#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ZNF718	255403	genome.wustl.edu	37	4	155370	155370	+	lincRNA	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:155370A>C	ENST00000510175.1	+	0	805							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		CTCATCCCTTAATGAACATAA	0.373																																																0			4											34.0	38.0	37.0					4																	155370		2101	4260	6361	145370			255403			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155370A>C		Somatic		Capture	Illumina GAIIx	4	145370	Q3SXZ4|Q3SXZ5	Missense_Mutation	SNP	ENST00000510175.1	37		SNP	13	WashU																																																																																				0.373	ZNF718-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000357865.3	NM_001039127		Missense_Mutation
CSF2RA	1438	genome.wustl.edu	37	X	1407745	1407745	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:1407745G>A	ENST00000381524.3	+	6	623	c.437G>A	c.(436-438)cGt>cAt	p.R146H	CSF2RA_ENST00000381509.3_Missense_Mutation_p.R146H|CSF2RA_ENST00000355805.2_Missense_Mutation_p.R146H|CSF2RA_ENST00000355432.3_Missense_Mutation_p.R146H|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Missense_Mutation_p.R146H|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000417535.2_Missense_Mutation_p.R146H|CSF2RA_ENST00000432318.2_Missense_Mutation_p.R146H|CSF2RA_ENST00000361536.3_Missense_Mutation_p.R146H|CSF2RA_ENST00000501036.2_Missense_Mutation_p.R13H|CSF2RA_ENST00000381529.3_Missense_Mutation_p.R146H			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	146					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.R146H(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ACGGCCCCCCGTGACGTCCAG	0.478																																					Esophageal Squamous(131;723 1707 25334 40494 41806)											1	Substitution - Missense(1)	ovary(1)	X											105.0	115.0	111.0					X																	1407745		2203	4295	6498	1367745	SO:0001583	missense	1438			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.437G>A	X.37:g.1407745G>A	ENSP00000370935:p.Arg146His	Somatic		Capture	Illumina GAIIx	4	1367745	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	ENST00000381524.3	37	CCDS35191.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	.	2.977	-0.211060	0.06140	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000381507;ENST00000501036;ENST00000381524;ENST00000412290;ENST00000419094;ENST00000381509;ENST00000355805;ENST00000355432;ENST00000417535;ENST00000381500	D;D;D;D;D;D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-1.74;-1.74;-3.78;-1.74;-1.74;-3.78;-1.74;-1.74;-3.78;-1.74	2.02	-4.04	0.04010	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Short hematopoietin receptor, family 2, conserved site (1);Immunoglobulin-like fold (1);	1.224780	0.06602	U	0.753965	D	0.89525	0.6740	.	.	.	0.09310	N	1	B;B;B;B;B;B	0.06786	0.001;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.08055	0.0;0.003;0.0;0.001;0.001;0.002	T	0.74867	-0.3518	9	0.35671	T	0.21	.	3.8976	0.09146	0.3415:0.3598:0.2987:0.0	.	146;146;146;146;146;146	P15509-2;A7J003;P15509-3;P15509-6;P15509-5;P15509	.;.;.;.;.;CSF2R_HUMAN	H	146;146;146;146;13;146;146;146;146;146;146;146;146	ENSP00000370940:R146H;ENSP00000416437:R146H;ENSP00000354836:R146H;ENSP00000440491:R13H;ENSP00000370935:R146H;ENSP00000410667:R146H;ENSP00000397452:R146H;ENSP00000370920:R146H;ENSP00000348058:R146H;ENSP00000347606:R146H;ENSP00000394227:R146H;ENSP00000370911:R146H	ENSP00000347606:R146H	R	+	2	0	CSF2RA	1367745	0.003000	0.15002	0.000000	0.03702	0.073000	0.16967	-0.819000	0.04462	-2.129000	0.00817	-0.799000	0.03217	CGT		0.478	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000035013.2			Missense_Mutation
SSU72P2	390031	genome.wustl.edu	37	11	4263818	4263818	+	IGR	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:4263818C>A								RP11-23F23.2 (39933 upstream) : OR52B4 (124674 downstream)																							CTCCATGCTCCTGTTGACATT	0.562																																																0			11																																								4220394	SO:0001628	intergenic_variant																																11.37:g.4263818C>A		Somatic		Capture	Illumina GAIIx	4	4220394		Missense_Mutation	SNP		37		SNP	24	WashU																																																																																			0	0.562									Missense_Mutation
CAMTA2	23125	genome.wustl.edu	37	17	4886184	4886184	+	Silent	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:4886184A>T	ENST00000348066.3	-	5	330	c.207T>A	c.(205-207)ccT>ccA	p.P69P	CAMTA2_ENST00000358183.4_Silent_p.P69P|CAMTA2_ENST00000361571.5_Silent_p.P92P|CAMTA2_ENST00000381311.5_Silent_p.P71P|CAMTA2_ENST00000572543.1_Silent_p.P69P|CAMTA2_ENST00000414043.3_Silent_p.P92P|CAMTA2_ENST00000571831.1_5'UTR	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	69					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)	p.P69P(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						AGCCATTCTGAGGCCTGGGAA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	17											120.0	114.0	116.0					17																	4886184		2203	4300	6503	4826908	SO:0001819	synonymous_variant	23125			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.207T>A	17.37:g.4886184A>T		Somatic		Capture	Illumina GAIIx	4	4826908	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Silent	SNP	ENST00000348066.3	37	CCDS11063.1	SNP	11	WashU																																																																																				0.542	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099		Silent
KCNA5	3741	genome.wustl.edu	37	12	5154498	5154498	+	Silent	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:5154498C>A	ENST00000252321.3	+	1	1414	c.1185C>A	c.(1183-1185)tcC>tcA	p.S395S		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	395					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)	p.S395S(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGGCCATGTCCCTGGCCATCC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	12											43.0	39.0	41.0					12																	5154498		2203	4300	6503	5024759	SO:0001819	synonymous_variant	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1185C>A	12.37:g.5154498C>A		Somatic		Capture	Illumina GAIIx	4	5024759	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	ENST00000252321.3	37	CCDS8536.1	SNP	22	WashU																																																																																				0.647	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234		Silent
ANO2	57101	genome.wustl.edu	37	12	5916479	5916479	+	Splice_Site	SNP	G	G	A	rs374528825		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:5916479G>A	ENST00000356134.5	-	9	1010	c.939C>T	c.(937-939)gaC>gaT	p.D313D	ANO2_ENST00000327087.8_Splice_Site_p.D312D|ANO2_ENST00000546188.1_Splice_Site_p.D313D	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	317					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.D313D(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TAGTACTTACGTCATGAAGAG	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19787	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						G		3,3743		0,3,1870	76.0	73.0	74.0		936	-10.5	0.7	12		74	0,8144		0,0,4072	no	coding-synonymous-near-splice	ANO2	NM_020373.2		0,3,5942	AA,AG,GG		0.0,0.0801,0.0252		312/999	5916479	3,11887	1873	4072	5945	5786740	SO:0001630	splice_region_variant	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.939+1C>T	12.37:g.5916479G>A		Somatic		Capture	Illumina GAIIx	4	5786740	C4N787|Q9H847	Silent	SNP	ENST00000356134.5	37		SNP	40	WashU																																																																																				0.438	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	Silent	Silent
DNHD1	144132	genome.wustl.edu	37	11	6530177	6530177	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:6530177G>C	ENST00000527990.2	+	3	988	c.988G>C	c.(988-990)Ggg>Cgg	p.G330R	DNHD1_ENST00000254579.6_Missense_Mutation_p.G330R|DNHD1_ENST00000354685.3_Missense_Mutation_p.G330R			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	330					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.G330R(2)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTCTCCCTTTGGGATCTTGCA	0.517																																																2	Substitution - Missense(2)	ovary(2)	11											178.0	151.0	160.0					11																	6530177		2201	4296	6497	6486753	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.988G>C	11.37:g.6530177G>C	ENSP00000436180:p.Gly330Arg	Somatic		Capture	Illumina GAIIx	4	6486753	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942694	0.73672	.	.	ENSG00000179532	ENST00000254579;ENST00000354685;ENST00000527990	T;T;T	0.19250	2.16;2.16;2.16	5.83	4.9	0.64082	.	0.317593	0.27464	N	0.019259	T	0.51329	0.1668	M	0.87381	2.88	0.35763	D	0.820337	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.68667	-0.5348	10	0.87932	D	0	.	13.3274	0.60467	0.0:0.0:0.8415:0.1585	.	330;330	Q96M86;Q96M86-4	DNHD1_HUMAN;.	R	330	ENSP00000254579:G330R;ENSP00000346716:G330R;ENSP00000436180:G330R	ENSP00000254579:G330R	G	+	1	0	DNHD1	6486753	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	5.429000	0.66495	1.418000	0.47098	0.650000	0.86243	GGG		0.517	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666		Missense_Mutation
LAMA1	284217	genome.wustl.edu	37	18	6999910	6999910	+	Splice_Site	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr18:6999910C>T	ENST00000389658.3	-	31	4562	c.4469G>A	c.(4468-4470)aGg>aAg	p.R1490K		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1490	Laminin EGF-like 16. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R1490K(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACCCATGTACCTTTCACAGTG	0.438																																																1	Substitution - Missense(1)	ovary(1)	18											82.0	71.0	75.0					18																	6999910		2203	4300	6503	6989910	SO:0001630	splice_region_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4469+1G>A	18.37:g.6999910C>T		Somatic		Capture	Illumina GAIIx	4	6989910		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816976	0.32145	.	.	ENSG00000101680	ENST00000389658	T	0.62941	-0.01	5.43	4.37	0.52481	EGF-like, laminin (4);	0.190435	0.37906	N	0.001896	T	0.55146	0.1902	L	0.49571	1.57	0.32932	D	0.517218	B	0.30146	0.27	B	0.31337	0.128	T	0.63220	-0.6686	9	.	.	.	.	12.9973	0.58654	0.0:0.8667:0.0:0.1333	.	1490	P25391	LAMA1_HUMAN	K	1490	ENSP00000374309:R1490K	.	R	-	2	0	LAMA1	6989910	1.000000	0.71417	1.000000	0.80357	0.182000	0.23217	3.307000	0.51888	2.549000	0.85964	0.655000	0.94253	AGG		0.438	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	Missense_Mutation	Missense_Mutation
LAMA1	284217	genome.wustl.edu	37	18	7015726	7015726	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr18:7015726A>T	ENST00000389658.3	-	22	3214	c.3121T>A	c.(3121-3123)Tgc>Agc	p.C1041S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1041	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.C1041S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTCACCTGGCACCCCACCTCC	0.517																																																1	Substitution - Missense(1)	ovary(1)	18											138.0	116.0	123.0					18																	7015726		2203	4300	6503	7005726	SO:0001583	missense	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3121T>A	18.37:g.7015726A>T	ENSP00000374309:p.Cys1041Ser	Somatic		Capture	Illumina GAIIx	4	7005726		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701718	0.68501	.	.	ENSG00000101680	ENST00000389658	D	0.94280	-3.39	5.36	5.36	0.76844	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.98055	0.9359	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99659	1.0993	10	0.87932	D	0	.	15.6451	0.77042	1.0:0.0:0.0:0.0	.	1041	P25391	LAMA1_HUMAN	S	1041	ENSP00000374309:C1041S	ENSP00000374309:C1041S	C	-	1	0	LAMA1	7005726	1.000000	0.71417	0.922000	0.36590	0.245000	0.25701	9.134000	0.94467	2.158000	0.67659	0.523000	0.50628	TGC		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		Missense_Mutation
SENP3	26168	genome.wustl.edu	37	17	7469076	7469076	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:7469076G>A	ENST00000429205.2	+	6	1307	c.1258G>A	c.(1258-1260)Gaa>Aaa	p.E420K	SENP3_ENST00000321337.7_Missense_Mutation_p.E420K|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	420	Protease.					cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)	p.E420K(1)		central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				CACAGTCCCTGAAAAGGTAGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	17											64.0	65.0	65.0					17																	7469076		1971	4145	6116	7409800	SO:0001583	missense	26168			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1258G>A	17.37:g.7469076G>A	ENSP00000403712:p.Glu420Lys	Somatic		Capture	Illumina GAIIx	4	7409800	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Missense_Mutation	SNP	ENST00000429205.2	37		SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587000	0.46110	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	T;T	0.39997	1.63;1.05	5.93	5.93	0.95920	.	0.059358	0.64402	D	0.000004	T	0.40815	0.1132	L	0.31294	0.92	0.51233	D	0.999918	P	0.51791	0.948	P	0.48704	0.587	T	0.07046	-1.0793	10	0.33141	T	0.24	-11.0423	15.8364	0.78801	0.0:0.0:1.0:0.0	.	420	Q9H4L4	SENP3_HUMAN	K	420	ENSP00000314029:E420K;ENSP00000403712:E420K	ENSP00000314029:E420K	E	+	1	0	SENP3	7409800	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.737000	0.55060	2.814000	0.96858	0.563000	0.77884	GAA		0.507	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578492	7578492	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:7578492C>T	ENST00000269305.4	-	5	627	c.438G>A	c.(436-438)tgG>tgA	p.W146*	TP53_ENST00000455263.2_Nonsense_Mutation_p.W146*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Nonsense_Mutation_p.W146*|TP53_ENST00000445888.2_Nonsense_Mutation_p.W146*|TP53_ENST00000420246.2_Nonsense_Mutation_p.W146*|TP53_ENST00000359597.4_Nonsense_Mutation_p.W146*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	146	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		W -> C (in a sporadic cancer; somatic mutation).|W -> G (in sporadic cancers; somatic mutation).|W -> L (in sporadic cancers; somatic mutation).|W -> R (in sporadic cancers; somatic mutation).|W -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W146*(39)|p.0?(8)|p.W53*(3)|p.W14*(3)|p.W146C(2)|p.Q144_G154del11(1)|p.W146_V147insXXXXXXX(1)|p.W146_S149>C(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.W146fs*1(1)|p.L137_W146del10(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGAATCAACCCACAGCTGCA	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Nonsense(45)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Substitution - Missense(2)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	lung(9)|liver(8)|breast(7)|large_intestine(6)|upper_aerodigestive_tract(5)|endometrium(5)|central_nervous_system(4)|oesophagus(4)|ovary(4)|bone(4)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|soft_tissue(1)|biliary_tract(1)|pancreas(1)	17											58.0	57.0	57.0					17																	7578492		2203	4300	6503	7519217	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.438G>A	17.37:g.7578492C>T	ENSP00000269305:p.Trp146*	Somatic		Capture	Illumina GAIIx	4	7519217	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653238	0.47362	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	4.52	0.55395	.	0.722123	0.13656	N	0.371928	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-1.8394	7.2875	0.26348	0.1676:0.7467:0.0:0.0857	.	.	.	.	X	146;146;146;146;146;146;135;53;14;53;14;146	.	ENSP00000269305:W146X	W	-	3	0	TP53	7519217	0.545000	0.26449	0.478000	0.27316	0.067000	0.16453	1.174000	0.31932	1.452000	0.47756	0.655000	0.94253	TGG		0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
DNAH2	146754	genome.wustl.edu	37	17	7637928	7637928	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:7637928C>G	ENST00000572933.1	+	7	2340	c.880C>G	c.(880-882)Cag>Gag	p.Q294E	DNAH2_ENST00000570791.1_Missense_Mutation_p.Q294E|DNAH2_ENST00000389173.2_Missense_Mutation_p.Q294E|DNAH2_ENST00000082259.3_Missense_Mutation_p.Q294E			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	294	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q294E(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CATCAGTAAGCAGCTGGTGAA	0.532																																																1	Substitution - Missense(1)	ovary(1)	17											116.0	100.0	106.0					17																	7637928		2203	4300	6503	7578653	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.880C>G	17.37:g.7637928C>G	ENSP00000458355:p.Gln294Glu	Somatic		Capture	Illumina GAIIx	4	7578653	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	25.3	4.629169	0.87560	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.68903	-0.36;-0.36	5.53	5.53	0.82687	Dynein heavy chain, domain-1 (1);	3.447900	0.00465	N	0.000104	D	0.87196	0.6117	M	0.82433	2.59	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.991	T	0.71721	-0.4507	10	0.87932	D	0	.	18.228	0.89924	0.0:1.0:0.0:0.0	.	294;294	Q9P225;Q9P225-3	DYH2_HUMAN;.	E	294	ENSP00000373825:Q294E;ENSP00000082259:Q294E	ENSP00000082259:Q294E	Q	+	1	0	DNAH2	7578653	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.871000	0.75531	2.613000	0.88420	0.455000	0.32223	CAG		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		Missense_Mutation
SWAP70	23075	genome.wustl.edu	37	11	9769488	9769488	+	Missense_Mutation	SNP	C	C	T	rs147789282		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:9769488C>T	ENST00000318950.6	+	10	1542	c.1439C>T	c.(1438-1440)gCg>gTg	p.A480V	SWAP70_ENST00000447399.2_Missense_Mutation_p.A422V	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	480					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)	p.A480V(1)		NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		ACAACCGAGGCGGAGAAGCAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	11						C	VAL/ALA	1,4401	2.1+/-5.4	0,1,2200	102.0	96.0	98.0		1439	5.8	0.6	11	dbSNP_134	98	0,8588		0,0,4294	no	missense	SWAP70	NM_015055.2	64	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	480/586	9769488	1,12989	2201	4294	6495	9726064	SO:0001583	missense	23075			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1439C>T	11.37:g.9769488C>T	ENSP00000315630:p.Ala480Val	Somatic		Capture	Illumina GAIIx	4	9726064	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	37	CCDS31426.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	13.57	2.278106	0.40294	2.27E-4	0.0	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.18960	2.18;2.18	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.27832	0.0685	L	0.38838	1.175	0.48341	D	0.999637	D;D	0.62365	0.989;0.991	P;B	0.49799	0.622;0.403	T	0.00329	-1.1813	10	0.29301	T	0.29	-14.9098	20.1346	0.98019	0.0:1.0:0.0:0.0	.	422;480	E7EMB1;Q9UH65	.;SWP70_HUMAN	V	422;480	ENSP00000399056:A422V;ENSP00000315630:A480V	ENSP00000315630:A480V	A	+	2	0	SWAP70	9726064	1.000000	0.71417	0.597000	0.28824	0.082000	0.17680	5.681000	0.68175	2.765000	0.95021	0.655000	0.94253	GCG		0.542	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055		Missense_Mutation
TMEM52B	120939	genome.wustl.edu	37	12	10332225	10332225	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:10332225C>T	ENST00000381923.2	+	2	456	c.52C>T	c.(52-54)Ctg>Ttg	p.L18L	TMEM52B_ENST00000298530.3_Silent_p.S12S|TMEM52B_ENST00000536952.1_Silent_p.L18L			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	18						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.S12S(1)									GTATTTCATCCTGGTGAGTTC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											162.0	152.0	155.0					12																	10332225		2203	4300	6503	10223492	SO:0001819	synonymous_variant	120939			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.52C>T	12.37:g.10332225C>T		Somatic		Capture	Illumina GAIIx	4	10223492	Q96NA7	Silent	SNP	ENST00000381923.2	37		SNP	24	WashU																																																																																				0.507	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000399645.1	NM_153022		Silent
MYH4	4622	genome.wustl.edu	37	17	10350372	10350372	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:10350372C>A	ENST00000255381.2	-	35	5237	c.5127G>T	c.(5125-5127)gaG>gaT	p.E1709D	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1709					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.E1709D(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CATCCAGAAGCTCTTGCTCTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											155.0	125.0	135.0					17																	10350372		2203	4300	6503	10291097	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5127G>T	17.37:g.10350372C>A	ENSP00000255381:p.Glu1709Asp	Somatic		Capture	Illumina GAIIx	4	10291097		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342658	0.82022	.	.	ENSG00000141048	ENST00000255381	D	0.81579	-1.51	5.29	-0.231	0.13086	Myosin tail (1);	0.000000	0.37530	U	0.002049	T	0.81894	0.4919	M	0.80028	2.48	0.40099	D	0.976349	P	0.46064	0.872	P	0.48270	0.572	T	0.80560	-0.1328	10	0.49607	T	0.09	.	10.0138	0.42003	0.0:0.5878:0.0:0.4122	.	1709	Q9Y623	MYH4_HUMAN	D	1709	ENSP00000255381:E1709D	ENSP00000255381:E1709D	E	-	3	2	MYH4	10291097	0.145000	0.22656	0.997000	0.53966	0.991000	0.79684	-0.427000	0.06999	0.063000	0.16370	0.563000	0.77884	GAG		0.493	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		Missense_Mutation
