368894.1	37	CCDS31304.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	6.381	0.438398	0.12104	.	.	ENSG00000203795	ENST00000368894	.	.	.	3.57	2.44	0.29823	.	0.160661	0.29964	N	0.010760	T	0.18299	0.0439	N	0.14661	0.345	0.22489	N	0.99906	B	0.22683	0.073	B	0.23018	0.043	T	0.13308	-1.0514	9	0.32370	T	0.25	.	5.8078	0.18450	0.0:0.1223:0.0:0.8777	.	82	A6NFZ4	FA24A_HUMAN	R	82	.	ENSP00000357889:C82R	C	+	1	0	FAM24A	124662386	0.917000	0.31117	0.081000	0.20488	0.055000	0.15305	1.578000	0.36525	0.736000	0.32559	-0.411000	0.06167	TGT		0.507	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050824.1	XM_058332		Missense_Mutation
TNPO3	23534	genome.wustl.edu	37	7	128655107	128655107	+	Silent	SNP	G	G	T			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr7:128655107G>T	ENST00000265388.5	-	4	621	c.478C>A	c.(478-480)Cga>Aga	p.R160R	TNPO3_ENST00000393245.1_Silent_p.R160R|TNPO3_ENST00000482320.1_Silent_p.R94R|TNPO3_ENST00000471234.1_Silent_p.R160R|TNPO3_ENST00000471166.1_Silent_p.R160R			Q9Y5L0	TNPO3_HUMAN	transportin 3	160					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)	p.R160R(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						GCTCCAATTCGTAAGGAACGA	0.378																																					Pancreas(147;583 2585 39696 52331)											1	Substitution - coding silent(1)	ovary(1)	7											114.0	104.0	107.0					7																	128655107		2203	4300	6503	128442343	SO:0001819	synonymous_variant	23534			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.478C>A	7.37:g.128655107G>T		Somatic		Capture	Illumina GAIIx	4	128442343	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Silent	SNP	ENST00000265388.5	37	CCDS5809.1	SNP	40	WashU																																																																																				0.378	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470		Silent
STK26	51765	genome.wustl.edu	37	X	131207039	131207039	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chrX:131207039G>A	ENST00000354719.6	+	10	1288	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	MST4_ENST00000481105.1_Missense_Mutation_p.E404K|MST4_ENST00000394335.2_Missense_Mutation_p.E305K|MST4_ENST00000394334.2_Missense_Mutation_p.E382K|MST4_ENST00000496850.1_Missense_Mutation_p.E320K														p.E382K(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(192;0.000127)					TGAAGAACTCGAGAAAAGTAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	X											63.0	69.0	67.0					X																	131207039		2198	4294	6492	131034720	SO:0001583	missense	51765																														ENST00000354719.6:c.1072G>A	X.37:g.131207039G>A	ENSP00000346755:p.Glu358Lys	Somatic		Capture	Illumina GAIIx	4	131034720		Missense_Mutation	SNP	ENST00000354719.6	37		SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	g	19.86	3.905722	0.72868	.	.	ENSG00000134602	ENST00000394334;ENST00000481105;ENST00000354719;ENST00000394335;ENST00000496850	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000004	T	0.38878	0.1057	L	0.49350	1.555	0.80722	D	1	B;B;B;B;B	0.30455	0.046;0.025;0.28;0.157;0.011	B;B;B;B;B	0.20767	0.014;0.008;0.031;0.031;0.008	T	0.13656	-1.0501	10	0.26408	T	0.33	.	19.0056	0.92849	0.0:0.0:1.0:0.0	.	404;358;320;305;382	B4E0Y9;Q8NBY1;Q9P289-3;Q9P289-2;Q9P289	.;.;.;.;MST4_HUMAN	K	382;404;358;305;320	ENSP00000377867:E382K;ENSP00000418753:E404K;ENSP00000346755:E358K;ENSP00000377868:E305K;ENSP00000419702:E320K	ENSP00000346755:E358K	E	+	1	0	AL109749.1	131034720	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	9.434000	0.97515	2.437000	0.82529	0.519000	0.50382	GAG		0.358	MST4-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000058308.2			Missense_Mutation
EFR3A	23167	genome.wustl.edu	37	8	132957037	132957037	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:132957037G>C	ENST00000254624.5	+	3	358	c.133G>C	c.(133-135)Gta>Cta	p.V45L	EFR3A_ENST00000519656.1_Missense_Mutation_p.V9L|EFR3A_ENST00000334503.4_Missense_Mutation_p.V45L	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	45						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.V45L(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATTTTATGCAGTATCTGCTCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	8											95.0	89.0	91.0					8																	132957037		2203	4298	6501	133026219	SO:0001583	missense	23167			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.133G>C	8.37:g.132957037G>C	ENSP00000254624:p.Val45Leu	Somatic		Capture	Illumina GAIIx	4	133026219	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	ENST00000254624.5	37	CCDS34942.2	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630544	0.28978	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000520362;ENST00000519656	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	5.75	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.09202	0.0227	N	0.11724	0.165	0.51482	D	0.999926	B	0.10296	0.003	B	0.06405	0.002	T	0.08848	-1.0702	10	0.02654	T	1	-24.5316	15.3508	0.74384	0.0:0.0:0.8596:0.1404	.	