MYH2	4620	genome.wustl.edu	37	17	10428144	10428144	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:10428144T>A	ENST00000245503.5	-	34	5285	c.4901A>T	c.(4900-4902)cAg>cTg	p.Q1634L	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.Q1634L|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1634					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.Q1634L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						ATGGTTCAGCTGGATTTCCAT	0.517																																																1	Substitution - Missense(1)	ovary(1)	17											205.0	177.0	187.0					17																	10428144		2203	4298	6501	10368869	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.4901A>T	17.37:g.10428144T>A	ENSP00000245503:p.Gln1634Leu	Somatic		Capture	Illumina GAIIx	4	10368869	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	17.55	3.417329	0.62622	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.78924	-1.22;-1.22	5.44	5.44	0.79542	Myosin tail (1);	0.000000	0.37304	U	0.002144	D	0.88194	0.6371	H	0.96269	3.795	0.58432	D	0.999999	P	0.34462	0.454	B	0.43155	0.41	D	0.90412	0.4410	10	0.87932	D	0	.	15.662	0.77193	0.0:0.0:0.0:1.0	.	1634	Q9UKX2	MYH2_HUMAN	L	1634	ENSP00000245503:Q1634L;ENSP00000380367:Q1634L	ENSP00000245503:Q1634L	Q	-	2	0	MYH2	10368869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.778000	0.85637	2.277000	0.76020	0.482000	0.46254	CAG		0.517	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534		Missense_Mutation
RP1L1	94137	genome.wustl.edu	37	8	10480641	10480641	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:10480641G>T	ENST00000382483.3	-	2	294	c.71C>A	c.(70-72)aCc>aAc	p.T24N	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	24					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.T24N(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GACCGAGGGGGTGCGAGCCAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	8											35.0	39.0	37.0					8																	10480641		2018	4168	6186	10518051	SO:0001583	missense	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.71C>A	8.37:g.10480641G>T	ENSP00000371923:p.Thr24Asn	Somatic		Capture	Illumina GAIIx	4	10518051	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	g	11.62	1.693782	0.30052	.	.	ENSG00000183638	ENST00000382483	T	0.04809	3.55	4.5	2.6	0.31112	.	.	.	.	.	T	0.04861	0.0131	L	0.38531	1.155	0.09310	N	1	P	0.43024	0.798	B	0.42959	0.403	T	0.37549	-0.9701	9	0.40728	T	0.16	-6.3853	4.2672	0.10769	0.0869:0.1549:0.5985:0.1597	.	24	A6NKC6	.	N	24	ENSP00000371923:T24N	ENSP00000371923:T24N	T	-	2	0	RP1L1	10518051	.	.	0.747000	0.31113	0.227000	0.25037	.	.	1.112000	0.41740	0.457000	0.33378	ACC		0.667	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Missense_Mutation
TARDBP	23435	genome.wustl.edu	37	1	11082452	11082452	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:11082452C>T	ENST00000240185.3	+	6	1100	c.986C>T	c.(985-987)gCa>gTa	p.A329V	TARDBP_ENST00000439080.2_Missense_Mutation_p.A213V|TARDBP_ENST00000315091.3_Intron	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	329	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A329V(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GCCCAGGCAGCACTACAGAGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	61.0	62.0					1																	11082452		2203	4300	6503	11005039	SO:0001583	missense	23435			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.986C>T	1.37:g.11082452C>T	ENSP00000240185:p.Ala329Val	Somatic		Capture	Illumina GAIIx	4	11005039	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	ENST00000240185.3	37	CCDS122.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703259	0.68501	.	.	ENSG00000120948	ENST00000240185;ENST00000439080	D;D	0.96334	-3.98;-3.98	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.97461	0.9169	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.986	D	0.95515	0.8589	10	0.13108	T	0.6	-20.6778	20.0826	0.97783	0.0:1.0:0.0:0.0	.	213;329	B4DJ45;Q13148	.;TADBP_HUMAN	V	329;213	ENSP00000240185:A329V;ENSP00000404666:A213V	ENSP00000240185:A329V	A	+	2	0	TARDBP	11005039	1.000000	0.71417	0.930000	0.37139	0.976000	0.68499	7.544000	0.82117	2.746000	0.94184	0.655000	0.94253	GCA		0.527	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006063.1	NM_007375		Missense_Mutation
MSL3	10943	genome.wustl.edu	37	X	11781906	11781906	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:11781906C>T	ENST00000312196.4	+	8	862	c.757C>T	c.(757-759)Ctt>Ttt	p.L253F	MSL3_ENST00000337339.2_Missense_Mutation_p.L253F|MSL3_ENST00000361672.2_Missense_Mutation_p.L104F|MSL3_ENST00000380693.3_Missense_Mutation_p.L87F|MSL3_ENST00000398527.2_Missense_Mutation_p.L241F	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	253	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L253F(1)		breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						CAGTGTTGACCTTTGTAAGGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											169.0	151.0	157.0					X																	11781906		2203	4300	6503	11691827	SO:0001583	missense	10943			AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.757C>T	X.37:g.11781906C>T	ENSP00000312244:p.Leu253Phe	Somatic		Capture	Illumina GAIIx	4	11691827	A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	ENST00000312196.4	37	CCDS14147.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	17.79	3.477089	0.63849	.	.	ENSG00000005302	ENST00000312196;ENST00000337339;ENST00000361672;ENST00000398527;ENST00000380693;ENST00000380692	T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71	5.06	4.18	0.49190	.	0.071450	0.53938	D	0.000042	T	0.38134	0.1029	M	0.86178	2.8	0.41853	D	0.990188	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.996;0.998;0.996;0.998;1.0	T	0.31364	-0.9946	10	0.66056	D	0.02	.	9.6398	0.39833	0.0:0.8338:0.0:0.1662	.	241;104;194;253;253	B4DUV8;B7Z227;Q8N5Y2-2;Q8N5Y2;A6NHW8	.;.;.;MS3L1_HUMAN;.	F	253;253;104;241;87;87	ENSP00000312244:L253F;ENSP00000338078:L253F;ENSP00000354562:L104F;ENSP00000381538:L241F;ENSP00000370069:L87F;ENSP00000370068:L87F	ENSP00000312244:L253F	L	+	1	0	MSL3	11691827	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.475000	0.35409	2.090000	0.63153	0.538000	0.68166	CTT		0.373	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055757.1	NM_006800		Missense_Mutation
DNAH5	1767	genome.wustl.edu	37	5	13769720	13769720	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:13769720T>G	ENST00000265104.4	-	57	9714	c.9610A>C	c.(9610-9612)Aat>Cat	p.N3204H	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3204	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N3204H(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATCCAGTATTCATTCTGGGA	0.398									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											132.0	126.0	128.0					5																	13769720		2203	4300	6503	13822720	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9610A>C	5.37:g.13769720T>G	ENSP00000265104:p.Asn3204His	Somatic		Capture	Illumina GAIIx	4	13822720	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928126	0.52759	.	.	ENSG00000039139	ENST00000265104	T	0.74632	-0.86	5.77	5.77	0.91146	Dynein heavy chain, coiled coil stalk (1);	0.089765	0.85682	D	0.000000	T	0.77751	0.4177	M	0.74647	2.275	0.54753	D	0.999987	B	0.17465	0.022	B	0.30105	0.111	T	0.75266	-0.3378	10	0.56958	D	0.05	.	16.3818	0.83467	0.0:0.0:0.0:1.0	.	3204	Q8TE73	DYH5_HUMAN	H	3204	ENSP00000265104:N3204H	ENSP00000265104:N3204H	N	-	1	0	DNAH5	13822720	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.875000	0.63072	2.330000	0.79161	0.528000	0.53228	AAT		0.398	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
FREM1	158326	genome.wustl.edu	37	9	14750192	14750192	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr9:14750192G>C	ENST00000380880.3	-	30	6273	c.5490C>G	c.(5488-5490)aaC>aaG	p.N1830K	FREM1_ENST00000380894.1_Missense_Mutation_p.N366K|FREM1_ENST00000486223.1_5'Flank|FREM1_ENST00000380881.4_Missense_Mutation_p.N1831K|FREM1_ENST00000422223.2_Missense_Mutation_p.N1830K			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1830	Calx-beta.				cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.N1831K(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCACAGGGGAGTTCAGAATTA	0.378																																																1	Substitution - Missense(1)	ovary(1)	9											157.0	146.0	150.0					9																	14750192		1848	4094	5942	14740192	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.5490C>G	9.37:g.14750192G>C	ENSP00000370262:p.Asn1830Lys	Somatic		Capture	Illumina GAIIx	4	14740192	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	5.903	0.350646	0.11182	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.51	5.51	0.81932	.	0.233910	0.45126	D	0.000394	T	0.15825	0.0381	L	0.33137	0.985	0.39974	D	0.974825	B;B	0.27791	0.189;0.189	B;B	0.21917	0.037;0.037	T	0.04621	-1.0938	10	0.06099	T	0.92	-24.9419	10.8831	0.46951	0.1453:0.0:0.8547:0.0	.	1830;366	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	K	1831;1830;366;1830	ENSP00000370263:N1831K;ENSP00000412940:N1830K;ENSP00000370278:N366K;ENSP00000370262:N1830K	ENSP00000370262:N1830K	N	-	3	2	FREM1	14740192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.464000	0.53057	2.588000	0.87417	0.563000	0.77884	AAC		0.378	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		Missense_Mutation
CAP2	10486	genome.wustl.edu	37	6	17543168	17543168	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:17543168G>T	ENST00000229922.2	+	10	1635	c.1103G>T	c.(1102-1104)gGg>gTg	p.G368V	CAP2_ENST00000493172.1_Missense_Mutation_p.G108V|CAP2_ENST00000489374.1_Missense_Mutation_p.G256V|CAP2_ENST00000465994.1_Missense_Mutation_p.G304V|CAP2_ENST00000378990.2_Missense_Mutation_p.G342V	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	368	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)		p.G368V(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			CAGATAAAAGGGAAAGTAAAC	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	112.0	114.0					6																	17543168		2203	4300	6503	17651147	SO:0001583	missense	10486			BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.1103G>T	6.37:g.17543168G>T	ENSP00000229922:p.Gly368Val	Somatic		Capture	Illumina GAIIx	4	17651147	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	ENST00000229922.2	37	CCDS4539.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	g	27.9	4.871480	0.91587	.	.	ENSG00000112186	ENST00000229922;ENST00000378994;ENST00000489374;ENST00000378990;ENST00000493172;ENST00000465994	T;T;T;T	0.16457	2.49;2.38;2.39;2.34	5.99	5.99	0.97316	CARP motif (1);Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal (1);Adenylate cyclase-associated CAP, C-terminal (2);C-CAP/cofactor C-like domain (1);	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	H	0.94698	3.57	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;0.997	T	0.64521	-0.6388	10	0.87932	D	0	-25.2775	20.4488	0.99124	0.0:0.0:1.0:0.0	.	108;256;304;342;368	B7Z214;B7Z385;B7Z1C4;E9PDI2;P40123	.;.;.;.;CAP2_HUMAN	V	368;285;256;342;108;304	ENSP00000229922:G368V;ENSP00000417705:G256V;ENSP00000368275:G342V;ENSP00000418604:G304V	ENSP00000229922:G368V	G	+	2	0	CAP2	17651147	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.023000	0.88764	2.843000	0.97960	0.655000	0.94253	GGG		0.348	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2			Missense_Mutation
CSRP2BP	57325	genome.wustl.edu	37	20	18142728	18142728	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:18142728G>C	ENST00000435364.3	+	5	1288	c.947G>C	c.(946-948)aGc>aCc	p.S316T	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.S315T|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.S188T	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	316					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.S316T(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TCCTCCTTGAGCTCCTCTGAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	20											146.0	162.0	157.0					20																	18142728		2203	4300	6503	18090728	SO:0001583	missense	57325			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.947G>C	20.37:g.18142728G>C	ENSP00000392318:p.Ser316Thr	Somatic		Capture	Illumina GAIIx	4	18090728	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267744	0.59540	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.18502	2.21;2.21;2.21;2.33	5.87	4.93	0.64822	.	0.039802	0.85682	D	0.000000	T	0.14527	0.0351	N	0.24115	0.695	0.58432	D	0.999995	P;B	0.37500	0.597;0.435	B;B	0.40285	0.325;0.115	T	0.10520	-1.0626	10	0.22109	T	0.4	-22.2941	15.3445	0.74324	0.0669:0.0:0.9331:0.0	.	188;316	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	T	316;315;316;188	ENSP00000278816:S316T;ENSP00000366909:S315T;ENSP00000392318:S316T;ENSP00000425909:S188T	ENSP00000278816:S316T	S	+	2	0	CSRP2BP	18090728	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.274000	0.78538	1.627000	0.50400	0.655000	0.94253	AGC		0.532	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536		Missense_Mutation
MAP7D2	256714	genome.wustl.edu	37	X	20028956	20028956	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:20028956G>A	ENST00000379651.3	-	15	2182	c.2164C>T	c.(2164-2166)Cct>Tct	p.P722S	MAP7D2_ENST00000443379.3_Missense_Mutation_p.P677S|MAP7D2_ENST00000543767.1_Missense_Mutation_p.P607S|MAP7D2_ENST00000379643.5_Missense_Mutation_p.P763S|MAP7D2_ENST00000452324.3_Missense_Mutation_p.P670S	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	722					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)		p.P722S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						TCTTGGCCAGGACTGTTAAAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											126.0	120.0	122.0					X																	20028956		2203	4300	6503	19938877	SO:0001583	missense	256714			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.2164C>T	X.37:g.20028956G>A	ENSP00000368972:p.Pro722Ser	Somatic		Capture	Illumina GAIIx	4	19938877	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	ENST00000379651.3	37	CCDS14195.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	24.6	4.543956	0.86022	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000544957;ENST00000452324	T;T;T;T;T	0.34072	1.69;1.75;1.7;1.38;1.73	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000001	T	0.59824	0.2222	M	0.64997	1.995	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.995	D;D;D;D;D	0.97110	0.993;0.997;0.997;1.0;0.968	T	0.62817	-0.6774	10	0.72032	D	0.01	-12.6583	18.3321	0.90272	0.0:0.0:1.0:0.0	.	677;670;763;722;607	B7Z3S7;C9JYW0;Q96T17-2;Q96T17;F5GYC2	.;.;.;MA7D2_HUMAN;.	S	722;763;607;677;405;670	ENSP00000368972:P722S;ENSP00000368964:P763S;ENSP00000440691:P607S;ENSP00000388239:P677S;ENSP00000413301:P670S	ENSP00000368964:P763S	P	-	1	0	MAP7D2	19938877	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.421000	0.66447	2.268000	0.75426	0.525000	0.51046	CCT		0.403	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056001.1	NM_152780		Missense_Mutation
DERL3	91319	genome.wustl.edu	37	22	24179304	24179304	+	Silent	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr22:24179304G>A	ENST00000318109.7	-	6	577	c.561C>T	c.(559-561)gaC>gaT	p.D187D	DERL3_ENST00000406855.3_Silent_p.D187D|DERL3_ENST00000404056.1_Silent_p.D160D|DERL3_ENST00000476077.1_Silent_p.D187D|DERL3_ENST00000464023.1_5'Flank			Q96Q80	DERL3_HUMAN	derlin 3	187					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of endoplasmic reticulum membrane (GO:0030176)		p.D187D(1)		ovary(1)|prostate(1)|skin(1)	3						TGGGGAAGACGTCCTCCAGGA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	22											76.0	70.0	72.0					22																	24179304		2203	4300	6503	22509304	SO:0001819	synonymous_variant	91319			AB049213	CCDS33615.1, CCDS42986.1, CCDS46672.1	22q11.23	2012-02-01	2012-02-01	2004-11-02	ENSG00000099958	ENSG00000099958			14236	protein-coding gene	gene with protein product		610305	"""chromosome 22 open reading frame 14"", ""Der1-like domain family, member 3"""	C22orf14		15215855	Standard	NM_198440		Approved	FLJ43842, MGC71803, derlin-3, IZP6	uc002zyk.4	Q96Q80	OTTHUMG00000150743	ENST00000318109.7:c.561C>T	22.37:g.24179304G>A		Somatic		Capture	Illumina GAIIx	4	22509304	F2Z3B6|Q6ICJ6|Q6PEX0|Q6ZUB5	Silent	SNP	ENST00000318109.7	37	CCDS33615.1	SNP	40	WashU																																																																																				0.617	DERL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319905.1	NM_198440		Silent
UPB1	51733	genome.wustl.edu	37	22	24909450	24909450	+	Silent	SNP	C	C	T	rs138608016		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr22:24909450C>T	ENST00000326010.5	+	5	962	c.618C>T	c.(616-618)aaC>aaT	p.N206N	UPB1_ENST00000413389.2_Silent_p.N138N	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	206	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)	p.N206N(1)|p.N206K(1)		endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					GTGATTTCAACGAGGTGAGCC	0.512																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	urinary_tract(1)|ovary(1)	22						C		3,4403	6.2+/-15.9	0,3,2200	52.0	43.0	46.0		618	-11.0	0.1	22	dbSNP_134	46	0,8600		0,0,4300	no	coding-synonymous	UPB1	NM_016327.2		0,3,6500	TT,TC,CC		0.0,0.0681,0.0231		206/385	24909450	3,13003	2203	4300	6503	23239450	SO:0001819	synonymous_variant	51733			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.618C>T	22.37:g.24909450C>T		Somatic		Capture	Illumina GAIIx	4	23239450	A3KMF8|Q9UIR3	Silent	SNP	ENST00000326010.5	37	CCDS13827.1	SNP	19	WashU																																																																																				0.512	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319869.1			Silent
SNRPD3	6634	genome.wustl.edu	37	22	24953654	24953654	+	Silent	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr22:24953654T>C	ENST00000215829.3	+	2	599	c.12T>C	c.(10-12)ggT>ggC	p.G4G	SNRPD3_ENST00000402849.1_Silent_p.G4G|GUCD1_ENST00000435822.1_5'Flank|GUCD1_ENST00000407471.3_5'Flank|GUCD1_ENST00000404664.3_5'Flank|GUCD1_ENST00000402766.1_5'Flank|GUCD1_ENST00000447813.2_5'Flank	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	4					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)	p.G4G(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						TGTCTATTGGTGTGCCGATTA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	22											200.0	169.0	180.0					22																	24953654		2203	4300	6503	23283654	SO:0001819	synonymous_variant	6634			U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.12T>C	22.37:g.24953654T>C		Somatic		Capture	Illumina GAIIx	4	23283654	B4DJP7|B5BU13|P43331	Silent	SNP	ENST00000215829.3	37	CCDS13828.1	SNP	59	WashU																																																																																				0.483	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319813.1	NM_004175		Silent
IRF9	10379	genome.wustl.edu	37	14	24632648	24632648	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr14:24632648G>T	ENST00000396864.3	+	4	713	c.426G>T	c.(424-426)agG>agT	p.R142S	RP11-468E2.4_ENST00000558468.1_3'UTR|IRF9_ENST00000557894.1_Missense_Mutation_p.R40S	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	142					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R142S(1)		NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		CCTCTGAGAGGAAGGAGGAAG	0.532																																																1	Substitution - Missense(1)	ovary(1)	14											172.0	160.0	164.0					14																	24632648		2203	4300	6503	23702488	SO:0001583	missense	10379			M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.426G>T	14.37:g.24632648G>T	ENSP00000380073:p.Arg142Ser	Somatic		Capture	Illumina GAIIx	4	23702488	D3DS61	Missense_Mutation	SNP	ENST00000396864.3	37	CCDS9615.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	9.255	1.041641	0.19748	.	.	ENSG00000213928	ENST00000396864;ENST00000324076	D;D	0.98835	-4.2;-5.17	5.01	2.06	0.26882	.	1.493320	0.04107	U	0.313855	D	0.96371	0.8816	L	0.53249	1.67	0.09310	N	1	B;B	0.31026	0.304;0.022	B;B	0.24974	0.057;0.01	D	0.91017	0.4854	10	0.20519	T	0.43	-38.601	3.8162	0.08817	0.1985:0.0:0.6086:0.1929	.	142;142	B4DI86;Q00978	.;IRF9_HUMAN	S	142;72	ENSP00000380073:R142S;ENSP00000313529:R72S	ENSP00000313529:R72S	R	+	3	2	IRF9	23702488	0.877000	0.30153	0.574000	0.28523	0.400000	0.30750	0.457000	0.21875	1.335000	0.45486	0.655000	0.94253	AGG		0.532	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071927.2			Missense_Mutation
CDH10	1008	genome.wustl.edu	37	5	24593441	24593441	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:24593441T>A	ENST00000264463.4	-	2	666	c.159A>T	c.(157-159)aaA>aaT	p.K53N	RP11-116O11.1_ENST00000510391.1_RNA	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	53					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K53N(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCCAACCACGTTTTTGACGAT	0.403										HNSCC(23;0.051)																																						1	Substitution - Missense(1)	ovary(1)	5											137.0	135.0	135.0					5																	24593441		2203	4300	6503	24629198	SO:0001583	missense	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.159A>T	5.37:g.24593441T>A	ENSP00000264463:p.Lys53Asn	Somatic		Capture	Illumina GAIIx	4	24629198	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451385	0.63290	.	.	ENSG00000040731	ENST00000264463	T	0.00554	6.64	4.37	-2.68	0.06041	.	0.000000	0.85682	D	0.000000	T	0.01156	0.0038	M	0.78456	2.415	0.31794	N	0.629257	D	0.60160	0.987	P	0.54460	0.753	T	0.08310	-1.0728	10	0.87932	D	0	.	11.2619	0.49089	0.0:0.5477:0.0:0.4523	.	53	Q9Y6N8	CAD10_HUMAN	N	53	ENSP00000264463:K53N	ENSP00000264463:K53N	K	-	3	2	CDH10	24629198	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	0.741000	0.26202	-0.494000	0.06669	-0.668000	0.03835	AAA		0.403	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		Missense_Mutation
LDLRAP1	26119	genome.wustl.edu	37	1	25880417	25880417	+	Silent	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:25880417G>T	ENST00000374338.4	+	2	212	c.93G>T	c.(91-93)ctG>ctT	p.L31L	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	31					amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)	p.L31L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCAGAGCTGCCTGAGAACT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											49.0	40.0	43.0					1																	25880417		2203	4300	6503	25753004	SO:0001819	synonymous_variant	26119			BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.93G>T	1.37:g.25880417G>T		Somatic		Capture	Illumina GAIIx	4	25753004	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Silent	SNP	ENST00000374338.4	37	CCDS30639.1	SNP	46	WashU																																																																																				0.622	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019350.3	NM_015627		Silent
HIST1H2BI	8346	genome.wustl.edu	37	6	26273279	26273279	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:26273279G>T	ENST00000377733.2	+	1	136	c.76G>T	c.(76-78)Gat>Tat	p.D26Y	HIST1H3G_ENST00000305910.3_5'Flank	NM_003525.2	NP_003516.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	26					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(1)|lung(8)|urinary_tract(1)	16						ACAGAAGAAGGATGGCAAGAA	0.592																																																0			6											187.0	175.0	179.0					6																	26273279		2203	4300	6503	26381258	SO:0001583	missense	8346			Z80782	CCDS4603.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000168242	ENSG00000278588		"""Histones / Replication-dependent"""	4756	protein-coding gene	gene with protein product		602807	"""H2B histone family, member K"", ""histone 1, H2bi"""	H2BFK		9119399, 12408966	Standard	NM_003525		Approved	H2B/k	uc003nhk.3	P62807	OTTHUMG00000014448	ENST00000377733.2:c.76G>T	6.37:g.26273279G>T	ENSP00000366962:p.Asp26Tyr	Somatic		Capture	Illumina GAIIx	4	26381258	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000377733.2	37	CCDS4603.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	.	12.79	2.043619	0.36085	.	.	ENSG00000168242	ENST00000377733	T	0.22336	1.96	4.78	4.78	0.61160	.	.	.	.	.	T	0.32823	0.0842	M	0.79258	2.445	0.32078	N	0.593506	.	.	.	.	.	.	T	0.20438	-1.0275	7	0.87932	D	0	.	16.4098	0.83704	0.0:0.0:1.0:0.0	.	.	.	.	Y	26	ENSP00000366962:D26Y	ENSP00000366962:D26Y	D	+	1	0	HIST1H2BI	26381258	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	3.914000	0.56401	2.206000	0.71126	0.563000	0.77884	GAT		0.592	HIST1H2BI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040111.1	NM_003525		Missense_Mutation
DEFB115	245929	genome.wustl.edu	37	20	29845473	29845473	+	Missense_Mutation	SNP	C	C	A	rs191451885		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:29845473C>A	ENST00000400552.1	+	1	7	c.7C>A	c.(7-9)Cca>Aca	p.P3T		NM_001037730.1	NP_001032819.1	Q30KQ5	DB115_HUMAN	defensin, beta 115	3					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.P3T(1)		kidney(1)|lung(3)|ovary(1)|skin(1)	6			Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)			CAGAATGCTGCCAGATCATTT	0.498																																																1	Substitution - Missense(1)	ovary(1)	20											98.0	93.0	95.0					20																	29845473		1975	4164	6139	29309134	SO:0001583	missense	245929			DQ012019	CCDS42859.1	20q11.1	2008-07-17			ENSG00000215547	ENSG00000215547		"""Defensins, beta"""	18096	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037730		Approved	DEFB-15	uc002wvp.1	Q30KQ5	OTTHUMG00000159284	ENST00000400552.1:c.7C>A	20.37:g.29845473C>A	ENSP00000383398:p.Pro3Thr	Somatic		Capture	Illumina GAIIx	4	29309134		Missense_Mutation	SNP	ENST00000400552.1	37	CCDS42859.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	1.660	-0.511750	0.04200	.	.	ENSG00000215547	ENST00000400552	T	0.29655	1.56	3.12	1.13	0.20643	.	.	.	.	.	T	0.15565	0.0375	.	.	.	0.09310	N	1	P	0.42518	0.782	B	0.34779	0.189	T	0.11591	-1.0581	8	0.32370	T	0.25	.	4.3332	0.11073	0.0:0.6303:0.2368:0.1329	.	3	Q30KQ5	DB115_HUMAN	T	3	ENSP00000383398:P3T	ENSP00000383398:P3T	P	+	1	0	DEFB115	29309134	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.361000	0.20267	0.345000	0.23873	-0.241000	0.12123	CCA		0.498	DEFB115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354402.1	NM_001037730		Missense_Mutation
HCK	3055	genome.wustl.edu	37	20	30681801	30681801	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:30681801G>A	ENST00000520553.1	+	11	1411	c.1165G>A	c.(1165-1167)Gag>Aag	p.E389K	HCK_ENST00000375862.2_Missense_Mutation_p.E409K|HCK_ENST00000375852.2_Missense_Mutation_p.E410K|HCK_ENST00000518730.1_Missense_Mutation_p.E388K|HCK_ENST00000538448.1_Missense_Mutation_p.E389K|HCK_ENST00000534862.1_Missense_Mutation_p.E390K	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	410	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.E389K(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	TGAGGACAACGAGTACACGGC	0.552																																																1	Substitution - Missense(1)	ovary(1)	20											165.0	134.0	144.0					20																	30681801		2203	4300	6503	30145462	SO:0001583	missense	3055			AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.1165G>A	20.37:g.30681801G>A	ENSP00000429848:p.Glu389Lys	Somatic		Capture	Illumina GAIIx	4	30145462	A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	ENST00000520553.1	37	CCDS54455.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179248	0.78564	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.05	4.06	0.47325	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.139699	0.46145	D	0.000317	T	0.75874	0.3909	N	0.21240	0.645	0.54753	D	0.999983	B;P	0.36125	0.242;0.538	B;B	0.39840	0.207;0.311	T	0.79938	-0.1592	10	0.87932	D	0	.	14.831	0.70149	0.0:0.1434:0.8566:0.0	.	388;410	P08631-3;P08631	.;HCK_HUMAN	K	390;389;409;389;388;410	ENSP00000444986:E390K;ENSP00000441169:E389K;ENSP00000365022:E409K;ENSP00000429848:E389K;ENSP00000427757:E388K;ENSP00000365012:E410K	ENSP00000365012:E410K	E	+	1	0	HCK	30145462	1.000000	0.71417	0.981000	0.43875	0.940000	0.58332	6.441000	0.73439	2.632000	0.89209	0.542000	0.68232	GAG		0.552	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000375751.1			Missense_Mutation
TEX26	122046	genome.wustl.edu	37	13	31526879	31526879	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:31526879A>C	ENST00000380473.3	+	3	242	c.229A>C	c.(229-231)Act>Cct	p.T77P		NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	77								p.T77P(1)									TGATGAGTACACTTGGAAATC	0.338																																																1	Substitution - Missense(1)	ovary(1)	13											110.0	105.0	107.0					13																	31526879		2203	4296	6499	30424879	SO:0001583	missense	122046			BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.229A>C	13.37:g.31526879A>C	ENSP00000369840:p.Thr77Pro	Somatic		Capture	Illumina GAIIx	4	30424879		Missense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	2.804	-0.248431	0.05867	.	.	ENSG00000175664	ENST00000380473	T	0.46063	0.88	4.5	-2.92	0.05615	.	1.822020	0.02934	N	0.139637	T	0.25680	0.0625	L	0.34521	1.04	0.09310	N	1	P	0.35982	0.531	B	0.31686	0.134	T	0.09015	-1.0694	10	0.36615	T	0.2	-0.0534	1.2923	0.02062	0.4371:0.1477:0.2655:0.1497	.	77	Q8N6G2	CM026_HUMAN	P	77	ENSP00000369840:T77P	ENSP00000369840:T77P	T	+	1	0	C13orf26	30424879	0.000000	0.05858	0.006000	0.13384	0.081000	0.17604	-0.754000	0.04787	-0.466000	0.06943	-0.456000	0.05471	ACT		0.338	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325		Missense_Mutation
DTNA	1837	genome.wustl.edu	37	18	32398247	32398247	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr18:32398247G>C	ENST00000399113.3	+	7	829	c.829G>C	c.(829-831)Ggt>Cgt	p.G277R	DTNA_ENST00000554864.3_Missense_Mutation_p.G277R|DTNA_ENST00000598142.1_Missense_Mutation_p.G277R|DTNA_ENST00000269192.7_5'Flank|DTNA_ENST00000591182.1_5'Flank|DTNA_ENST00000597674.1_5'Flank|DTNA_ENST00000601125.1_5'UTR|DTNA_ENST00000595022.1_Missense_Mutation_p.G277R|AC068506.1_ENST00000408482.1_RNA|DTNA_ENST00000269190.7_Missense_Mutation_p.G277R|DTNA_ENST00000556414.3_5'Flank|DTNA_ENST00000348997.5_Missense_Mutation_p.G277R|DTNA_ENST00000444659.1_Missense_Mutation_p.G277R|DTNA_ENST00000315456.6_Missense_Mutation_p.G277R|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000269191.6_Missense_Mutation_p.G277R|DTNA_ENST00000599844.1_5'Flank|DTNA_ENST00000598334.1_Missense_Mutation_p.G277R|DTNA_ENST00000283365.9_Missense_Mutation_p.G277R|DTNA_ENST00000399121.5_Missense_Mutation_p.G277R|DTNA_ENST00000597599.1_Missense_Mutation_p.G277R|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000598774.1_Missense_Mutation_p.G277R			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	277	Interaction with MAGEE1. {ECO:0000250}.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.G277R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						GGGACATGCCGGTGGTTCTCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	18											123.0	99.0	107.0					18																	32398247		2203	4300	6503	30652245	SO:0001583	missense	1837			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.829G>C	18.37:g.32398247G>C	ENSP00000382064:p.Gly277Arg	Somatic		Capture	Illumina GAIIx	4	30652245	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	CCDS59311.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	17.04	3.288415	0.59976	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	D;D;D;D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86	5.87	2.72	0.32119	Zinc finger, ZZ-type (3);	0.425847	0.27821	N	0.017718	D	0.83403	0.5247	N	0.20685	0.6	0.80722	D	1	P;B;P;B;B;P;B;P;P;B;B;B	0.46277	0.875;0.113;0.454;0.293;0.16;0.679;0.063;0.464;0.464;0.16;0.095;0.409	P;B;B;P;B;B;B;B;B;B;B;B	0.46208	0.471;0.399;0.406;0.507;0.203;0.406;0.214;0.306;0.425;0.094;0.113;0.299	T	0.81204	-0.1039	10	0.87932	D	0	-8.4574	5.3848	0.16213	0.5319:0.0:0.468:0.0	.	27;277;277;277;277;277;277;288;277;277;277;277	B7Z3X3;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-4;E9PEH8;Q59GK7;Q9BS59;Q9Y4J8-2;Q9Y4J8-5;Q9Y4J8-7	.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.;.	R	277	ENSP00000283365:G277R;ENSP00000322519:G277R;ENSP00000269190:G277R;ENSP00000336682:G277R;ENSP00000382072:G277R;ENSP00000405819:G277R;ENSP00000269191:G277R;ENSP00000382064:G277R	ENSP00000269190:G277R	G	+	1	0	DTNA	30652245	1.000000	0.71417	0.736000	0.30914	0.995000	0.86356	4.400000	0.59709	0.812000	0.34326	0.650000	0.86243	GGT		0.507	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390		Missense_Mutation
BPIFB3	359710	genome.wustl.edu	37	20	31647277	31647277	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:31647277G>A	ENST00000375494.3	+	3	375	c.375G>A	c.(373-375)atG>atA	p.M125I	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	125	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.M125I(1)									AAGTGGGCATGCATTGCTCTG	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											67.0	59.0	62.0					20																	31647277		2203	4299	6502	31110938	SO:0001583	missense	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.375G>A	20.37:g.31647277G>A	ENSP00000364643:p.Met125Ile	Somatic		Capture	Illumina GAIIx	4	31110938	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	1.356	-0.589965	0.03799	.	.	ENSG00000186190	ENST00000375494	T	0.03468	3.92	4.34	3.34	0.38264	.	0.357444	0.20416	N	0.092772	T	0.01387	0.0045	N	0.02539	-0.55	0.22489	N	0.999057	B	0.02656	0.0	B	0.06405	0.002	T	0.47262	-0.9131	10	0.02654	T	1	-6.0536	9.2855	0.37755	0.0:0.241:0.759:0.0	.	125	P59826	BPIB3_HUMAN	I	125	ENSP00000364643:M125I	ENSP00000364643:M125I	M	+	3	0	BPIFB3	31110938	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.718000	0.47236	2.253000	0.74438	0.561000	0.74099	ATG		0.587	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658		Missense_Mutation
BPIFB3	359710	genome.wustl.edu	37	20	31656714	31656714	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:31656714G>A	ENST00000375494.3	+	10	1084	c.1084G>A	c.(1084-1086)Gcc>Acc	p.A362T		NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	362					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.A362T(1)									CTCCCTCCCAGCCAACATCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											129.0	94.0	106.0					20																	31656714		2203	4300	6503	31120375	SO:0001583	missense	359710			AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.1084G>A	20.37:g.31656714G>A	ENSP00000364643:p.Ala362Thr	Somatic		Capture	Illumina GAIIx	4	31120375	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	37	CCDS13212.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279556	0.40294	.	.	ENSG00000186190	ENST00000375494	T	0.09911	2.93	4.25	4.25	0.50352	.	0.127728	0.35013	N	0.003506	T	0.17831	0.0428	M	0.70275	2.135	0.21147	N	0.999771	P	0.45348	0.856	P	0.45753	0.492	T	0.07139	-1.0788	10	0.46703	T	0.11	-7.9546	12.3459	0.55119	0.0:0.0:1.0:0.0	.	362	P59826	BPIB3_HUMAN	T	362	ENSP00000364643:A362T	ENSP00000364643:A362T	A	+	1	0	BPIFB3	31120375	0.020000	0.18652	0.789000	0.31954	0.027000	0.11550	1.858000	0.39408	2.368000	0.80403	0.591000	0.81541	GCC		0.602	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658		Missense_Mutation
HCRTR1	3061	genome.wustl.edu	37	1	32085249	32085249	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:32085249G>T	ENST00000373706.5	+	2	469	c.316G>T	c.(316-318)Gtg>Ttg	p.V106L	HCRTR1_ENST00000468521.1_Intron|HCRTR1_ENST00000403528.2_Missense_Mutation_p.V106L|HCRTR1_ENST00000373705.1_Missense_Mutation_p.V106L			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	106					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)	p.V106L(1)		breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CAGCCTGCTGGTGGACATCAC	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	85.0	97.0					1																	32085249		2203	4300	6503	31857836	SO:0001583	missense	3061			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.316G>T	1.37:g.32085249G>T	ENSP00000362810:p.Val106Leu	Somatic		Capture	Illumina GAIIx	4	31857836	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	CCDS344.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640615	0.67244	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.01446	4.88;4.88;4.88	4.45	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.02848	0.0085	L	0.41356	1.27	0.42774	D	0.993844	P;P	0.45986	0.667;0.87	P;P	0.46718	0.474;0.525	T	0.66763	-0.5841	10	0.12430	T	0.62	.	15.3972	0.74805	0.0:0.0:1.0:0.0	.	106;106	A6NMV7;O43613	.;OX1R_HUMAN	L	106	ENSP00000384387:V106L;ENSP00000362810:V106L;ENSP00000362809:V106L	ENSP00000362809:V106L	V	+	1	0	HCRTR1	31857836	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	9.407000	0.97325	2.383000	0.81215	0.655000	0.94253	GTG		0.587	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525		Missense_Mutation
NOL6	65083	genome.wustl.edu	37	9	33466931	33466931	+	Silent	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr9:33466931T>C	ENST00000379471.2	-	15	2016	c.1929A>G	c.(1927-1929)gcA>gcG	p.A643A	NOL6_ENST00000455041.2_Silent_p.A591A|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	643					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A643A(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CTTGGATAAGTGCATCCAGGG	0.522											OREG0019137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	9											214.0	233.0	226.0					9																	33466931		2203	4300	6503	33456931	SO:0001819	synonymous_variant	65083			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.1929A>G	9.37:g.33466931T>C		Somatic	840	Capture	Illumina GAIIx	4	33456931	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	ENST00000379471.2	37		SNP	59	WashU																																																																																				0.522	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917		Silent
GRM4	2914	genome.wustl.edu	37	6	33996116	33996116	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:33996116C>A	ENST00000538487.2	-	10	2913	c.2470G>T	c.(2470-2472)Gtc>Ttc	p.V824F	GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374181.4_Missense_Mutation_p.V824F|GRM4_ENST00000609222.1_Missense_Mutation_p.V691F|GRM4_ENST00000374177.3_Missense_Mutation_p.V708F|GRM4_ENST00000455714.2_Missense_Mutation_p.V684F|GRM4_ENST00000535756.1_Missense_Mutation_p.V691F|GRM4_ENST00000544773.2_Missense_Mutation_p.V655F	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	824					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.V708F(1)|p.V824F(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTCACCGAGACCGTCAGCGTC	0.637																																																2	Substitution - Missense(2)	ovary(2)	6											122.0	113.0	116.0					6																	33996116		2203	4300	6503	34104094	SO:0001583	missense	2914			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2470G>T	6.37:g.33996116C>A	ENSP00000440556:p.Val824Phe	Somatic		Capture	Illumina GAIIx	4	34104094	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	10.64	1.408395	0.25378	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23;-2.23;-2.23	4.44	4.44	0.53790	GPCR, family 3, C-terminal (2);	0.255095	0.31041	N	0.008377	T	0.68366	0.2993	N	0.17564	0.495	0.40939	D	0.98445	B;B;P;P;B	0.44429	0.002;0.005;0.835;0.78;0.022	B;B;P;B;B	0.50825	0.019;0.017;0.651;0.446;0.034	T	0.72151	-0.4377	10	0.02654	T	1	.	8.531	0.33335	0.0:0.8563:0.0:0.1437	.	777;655;684;824;691	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	F	824;708;516;691;655;824;684	ENSP00000363296:V824F;ENSP00000363292:V708F;ENSP00000445533:V516F;ENSP00000437925:V691F;ENSP00000437730:V655F;ENSP00000440556:V824F;ENSP00000398456:V684F	ENSP00000363292:V708F	V	-	1	0	GRM4	34104094	0.980000	0.34600	0.998000	0.56505	0.052000	0.14988	1.694000	0.37752	2.298000	0.77334	0.549000	0.68633	GTC		0.637	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2			Missense_Mutation
AGXT2	64902	genome.wustl.edu	37	5	35047956	35047956	+	Silent	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:35047956C>G	ENST00000231420.6	-	1	242	c.42G>C	c.(40-42)ctG>ctC	p.L14L		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	14					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.L14L(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	CGGAAGTGACCAGGCACAAGG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	5											72.0	64.0	67.0					5																	35047956		2203	4300	6503	35083713	SO:0001819	synonymous_variant	64902			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.42G>C	5.37:g.35047956C>G		Somatic		Capture	Illumina GAIIx	4	35083713	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	ENST00000231420.6	37	CCDS3908.1	SNP	21	WashU																																																																																				0.547	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900		Silent
UNC5D	137970	genome.wustl.edu	37	8	35541228	35541228	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:35541228C>A	ENST00000404895.2	+	5	1062	c.734C>A	c.(733-735)gCc>gAc	p.A245D	UNC5D_ENST00000453357.2_Missense_Mutation_p.A240D|UNC5D_ENST00000420357.1_Missense_Mutation_p.A245D|UNC5D_ENST00000287272.2_Missense_Mutation_p.A245D|UNC5D_ENST00000416672.1_Missense_Mutation_p.A245D	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	245					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.A240D(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		AGCCTGTCGGCCACTGTTGTG	0.502																																																1	Substitution - Missense(1)	ovary(1)	8											53.0	47.0	49.0					8																	35541228		2203	4300	6503	35660770	SO:0001583	missense	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.734C>A	8.37:g.35541228C>A	ENSP00000385143:p.Ala245Asp	Somatic		Capture	Illumina GAIIx	4	35660770	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945253	0.73672	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	5.39	5.39	0.77823	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.046618	0.85682	D	0.000000	D	0.86973	0.6062	M	0.90198	3.095	0.80722	D	1	D;D;P	0.57257	0.978;0.979;0.954	D;P;P	0.65233	0.933;0.894;0.9	D	0.89015	0.3431	10	0.72032	D	0.01	-24.8971	19.5354	0.95251	0.0:1.0:0.0:0.0	.	245;240;245	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	D	245;245;245;245;240	ENSP00000385143:A245D;ENSP00000392739:A245D;ENSP00000287272:A245D;ENSP00000412652:A245D;ENSP00000394303:A240D	ENSP00000287272:A245D	A	+	2	0	UNC5D	35660770	1.000000	0.71417	0.990000	0.47175	0.467000	0.32768	7.818000	0.86416	2.709000	0.92574	0.655000	0.94253	GCC		0.502	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			Missense_Mutation