45	Q14156	EFR3A_HUMAN	L	45;9;45;45;9;9	ENSP00000254624:V45L;ENSP00000430512:V9L;ENSP00000334769:V45L;ENSP00000428086:V9L	ENSP00000254624:V45L	V	+	1	0	EFR3A	133026219	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	5.476000	0.66793	1.430000	0.47334	-0.169000	0.13324	GTA		0.358	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137		Missense_Mutation
HIPK2	28996	genome.wustl.edu	37	7	139299210	139299210	+	Silent	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr7:139299210G>C	ENST00000406875.3	-	8	1906	c.1812C>G	c.(1810-1812)tcC>tcG	p.S604S	HIPK2_ENST00000342645.6_Silent_p.S604S|HIPK2_ENST00000428878.2_Intron	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	604	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)	p.S604S(1)		breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GATTGGCTAAGGAAATAGTGG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	7											72.0	73.0	73.0					7																	139299210		1920	4126	6046	138949750	SO:0001819	synonymous_variant	28996			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1812C>G	7.37:g.139299210G>C		Somatic		Capture	Illumina GAIIx	4	138949750	Q75MR7|Q8WWI4|Q9H2Y1	Silent	SNP	ENST00000406875.3	37		SNP	35	WashU																																																																																				0.502	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740		Silent
PCDHB16	57717	genome.wustl.edu	37	5	140562641	140562641	+	Silent	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr5:140562641C>T	ENST00000361016.2	+	1	1662	c.507C>T	c.(505-507)aaC>aaT	p.N169N		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	169	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N169N(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGTTCAAAACTATAAAATCA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	5											42.0	45.0	44.0					5																	140562641		2200	4299	6499	140542825	SO:0001819	synonymous_variant	57717			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.507C>T	5.37:g.140562641C>T		Somatic		Capture	Illumina GAIIx	4	140542825	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	CCDS4251.1	SNP	20	WashU																																																																																				0.423	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957		Silent
ACVR1	90	genome.wustl.edu	37	2	158594088	158594088	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:158594088C>G	ENST00000263640.3	-	11	1914	c.1485G>C	c.(1483-1485)ttG>ttC	p.L495F	ACVR1_ENST00000409283.2_Missense_Mutation_p.L495F|AC019186.1_ENST00000447019.1_lincRNA|ACVR1_ENST00000434821.1_Missense_Mutation_p.L495F|ACVR1_ENST00000410057.2_Missense_Mutation_p.L495F	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	495	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.L495F(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	CAATTTTGGTCAAAGTCTTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											141.0	127.0	132.0					2																	158594088		2203	4300	6503	158302334	SO:0001583	missense	90				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.1485G>C	2.37:g.158594088C>G	ENSP00000263640:p.Leu495Phe	Somatic		Capture	Illumina GAIIx	4	158302334		Missense_Mutation	SNP	ENST00000263640.3	37	CCDS2206.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293388	0.60086	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057	D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59	6.16	6.16	0.99307	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.060701	0.64402	D	0.000002	D	0.97188	0.9081	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97145	0.9827	10	0.87932	D	0	.	13.9788	0.64291	0.0:0.9314:0.0:0.0686	.	495	Q04771	ACVR1_HUMAN	F	495	ENSP00000263640:L495F;ENSP00000387273:L495F;ENSP00000405004:L495F;ENSP00000387127:L495F	ENSP00000263640:L495F	L	-	3	2	ACVR1	158302334	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.387000	0.52501	2.937000	0.99478	0.650000	0.86243	TTG		0.408	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105		Missense_Mutation
HMP19	51617	genome.wustl.edu	37	5	173534384	173534384	+	Missense_Mutation	SNP	G	G	A	rs147555850		TCGA-13-0884-01	TCGA-13-0884-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr5:173534384G>A	ENST00000303177.3	+	5	654	c.392G>A	c.(391-393)cGc>cAc	p.R131H	NSG2_ENST00000521585.1_Intron|NSG2_ENST00000521959.1_3'UTR	NM_015980.4	NP_057064.1	Q9Y328	NSG2_HUMAN		131					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R131H(1)									TCCAGAAGCCGCTTCTACACA	0.592													G|||	1	0.000199681	0.0	0.0014	5008	,	,		12913	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	HIS/ARG	0,4406		0,0,2203	65.0	66.0	66.0		392	5.2	1.0	5	dbSNP_134	66	2,8598	2.2+/-6.3	0,2,4298	no	missense	HMP19	NM_015980.3	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	131/172	173534384	2,13004	2203	4300	6503	173466990	SO:0001583	missense	51617																														ENST00000303177.3:c.392G>A	5.37:g.173534384G>A	ENSP00000307722:p.Arg131His	Somatic		Capture	Illumina GAIIx	4	173466990	B2R5Y0|D3DQN0|Q9UHX8	Missense_Mutation	SNP	ENST00000303177.3	37	CCDS4391.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048768	0.93740	0.0	2.33E-4	ENSG00000170091	ENST00000303177;ENST00000519867;ENST00000521278;ENST00000519717	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.78559	0.4302	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.80439	-0.1382	9	0.66056	D	0.02	-16.7602	18.7667	0.91876	0.0:0.0:1.0:0.0	.	131	Q9Y328	NSG2_HUMAN	H	131	.	ENSP00000307722:R131H	R	+	2	0	AC011333.1	173466990	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.098000	0.94202	2.425000	0.82216	0.561000	0.74099	CGC		0.592	NSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252966.2			Missense_Mutation
HOXD10	3236	genome.wustl.edu	37	2	176983684	176983684	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:176983684G>A	ENST00000249501.4	+	2	1003	c.748G>A	c.(748-750)Gaa>Aaa	p.E250K	HOXD-AS2_ENST00000440016.2_RNA|HOXD10_ENST00000490088.2_3'UTR	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	250					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E250K(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TTTGTTAGAGGAAATCAAGTC	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											50.0	53.0	52.0					2																	176983684		2203	4300	6503	176691930	SO:0001583	missense	3236				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.748G>A	2.37:g.176983684G>A	ENSP00000249501:p.Glu250Lys	Somatic		Capture	Illumina GAIIx	4	176691930	Q6NT10	Missense_Mutation	SNP	ENST00000249501.4	37	CCDS2266.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328363	0.41197	.	.	ENSG00000128710	ENST00000249501	D	0.93547	-3.24	5.94	5.94	0.96194	Homeodomain-like (1);	0.093293	0.64402	D	0.000001	D	0.92870	0.7732	M	0.71581	2.175	0.45150	D	0.998168	P	0.36789	0.57	B	0.35114	0.196	D	0.91562	0.5265	10	0.38643	T	0.18	.	19.9695	0.97278	0.0:0.0:1.0:0.0	.	250	P28358	HXD10_HUMAN	K	250	ENSP00000249501:E250K	ENSP00000249501:E250K	E	+	1	0	HOXD10	176691930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.834000	0.69361	2.816000	0.96949	0.561000	0.74099	GAA		0.358	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			Missense_Mutation
LAMC2	3918	genome.wustl.edu	37	1	183212497	183212497	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr1:183212497C>G	ENST00000264144.4	+	23	3609	c.3544C>G	c.(3544-3546)Cca>Gca	p.P1182A		NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1182	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.P1182A(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						CAACCTGCCCCCAGGCTGCTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	95.0	95.0					1																	183212497		2203	4300	6503	181479120	SO:0001583	missense	3918			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3544C>G	1.37:g.183212497C>G	ENSP00000264144:p.Pro1182Ala	Somatic		Capture	Illumina GAIIx	4	181479120	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	37	CCDS1352.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268777	0.59540	.	.	ENSG00000058085	ENST00000264144	T	0.15834	2.39	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000002	T	0.42086	0.1187	M	0.72118	2.19	0.43782	D	0.996313	D	0.89917	1.0	D	0.83275	0.996	T	0.09684	-1.0663	10	0.21540	T	0.41	.	19.165	0.93553	0.0:1.0:0.0:0.0	.	1182	Q13753	LAMC2_HUMAN	A	1182	ENSP00000264144:P1182A	ENSP00000264144:P1182A	P	+	1	0	LAMC2	181479120	0.329000	0.24696	1.000000	0.80357	0.978000	0.69477	2.338000	0.43957	2.519000	0.84933	0.655000	0.94253	CCA		0.522	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562		Missense_Mutation