IL7R	3575	genome.wustl.edu	37	5	35876436	35876436	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:35876436A>G	ENST00000303115.3	+	8	1357	c.1228A>G	c.(1228-1230)Act>Gct	p.T410A	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	410					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.T410A(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TAGCCTTGGGACTACAAACAG	0.542			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	1	Substitution - Missense(1)	ovary(1)	5											102.0	88.0	93.0					5																	35876436		2203	4300	6503	35912193	SO:0001583	missense	3575			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.1228A>G	5.37:g.35876436A>G	ENSP00000306157:p.Thr410Ala	Somatic		Capture	Illumina GAIIx	4	35912193	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	CCDS3911.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	11.02	1.515852	0.27123	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.32753	1.95;1.44	5.6	1.72	0.24424	.	0.877555	0.10025	N	0.725521	T	0.25494	0.0620	L	0.57536	1.79	0.09310	N	0.999998	B	0.22480	0.07	B	0.19148	0.024	T	0.25328	-1.0135	10	0.23302	T	0.38	-27.5526	4.8102	0.13340	0.485:0.1543:0.0:0.3607	.	410	P16871	IL7RA_HUMAN	A	410;176	ENSP00000306157:T410A;ENSP00000420923:T176A	ENSP00000306157:T410A	T	+	1	0	IL7R	35912193	0.009000	0.17119	0.316000	0.25252	0.040000	0.13550	0.944000	0.29043	0.914000	0.36822	0.533000	0.62120	ACT		0.542	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			Missense_Mutation
BPI	671	genome.wustl.edu	37	20	36932679	36932679	+	Silent	SNP	C	C	T	rs201427770		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:36932679C>T	ENST00000262865.4	+	1	155	c.66C>T	c.(64-66)gtC>gtT	p.V22V	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	22					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.V22V(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				TGGTGCTGGTCGCCATAGGCA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		16062	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	20											71.0	63.0	66.0					20																	36932679		2203	4300	6503	36366093	SO:0001819	synonymous_variant	671			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.66C>T	20.37:g.36932679C>T		Somatic		Capture	Illumina GAIIx	4	36366093	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	37	CCDS13303.1	SNP	31	WashU																																																																																				0.632	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725		Silent
HHATL	57467	genome.wustl.edu	37	3	42734256	42734256	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:42734256T>C	ENST00000441594.1	-	12	1763	c.1502A>G	c.(1501-1503)gAg>gGg	p.E501G	HHATL_ENST00000310417.5_Missense_Mutation_p.E501G	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	501					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.E501G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		CTCCGGCTTCTCTTTGTCCTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	80.0	87.0					3																	42734256		2203	4300	6503	42709260	SO:0001583	missense	57467			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1502A>G	3.37:g.42734256T>C	ENSP00000405423:p.Glu501Gly	Somatic		Capture	Illumina GAIIx	4	42709260	Q8TBG3|Q9ULP7	Missense_Mutation	SNP	ENST00000441594.1	37	CCDS2704.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	t	10.09	1.255925	0.22965	.	.	ENSG00000010282	ENST00000310417;ENST00000441594	T;T	0.19250	2.16;2.16	3.25	3.25	0.37280	.	0.547968	0.16738	U	0.201560	T	0.10121	0.0248	N	0.14661	0.345	0.23089	N	0.99831	B	0.30068	0.267	B	0.19666	0.026	T	0.18053	-1.0349	10	0.36615	T	0.2	-10.8341	6.746	0.23462	0.0:0.0:0.2717:0.7283	.	501	Q9HCP6	HHATL_HUMAN	G	501	ENSP00000310621:E501G;ENSP00000405423:E501G	ENSP00000310621:E501G	E	-	2	0	HHATL	42709260	0.999000	0.42202	0.999000	0.59377	0.354000	0.29330	2.585000	0.46111	1.374000	0.46228	0.149000	0.16113	GAG		0.552	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707		Missense_Mutation
PEX6	5190	genome.wustl.edu	37	6	42934267	42934267	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:42934267G>A	ENST00000304611.8	-	10	2159	c.2090C>T	c.(2089-2091)cCc>cTc	p.P697L	PEX6_ENST00000244546.4_Missense_Mutation_p.P697L	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	697					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.P697L(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CTCCACCTTGGGGGCTCCAAC	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											67.0	70.0	69.0					6																	42934267		2203	4300	6503	43042245	SO:0001583	missense	5190			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2090C>T	6.37:g.42934267G>A	ENSP00000303511:p.Pro697Leu	Somatic		Capture	Illumina GAIIx	4	43042245	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	37	CCDS4877.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774156	0.90108	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	D;D	0.97553	-3.56;-4.43	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.97037	0.9032	L	0.46614	1.455	0.80722	D	1	P	0.52316	0.952	P	0.58577	0.841	D	0.97462	1.0035	10	0.62326	D	0.03	-23.2469	18.9872	0.92777	0.0:0.0:1.0:0.0	.	697	Q13608	PEX6_HUMAN	L	697	ENSP00000303511:P697L;ENSP00000244546:P697L	ENSP00000244546:P697L	P	-	2	0	PEX6	43042245	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	9.198000	0.94994	2.564000	0.86499	0.563000	0.77884	CCC		0.617	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287		Missense_Mutation
EIF2B3	8891	genome.wustl.edu	37	1	45454127	45454127	+	5'Flank	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:45454127G>A	ENST00000360403.2	-	0	0				EIF2B3_ENST00000480675.1_5'Flank|EIF2B3_ENST00000372183.3_5'Flank	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa						cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					GGATGTGTATGCTTTAGGACG	0.502																																					Colon(26;357 658 2581 11857 12657)											0			1																																								45226714	SO:0001631	upstream_gene_variant	128192			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585		1.37:g.45454127G>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	45226714	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	ENST00000360403.2	37	CCDS517.1	SNP	46	WashU																																																																																				0.502	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365		Missense_Mutation
OR10AD1	121275	genome.wustl.edu	37	12	48596656	48596656	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:48596656C>G	ENST00000310248.2	-	1	514	c.420G>C	c.(418-420)aaG>aaC	p.K140N		NM_001004134.1	NP_001004134.1	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD, member 1	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K140N(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|urinary_tract(1)	9						TGACACAGACCTTCTGGCTTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	65.0	68.0					12																	48596656		2203	4300	6503	46882923	SO:0001583	missense	121275				CCDS31787.1	12q13.11	2013-09-24	2002-11-13	2002-11-15	ENSG00000172640	ENSG00000172640		"""GPCR / Class A : Olfactory receptors"""	14819	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily AD, member 1 pseudogene"""	OR10AD1P			Standard	NM_001004134		Approved		uc001rrl.1	Q8NGE0	OTTHUMG00000168027	ENST00000310248.2:c.420G>C	12.37:g.48596656C>G	ENSP00000308689:p.Lys140Asn	Somatic		Capture	Illumina GAIIx	4	46882923	B9EGT9|Q6IFA8	Missense_Mutation	SNP	ENST00000310248.2	37	CCDS31787.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	0.606	-0.827071	0.02734	.	.	ENSG00000172640	ENST00000310248	T	0.40225	1.04	4.83	1.75	0.24633	GPCR, rhodopsin-like superfamily (1);	0.209910	0.24063	N	0.041881	T	0.31295	0.0792	L	0.41632	1.29	0.25595	N	0.986653	B	0.27625	0.183	B	0.28916	0.096	T	0.19128	-1.0315	10	0.36615	T	0.2	-0.1959	9.005	0.36106	0.2885:0.5709:0.1406:0.0	.	140	Q8NGE0	O10AD_HUMAN	N	140	ENSP00000308689:K140N	ENSP00000308689:K140N	K	-	3	2	OR10AD1	46882923	0.000000	0.05858	0.982000	0.44146	0.150000	0.21749	-0.441000	0.06879	0.727000	0.32360	0.561000	0.74099	AAG		0.502	OR10AD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397577.1			Missense_Mutation
STAU1	6780	genome.wustl.edu	37	20	47752392	47752392	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:47752392C>T	ENST00000371856.2	-	6	997	c.587G>A	c.(586-588)cGg>cAg	p.R196Q	STAU1_ENST00000371802.1_Missense_Mutation_p.R115Q|STAU1_ENST00000360426.4_Missense_Mutation_p.R115Q|STAU1_ENST00000371828.3_Missense_Mutation_p.R115Q|STAU1_ENST00000340954.7_Missense_Mutation_p.R115Q|STAU1_ENST00000347458.5_Missense_Mutation_p.R115Q|STAU1_ENST00000371792.1_Missense_Mutation_p.R115Q	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	196	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.R196Q(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			AGGCAAGTTCCGTTTAAGTGC	0.323																																																1	Substitution - Missense(1)	ovary(1)	20											102.0	93.0	96.0					20																	47752392		2202	4300	6502	47185799	SO:0001583	missense	6780				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.587G>A	20.37:g.47752392C>T	ENSP00000360922:p.Arg196Gln	Somatic		Capture	Illumina GAIIx	4	47185799	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.678151	0.96764	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404	T;T;T;T;T;T;T;T	0.76316	-0.25;-1.01;-1.01;-1.01;-1.01;-0.25;-1.01;-0.25	5.77	5.77	0.91146	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.050019	0.85682	D	0.000000	D	0.87732	0.6251	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.984	D	0.88075	0.2803	10	0.87932	D	0	-12.9136	19.5894	0.95501	0.0:1.0:0.0:0.0	.	196;115	O95793;Q5JW29	STAU1_HUMAN;.	Q	115;115;196;115;115;115;115;115;115	ENSP00000360893:R115Q;ENSP00000345425:R115Q;ENSP00000360922:R196Q;ENSP00000353604:R115Q;ENSP00000323443:R115Q;ENSP00000360867:R115Q;ENSP00000360857:R115Q;ENSP00000416779:R115Q	ENSP00000345425:R115Q	R	-	2	0	STAU1	47185799	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.603000	0.74145	2.720000	0.93068	0.557000	0.71058	CGG		0.323	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453		Missense_Mutation
SLC5A9	200010	genome.wustl.edu	37	1	48705048	48705048	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:48705048C>T	ENST00000438567.2	+	12	1568	c.1516C>T	c.(1516-1518)Ctg>Ttg	p.L506L	SLC5A9_ENST00000533824.1_Silent_p.L527L|SLC5A9_ENST00000236495.5_Silent_p.L531L	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	506					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.L524L(1)		breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						GCGTATGATCCTGGAGTTCTC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	1											158.0	153.0	154.0					1																	48705048		2203	4300	6503	48477635	SO:0001819	synonymous_variant	200010			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.1516C>T	1.37:g.48705048C>T		Somatic		Capture	Illumina GAIIx	4	48477635	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Silent	SNP	ENST00000438567.2	37	CCDS30709.2	SNP	24	WashU																																																																																				0.602	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022061.3	XM_117174		Silent
TRIM13	10206	genome.wustl.edu	37	13	50587277	50587277	+	Missense_Mutation	SNP	G	G	T	rs372562992		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:50587277G>T	ENST00000378182.3	+	2	1939	c.1201G>T	c.(1201-1203)Gtg>Ttg	p.V401L	TRIM13_ENST00000420995.2_Missense_Mutation_p.V401L|TRIM13_ENST00000298772.5_Missense_Mutation_p.V404L|KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000457662.2_Missense_Mutation_p.V401L|TRIM13_ENST00000356017.4_Missense_Mutation_p.V404L	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	401					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V401L(1)		large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		GGCAGAATTTGTGTGCAAATA	0.313																																																1	Substitution - Missense(1)	ovary(1)	13											66.0	73.0	71.0					13																	50587277		2202	4300	6502	49485278	SO:0001583	missense	10206			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.1201G>T	13.37:g.50587277G>T	ENSP00000367424:p.Val401Leu	Somatic		Capture	Illumina GAIIx	4	49485278	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	ENST00000378182.3	37	CCDS9423.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930234	0.34096	.	.	ENSG00000204977	ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	T;T;T;T;T	0.25749	1.78;1.78;2.32;1.78;2.32	5.91	4.06	0.47325	.	0.280406	0.33401	N	0.004946	T	0.18551	0.0445	L	0.29908	0.895	0.33110	D	0.540334	B;B	0.19817	0.023;0.039	B;B	0.20184	0.012;0.028	T	0.16512	-1.0400	9	.	.	.	-1.9099	12.1156	0.53863	0.1497:0.0:0.8503:0.0	.	401;404	O60858;O60858-3	TRI13_HUMAN;.	L	401;401;404;401;404	ENSP00000412943:V401L;ENSP00000367424:V401L;ENSP00000348299:V404L;ENSP00000399206:V401L;ENSP00000298772:V404L	.	V	+	1	0	TRIM13	49485278	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.700000	0.47085	0.712000	0.32039	0.655000	0.94253	GTG		0.313	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278		Missense_Mutation
BCL3	602	genome.wustl.edu	37	19	45259535	45259535	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:45259535C>T	ENST00000164227.5	+	3	701	c.457C>T	c.(457-459)Cgg>Tgg	p.R153W		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	153					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R145W(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				AGCTGTGCACCGGCTGGTCAA	0.622			T	IGH@	CLL																																		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	1	Substitution - Missense(1)	ovary(1)	19											41.0	37.0	38.0					19																	45259535		2203	4300	6503	49951375	SO:0001583	missense	602			M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.457C>T	19.37:g.45259535C>T	ENSP00000164227:p.Arg153Trp	Somatic		Capture	Illumina GAIIx	4	49951375		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	SNP	23	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.351668|2.351668	0.41700|0.41700	.|.	.|.	ENSG00000069399|ENSG00000069399	ENST00000444487|ENST00000403534;ENST00000164227	.|T	.|0.64618	.|-0.11	4.69|4.69	4.69|4.69	0.59074|0.59074	.|Ankyrin repeat-containing domain (3);	.|0.517985	.|0.16082	.|N	.|0.230468	T|T	0.48874|0.48874	0.1524|0.1524	L|L	0.31926|0.31926	0.97|0.97	0.09310|0.09310	N|N	1|1	.|B	.|0.27192	.|0.171	.|B	.|0.15870	.|0.014	T|T	0.45804|0.45804	-0.9236|-0.9236	5|10	.|0.56958	.|D	.|0.05	-14.9321|-14.9321	10.3791|10.3791	0.44101|0.44101	0.1959:0.8041:0.0:0.0|0.1959:0.8041:0.0:0.0	.|.	.|153	.|P20749	.|BCL3_HUMAN	L|W	36|113;153	.|ENSP00000164227:R153W	.|ENSP00000164227:R153W	P|R	+|+	2|1	0|2	BCL3|BCL3	49951375|49951375	0.025000|0.025000	0.19082|0.19082	0.013000|0.013000	0.15412|0.15412	0.553000|0.553000	0.35397|0.35397	1.889000|1.889000	0.39718|0.39718	2.141000|2.141000	0.66446|0.66446	0.462000|0.462000	0.41574|0.41574	CCG|CGG		0.622	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178		Missense_Mutation
RBM6	10180	genome.wustl.edu	37	3	50005087	50005087	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:50005087G>T	ENST00000266022.4	+	3	488	c.229G>T	c.(229-231)Gct>Tct	p.A77S	RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_5'UTR|RBM6_ENST00000441115.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	77					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A77S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CAGCTATGGAGCTAGAGACGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	3											93.0	99.0	97.0					3																	50005087		2203	4300	6503	49980091	SO:0001583	missense	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.229G>T	3.37:g.50005087G>T	ENSP00000266022:p.Ala77Ser	Somatic		Capture	Illumina GAIIx	4	49980091	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	13.25	2.182112	0.38511	.	.	ENSG00000004534	ENST00000266022;ENST00000416583	T	0.36520	1.25	6.04	6.04	0.98038	.	0.142736	0.48767	D	0.000164	T	0.20495	0.0493	N	0.08118	0	0.80722	D	1	B	0.24258	0.1	B	0.19148	0.024	T	0.11665	-1.0578	9	.	.	.	-15.1638	15.993	0.80220	0.0:0.1337:0.8663:0.0	.	77	P78332	RBM6_HUMAN	S	77	ENSP00000266022:A77S	.	A	+	1	0	RBM6	49980091	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.386000	0.66238	2.873000	0.98535	0.561000	0.74099	GCT		0.512	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		Missense_Mutation
CCNB3	85417	genome.wustl.edu	37	X	50053209	50053209	+	Silent	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:50053209T>A	ENST00000376042.1	+	6	2338	c.2040T>A	c.(2038-2040)gtT>gtA	p.V680V	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Silent_p.V680V			Q8WWL7	CCNB3_HUMAN	cyclin B3	680					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.V680V(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CATTGCATGTTAAGCATACCA	0.473																																																2	Substitution - coding silent(2)	ovary(2)	X											34.0	29.0	31.0					X																	50053209		2203	4300	6503	50069949	SO:0001819	synonymous_variant	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2040T>A	X.37:g.50053209T>A		Somatic		Capture	Illumina GAIIx	4	50069949	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Silent	SNP	ENST00000376042.1	37	CCDS14331.1	SNP	61	WashU																																																																																				0.473	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			Silent
GNAI2	2771	genome.wustl.edu	37	3	50290492	50290492	+	Missense_Mutation	SNP	G	G	A	rs368004918		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:50290492G>A	ENST00000313601.6	+	4	724	c.340G>A	c.(340-342)Gcc>Acc	p.A114T	GNAI2_ENST00000440628.1_Missense_Mutation_p.A62T|GNAI2_ENST00000451956.1_Missense_Mutation_p.A77T|GNAI2_ENST00000422163.1_Missense_Mutation_p.A98T|GNAI2_ENST00000266027.5_Missense_Mutation_p.A98T|GNAI2_ENST00000536647.1_Missense_Mutation_p.A33T|GNAI2_ENST00000491100.1_3'UTR	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	114					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.A114T(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GTCCTGCACCGCCGAGGAGCA	0.637																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	3						G	THR/ALA,THR/ALA	0,4406		0,0,2203	121.0	110.0	113.0		229,340	5.3	0.8	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GNAI2	NM_001166425.1,NM_002070.2	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	77/319,114/356	50290492	1,13005	2203	4300	6503	50265496	SO:0001583	missense	2771			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.340G>A	3.37:g.50290492G>A	ENSP00000312999:p.Ala114Thr	Somatic		Capture	Illumina GAIIx	4	50265496	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	37	CCDS2813.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180559	0.78677	0.0	1.16E-4	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	5.34	5.34	0.76211	G protein alpha subunit, helical insertion (2);	0.049801	0.85682	D	0.000000	T	0.81758	0.4890	L	0.31926	0.97	0.80722	D	1	B;B;B;B	0.10296	0.002;0.002;0.003;0.002	B;B;B;B	0.08055	0.002;0.002;0.003;0.002	T	0.74884	-0.3512	10	0.29301	T	0.29	.	17.3557	0.87335	0.0:0.0:1.0:0.0	.	77;114;98;98	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	T	98;114;33;114;62;77;98	ENSP00000406871:A98T;ENSP00000312999:A114T;ENSP00000444360:A33T;ENSP00000395736:A62T;ENSP00000406369:A77T;ENSP00000266027:A98T	ENSP00000266027:A98T	A	+	1	0	GNAI2	50265496	1.000000	0.71417	0.768000	0.31515	0.949000	0.60115	6.693000	0.74582	2.884000	0.98904	0.655000	0.94253	GCC		0.637	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070		Missense_Mutation
PARG	8505	genome.wustl.edu	37	10	51087745	51087745	+	Silent	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr10:51087745A>G	ENST00000402038.3	-	5	506	c.507T>C	c.(505-507)tcT>tcC	p.S169S		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	654	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)	p.S654S(1)		endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		CTGGGTAACTAGAATACTCCG	0.358																																																1	Substitution - coding silent(1)	ovary(1)	10											114.0	94.0	100.0					10																	51087745		692	1591	2283	50757751	SO:0001819	synonymous_variant	8505			AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.507T>C	10.37:g.51087745A>G		Somatic		Capture	Illumina GAIIx	4	50757751	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Silent	SNP	ENST00000402038.3	37		SNP	15	WashU																																																																																				0.358	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631		Silent