STAT1	6772	genome.wustl.edu	37	2	191839594	191839594	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:191839594C>G	ENST00000361099.3	-	24	2587	c.2200G>C	c.(2200-2202)Gtg>Ctg	p.V734L	STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.V734L	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	734					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.V734L(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			ATCCGAGACACCTCGTCAAAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											138.0	117.0	124.0					2																	191839594		2203	4300	6503	191547839	SO:0001583	missense	6772				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.2200G>C	2.37:g.191839594C>G	ENSP00000354394:p.Val734Leu	Somatic		Capture	Illumina GAIIx	4	191547839	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	37	CCDS2309.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	5.523	0.281421	0.10458	.	.	ENSG00000115415	ENST00000361099;ENST00000409465	D;D	0.92858	-3.12;-3.12	5.45	3.49	0.39957	Signal transducer and activation of transcription 1, TAZ2 binding domain, C-terminal (1);	0.325948	0.32819	N	0.005608	T	0.81394	0.4813	N	0.17082	0.46	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.73014	-0.4116	10	0.02654	T	1	.	11.0096	0.47654	0.138:0.7866:0.0:0.0754	.	734	P42224	STAT1_HUMAN	L	734	ENSP00000354394:V734L;ENSP00000386244:V734L	ENSP00000354394:V734L	V	-	1	0	STAT1	191547839	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.685000	0.46959	1.508000	0.48769	0.655000	0.94253	GTG		0.498	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315		Missense_Mutation
UBXN7	26043	genome.wustl.edu	37	3	196094997	196094997	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr3:196094997C>A	ENST00000296328.4	-	8	810	c.736G>T	c.(736-738)Gat>Tat	p.D246Y	UBXN7_ENST00000535858.1_Missense_Mutation_p.D98Y|UBXN7_ENST00000428095.1_Missense_Mutation_p.D84Y	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	246						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.D246Y(1)		NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						GAAGATACATCTAACTGGTGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	79.0	81.0					3																	196094997		1841	4087	5928	197579394	SO:0001583	missense	26043			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.736G>T	3.37:g.196094997C>A	ENSP00000296328:p.Asp246Tyr	Somatic		Capture	Illumina GAIIx	4	197579394	D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	ENST00000296328.4	37	CCDS43191.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474331	0.84640	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	T;T;T	0.48522	0.81;0.81;0.81	5.29	5.29	0.74685	UAS (1);	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.60919	-0.7167	10	0.66056	D	0.02	-16.725	19.1204	0.93360	0.0:1.0:0.0:0.0	.	246	O94888	UBXN7_HUMAN	Y	246;84;98	ENSP00000296328:D246Y;ENSP00000397256:D84Y;ENSP00000440716:D98Y	ENSP00000296328:D246Y	D	-	1	0	UBXN7	197579394	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.674000	0.74487	2.734000	0.93682	0.655000	0.94253	GAT		0.403	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353		Missense_Mutation
BMPR2	659	genome.wustl.edu	37	2	203424473	203424473	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:203424473G>C	ENST00000374580.4	+	13	3460	c.2921G>C	c.(2920-2922)cGt>cCt	p.R974P	BMPR2_ENST00000374574.2_3'UTR	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	974					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R974P(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						ATCAAGAAACGTGTGAAAACT	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	93.0	95.0					2																	203424473		2203	4300	6503	203132718	SO:0001583	missense	659			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.2921G>C	2.37:g.203424473G>C	ENSP00000363708:p.Arg974Pro	Somatic		Capture	Illumina GAIIx	4	203132718	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337548	0.81911	.	.	ENSG00000204217	ENST00000374580	D	0.95103	-3.61	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.95784	0.8628	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96325	0.9239	10	0.87932	D	0	.	19.7342	0.96195	0.0:0.0:1.0:0.0	.	974	Q13873	BMPR2_HUMAN	P	974	ENSP00000363708:R974P	ENSP00000363708:R974P	R	+	2	0	BMPR2	203132718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.670000	0.98625	2.686000	0.91538	0.650000	0.86243	CGT		0.428	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204		Missense_Mutation
EPRS	2058	genome.wustl.edu	37	1	220162112	220162112	+	Silent	SNP	T	T	C			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr1:220162112T>C	ENST00000366923.3	-	19	2864	c.2595A>G	c.(2593-2595)aaA>aaG	p.K865K	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	865	3 X 57 AA approximate repeats.|WHEP-TRS 2.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)	p.K865K(1)		breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CAGTTTTTTCTTTATACTGAG	0.373																																																1	Substitution - coding silent(1)	ovary(1)	1											107.0	113.0	111.0					1																	220162112		2203	4299	6502	218228735	SO:0001819	synonymous_variant	2058			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2595A>G	1.37:g.220162112T>C		Somatic		Capture	Illumina GAIIx	4	218228735	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	37	CCDS31027.1	SNP	56	WashU																																																																																				0.373	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446		Silent
AGFG1	3267	genome.wustl.edu	37	2	228418450	228418450	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0884-01	TCGA-13-0884-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:228418450A>G	ENST00000310078.8	+	12	1828	c.1568A>G	c.(1567-1569)aAg>aGg	p.K523R	AGFG1_ENST00000373671.3_Missense_Mutation_p.K483R|AGFG1_ENST00000409315.1_Missense_Mutation_p.K502R|AGFG1_ENST00000409171.1_Missense_Mutation_p.K521R|AGFG1_ENST00000409979.2_Missense_Mutation_p.K545R	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	523					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.K523R(1)|p.T522fs*3(1)		central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						GGACAAACAAAGCCAGTAGTA	0.348																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|central_nervous_system(1)	2											102.0	109.0	107.0					2																	228418450		2203	4300	6503	228126694	SO:0001583	missense	3267				CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1568A>G	2.37:g.228418450A>G	ENSP00000312059:p.Lys523Arg	Somatic		Capture	Illumina GAIIx	4	228126694	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	ENST00000310078.8	37	CCDS2467.1	SNP	3	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.500134|4.500134	0.85176|0.85176	.|.	.|.	ENSG00000173744|ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171|ENST00000458212	T;T;T;T;T|.	0.32272|.	1.6;1.61;1.46;1.66;1.66|.	5.75|5.75	4.58|4.58	0.56647|0.56647	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69088|0.69088	0.3072|0.3072	M|M	0.62723|0.62723	1.935|1.935	0.46356|0.46356	D|D	0.999|0.999	D;B;D;D|.	0.76494|.	0.998;0.392;0.997;0.999|.	D;B;D;P|.	0.80764|.	0.994;0.124;0.98;0.874|.	T|T	0.66925|0.66925	-0.5800|-0.5800	10|5	0.26408|.	T|.	0.33|.	.|.	13.0852|13.0852	0.59135|0.59135	0.8659:0.1341:0.0:0.0|0.8659:0.1341:0.0:0.0	.|.	483;521;545;523|.	P52594-2;P52594-3;E9PHX7;P52594|.	.;.;.;AGFG1_HUMAN|.	R|G	545;530;523;502;483;521|93	ENSP00000387282:K545R;ENSP00000312059:K523R;ENSP00000387154:K502R;ENSP00000362775:K483R;ENSP00000387218:K521R|.	ENSP00000312059:K523R|.	K|S	+|+	2|1	0|0	AGFG1|AGFG1	228126694|228126694	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.641000|6.641000	0.74324|0.74324	0.983000|0.983000	0.38602|0.38602	0.482000|0.482000	0.46254|0.46254	AAG|AGC		0.348	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256895.2	NM_004504		Missense_Mutation
COL6A3	1293	genome.wustl.edu	37	2	238243270	238243270	+	Splice_Site	SNP	T	T	G			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:238243270T>G	ENST00000295550.4	-	41	9680	c.9228A>C	c.(9226-9228)acA>acC	p.T3076T	COL6A3_ENST00000472056.1_Splice_Site_p.T2469T|COL6A3_ENST00000409809.1_Splice_Site_p.T2870T|COL6A3_ENST00000353578.4_Splice_Site_p.T2870T|COL6A3_ENST00000346358.4_Splice_Site_p.T2876T|COL6A3_ENST00000347401.3_Splice_Site_p.T2875T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	3076	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T3076T(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGTACTTACTTGTACTGAAAC	0.453																																																1	Substitution - coding silent(1)	ovary(1)	2											68.0	57.0	60.0					2																	238243270		2203	4300	6503	237908009	SO:0001630	splice_region_variant	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.9229+1A>C	2.37:g.238243270T>G		Somatic		Capture	Illumina GAIIx	4	237908009	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	63	WashU																																																																																				0.453	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	Silent	Silent