TSHZ2	128553	genome.wustl.edu	37	20	51871911	51871911	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr20:51871911A>C	ENST00000371497.5	+	2	2801	c.1914A>C	c.(1912-1914)gaA>gaC	p.E638D	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.E635D|TSHZ2_ENST00000603338.2_Missense_Mutation_p.E635D	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	638					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E638D(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GCAAAAGTGAAACACCTCCAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	20											56.0	61.0	60.0					20																	51871911		2203	4300	6503	51305318	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1914A>C	20.37:g.51871911A>C	ENSP00000360552:p.Glu638Asp	Somatic		Capture	Illumina GAIIx	4	51305318	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	1.857	-0.463530	0.04476	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.42513	0.97;0.97	5.24	0.194	0.15143	.	0.177411	0.49305	D	0.000158	T	0.29190	0.0726	L	0.39085	1.19	0.20489	N	0.999897	B	0.06786	0.001	B	0.06405	0.002	T	0.19976	-1.0289	10	0.40728	T	0.16	-13.8958	9.9414	0.41583	0.5645:0.0:0.4355:0.0	.	638	Q9NRE2	TSH2_HUMAN	D	638;635;164	ENSP00000360552:E638D;ENSP00000333114:E635D	ENSP00000333114:E635D	E	+	3	2	TSHZ2	51305318	0.199000	0.23386	0.011000	0.14972	0.014000	0.08584	0.812000	0.27211	0.036000	0.15547	0.523000	0.50628	GAA		0.542	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485		Missense_Mutation
CCDC8	83987	genome.wustl.edu	37	19	46915879	46915879	+	Silent	SNP	G	G	A	rs201425257		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:46915879G>A	ENST00000307522.3	-	1	962	c.189C>T	c.(187-189)acC>acT	p.T63T		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	63					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.T63T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GCGGGTGCggggtgctcttct	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		10669	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19																																								51607719	SO:0001819	synonymous_variant	83987			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.189C>T	19.37:g.46915879G>A		Somatic		Capture	Illumina GAIIx	4	51607719	Q8TB26	Silent	SNP	ENST00000307522.3	37	CCDS12685.1	SNP	43	WashU																																																																																				0.667	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040		Silent
UNC13C	440279	genome.wustl.edu	37	15	54307266	54307266	+	Silent	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr15:54307266A>C	ENST00000260323.11	+	1	2166	c.2166A>C	c.(2164-2166)ccA>ccC	p.P722P	UNC13C_ENST00000537900.1_Silent_p.P722P|UNC13C_ENST00000545554.1_Silent_p.P722P	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	722					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.P722P(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ATTCTTCTCCATGCCCTGGCT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	15											33.0	32.0	32.0					15																	54307266		1880	4117	5997	52094558	SO:0001819	synonymous_variant	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2166A>C	15.37:g.54307266A>C		Somatic		Capture	Illumina GAIIx	4	52094558	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1	SNP	8	WashU																																																																																				0.408	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		Silent
SULT2A1	6822	genome.wustl.edu	37	19	48386926	48386926	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:48386926T>C	ENST00000222002.3	-	2	392	c.253A>G	c.(253-255)Aca>Gca	p.T85A		NM_003167.3	NP_003158.2	Q06520	ST2A1_HUMAN	sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1	85					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|bile acid catabolic process (GO:0030573)|cellular lipid metabolic process (GO:0044255)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	bile-salt sulfotransferase activity (GO:0047704)|sulfotransferase activity (GO:0008146)	p.T85A(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)	Abiraterone(DB05812)|Acetaminophen(DB00316)	CTGAGTGCTGTATACCCAATC	0.527																																																1	Substitution - Missense(1)	ovary(1)	19											142.0	106.0	118.0					19																	48386926		2203	4300	6503	53078738	SO:0001583	missense	6822			X70222	CCDS12707.1	19q13.3	2014-05-21			ENSG00000105398	ENSG00000105398	2.8.2.2	"""Sulfotransferases, cytosolic"""	11458	protein-coding gene	gene with protein product		125263		STD		1588921, 7736787	Standard	NM_003167		Approved	DHEA-ST	uc002phr.2	Q06520	OTTHUMG00000162469	ENST00000222002.3:c.253A>G	19.37:g.48386926T>C	ENSP00000222002:p.Thr85Ala	Somatic		Capture	Illumina GAIIx	4	53078738		Missense_Mutation	SNP	ENST00000222002.3	37	CCDS12707.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	0.762	-0.768990	0.02974	.	.	ENSG00000105398	ENST00000222002	T	0.01584	4.75	2.83	-4.92	0.03075	Sulfotransferase domain (1);	2.385940	0.01781	N	0.031738	T	0.01029	0.0034	N	0.03224	-0.385	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47911	-0.9080	10	0.27785	T	0.31	.	7.0836	0.25245	0.0:0.5335:0.1476:0.319	.	85	Q06520	ST2A1_HUMAN	A	85	ENSP00000222002:T85A	ENSP00000222002:T85A	T	-	1	0	SULT2A1	53078738	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.940000	0.01543	-1.299000	0.02344	-0.269000	0.10298	ACA		0.527	SULT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369044.1	NM_003167		Missense_Mutation
HUWE1	10075	genome.wustl.edu	37	X	53577911	53577911	+	Silent	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:53577911C>G	ENST00000342160.3	-	64	9793	c.9336G>C	c.(9334-9336)ctG>ctC	p.L3112L	HUWE1_ENST00000262854.6_Silent_p.L3112L|HUWE1_ENST00000474288.1_5'Flank			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3112					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.L3002L(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGTGCCCAAACAGACGCTCAT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	X											61.0	44.0	50.0					X																	53577911		2203	4300	6503	53594636	SO:0001819	synonymous_variant	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9336G>C	X.37:g.53577911C>G		Somatic		Capture	Illumina GAIIx	4	53594636	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	37	CCDS35301.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	9.096	1.002917	0.19121	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.75	-3.49	0.04724	.	.	.	.	.	T	0.41858	0.1177	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32161	-0.9917	4	.	.	.	.	4.2864	0.10857	0.2521:0.4445:0.2167:0.0867	.	.	.	.	L	2146	.	.	V	-	1	0	HUWE1	53594636	0.471000	0.25862	0.958000	0.39756	0.996000	0.88848	-0.354000	0.07681	-0.842000	0.04195	0.513000	0.50165	GTT		0.577	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119		Silent
RB1CC1	9821	genome.wustl.edu	37	8	53570342	53570342	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:53570342C>T	ENST00000025008.5	-	15	2570	c.2047G>A	c.(2047-2049)Gca>Aca	p.A683T	RB1CC1_ENST00000435644.2_Missense_Mutation_p.A683T|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Missense_Mutation_p.A683T	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	683					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.A683T(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GGACAAACTGCAGGACATAAG	0.423																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Missense(1)	ovary(1)	8											96.0	97.0	97.0					8																	53570342		2203	4300	6503	53732895	SO:0001583	missense	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2047G>A	8.37:g.53570342C>T	ENSP00000025008:p.Ala683Thr	Somatic		Capture	Illumina GAIIx	4	53732895	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309231	0.23821	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.15952	2.38;2.38;2.38	5.46	2.41	0.29592	.	0.414112	0.28322	N	0.015770	T	0.09774	0.0240	N	0.24115	0.695	0.30182	N	0.800303	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.002	T	0.21177	-1.0253	10	0.19590	T	0.45	-8.3406	7.9563	0.30045	0.0:0.6139:0.2119:0.1742	.	683;683	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	T	683	ENSP00000025008:A683T;ENSP00000396067:A683T;ENSP00000445960:A683T	ENSP00000025008:A683T	A	-	1	0	RB1CC1	53732895	1.000000	0.71417	0.992000	0.48379	0.855000	0.48748	1.419000	0.34793	0.777000	0.33496	0.655000	0.94253	GCA		0.423	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		Missense_Mutation
ERLEC1	27248	genome.wustl.edu	37	2	54028849	54028849	+	Splice_Site	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:54028849G>A	ENST00000185150.4	+	8	880		c.e8-1		ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Splice_Site|ERLEC1_ENST00000405123.3_Splice_Site	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)	p.?(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						CTACTGAACAGGTTCAGAGCA	0.393																																																1	Unknown(1)	ovary(1)	2											99.0	89.0	92.0					2																	54028849		2203	4300	6503	53882353	SO:0001630	splice_region_variant	27248			AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.750-1G>A	2.37:g.54028849G>A		Somatic		Capture	Illumina GAIIx	4	53882353	B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Splice_Site_SNP	SNP	ENST00000185150.4	37	CCDS1848.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598577	0.87055	.	.	ENSG00000068912	ENST00000405123;ENST00000185150;ENST00000378239	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERLEC1	53882353	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	9.476000	0.97823	2.827000	0.97445	0.650000	0.86243	.		0.393	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251404.1	NM_015701	Intron	Splice_Site_SNP
SCFD2	152579	genome.wustl.edu	37	4	54231639	54231639	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:54231639G>A	ENST00000401642.3	-	1	603	c.470C>T	c.(469-471)cCg>cTg	p.P157L	SCFD2_ENST00000388940.4_Missense_Mutation_p.P157L	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	157					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)			p.P157L(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AAGCAATAACGGGACATGGAA	0.572																																																1	Substitution - Missense(1)	ovary(1)	4											87.0	74.0	78.0					4																	54231639		2203	4300	6503	53926396	SO:0001583	missense	152579			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.470C>T	4.37:g.54231639G>A	ENSP00000384182:p.Pro157Leu	Somatic		Capture	Illumina GAIIx	4	53926396	Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201388	0.58234	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.75589	-0.86;-0.95	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.85173	0.5636	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.85894	0.1430	10	0.87932	D	0	.	16.9624	0.86275	0.0:0.0:1.0:0.0	.	157;157	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	L	157	ENSP00000384182:P157L;ENSP00000373592:P157L	ENSP00000373592:P157L	P	-	2	0	SCFD2	53926396	1.000000	0.71417	0.400000	0.26346	0.049000	0.14656	8.673000	0.91186	2.873000	0.98535	0.561000	0.74099	CCG		0.572	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		Missense_Mutation
CDCP2	200008	genome.wustl.edu	37	1	54605743	54605743	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:54605743T>A	ENST00000371330.1	-	4	1647	c.800A>T	c.(799-801)aAc>aTc	p.N267I	RP11-446E24.4_ENST00000525949.1_5'Flank|CDCP2_ENST00000530059.1_5'Flank	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	267	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)		p.N267I(1)		kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						GCTGGAGAAGTTGCCCCGCAT	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											47.0	37.0	41.0					1																	54605743		2195	4280	6475	54378331	SO:0001583	missense	200008				CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.800A>T	1.37:g.54605743T>A	ENSP00000360381:p.Asn267Ile	Somatic		Capture	Illumina GAIIx	4	54378331	Q6ZWJ3	Missense_Mutation	SNP	ENST00000371330.1	37	CCDS588.2	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890690	0.72524	.	.	ENSG00000157211	ENST00000371330	T	0.26957	1.7	5.83	5.83	0.93111	CUB (5);	0.061993	0.64402	D	0.000005	T	0.38746	0.1052	L	0.28776	0.89	0.52099	D	0.999947	D	0.89917	1.0	D	0.73380	0.98	T	0.08106	-1.0738	10	0.30854	T	0.27	-34.8846	16.1883	0.81967	0.0:0.0:0.0:1.0	.	267	Q5VXM1	CDCP2_HUMAN	I	267	ENSP00000360381:N267I	ENSP00000360381:N267I	N	-	2	0	CDCP2	54378331	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	4.995000	0.63908	2.231000	0.72958	0.454000	0.30748	AAC		0.607	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2	NM_201546		Missense_Mutation
FGD1	2245	genome.wustl.edu	37	X	54472706	54472706	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:54472706G>C	ENST00000375135.3	-	18	3455	c.2722C>G	c.(2722-2724)Cta>Gta	p.L908V		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	908	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.L908V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGTCGCTGTAGTTCCTCTGTC	0.657																																																1	Substitution - Missense(1)	ovary(1)	X											54.0	41.0	45.0					X																	54472706		2203	4300	6503	54489431	SO:0001583	missense	2245			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.2722C>G	X.37:g.54472706G>C	ENSP00000364277:p.Leu908Val	Somatic		Capture	Illumina GAIIx	4	54489431	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845904	0.71603	.	.	ENSG00000102302	ENST00000375135	T	0.12361	2.69	5.79	5.79	0.91817	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.43416	D	0.000564	T	0.33498	0.0865	M	0.72353	2.195	0.45580	D	0.998524	P	0.38048	0.616	P	0.51550	0.673	T	0.01648	-1.1304	10	0.66056	D	0.02	-9.2486	17.6058	0.88037	0.0:0.0:1.0:0.0	.	908	P98174	FGD1_HUMAN	V	908	ENSP00000364277:L908V	ENSP00000364277:L908V	L	-	1	2	FGD1	54489431	1.000000	0.71417	0.994000	0.49952	0.942000	0.58702	8.852000	0.92215	2.429000	0.82318	0.513000	0.50165	CTA		0.657	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463		Missense_Mutation
SLC6A16	28968	genome.wustl.edu	37	19	49812592	49812592	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:49812592G>A	ENST00000335875.4	-	6	1194	c.953C>T	c.(952-954)gCa>gTa	p.A318V	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Missense_Mutation_p.A318V	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	318					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A318V(1)		NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GCCAAATTTTGCCCCTTCCAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	73.0	73.0					19																	49812592		1927	4127	6054	54504404	SO:0001583	missense	28968			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.953C>T	19.37:g.49812592G>A	ENSP00000338627:p.Ala318Val	Somatic		Capture	Illumina GAIIx	4	54504404	Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	ENST00000335875.4	37	CCDS42590.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801472	0.70682	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.80033	-1.33;-1.33	4.37	1.07	0.20283	.	0.404030	0.25774	N	0.028398	D	0.88160	0.6362	M	0.91872	3.25	0.09310	N	0.999999	D;D	0.59357	0.985;0.985	P;P	0.60345	0.873;0.873	T	0.79671	-0.1706	10	0.87932	D	0	.	8.0368	0.30496	0.2795:0.0:0.7205:0.0	.	318;318	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	V	318	ENSP00000338627:A318V;ENSP00000404022:A318V	ENSP00000338627:A318V	A	-	2	0	SLC6A16	54504404	0.302000	0.24454	0.001000	0.08648	0.082000	0.17680	2.066000	0.41452	0.354000	0.24105	0.561000	0.74099	GCA		0.498	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465503.2	NM_014037		Missense_Mutation
HCRTR2	3062	genome.wustl.edu	37	6	55120146	55120146	+	Silent	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:55120146C>A	ENST00000370862.3	+	3	951	c.615C>A	c.(613-615)acC>acA	p.T205T		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	205					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.T205T(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATAAAACCACCCTCTTTACGG	0.453																																																1	Substitution - coding silent(1)	ovary(1)	6											134.0	112.0	119.0					6																	55120146		2203	4300	6503	55228105	SO:0001819	synonymous_variant	3062			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.615C>A	6.37:g.55120146C>A		Somatic		Capture	Illumina GAIIx	4	55228105	Q5VTM0	Silent	SNP	ENST00000370862.3	37	CCDS4956.1	SNP	22	WashU																																																																																				0.453	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1			Silent
DST	667	genome.wustl.edu	37	6	56357225	56357225	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:56357225C>T	ENST00000361203.3	-	80	19604	c.19597G>A	c.(19597-19599)Gcc>Acc	p.A6533T	DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Missense_Mutation_p.A6644T|DST_ENST00000340834.4_5'Flank|DST_ENST00000370788.2_Missense_Mutation_p.A4447T|DST_ENST00000370754.5_Missense_Mutation_p.A6822T|DST_ENST00000421834.2_Missense_Mutation_p.A4556T|DST_ENST00000446842.2_Missense_Mutation_p.A6318T|DST_ENST00000244364.6_Missense_Mutation_p.A4230T			Q03001	DYST_HUMAN	dystonin	6533					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.A6644T(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACTTCATTGGCAAAAACCTTT	0.308																																																1	Substitution - Missense(1)	ovary(1)	6											72.0	69.0	70.0					6																	56357225		1801	4065	5866	56465184	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19597G>A	6.37:g.56357225C>T	ENSP00000354508:p.Ala6533Thr	Somatic		Capture	Illumina GAIIx	4	56465184	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127286	0.77549	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.11	5.11	0.69529	.	0.000000	0.48286	D	0.000195	T	0.51329	0.1668	L	0.43152	1.355	0.32935	D	0.517689	P;D;D;P;P	0.69078	0.931;0.997;0.993;0.77;0.865	P;D;D;P;P	0.73380	0.745;0.98;0.926;0.478;0.494	T	0.33445	-0.9868	9	0.20519	T	0.43	.	18.9056	0.92460	0.0:1.0:0.0:0.0	.	4556;6644;6822;6642;4230	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	T	4230;6822;6644;4556;6318;4447;6533	ENSP00000244364:A4230T;ENSP00000359790:A6822T;ENSP00000359805:A6644T;ENSP00000400883:A4556T;ENSP00000393645:A6318T;ENSP00000359824:A4447T;ENSP00000354508:A6533T	ENSP00000244364:A4230T	A	-	1	0	DST	56465184	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.592000	0.82676	2.540000	0.85666	0.591000	0.81541	GCC		0.308	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		Missense_Mutation
HAS1	3036	genome.wustl.edu	37	19	52219569	52219569	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:52219569C>T	ENST00000222115.1	-	4	1035	c.1001G>A	c.(1000-1002)tGt>tAt	p.C334Y	HAS1_ENST00000540069.2_Missense_Mutation_p.C333Y|HAS1_ENST00000594621.1_Intron|HAS1_ENST00000601714.1_Missense_Mutation_p.C341Y	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	334					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.C334Y(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CCCAAAAGTACAGTGGGTACC	0.547																																					NSCLC(132;636 2450 45807 47979)											1	Substitution - Missense(1)	ovary(1)	19											118.0	107.0	111.0					19																	52219569		2203	4300	6503	56911381	SO:0001583	missense	3036			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1001G>A	19.37:g.52219569C>T	ENSP00000222115:p.Cys334Tyr	Somatic		Capture	Illumina GAIIx	4	56911381	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	c	15.54	2.863522	0.51482	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.44482	0.92;0.92	3.35	3.35	0.38373	.	0.176934	0.48767	U	0.000178	T	0.61009	0.2313	M	0.76574	2.34	0.58432	D	0.999999	D;D;D	0.64830	0.971;0.994;0.994	P;D;D	0.67900	0.866;0.954;0.954	T	0.67051	-0.5768	10	0.87932	D	0	-25.5905	12.592	0.56447	0.0:1.0:0.0:0.0	.	333;334;333	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	Y	333;334	ENSP00000445021:C333Y;ENSP00000222115:C334Y	ENSP00000222115:C334Y	C	-	2	0	HAS1	56911381	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	7.614000	0.82996	1.608000	0.50180	0.165000	0.16767	TGT		0.547	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523		Missense_Mutation
SDR16C5	195814	genome.wustl.edu	37	8	57228783	57228783	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:57228783T>G	ENST00000303749.3	-	2	761	c.124A>C	c.(124-126)Ata>Cta	p.I42L	SDR16C5_ENST00000522671.1_Missense_Mutation_p.I42L|SDR16C5_ENST00000396721.2_Missense_Mutation_p.I42L	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	42					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)	p.I42L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						ATGAGGACTATTTCACCAGCA	0.453																																																1	Substitution - Missense(1)	ovary(1)	8											92.0	84.0	86.0					8																	57228783		2203	4300	6503	57391337	SO:0001583	missense	195814				CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.124A>C	8.37:g.57228783T>G	ENSP00000307607:p.Ile42Leu	Somatic		Capture	Illumina GAIIx	4	57391337	B4DGK2|Q330K3|Q8TDV9|Q96LX1	Missense_Mutation	SNP	ENST00000303749.3	37	CCDS6167.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	9.430	1.085223	0.20390	.	.	ENSG00000170786	ENST00000396721;ENST00000303749;ENST00000522671;ENST00000538514	D;D;D	0.89485	-2.52;-2.52;-2.29	5.25	1.53	0.23141	NAD(P)-binding domain (1);	0.258991	0.44285	D	0.000469	D	0.84875	0.5569	L	0.39898	1.24	0.45762	D	0.998654	B;B;B	0.25351	0.02;0.124;0.124	B;B;B	0.37387	0.044;0.149;0.248	T	0.77726	-0.2480	10	0.45353	T	0.12	.	8.9017	0.35499	0.0:0.2181:0.0:0.7819	.	42;42;42	Q8N3Y7-2;G3V145;Q8N3Y7	.;.;RDHE2_HUMAN	L	42	ENSP00000379947:I42L;ENSP00000307607:I42L;ENSP00000431010:I42L	ENSP00000307607:I42L	I	-	1	0	SDR16C5	57391337	1.000000	0.71417	0.547000	0.28179	0.036000	0.12997	1.990000	0.40717	0.307000	0.22880	-0.376000	0.06991	ATA		0.453	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378235.1	NM_138969		Missense_Mutation