RGS7	6000	genome.wustl.edu	37	1	240966120	240966120	+	Intron	SNP	C	C	T			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr1:240966120C>T	ENST00000407727.1	-	15	1359				RGS7_ENST00000446183.2_Intron|RGS7_ENST00000348120.2_Intron|RGS7_ENST00000366565.1_Intron|RGS7_ENST00000401882.1_Intron|RGS7_ENST00000331110.7_Intron|RGS7_ENST00000366564.1_Intron|RGS7_ENST00000366562.4_Intron|RGS7_ENST00000366563.1_Intron			P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TAGTCCAATACCCTGGATTCA	0.363																																																0			1																																								239032743	SO:0001627	intron_variant	6000			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1359+83G>A	1.37:g.240966120C>T		Somatic		Capture	Illumina GAIIx	4	239032743	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		SNP	18	WashU																																																																																				0.363	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924		Missense_Mutation
COL4A1	1282	genome.wustl.edu	37	13	110817260	110817260	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr13:110817260G>A	ENST00000375820.4	-	46	4220	c.4099C>T	c.(4099-4101)Ccc>Tcc	p.P1367S	COL4A1_ENST00000467182.1_5'Flank	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1367	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.P1367S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AGCCCTGGGGGGCCCTCAGGA	0.662																																																1	Substitution - Missense(1)	ovary(1)	13											13.0	14.0	14.0					13																	110817260		2200	4299	6499	109615261	SO:0001583	missense	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4099C>T	13.37:g.110817260G>A	ENSP00000364979:p.Pro1367Ser	Somatic		Capture	Illumina GAIIx	Phase_III	109615261	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637983	0.47153	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.94793	-3.52	5.14	5.14	0.70334	.	0.072360	0.64402	D	0.000019	D	0.92351	0.7573	L	0.59912	1.85	0.80722	D	1	P	0.47350	0.894	B	0.39119	0.291	D	0.91257	0.5034	10	0.22109	T	0.4	.	18.6358	0.91378	0.0:0.0:1.0:0.0	.	1367	P02462	CO4A1_HUMAN	S	1010;1367;1016	ENSP00000364979:P1367S	ENSP00000364973:P1010S	P	-	1	0	COL4A1	109615261	1.000000	0.71417	0.974000	0.42286	0.875000	0.50365	6.016000	0.70798	2.391000	0.81399	0.655000	0.94253	CCC		0.662	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3			Missense_Mutation
POLI	11201	genome.wustl.edu	37	18	51800324	51800324	+	Silent	SNP	C	C	A			TCGA-13-0884-01	TCGA-13-0884-10	C	C	A	C	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr18:51800324C>A	ENST00000579534.1	+	3	413	c.270C>A	c.(268-270)acC>acA	p.T90T	POLI_ENST00000579434.1_5'UTR|POLI_ENST00000217800.5_5'UTR|POLI_ENST00000406285.3_Silent_p.T90T	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	90	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.T65T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		TGGTGGTTACCTGCAACTATG	0.328								DNA polymerases (catalytic subunits)																																								1	Substitution - coding silent(1)	ovary(1)	18											47.0	47.0	47.0					18																	51800324		2202	4300	6502	50054322	SO:0001819	synonymous_variant	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.270C>A	18.37:g.51800324C>A		Somatic		Capture	Illumina GAIIx	Phase_III	50054322	Q8N590|Q9H0S1|Q9NYH6	Silent	SNP	ENST00000579534.1	37	CCDS11954.2	SNP	24	WashU																																																																																				0.328	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195		Silent
NRP1	8829	genome.wustl.edu	37	10	33510661	33510661	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr10:33510661C>G	ENST00000265371.4	-	9	1793	c.1268G>C	c.(1267-1269)gGt>gCt	p.G423A	NRP1_ENST00000374821.5_Missense_Mutation_p.G423A|NRP1_ENST00000374816.3_Missense_Mutation_p.G423A|NRP1_ENST00000374823.5_Missense_Mutation_p.G423A|NRP1_ENST00000374867.2_Missense_Mutation_p.G423A|NRP1_ENST00000395995.1_Missense_Mutation_p.G423A|NRP1_ENST00000374822.4_Missense_Mutation_p.G423A|NRP1_ENST00000432372.2_Missense_Mutation_p.G423A|NRP1_ENST00000374875.1_Missense_Mutation_p.G242A			O14786	NRP1_HUMAN	neuropilin 1	423	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.G423A(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	TATCTTGCAACCGTATACTTC	0.393																																					Melanoma(104;886 1489 44640 45944 51153)											1	Substitution - Missense(1)	ovary(1)	10											146.0	141.0	143.0					10																	33510661		2203	4300	6503	33550667	SO:0001583	missense	8829			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1268G>C	10.37:g.33510661C>G	ENSP00000265371:p.Gly423Ala	Somatic		Capture	Illumina GAIIx	4	33550667	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	ENST00000265371.4	37	CCDS7177.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	29.5	5.007474	0.93287	.	.	ENSG00000099250	ENST00000265371;ENST00000374875;ENST00000374867;ENST00000395995;ENST00000374822;ENST00000374821;ENST00000374823;ENST00000374816;ENST00000432372	D;D;D;D;D;D;D;D;D	0.99194	-3.02;-4.08;-3.02;-3.0;-3.4;-3.36;-3.43;-3.42;-5.54	5.87	5.87	0.94306	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99408	0.9791	M	0.91818	3.245	0.80722	D	1	D;D;D;D;D;P;D;P;D	0.64830	0.989;0.994;0.994;0.994;0.986;0.956;0.989;0.953;0.989	P;P;P;P;P;B;P;P;P	0.61658	0.804;0.862;0.862;0.892;0.671;0.376;0.804;0.598;0.757	D	0.99032	1.0821	10	0.87932	D	0	-28.2902	20.5827	0.99408	0.0:1.0:0.0:0.0	.	423;423;423;423;423;423;423;242;423	A8K9V7;E7EX60;Q5T7F0;Q5T7F1;O14786-2;Q68DN3;O14786;Q5JWQ6;E9PEP6	.;.;.;.;.;.;NRP1_HUMAN;.;.	A	423;242;423;423;423;423;423;423;96	ENSP00000265371:G423A;ENSP00000364009:G242A;ENSP00000364001:G423A;ENSP00000379317:G423A;ENSP00000363955:G423A;ENSP00000363954:G423A;ENSP00000363956:G423A;ENSP00000363949:G423A;ENSP00000408911:G96A	ENSP00000265371:G423A	G	-	2	0	NRP1	33550667	1.000000	0.71417	0.999000	0.59377	0.941000	0.58515	7.439000	0.80444	2.941000	0.99782	0.655000	0.94253	GGT		0.393	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2			Missense_Mutation
RNU6-617P	106479839	genome.wustl.edu	37	2	132357668	132357668	+	RNA	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr2:132357668C>G	ENST00000516147.1	+	0	0									RNA, U6 small nuclear 617, pseudogene																		TTTAAATGCACTGGATAGATA	0.323																																																0			2																																								132074138								2q21.1	2013-05-01			ENSG00000251956	ENSG00000251956			47580	pseudogene	RNA, pseudogene							Standard			Approved						2.37:g.132357668C>G		Somatic		Capture	Illumina GAIIx	4	132074138		Missense_Mutation	SNP	ENST00000516147.1	37		SNP	20	WashU																																																																																				0.323	RNU6-617P-201	KNOWN	basic	snRNA	snRNA				Missense_Mutation
OR7E35P	391632	genome.wustl.edu	37	4	9756802	9756802	+	IGR	SNP	T	T	A			TCGA-13-0884-01	TCGA-13-0884-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr4:9756802T>A								AC097493.1 (154751 upstream) : DRD5 (26455 downstream)																							CTCAGATGTCTCTCTTTGCCA	0.498																																																0			4																																								9365900	SO:0001628	intergenic_variant																																4.37:g.9756802T>A		Somatic		Capture	Illumina GAIIx	4	9365900		Silent	SNP		37		SNP	54	WashU																																																																																			0	0.498									Silent
PCDHA2	56146	genome.wustl.edu	37	5	140174571	140174571	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr5:140174571G>C	ENST00000526136.1	+	1	22	c.22G>C	c.(22-24)Ggc>Cgc	p.G8R	PCDHA2_ENST00000378132.1_Missense_Mutation_p.G8R|PCDHA2_ENST00000520672.2_Missense_Mutation_p.G8R|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	8					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.G8R(1)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATCAGAAGGGGCCGAGGGGC	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											41.0	49.0	46.0					5																	140174571		2203	4300	6503	140154755	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.22G>C	5.37:g.140174571G>C	ENSP00000431748:p.Gly8Arg	Somatic		Capture	Illumina GAIIx	4	140154755	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	g	12.76	2.035763	0.35893	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.51325	0.79;0.71;0.75	4.02	2.19	0.27852	.	0.567765	0.14553	U	0.312575	T	0.40619	0.1124	N	0.16708	0.43	0.09310	N	1	B;B;P	0.43909	0.004;0.026;0.821	B;B;P	0.55455	0.011;0.031;0.776	T	0.25537	-1.0129	10	0.13470	T	0.59	.	7.8655	0.29535	0.2684:0.0:0.7316:0.0	.	8;8;8	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	R	8	ENSP00000430584:G8R;ENSP00000367372:G8R;ENSP00000431748:G8R	ENSP00000367372:G8R	G	+	1	0	PCDHA2	140154755	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	0.503000	0.22610	0.454000	0.26884	0.556000	0.70494	GGC		0.522	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		Missense_Mutation