FAM111B	374393	genome.wustl.edu	37	11	58892562	58892562	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:58892562G>A	ENST00000343597.3	+	4	1183	c.992G>A	c.(991-993)aGc>aAc	p.S331N	FAM111B_ENST00000529618.1_Missense_Mutation_p.S301N|FAM111B_ENST00000411426.1_Missense_Mutation_p.S301N	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	331							catalytic activity (GO:0003824)	p.S331N(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						CAGGATCTAAGCCATTATATT	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											69.0	82.0	78.0					11																	58892562		2196	4292	6488	58649138	SO:0001583	missense	374393			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.992G>A	11.37:g.58892562G>A	ENSP00000341565:p.Ser331Asn	Somatic		Capture	Illumina GAIIx	4	58649138	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	0.053	-1.244072	0.01481	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	T;T;T	0.31769	1.48;1.48;1.48	3.18	0.186	0.15105	.	.	.	.	.	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.22604	0.072	B	0.14023	0.01	T	0.21109	-1.0255	9	0.56958	D	0.05	.	6.548	0.22416	0.3191:0.0:0.6809:0.0	.	331	Q6SJ93	F111B_HUMAN	N	301;301;331	ENSP00000393855:S301N;ENSP00000432875:S301N;ENSP00000341565:S331N	ENSP00000341565:S331N	S	+	2	0	FAM111B	58649138	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.086000	0.14935	-0.058000	0.13177	-0.768000	0.03414	AGC		0.368	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947		Missense_Mutation
MS4A1	931	genome.wustl.edu	37	11	60230495	60230495	+	Silent	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:60230495G>T	ENST00000534668.1	+	3	469	c.180G>T	c.(178-180)ggG>ggT	p.G60G	MS4A1_ENST00000528313.1_Intron|MS4A1_ENST00000532073.1_Silent_p.G60G|MS4A1_ENST00000389939.2_Silent_p.G60G|MS4A1_ENST00000534503.1_3'UTR|MS4A1_ENST00000345732.4_Silent_p.G60G	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	60					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)	p.G60G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	TTATGAATGGGCTCTTCCACA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	11											105.0	102.0	103.0					11																	60230495		2203	4300	6503	59987071	SO:0001819	synonymous_variant	931			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.180G>T	11.37:g.60230495G>T		Somatic		Capture	Illumina GAIIx	4	59987071	A6NMS4|B4DT24|P08984|Q13963	Silent	SNP	ENST00000534668.1	37	CCDS31570.1	SNP	42	WashU																																																																																				0.542	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1			Silent
CYP2J2	1573	genome.wustl.edu	37	1	60359363	60359363	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:60359363G>T	ENST00000371204.3	-	9	1512	c.1469C>A	c.(1468-1470)tCc>tAc	p.S490Y	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	490					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.S490Y(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	ACTGACTGGGGAAATGGTGAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											277.0	299.0	291.0					1																	60359363		2203	4300	6503	60131951	SO:0001583	missense	1573			BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.1469C>A	1.37:g.60359363G>T	ENSP00000360247:p.Ser490Tyr	Somatic		Capture	Illumina GAIIx	4	60131951	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904598	0.33628	.	.	ENSG00000134716	ENST00000371204	T	0.68903	-0.36	5.88	4.95	0.65309	.	0.777101	0.12131	N	0.496771	T	0.68183	0.2973	M	0.70108	2.13	0.22918	N	0.998561	B	0.21147	0.052	B	0.30179	0.112	T	0.57888	-0.7733	10	0.25106	T	0.35	.	13.1845	0.59673	0.0:0.3062:0.6938:0.0	.	490	P51589	CP2J2_HUMAN	Y	490	ENSP00000360247:S490Y	ENSP00000360247:S490Y	S	-	2	0	CYP2J2	60131951	0.000000	0.05858	0.474000	0.27266	0.078000	0.17371	-0.258000	0.08733	1.459000	0.47892	0.655000	0.94253	TCC		0.443	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775		Missense_Mutation
LPHN3	23284	genome.wustl.edu	37	4	62800625	62800625	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:62800625C>G	ENST00000514591.1	+	13	2305	c.1976C>G	c.(1975-1977)aCg>aGg	p.T659R	LPHN3_ENST00000507164.1_Missense_Mutation_p.T727R|LPHN3_ENST00000506746.1_Missense_Mutation_p.T727R|LPHN3_ENST00000514157.1_Missense_Mutation_p.T659R|LPHN3_ENST00000511324.1_Missense_Mutation_p.T727R|LPHN3_ENST00000508693.1_Missense_Mutation_p.T727R|LPHN3_ENST00000506700.1_Missense_Mutation_p.T659R|LPHN3_ENST00000508946.1_Missense_Mutation_p.T659R|LPHN3_ENST00000507625.1_Missense_Mutation_p.T727R|LPHN3_ENST00000514996.1_Missense_Mutation_p.T659R|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000504896.1_Missense_Mutation_p.T659R|LPHN3_ENST00000512091.2_Missense_Mutation_p.T659R|LPHN3_ENST00000506720.1_Missense_Mutation_p.T727R|LPHN3_ENST00000545650.1_Missense_Mutation_p.T659R|LPHN3_ENST00000509896.1_Missense_Mutation_p.T727R			Q9HAR2	LPHN3_HUMAN	latrophilin 3	646					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GACCTGACTACGAGTGATCAG	0.483																																																0			4											88.0	93.0	92.0					4																	62800625		2086	4220	6306	62483220	SO:0001583	missense	23284			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1976C>G	4.37:g.62800625C>G	ENSP00000422533:p.Thr659Arg	Somatic		Capture	Illumina GAIIx	4	62483220	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	SNP	19	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.794|1.794	-0.478856|-0.478856	0.04414|0.04414	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.09350|.	2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99;2.99|.	5.43|5.43	4.58|4.58	0.56647|0.56647	Domain of unknown function DUF3497 (1);|.	0.305202|.	0.36444|.	N|.	0.002597|.	T|.	0.41143|.	0.1146|.	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.002;0.002;0.003|.	B;B;B|.	0.10450|.	0.005;0.005;0.005|.	T|.	0.25950|.	-1.0117|.	10|.	0.56958|.	D|.	0.05|.	.|.	17.4472|17.4472	0.87581|0.87581	0.0:0.9343:0.0:0.0657|0.0:0.9343:0.0:0.0657	.|.	659;646;659|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	R|X	659;659;727;727;659;646;659;646;659;727;727;727;659;659;659;727;727;659|116	ENSP00000423388:T659R;ENSP00000422533:T659R;ENSP00000423787:T727R;ENSP00000425033:T727R;ENSP00000424120:T659R;ENSP00000439831:T659R;ENSP00000421476:T727R;ENSP00000424030:T727R;ENSP00000421372:T727R;ENSP00000425201:T659R;ENSP00000423434:T659R;ENSP00000421627:T659R;ENSP00000420931:T727R;ENSP00000425884:T727R;ENSP00000424258:T659R|.	ENSP00000280009:T659R|.	T|Y	+|+	2|3	0|2	LPHN3|LPHN3	62483220|62483220	0.399000|0.399000	0.25287|0.25287	0.391000|0.391000	0.26233|0.26233	0.017000|0.017000	0.09413|0.09413	2.452000|2.452000	0.44961|0.44961	0.872000|0.872000	0.35775|0.35775	-0.813000|-0.813000	0.03139|0.03139	ACG|TAC		0.483	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			Missense_Mutation
KANK4	163782	genome.wustl.edu	37	1	62737155	62737155	+	Silent	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:62737155G>A	ENST00000371153.4	-	4	2385	c.2007C>T	c.(2005-2007)aaC>aaT	p.N669N	KANK4_ENST00000354381.3_Silent_p.N41N|KANK4_ENST00000371150.1_Silent_p.N25N	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	669						cytoplasm (GO:0005737)		p.N669N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CTTACCCACCGTTAACCCCAA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	1											197.0	182.0	187.0					1																	62737155		2203	4300	6503	62509743	SO:0001819	synonymous_variant	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2007C>T	1.37:g.62737155G>A		Somatic		Capture	Illumina GAIIx	4	62509743	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	ENST00000371153.4	37	CCDS620.1	SNP	40	WashU																																																																																				0.478	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		Silent
ARID5B	84159	genome.wustl.edu	37	10	63816939	63816939	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr10:63816939T>G	ENST00000279873.7	+	6	1320	c.910T>G	c.(910-912)Tca>Gca	p.S304A	ARID5B_ENST00000309334.5_Missense_Mutation_p.S61A	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	304					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)	p.S304A(1)		NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TAAAAAAGTCTCAAATGAAGA	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	86.0	85.0					10																	63816939		2203	4300	6503	63486945	SO:0001583	missense	84159			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.910T>G	10.37:g.63816939T>G	ENSP00000279873:p.Ser304Ala	Somatic		Capture	Illumina GAIIx	4	63486945	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	11.68	1.709453	0.30322	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.13420	2.59;2.59	5.96	4.83	0.62350	ARID/BRIGHT DNA-binding domain (1);	1.087730	0.06906	N	0.806756	T	0.15522	0.0374	L	0.44542	1.39	0.29196	N	0.87553	B;B	0.28258	0.205;0.04	B;B	0.26770	0.073;0.009	T	0.29701	-1.0003	10	0.27785	T	0.31	-11.897	12.2338	0.54503	0.0:0.0661:0.0:0.9339	.	61;304	Q14865-2;Q14865	.;ARI5B_HUMAN	A	304;61	ENSP00000279873:S304A;ENSP00000308862:S61A	ENSP00000279873:S304A	S	+	1	0	ARID5B	63486945	1.000000	0.71417	0.928000	0.36995	0.861000	0.49209	3.906000	0.56340	1.082000	0.41137	-0.264000	0.10439	TCA		0.423	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482		Missense_Mutation
SREK1IP1	285672	genome.wustl.edu	37	5	64036949	64036949	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:64036949G>C	ENST00000513458.4	-	3	307	c.140C>G	c.(139-141)aCa>aGa	p.T47R	SREK1IP1_ENST00000506252.1_5'Flank	NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	47					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.T47R(1)		breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						TTCACTACTTGTACTGCTGAC	0.353																																																1	Substitution - Missense(1)	ovary(1)	5											88.0	82.0	84.0					5																	64036949		2203	4299	6502	64072705	SO:0001583	missense	285672			AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.140C>G	5.37:g.64036949G>C	ENSP00000427401:p.Thr47Arg	Somatic		Capture	Illumina GAIIx	4	64072705	Q32NC8	Missense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036470	0.93630	.	.	ENSG00000153006	ENST00000513458	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.83594	0.5288	M	0.79693	2.465	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84126	0.0409	9	0.59425	D	0.04	-2.2425	19.7068	0.96076	0.0:0.0:1.0:0.0	.	47	Q8N9Q2	SR1IP_HUMAN	R	47	.	ENSP00000427401:T47R	T	-	2	0	SREK1IP1	64072705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.282000	0.95840	2.824000	0.97209	0.655000	0.94253	ACA		0.353	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4	NM_173829		Missense_Mutation
RAB15	376267	genome.wustl.edu	37	14	65417081	65417081	+	Nonsense_Mutation	SNP	C	C	A	rs146206891		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr14:65417081C>A	ENST00000533601.2	-	5	713	c.376G>T	c.(376-378)Gag>Tag	p.E126*	RAB15_ENST00000426039.3_Nonsense_Mutation_p.E80*|RAB15_ENST00000267512.5_Missense_Mutation_p.R169S|RAB15_ENST00000436278.2_3'UTR|CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000542227.1_Intron|FNTB_ENST00000447296.2_Intron			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family	126					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)	p.R169S(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		CGTTTCTGCTCCTCATCAGCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	14											308.0	269.0	282.0					14																	65417081		2203	4300	6503	64486834	SO:0001587	stop_gained	376267			BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.376G>T	14.37:g.65417081C>A	ENSP00000434103:p.Glu126*	Somatic		Capture	Illumina GAIIx	4	64486834	G5EMR7|Q86TX7|Q8IW89	Missense_Mutation	SNP	ENST00000533601.2	37		SNP	30	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.808827|7.808827	0.98501|0.98501	.|.	.|.	ENSG00000139998|ENSG00000139998	ENST00000533601;ENST00000426039;ENST00000554593|ENST00000267512	.|T	.|0.68479	.|-0.33	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.238929	.|0.21550	.|N	.|0.072759	.|T	.|0.55353	.|0.1915	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|B	.|0.19200	.|0.034	.|B	.|0.24394	.|0.053	.|T	.|0.50874	.|-0.8776	.|10	0.30078|0.51188	T|T	0.28|0.08	.|.	18.9094|18.9094	0.92477|0.92477	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|169	.|P59190-2	.|.	X|S	126;80;80|169	.|ENSP00000267512:R169S	ENSP00000434103:E126X|ENSP00000267512:R169S	E|R	-|-	1|3	0|2	RAB15|RAB15	64486834|64486834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	5.234000|5.234000	0.65343|0.65343	2.779000|2.779000	0.95612|0.95612	0.655000|0.655000	0.94253|0.94253	GAG|AGG		0.592	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390443.2	NM_198686		Missense_Mutation
KCNQ5	56479	genome.wustl.edu	37	6	73904330	73904330	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:73904330A>T	ENST00000370398.1	+	14	2101	c.1992A>T	c.(1990-1992)aaA>aaT	p.K664N	KCNQ5_ENST00000355635.3_Missense_Mutation_p.K665N|KCNQ5_ENST00000402622.2_Missense_Mutation_p.K674N|KCNQ5_ENST00000414165.2_Missense_Mutation_p.K554N|KCNQ5_ENST00000342056.2_Missense_Mutation_p.K683N|KCNQ5_ENST00000355194.4_Missense_Mutation_p.K664N|KCNQ5_ENST00000403813.2_Missense_Mutation_p.K655N	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	664					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.K664N(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TGGATAGCAAAGATCTTTCGG	0.488																																					GBM(142;1375 1859 14391 23261 44706)											1	Substitution - Missense(1)	ovary(1)	6											95.0	95.0	95.0					6																	73904330		2203	4300	6503	73961051	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1992A>T	6.37:g.73904330A>T	ENSP00000359425:p.Lys664Asn	Somatic		Capture	Illumina GAIIx	4	73961051	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	14.63	2.592029	0.46214	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99499	-5.79;-5.81;-5.82;-5.8;-5.81;-5.84;-6.02	5.41	1.72	0.24424	.	0.107994	0.64402	D	0.000008	D	0.98579	0.9525	L	0.55481	1.735	0.28143	N	0.929709	D;P;P;D;D	0.63880	0.993;0.93;0.645;0.991;0.984	D;P;P;P;P	0.64144	0.922;0.738;0.468;0.823;0.67	D	0.97226	0.9881	10	0.62326	D	0.03	-7.5187	9.5862	0.39517	0.7256:0.0:0.2744:0.0	.	554;674;683;655;664	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	N	683;683;664;664;674;665;655;554	ENSP00000345055:K683N;ENSP00000347326:K664N;ENSP00000359425:K664N;ENSP00000385501:K674N;ENSP00000347853:K665N;ENSP00000384453:K655N;ENSP00000409861:K554N	ENSP00000345055:K683N	K	+	3	2	KCNQ5	73961051	1.000000	0.71417	0.999000	0.59377	0.779000	0.44077	1.753000	0.38359	0.057000	0.16193	0.459000	0.35465	AAA		0.488	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842		Missense_Mutation
CD109	135228	genome.wustl.edu	37	6	74517952	74517952	+	Silent	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr6:74517952T>G	ENST00000287097.5	+	26	3448	c.3336T>G	c.(3334-3336)acT>acG	p.T1112T	CD109_ENST00000422508.2_Silent_p.T1035T|CD109_ENST00000437994.2_Silent_p.T1112T			Q6YHK3	CD109_HUMAN	CD109 molecule	1112					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.T1112T(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ATATGCTGACTTGGAGAGCAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	6											93.0	95.0	94.0					6																	74517952		2203	4300	6503	74574673	SO:0001819	synonymous_variant	135228			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3336T>G	6.37:g.74517952T>G		Somatic		Capture	Illumina GAIIx	4	74574673	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	ENST00000287097.5	37	CCDS4982.1	SNP	56	WashU																																																																																				0.383	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493		Silent
ALDH1A1	216	genome.wustl.edu	37	9	75526946	75526946	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr9:75526946C>T	ENST00000297785.3	-	10	1182	c.1128G>A	c.(1126-1128)ggG>ggA	p.G376G		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	376					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)	p.G376G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	AGCCTTTATTCCCCCACGGGC	0.438																																																1	Substitution - coding silent(1)	ovary(1)	9											148.0	132.0	137.0					9																	75526946		2203	4300	6503	74716766	SO:0001819	synonymous_variant	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1128G>A	9.37:g.75526946C>T		Somatic		Capture	Illumina GAIIx	4	74716766	O00768|Q5SYR1	Silent	SNP	ENST00000297785.3	37	CCDS6644.1	SNP	30	WashU																																																																																				0.438	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052679.1			Silent
ENPP7	339221	genome.wustl.edu	37	17	77705007	77705007	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:77705007G>C	ENST00000328313.5	+	1	327	c.106G>C	c.(106-108)Gtg>Ctg	p.V36L		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.V36L(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCTGCTCCTGGTGTCCTTCGA	0.662																																																1	Substitution - Missense(1)	ovary(1)	17											43.0	39.0	40.0					17																	77705007		2203	4300	6503	75319602	SO:0001583	missense	339221			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.106G>C	17.37:g.77705007G>C	ENSP00000332656:p.Val36Leu	Somatic		Capture	Illumina GAIIx	4	75319602		Missense_Mutation	SNP	ENST00000328313.5	37	CCDS11763.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076153	0.55646	.	.	ENSG00000182156	ENST00000328313	T	0.69306	-0.39	4.59	1.54	0.23209	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.237937	0.36628	N	0.002490	T	0.65719	0.2718	L	0.55743	1.74	0.34653	D	0.72188	P	0.41947	0.766	P	0.49387	0.609	T	0.70160	-0.4948	10	0.52906	T	0.07	-37.6038	7.5502	0.27793	0.3403:0.0:0.6597:0.0	.	36	Q6UWV6	ENPP7_HUMAN	L	36	ENSP00000332656:V36L	ENSP00000332656:V36L	V	+	1	0	ENPP7	75319602	0.961000	0.32948	0.509000	0.27700	0.612000	0.37316	1.838000	0.39211	0.191000	0.20236	0.561000	0.74099	GTG		0.662	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543		Missense_Mutation
PARM1	25849	genome.wustl.edu	37	4	75937901	75937901	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:75937901C>G	ENST00000307428.7	+	2	522	c.310C>G	c.(310-312)Ccc>Gcc	p.P104A	PARM1_ENST00000513238.1_Intron|RP11-44F21.2_ENST00000513770.1_RNA	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	104					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)		p.P104A(1)		cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						AAACACAGACCCCTCACCTTC	0.537																																																1	Substitution - Missense(1)	ovary(1)	4											147.0	146.0	147.0					4																	75937901		2076	4198	6274	76156925	SO:0001583	missense	25849			AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.310C>G	4.37:g.75937901C>G	ENSP00000370224:p.Pro104Ala	Somatic		Capture	Illumina GAIIx	4	76156925	B3KMQ9|Q96DV8|Q9Y4S1	Missense_Mutation	SNP	ENST00000307428.7	37	CCDS47077.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642145	0.29157	.	.	ENSG00000169116	ENST00000307428	T	0.80304	-1.36	5.21	-5.03	0.02973	.	1.190680	0.05884	N	0.627014	T	0.64057	0.2564	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.44757	-0.9307	10	0.28530	T	0.3	2.0E-4	5.2808	0.15674	0.1127:0.1715:0.5481:0.1677	.	104	Q6UWI2	PARM1_HUMAN	A	104	ENSP00000370224:P104A	ENSP00000370224:P104A	P	+	1	0	PARM1	76156925	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.179000	0.03090	-1.132000	0.02907	-0.344000	0.07964	CCC		0.537	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393		Missense_Mutation
CLN5	1203	genome.wustl.edu	37	13	77570168	77570168	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:77570168C>T	ENST00000377453.3	+	3	1910	c.618C>T	c.(616-618)ttC>ttT	p.F206F	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	157					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)	p.F206F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		ATGCCCCTTTCTGGTGTAATC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	13											171.0	158.0	163.0					13																	77570168		2203	4300	6503	76468169	SO:0001819	synonymous_variant	1203				CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.618C>T	13.37:g.77570168C>T		Somatic		Capture	Illumina GAIIx	4	76468169	B3KQK7	Silent	SNP	ENST00000377453.3	37	CCDS9456.1	SNP	32	WashU																																																																																				0.423	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493		Silent
MYCBP2	23077	genome.wustl.edu	37	13	77798611	77798611	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:77798611G>C	ENST00000544440.2	-	20	2817	c.2800C>G	c.(2800-2802)Cta>Gta	p.L934V	MYCBP2_ENST00000407578.2_Missense_Mutation_p.L972V|MYCBP2_ENST00000357337.6_Missense_Mutation_p.L934V|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase									p.L934V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CCATGTCCTAGCTGCCCATGC	0.348																																																1	Substitution - Missense(1)	ovary(1)	13											115.0	108.0	111.0					13																	77798611		2203	4300	6503	76696612	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2800C>G	13.37:g.77798611G>C	ENSP00000444596:p.Leu934Val	Somatic		Capture	Illumina GAIIx	4	76696612		Missense_Mutation	SNP	ENST00000544440.2	37		SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842104	0.91197	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	D;D;D	0.97114	-4.25;-4.25;-4.25	5.61	5.61	0.85477	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.64402	D	0.000005	D	0.98921	0.9634	M	0.93678	3.445	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	D	0.99437	1.0937	10	0.87932	D	0	.	19.6419	0.95762	0.0:0.0:1.0:0.0	.	934	O75592	MYCB2_HUMAN	V	934;972;934	ENSP00000349892:L934V;ENSP00000384288:L972V;ENSP00000444596:L934V	ENSP00000349892:L934V	L	-	1	2	MYCBP2	76696612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.434000	0.73408	2.640000	0.89533	0.655000	0.94253	CTA		0.348	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		Missense_Mutation
ADRA2B	151	genome.wustl.edu	37	2	96781427	96781427	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:96781427C>A	ENST00000409345.3	-	1	557	c.462G>T	c.(460-462)caG>caT	p.Q154H		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	154					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)	p.Q154H(1)		endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCTGGGGGCCCTGGTCGCCCT	0.647																																																1	Substitution - Missense(1)	ovary(1)	2											26.0	32.0	30.0					2																	96781427		2127	4243	6370	96145154	SO:0001583	missense	151			M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.462G>T	2.37:g.96781427C>A	ENSP00000387281:p.Gln154His	Somatic		Capture	Illumina GAIIx	4	96145154	Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	ENST00000409345.3	37	CCDS56129.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471525	0.26423	.	.	ENSG00000222040	ENST00000409345	T	0.37058	1.22	4.65	1.78	0.24846	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.30103	0.0754	L	0.49513	1.565	0.09310	N	0.999999	B	0.19817	0.039	B	0.29440	0.102	T	0.40850	-0.9541	9	0.62326	D	0.03	.	1.8482	0.03163	0.1661:0.4946:0.1609:0.1784	.	154	P18089	ADA2B_HUMAN	H	154	ENSP00000387281:Q154H	ENSP00000387281:Q154H	Q	-	3	2	ADRA2B	96145154	0.071000	0.21146	0.990000	0.47175	0.926000	0.56050	0.088000	0.14979	0.177000	0.19895	-0.493000	0.04662	CAG		0.647	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1			Missense_Mutation
MRPL30	51263	genome.wustl.edu	37	2	99812084	99812084	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:99812084G>T	ENST00000338148.3	+	6	600	c.402G>T	c.(400-402)atG>atT	p.M134I	MRPL30_ENST00000465432.1_3'UTR|C2orf15_ENST00000512183.2_Missense_Mutation_p.M134I	NM_145212.3	NP_660213.1	Q8TCC3	RM30_HUMAN	mitochondrial ribosomal protein L30	134						mitochondrion (GO:0005739)|ribosome (GO:0005840)		p.M134I(1)		breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						AGGAGAACATGTCTAACACGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	2											164.0	151.0	156.0					2																	99812084		2203	4300	6503	99178516	SO:0001583	missense	51263			AB051342	CCDS2041.1	2q11.2	2012-09-13			ENSG00000185414	ENSG00000185414		"""Mitochondrial ribosomal proteins / large subunits"""	14036	protein-coding gene	gene with protein product		611838					Standard	NM_145212		Approved	MRP-L28, RPML28	uc002szv.3	Q8TCC3	OTTHUMG00000130642	ENST00000338148.3:c.402G>T	2.37:g.99812084G>T	ENSP00000338057:p.Met134Ile	Somatic		Capture	Illumina GAIIx	4	99178516	A6NIC6|D3DVI0|D3DVI3|Q0D2Q7|Q6ZTP4|Q96Q69|Q9P0N0	Missense_Mutation	SNP	ENST00000338148.3	37	CCDS2041.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	9.096	1.003010	0.19121	.	.	ENSG00000241962;ENSG00000241962;ENSG00000185414;ENSG00000185414	ENST00000512183;ENST00000308644;ENST00000338148;ENST00000409841	T;T;T	0.39406	1.08;1.08;1.08	4.26	3.37	0.38596	.	0.164425	0.64402	N	0.000004	T	0.30417	0.0764	L	0.52126	1.63	0.36268	D	0.855003	B	0.16396	0.017	B	0.09377	0.004	T	0.19353	-1.0308	10	0.19590	T	0.45	-20.337	5.427	0.16431	0.1035:0.0:0.6984:0.1981	.	134	Q8TCC3	RM30_HUMAN	I	134;147;134;134	ENSP00000420959:M134I;ENSP00000338057:M134I;ENSP00000386752:M134I	ENSP00000312464:M147I	M	+	3	0	C2orf15;MRPL30	99178516	1.000000	0.71417	0.947000	0.38551	0.609000	0.37215	3.534000	0.53568	1.145000	0.42336	0.585000	0.79938	ATG		0.483	MRPL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253130.2			Missense_Mutation
SLC17A8	246213	genome.wustl.edu	37	12	100813902	100813902	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:100813902C>A	ENST00000323346.5	+	12	2048	c.1735C>A	c.(1735-1737)Cag>Aag	p.Q579K	SLC17A8_ENST00000392989.3_Missense_Mutation_p.Q529K	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	579					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.Q579K(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						GACATCCTACCAGAATGAAGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											73.0	65.0	67.0					12																	100813902		2203	4300	6503	99338033	SO:0001583	missense	246213			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1735C>A	12.37:g.100813902C>A	ENSP00000316909:p.Gln579Lys	Somatic		Capture	Illumina GAIIx	4	99338033	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178566	0.38511	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.67865	0.13;-0.29	4.8	4.8	0.61643	.	0.351400	0.30085	N	0.010446	T	0.45975	0.1369	N	0.14661	0.345	0.31665	N	0.645139	B;B	0.19200	0.02;0.034	B;B	0.22601	0.021;0.04	T	0.37291	-0.9712	10	0.05833	T	0.94	.	13.9424	0.64064	0.0:0.8479:0.1521:0.0	.	579;529	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	K	579;529	ENSP00000316909:Q579K;ENSP00000376715:Q529K	ENSP00000316909:Q579K	Q	+	1	0	SLC17A8	99338033	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.308000	0.33528	2.388000	0.81334	0.591000	0.81541	CAG		0.438	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319		Missense_Mutation
LPPR4	9890	genome.wustl.edu	37	1	99764580	99764580	+	Intron	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:99764580T>A	ENST00000370185.3	+	4	1035				LPPR4_ENST00000457765.1_Intron|LPPR4_ENST00000370184.1_Silent_p.I18I	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN							axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TTTCTTTCATTTTGCCTATAG	0.338																																																0			1											123.0	105.0	111.0					1																	99764580		2203	4300	6503	99537168	SO:0001627	intron_variant																															ENST00000370185.3:c.539-11T>A	1.37:g.99764580T>A		Somatic		Capture	Illumina GAIIx	4	99537168	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	ENST00000370185.3	37	CCDS757.1	SNP	64	WashU																																																																																				0.338	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			Silent
AFF3	3899	genome.wustl.edu	37	2	100175346	100175346	+	Silent	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:100175346G>A	ENST00000409236.2	-	20	3388	c.3276C>T	c.(3274-3276)gaC>gaT	p.D1092D	AFF3_ENST00000356421.2_Silent_p.D1117D|AFF3_ENST00000317233.4_Silent_p.D1092D|AFF3_ENST00000409579.1_Silent_p.D1117D			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1092					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.D1117D(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CCTTGAAATAGTCGATTAGTG	0.453											OREG0014830	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	2											124.0	117.0	119.0					2																	100175346		2203	4300	6503	99541778	SO:0001819	synonymous_variant	3899			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.3276C>T	2.37:g.100175346G>A		Somatic	1349	Capture	Illumina GAIIx	4	99541778	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	37	CCDS42723.1	SNP	36	WashU																																																																																				0.453	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285		Silent
DCBLD2	131566	genome.wustl.edu	37	3	98568343	98568343	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:98568343C>A	ENST00000326840.6	-	3	895	c.533G>T	c.(532-534)cGc>cTc	p.R178L	DCBLD2_ENST00000469648.1_5'UTR|DCBLD2_ENST00000326857.9_Missense_Mutation_p.R178L	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	178	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.R178L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CAAAAATCCGCGTCCAGAAAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	3											124.0	118.0	120.0					3																	98568343		1868	4098	5966	100051033	SO:0001583	missense	131566				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.533G>T	3.37:g.98568343C>A	ENSP00000321573:p.Arg178Leu	Somatic		Capture	Illumina GAIIx	4	100051033	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	CCDS46878.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759488	0.89932	.	.	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857;ENST00000449482	T;T;T	0.19394	2.15;2.15;2.15	5.62	5.62	0.85841	CUB (5);	0.055231	0.64402	D	0.000001	T	0.51363	0.1670	M	0.84082	2.675	0.48571	D	0.999671	D;D	0.69078	0.992;0.997	P;D	0.81914	0.871;0.995	T	0.55335	-0.8157	10	0.72032	D	0.01	-13.6293	17.1542	0.86785	0.0:1.0:0.0:0.0	.	178;178	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	L	178;132;178;72	ENSP00000321573:R178L;ENSP00000321646:R178L;ENSP00000396803:R72L	ENSP00000321573:R178L	R	-	2	0	DCBLD2	100051033	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.668000	0.54554	2.648000	0.89879	0.655000	0.94253	CGC		0.363	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927		Missense_Mutation
ZAN	7455	genome.wustl.edu	37	7	100352980	100352980	+	RNA	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:100352980C>A	ENST00000348028.3	+	0	3421				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H1086N(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TAGTGACAACCACTGCATCCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	7											117.0	117.0	117.0					7																	100352980		1923	4138	6061	100190916			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100352980C>A		Somatic		Capture	Illumina GAIIx	4	100190916	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	c	14.05	2.419509	0.42918	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	D;D;D	0.90324	-2.65;-2.65;-2.65	5.13	-10.3	0.00346	EGF-like region, conserved site (1);Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	2.345740	0.01778	N	0.031601	T	0.79393	0.4438	N	0.10707	0.03	0.19300	N	0.999973	B;B	0.06786	0.001;0.001	B;B	0.11329	0.003;0.006	T	0.68059	-0.5509	10	0.38643	T	0.18	.	13.1582	0.59531	0.6922:0.1401:0.1677:0.0	.	1086;1086	F5H0T8;Q9Y493	.;ZAN_HUMAN	N	1086	ENSP00000445943:H1086N;ENSP00000445091:H1086N;ENSP00000444427:H1086N	ENSP00000423579:H1086N	H	+	1	0	ZAN	100190916	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.242000	0.08928	-2.373000	0.00600	-0.170000	0.13304	CAC		0.572	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386		Missense_Mutation
MUC17	140453	genome.wustl.edu	37	7	100681591	100681591	+	Silent	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:100681591C>A	ENST00000306151.4	+	3	6958	c.6894C>A	c.(6892-6894)acC>acA	p.T2298T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2298	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T2298T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGGTTAGCACCCTTTCAACAA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	7											225.0	227.0	226.0					7																	100681591		2203	4300	6503	100468311	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6894C>A	7.37:g.100681591C>A		Somatic		Capture	Illumina GAIIx	4	100468311	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	22	WashU																																																																																				0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
VPS13B	157680	genome.wustl.edu	37	8	100479763	100479763	+	Silent	SNP	T	T	A	rs144895307		TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:100479763T>A	ENST00000358544.2	+	24	3678	c.3567T>A	c.(3565-3567)tcT>tcA	p.S1189S	VPS13B_ENST00000395996.1_Silent_p.S1189S|VPS13B_ENST00000357162.2_Silent_p.S1189S	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1189					protein transport (GO:0015031)			p.S1189S(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTGTCACGTCTCAAAAACTGC	0.443																																					Colon(161;2205 2542 7338 31318)											1	Substitution - coding silent(1)	ovary(1)	8											226.0	197.0	207.0					8																	100479763		2203	4300	6503	100548939	SO:0001819	synonymous_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3567T>A	8.37:g.100479763T>A		Somatic		Capture	Illumina GAIIx	4	100548939	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1	SNP	54	WashU																																																																																				0.443	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		Silent
BHLHB9	80823	genome.wustl.edu	37	X	102004101	102004101	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:102004101G>A	ENST00000372735.1	+	4	763	c.178G>A	c.(178-180)Gca>Aca	p.A60T	BHLHB9_ENST00000447531.1_Missense_Mutation_p.A60T|BHLHB9_ENST00000457056.1_Missense_Mutation_p.A60T|BHLHB9_ENST00000448867.1_Missense_Mutation_p.A60T|BHLHB9_ENST00000361229.4_Missense_Mutation_p.A60T			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	60					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.A60T(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGAGATGAAGGCAGTGTCTAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											125.0	101.0	109.0					X																	102004101		2203	4300	6503	101890757	SO:0001583	missense	80823			AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.178G>A	X.37:g.102004101G>A	ENSP00000361820:p.Ala60Thr	Somatic		Capture	Illumina GAIIx	4	101890757	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506632	0.44558	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62	4.42	-1.77	0.07982	.	0.442204	0.16721	N	0.202255	T	0.05823	0.0152	N	0.20986	0.625	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.33675	-0.9859	9	.	.	.	-19.8684	0.7795	0.01038	0.254:0.1274:0.3544:0.2641	.	60	Q6PI77	BHLH9_HUMAN	T	60	ENSP00000403226:A60T;ENSP00000354675:A60T;ENSP00000405893:A60T;ENSP00000391722:A60T;ENSP00000361820:A60T	.	A	+	1	0	BHLHB9	101890757	0.144000	0.22641	0.000000	0.03702	0.826000	0.46750	0.693000	0.25497	-0.563000	0.06078	0.436000	0.28706	GCA		0.522	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639		Missense_Mutation
ERCC5	2073	genome.wustl.edu	37	13	103528187	103528187	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:103528187C>T	ENST00000355739.4	+	15	4918	c.3495C>T	c.(3493-3495)gcC>gcT	p.A1165A	ERCC5_ENST00000472247.1_3'UTR|ERCC5_ENST00000375954.1_Silent_p.A398A	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	1165					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)	p.A1165A(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TCGTGACCGCCAGATCTGTGT	0.443			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	1	Substitution - coding silent(1)	ovary(1)	13											44.0	47.0	46.0					13																	103528187		2203	4300	6503	102326188	SO:0001819	synonymous_variant	2073	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.3495C>T	13.37:g.103528187C>T		Somatic		Capture	Illumina GAIIx	4	102326188	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Silent	SNP	ENST00000355739.4	37	CCDS32004.1	SNP	21	WashU																																																																																				0.443	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			Silent
ODF1	4956	genome.wustl.edu	37	8	103563969	103563969	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:103563969G>C	ENST00000285402.3	+	1	170	c.14G>C	c.(13-15)aGt>aCt	p.S5T		NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	5					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.S5T(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			GCTGCACTGAGTTGTCTCTTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	8											126.0	103.0	110.0					8																	103563969		2203	4300	6503	103633145	SO:0001583	missense	4956			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.14G>C	8.37:g.103563969G>C	ENSP00000285402:p.Ser5Thr	Somatic		Capture	Illumina GAIIx	4	103633145	Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	CCDS6293.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239549	0.58995	.	.	ENSG00000155087	ENST00000285402	T	0.35973	1.28	5.7	3.81	0.43845	.	0.000000	0.64402	D	0.000006	T	0.17450	0.0419	N	0.08118	0	0.80722	D	1	B	0.14805	0.011	B	0.12156	0.007	T	0.04915	-1.0918	10	0.37606	T	0.19	-20.8441	7.2168	0.25965	0.0899:0.1711:0.739:0.0	.	5	Q14990	ODFP1_HUMAN	T	5	ENSP00000285402:S5T	ENSP00000285402:S5T	S	+	2	0	ODF1	103633145	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.258000	0.43249	1.413000	0.46997	-0.251000	0.11542	AGT		0.473	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1			Missense_Mutation
ARHGAP20	57569	genome.wustl.edu	37	11	110453112	110453112	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:110453112A>T	ENST00000260283.4	-	15	1937	c.1653T>A	c.(1651-1653)ttT>ttA	p.F551L	ARHGAP20_ENST00000527598.1_Missense_Mutation_p.F515L|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.F94L|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.F515L|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.F528L|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.F525L|ARHGAP20_ENST00000533353.1_Missense_Mutation_p.F525L	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	551	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.F551L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		TTTCTTCTCCAAATATCCTAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	11											116.0	120.0	119.0					11																	110453112		2201	4298	6499	109958322	SO:0001583	missense	57569			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.1653T>A	11.37:g.110453112A>T	ENSP00000260283:p.Phe551Leu	Somatic		Capture	Illumina GAIIx	4	109958322	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	16.79	3.221583	0.58560	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.72942	-0.7;-0.7;1.49;-0.7;-0.7;-0.7;-0.7	5.87	2.31	0.28768	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.064498	0.64402	D	0.000007	T	0.71846	0.3388	M	0.86864	2.845	0.32394	N	0.552793	P;P;P	0.41929	0.765;0.474;0.609	B;B;B	0.41036	0.346;0.188;0.346	T	0.74087	-0.3778	10	0.34782	T	0.22	.	9.557	0.39346	0.8013:0.0:0.1987:0.0	.	525;551;528	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	L	551;525;94;528;515;525;515	ENSP00000260283:F551L;ENSP00000349660:F525L;ENSP00000437905:F94L;ENSP00000432076:F528L;ENSP00000436319:F515L;ENSP00000436522:F525L;ENSP00000431399:F515L	ENSP00000260283:F551L	F	-	3	2	ARHGAP20	109958322	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.388000	0.44398	0.144000	0.18951	-0.326000	0.08463	TTT		0.348	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809		Missense_Mutation
ALDH2	217	genome.wustl.edu	37	12	112228252	112228252	+	Silent	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:112228252C>G	ENST00000261733.2	+	6	628	c.567C>G	c.(565-567)ctC>ctG	p.L189L	RP11-162P23.2_ENST00000546840.2_Missense_Mutation_p.S186C|ALDH2_ENST00000416293.3_Silent_p.L142L	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	189					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)	p.L189L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	ATTTCCCGCTCCTGATGCAAG	0.562			T	HMGA2	leiomyoma																																		Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	1	Substitution - coding silent(1)	ovary(1)	12											129.0	109.0	116.0					12																	112228252		2203	4300	6503	110712635	SO:0001819	synonymous_variant	217			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.567C>G	12.37:g.112228252C>G		Somatic		Capture	Illumina GAIIx	4	110712635	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Silent	SNP	ENST00000261733.2	37	CCDS9155.1	SNP	30	WashU																																																																																				0.562	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1	NM_000690		Silent