PSORS1C1	170679	genome.wustl.edu	37	6	31083820	31083820	+	Intron	SNP	C	C	G			TCGA-13-0884-01	TCGA-13-0884-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr6:31083820C>G	ENST00000259881.9	+	1	61				PSORS1C1_ENST00000467107.1_3'UTR|CDSN_ENST00000376288.2_Missense_Mutation_p.E524D	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1									p.E524D(1)		kidney(1)|ovary(2)|prostate(1)|skin(1)	5						TGTTGAGTAACTCTCCTTGGG	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											52.0	50.0	51.0					6																	31083820		1809	3622	5431	31191799	SO:0001627	intron_variant	1041			AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+1152C>G	6.37:g.31083820C>G		Somatic		Capture	Illumina GAIIx	4	31191799	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	CCDS34390.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	0.349	-0.945945	0.02304	.	.	ENSG00000204539	ENST00000376288	T	0.06768	3.26	4.16	1.2	0.21068	.	0.318910	0.22472	N	0.059620	T	0.01061	0.0035	N	0.11560	0.145	0.09310	N	0.999999	B	0.13594	0.008	B	0.11329	0.006	T	0.47724	-0.9095	10	0.27785	T	0.31	-5.6147	4.74	0.13008	0.38:0.5137:0.0:0.1063	.	524	Q15517	CDSN_HUMAN	D	524	ENSP00000365465:E524D	ENSP00000365465:E524D	E	-	3	2	CDSN	31191799	0.581000	0.26741	0.096000	0.21009	0.106000	0.19336	1.160000	0.31761	0.108000	0.17862	0.523000	0.50628	GAG		0.527	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068		Missense_Mutation
ROR2	4920	genome.wustl.edu	37	9	94487229	94487229	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0884-01	TCGA-13-0884-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr9:94487229G>A	ENST00000375708.3	-	9	1745	c.1547C>T	c.(1546-1548)cCc>cTc	p.P516L	ROR2_ENST00000375715.1_Missense_Mutation_p.P376L|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	516	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.P516L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CTCCCGCAGGGGCCCCTCCGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	9											80.0	93.0	89.0					9																	94487229		2203	4300	6503	93527050	SO:0001583	missense	4920			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1547C>T	9.37:g.94487229G>A	ENSP00000364860:p.Pro516Leu	Somatic		Capture	Illumina GAIIx	4	93527050	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	CCDS6691.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920812	0.33908	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.82344	-1.6;-1.6	4.47	4.47	0.54385	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.359875	0.20116	N	0.098913	T	0.69611	0.3130	N	0.04387	-0.21	0.34099	D	0.661621	B;B	0.30146	0.215;0.27	B;B	0.32090	0.131;0.14	T	0.76389	-0.2977	10	0.48119	T	0.1	.	17.7014	0.88295	0.0:0.0:1.0:0.0	.	516;376	Q01974;B1APY4	ROR2_HUMAN;.	L	376;516	ENSP00000364867:P376L;ENSP00000364860:P516L	ENSP00000364860:P516L	P	-	2	0	ROR2	93527050	0.988000	0.35896	0.014000	0.15608	0.535000	0.34838	6.932000	0.75869	2.478000	0.83669	0.491000	0.48974	CCC		0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			Missense_Mutation
C8orf76	84933	genome.wustl.edu	37	8	124243568	124243578	+	Frame_Shift_Del	DEL	TCAGCTGAGTC	TCAGCTGAGTC	-	rs113006115		TCGA-13-0884-01	TCGA-13-0884-10	TCAGCTGAGTC	TCAGCTGAGTC	TCAGCTGAGTC	-	TCAGCTGAGTC	TCAGCTGAGTC	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0884-01	TCGA-13-0884-10	g.chr8:124243568_124243578delTCAGCTGAGTC	ENST00000276704.4	-	4	828_838	c.777_787delGACTCAGCTGA	c.(775-789)gagactcagctgaaafs	p.TQLK260fs	C8orf76_ENST00000521310.1_5'UTR|ZHX1-C8ORF76_ENST00000357082.4_Frame_Shift_Del_p.TQLK228fs	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	260								p.T260fs*35(1)		NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GCACATGCTTTCAGCTGAGTCTCTATCAACA	0.389																																																1	Deletion - Frameshift(1)	ovary(1)	8																																								124312759	SO:0001589	frameshift_variant	84933			AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.777_787delGACTCAGCTGA	8.37:g.124243568_124243578delTCAGCTGAGTC	ENSP00000276704:p.Thr260fs	Somatic		Capture	Illumina GAIIx	PhaseIII	124312749	Q53HC1	Frame_Shift_Del	DEL	ENST00000276704.4	37	CCDS6341.1	DEL	62	WashU																																																																																				0.389	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847		Frame_Shift_Del