KCNA3	3738	genome.wustl.edu	37	1	111216030	111216030	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:111216030C>T	ENST00000369769.2	-	1	1625	c.1402G>A	c.(1402-1404)Ggt>Agt	p.G468S		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	468					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)	p.G468S(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GTCAAGACACCGGCGATGGCA	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	82.0	89.0					1																	111216030		2203	4300	6503	111017553	SO:0001583	missense	3738			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1402G>A	1.37:g.111216030C>T	ENSP00000358784:p.Gly468Ser	Somatic		Capture	Illumina GAIIx	4	111017553	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727560	0.89390	.	.	ENSG00000177272	ENST00000369769	D	0.98889	-5.21	5.91	5.91	0.95273	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.99432	0.9799	M	0.92691	3.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98920	1.0783	10	0.87932	D	0	.	20.2896	0.98541	0.0:1.0:0.0:0.0	.	468	P22001	KCNA3_HUMAN	S	468	ENSP00000358784:G468S	ENSP00000358784:G468S	G	-	1	0	KCNA3	111017553	1.000000	0.71417	0.830000	0.32933	0.995000	0.86356	7.814000	0.86154	2.794000	0.96219	0.655000	0.94253	GGT		0.527	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232		Missense_Mutation
HSPB2	3316	genome.wustl.edu	37	11	111784461	111784461	+	Silent	SNP	C	C	A	rs587679193		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:111784461C>A	ENST00000304298.3	+	2	979	c.391C>A	c.(391-393)Cga>Aga	p.R131R	CRYAB_ENST00000533280.1_5'Flank|CRYAB_ENST00000533971.1_5'Flank|HSPB2-C11orf52_ENST00000534100.1_Intron|HSPB2_ENST00000537382.1_Silent_p.R131R|CRYAB_ENST00000526180.1_5'Flank|CRYAB_ENST00000527950.1_Intron|CRYAB_ENST00000533475.1_5'UTR|CRYAB_ENST00000227251.3_5'Flank|CRYAB_ENST00000525823.1_5'Flank|CRYAB_ENST00000531198.1_5'Flank	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	131					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)	p.R131R(1)|p.R131*(1)		large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		CGACCCCTGGCGAGTCCGAGC	0.622																																																2	Substitution - Nonsense(1)|Substitution - coding silent(1)	ovary(2)	11											68.0	63.0	64.0					11																	111784461		2201	4297	6498	111289671	SO:0001819	synonymous_variant	3316			U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.391C>A	11.37:g.111784461C>A		Somatic		Capture	Illumina GAIIx	4	111289671	Q6I9U7	Silent	SNP	ENST00000304298.3	37	CCDS8352.1	SNP	27	WashU																																																																																				0.622	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1			Silent
LRIF1	55791	genome.wustl.edu	37	1	111494210	111494210	+	Silent	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:111494210G>C	ENST00000369763.4	-	2	1686	c.1296C>G	c.(1294-1296)acC>acG	p.T432T	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000485275.2_Intron|LRIF1_ENST00000494675.1_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)		p.T432T(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						AAGCAAGCTGGGTATTGGAAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	1											175.0	177.0	177.0					1																	111494210		2203	4300	6503	111295733	SO:0001819	synonymous_variant	55791			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1296C>G	1.37:g.111494210G>C		Somatic		Capture	Illumina GAIIx	4	111295733	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Silent	SNP	ENST00000369763.4	37	CCDS30800.1	SNP	43	WashU																																																																																				0.398	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372		Silent
ANK2	287	genome.wustl.edu	37	4	114214596	114214596	+	Splice_Site	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:114214596A>T	ENST00000357077.4	+	22	2430	c.2377A>T	c.(2377-2379)Aat>Tat	p.N793Y	ANK2_ENST00000394537.3_Splice_Site_p.N793Y|ANK2_ENST00000506722.1_Splice_Site_p.N772Y|ANK2_ENST00000264366.6_Splice_Site_p.N793Y|ANK2_ENST00000509550.1_Splice_Site_p.N2Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	793					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.N793Y(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ctctctTCAGAATGGCAACAC	0.532																																																1	Substitution - Missense(1)	ovary(1)	4											189.0	173.0	178.0					4																	114214596		2203	4300	6503	114434045	SO:0001630	splice_region_variant	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2377-1A>T	4.37:g.114214596A>T		Somatic		Capture	Illumina GAIIx	4	114434045	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	24.4	4.528020	0.85706	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T;T	0.80393	2.31;2.31;2.31;2.31;2.31;2.31;2.31;-1.37	5.29	5.29	0.74685	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000036	D	0.90417	0.7000	M	0.86268	2.805	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.991;0.995	P;D;D;D;D;D	0.85130	0.897;0.989;0.986;0.997;0.945;0.994	D	0.92064	0.5659	10	0.87932	D	0	.	15.2404	0.73465	1.0:0.0:0.0:0.0	.	2;793;793;793;772;772	E9PCH6;Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.	Y	772;739;772;808;793;793;793;772;2	ENSP00000423799:N772Y;ENSP00000421011:N739Y;ENSP00000421067:N772Y;ENSP00000424722:N808Y;ENSP00000378044:N793Y;ENSP00000349588:N793Y;ENSP00000264366:N793Y;ENSP00000426944:N2Y	ENSP00000264366:N793Y	N	+	1	0	ANK2	114434045	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.339000	0.96797	1.988000	0.58038	0.533000	0.62120	AAT		0.532	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	Missense_Mutation	Missense_Mutation
KMT2A	4297	genome.wustl.edu	37	11	118363844	118363844	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:118363844G>C	ENST00000389506.5	+	16	5068	c.5068G>C	c.(5068-5070)Gat>Cat	p.D1690H	KMT2A_ENST00000534358.1_Missense_Mutation_p.D1693H|KMT2A_ENST00000354520.4_Missense_Mutation_p.D1652H			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1690					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.D1690H(1)									CGAAGGACCTGATCCACCAGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	106.0	108.0					11																	118363844		2200	4296	6496	117869054	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5068G>C	11.37:g.118363844G>C	ENSP00000374157:p.Asp1690His	Somatic		Capture	Illumina GAIIx	4	117869054	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560156	0.65538	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83506	-1.73;-1.73;-1.64	5.28	5.28	0.74379	Bromodomain (1);	0.053066	0.64402	D	0.000001	D	0.88559	0.6469	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.972	D	0.89629	0.3854	10	0.87932	D	0	.	18.9088	0.92474	0.0:0.0:1.0:0.0	.	1693;1690	E9PQG7;Q03164	.;MLL1_HUMAN	H	1693;1690;1652;600	ENSP00000436786:D1693H;ENSP00000374157:D1690H;ENSP00000346516:D1652H	ENSP00000346516:D1652H	D	+	1	0	MLL	117869054	1.000000	0.71417	0.821000	0.32701	0.922000	0.55478	9.320000	0.96346	2.449000	0.82847	0.561000	0.74099	GAT		0.488	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933		Missense_Mutation
VPS11	55823	genome.wustl.edu	37	11	118948712	118948712	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:118948712G>A	ENST00000300793.6	+	11	1736	c.1694G>A	c.(1693-1695)gGa>gAa	p.G565E	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	566					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.G565E(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TTGCTGAAGGGACTTTGTACT	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											123.0	123.0	123.0					11																	118948712		2044	4189	6233	118453922	SO:0001583	missense	55823			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.1694G>A	11.37:g.118948712G>A	ENSP00000475301:p.Gly565Glu	Somatic		Capture	Illumina GAIIx	4	118453922	Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	ENST00000300793.6	37		SNP	41	WashU																																																																																				0.572	VPS11-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021729		Missense_Mutation
MCMBP	79892	genome.wustl.edu	37	10	121619381	121619381	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr10:121619381T>A	ENST00000360003.3	-	2	243	c.74A>T	c.(73-75)aAt>aTt	p.N25I	MCMBP_ENST00000466047.1_5'UTR|MCMBP_ENST00000369077.3_Missense_Mutation_p.N25I	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	25					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.N25I(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						CCAGTCAGGATTAACTCCATT	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											84.0	80.0	81.0					10																	121619381		2203	4298	6501	121609371	SO:0001583	missense	79892			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.74A>T	10.37:g.121619381T>A	ENSP00000353098:p.Asn25Ile	Somatic		Capture	Illumina GAIIx	4	121609371	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Missense_Mutation	SNP	ENST00000360003.3	37	CCDS7617.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	15.26	2.779456	0.49891	.	.	ENSG00000197771	ENST00000360003;ENST00000369077	.	.	.	5.62	0.447	0.16608	.	0.684613	0.14627	N	0.308047	T	0.20007	0.0481	N	0.08118	0	0.33515	D	0.591636	P	0.41265	0.744	B	0.39068	0.289	T	0.25187	-1.0139	9	0.54805	T	0.06	-12.7699	5.5536	0.17103	0.0:0.1426:0.2736:0.5838	.	25	Q9BTE3	MCMBP_HUMAN	I	25	.	ENSP00000353098:N25I	N	-	2	0	MCMBP	121609371	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	0.634000	0.24614	-0.162000	0.10964	0.383000	0.25322	AAT		0.343	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834		Missense_Mutation
OR4D5	219875	genome.wustl.edu	37	11	123811042	123811042	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:123811042G>C	ENST00000307033.2	+	1	793	c.719G>C	c.(718-720)tGt>tCt	p.C240S		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C240S(1)		autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTGTCTACCTGTGCCTCTCAC	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											239.0	195.0	210.0					11																	123811042		2202	4299	6501	123316252	SO:0001583	missense	219875			BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.719G>C	11.37:g.123811042G>C	ENSP00000305970:p.Cys240Ser	Somatic		Capture	Illumina GAIIx	4	123316252	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	37	CCDS31699.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787420	0.70337	.	.	ENSG00000171014	ENST00000307033	T	0.00369	7.74	5.49	5.49	0.81192	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.02380	0.0073	H	0.98295	4.195	0.42985	D	0.994474	D	0.71674	0.998	D	0.83275	0.996	T	0.13442	-1.0509	10	0.72032	D	0.01	-10.1946	18.9615	0.92679	0.0:0.0:1.0:0.0	.	240	Q8NGN0	OR4D5_HUMAN	S	240	ENSP00000305970:C240S	ENSP00000305970:C240S	C	+	2	0	OR4D5	123316252	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	9.481000	0.97933	2.571000	0.86741	0.650000	0.86243	TGT		0.542	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965		Missense_Mutation
RABGAP1	23637	genome.wustl.edu	37	9	125751633	125751633	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr9:125751633C>T	ENST00000373647.4	+	5	782	c.648C>T	c.(646-648)ctC>ctT	p.L216L		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	216	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.L144L(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ACAAAATCCTCTTCTGTGTCA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	9											119.0	119.0	119.0					9																	125751633		2203	4300	6503	124791454	SO:0001819	synonymous_variant	23637			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.648C>T	9.37:g.125751633C>T		Somatic		Capture	Illumina GAIIx	4	124791454	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2	SNP	32	WashU																																																																																				0.403	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197		Silent
FBN2	2201	genome.wustl.edu	37	5	127670890	127670890	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:127670890C>T	ENST00000508053.1	-	36	4919	c.3945G>A	c.(3943-3945)atG>atA	p.M1315I	FBN2_ENST00000508989.1_Missense_Mutation_p.M1282I|FBN2_ENST00000262464.4_Missense_Mutation_p.M1315I|FBN2_ENST00000507835.1_Missense_Mutation_p.M165I			P35556	FBN2_HUMAN	fibrillin 2	1315	EGF-like 20; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.M1315I(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCATGGAAGCCATGAAGCCAT	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											123.0	116.0	118.0					5																	127670890		2203	4300	6503	127698789	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3945G>A	5.37:g.127670890C>T	ENSP00000424571:p.Met1315Ile	Somatic		Capture	Illumina GAIIx	4	127698789	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123263	0.56613	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	5.09	5.09	0.68999	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.77123	0.4084	N	0.15975	0.35	0.46725	D	0.999178	B;B	0.13145	0.007;0.001	B;B	0.08055	0.003;0.001	T	0.71337	-0.4623	10	0.34782	T	0.22	.	14.3227	0.66496	0.0:0.9266:0.0:0.0734	.	1282;1315	D6RJI3;P35556	.;FBN2_HUMAN	I	1315;1315;165;1282	ENSP00000262464:M1315I;ENSP00000424571:M1315I;ENSP00000426839:M165I;ENSP00000425596:M1282I	ENSP00000262464:M1315I	M	-	3	0	FBN2	127698789	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.807000	0.55591	2.804000	0.96469	0.655000	0.94253	ATG		0.448	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		Missense_Mutation
TMEM209	84928	genome.wustl.edu	37	7	129815423	129815423	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:129815423A>T	ENST00000397622.2	-	11	1395	c.1273T>A	c.(1273-1275)Tca>Aca	p.S425T	TMEM209_ENST00000336804.8_Missense_Mutation_p.S382T|TMEM209_ENST00000462753.1_Missense_Mutation_p.S424T|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000473456.1_Missense_Mutation_p.S383T	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	425						integral component of membrane (GO:0016021)		p.S424T(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CATCGAAATGAGCTCATACAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											56.0	56.0	56.0					7																	129815423		2094	4235	6329	129602659	SO:0001583	missense	84928				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.1273T>A	7.37:g.129815423A>T	ENSP00000380747:p.Ser425Thr	Somatic		Capture	Illumina GAIIx	4	129602659	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	CCDS47712.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	18.64	3.668382	0.67814	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.53249	1.67	0.58432	D	0.999999	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.04946	-1.0916	10	0.30078	T	0.28	-15.0312	14.7988	0.69898	1.0:0.0:0.0:0.0	.	383;425	Q96SK2-3;Q96SK2	.;TM209_HUMAN	T	425;424;383;382	ENSP00000380747:S425T;ENSP00000419697:S424T;ENSP00000417258:S383T;ENSP00000338388:S382T	ENSP00000338388:S382T	S	-	1	0	TMEM209	129602659	1.000000	0.71417	0.847000	0.33407	0.956000	0.61745	6.666000	0.74446	2.098000	0.63641	0.482000	0.46254	TCA		0.403	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842		Missense_Mutation
C7orf49	78996	genome.wustl.edu	37	7	134851584	134851584	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:134851584C>A	ENST00000393114.3	-	4	434	c.253G>T	c.(253-255)Gcg>Tcg	p.A85S	C7orf49_ENST00000483029.2_Missense_Mutation_p.A30S|C7orf49_ENST00000459937.1_Intron|C7orf49_ENST00000430372.1_Missense_Mutation_p.A84S|RP11-134L10.1_ENST00000608819.1_RNA|C7orf49_ENST00000424142.1_Missense_Mutation_p.A30S			Q9BWK5	MRI_HUMAN	chromosome 7 open reading frame 49	85						cytoplasm (GO:0005737)		p.A57S(1)		endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						TCAGCCCCCGCCAGGGCCGGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	7											54.0	60.0	58.0					7																	134851584		2203	4300	6503	134502124	SO:0001583	missense	78996			BC000168	CCDS5838.2, CCDS59082.1, CCDS75663.1	7q33	2011-12-09			ENSG00000122783	ENSG00000122783			22432	protein-coding gene	gene with protein product	"""modulator of retrovirus infection"""					17043244	Standard	NM_001243755		Approved	MGC5242, FLJ27285, FLJ22450, MRI	uc003vsh.3	Q9BWK5	OTTHUMG00000155447	ENST00000393114.3:c.253G>T	7.37:g.134851584C>A	ENSP00000376823:p.Ala85Ser	Somatic		Capture	Illumina GAIIx	4	134502124	Q6NWZ4|Q6ZNR5	Missense_Mutation	SNP	ENST00000393114.3	37	CCDS5838.2	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	10.44	1.350600	0.24512	.	.	ENSG00000122783	ENST00000435834;ENST00000424142;ENST00000393114;ENST00000430372	.	.	.	5.37	3.41	0.39046	.	1.106060	0.06912	N	0.807803	T	0.36663	0.0975	L	0.29908	0.895	0.09310	N	1	B;B;B	0.29301	0.241;0.081;0.081	B;B;B	0.34931	0.192;0.094;0.094	T	0.30679	-0.9970	9	0.17369	T	0.5	-4.5827	13.2047	0.59788	0.0:0.6765:0.3235:0.0	.	84;85;56	C9JKC7;Q9BWK5;Q9BWK5-2	.;MRI_HUMAN;.	S	30;30;85;84	.	ENSP00000376823:A85S	A	-	1	0	C7orf49	134502124	0.023000	0.18921	0.027000	0.17364	0.004000	0.04260	1.280000	0.33202	1.229000	0.43630	0.563000	0.77884	GCG		0.577	C7orf49-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340145.1	NM_024033		Missense_Mutation
BRS3	680	genome.wustl.edu	37	X	135572549	135572549	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:135572549C>G	ENST00000370648.3	+	2	920	c.692C>G	c.(691-693)tCt>tGt	p.S231C	Z97632.1_ENST00000580943.1_RNA	NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	231					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.S231C(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					ATTCCACTCTCTATTATCTCT	0.403																																																1	Substitution - Missense(1)	ovary(1)	X											86.0	80.0	82.0					X																	135572549		2203	4300	6503	135400215	SO:0001583	missense	680				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.692C>G	X.37:g.135572549C>G	ENSP00000359682:p.Ser231Cys	Somatic		Capture	Illumina GAIIx	4	135400215		Missense_Mutation	SNP	ENST00000370648.3	37	CCDS14656.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040976	0.55003	.	.	ENSG00000102239	ENST00000370648	T	0.38401	1.14	5.45	5.45	0.79879	GPCR, rhodopsin-like superfamily (1);	0.174700	0.39615	N	0.001312	T	0.53174	0.1780	L	0.46885	1.475	0.36963	D	0.893449	D	0.67145	0.996	D	0.67231	0.95	T	0.56269	-0.8007	10	0.37606	T	0.19	-13.2094	18.2761	0.90084	0.0:1.0:0.0:0.0	.	231	P32247	BRS3_HUMAN	C	231	ENSP00000359682:S231C	ENSP00000359682:S231C	S	+	2	0	BRS3	135400215	0.788000	0.28762	0.984000	0.44739	0.990000	0.78478	2.436000	0.44819	2.254000	0.74563	0.600000	0.82982	TCT		0.403	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059005.1	NM_001727		Missense_Mutation
COL22A1	169044	genome.wustl.edu	37	8	139737661	139737661	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr8:139737661A>G	ENST00000303045.6	-	24	2608	c.2162T>C	c.(2161-2163)gTc>gCc	p.V721A	COL22A1_ENST00000435777.1_Missense_Mutation_p.V721A	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	721	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.V721A(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGGCCTGGGACACCAGGGGG	0.592										HNSCC(7;0.00092)																																						1	Substitution - Missense(1)	ovary(1)	8											53.0	61.0	59.0					8																	139737661		2203	4300	6503	139806843	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2162T>C	8.37:g.139737661A>G	ENSP00000303153:p.Val721Ala	Somatic		Capture	Illumina GAIIx	4	139806843	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	2.041	-0.420019	0.04734	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.94897	-3.55;-3.55	4.94	1.01	0.19927	.	1.381150	0.04994	N	0.467868	D	0.83723	0.5316	N	0.05330	-0.07	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.75651	-0.3244	10	0.05721	T	0.95	.	3.2757	0.06897	0.5516:0.2112:0.2372:0.0	.	721;721	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	A	721;721;434	ENSP00000303153:V721A;ENSP00000387655:V721A	ENSP00000303153:V721A	V	-	2	0	COL22A1	139806843	0.086000	0.21541	0.187000	0.23214	0.862000	0.49288	0.622000	0.24433	0.428000	0.26173	0.533000	0.62120	GTC		0.592	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Missense_Mutation
ZBTB38	253461	genome.wustl.edu	37	3	141163185	141163185	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:141163185G>A	ENST00000514251.1	+	4	2234	c.1955G>A	c.(1954-1956)gGt>gAt	p.G652D	ZBTB38_ENST00000321464.5_Missense_Mutation_p.G653D|ZBTB38_ENST00000441582.2_Missense_Mutation_p.G652D					zinc finger and BTB domain containing 38									p.G652D(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						AATGCAGAGGGTACCAAATGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	93.0	94.0					3																	141163185		1918	4135	6053	142645875	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1955G>A	3.37:g.141163185G>A	ENSP00000426387:p.Gly652Asp	Somatic		Capture	Illumina GAIIx	4	142645875		Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489474	0.64074	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.08984	3.53;3.03;3.03;3.04	5.02	4.13	0.48395	.	0.364396	0.24260	N	0.040091	T	0.07908	0.0198	L	0.40543	1.245	0.09310	N	1	P;P	0.40875	0.731;0.731	B;B	0.38428	0.273;0.273	T	0.27673	-1.0067	9	.	.	.	-20.3704	11.5518	0.50725	0.089:0.0:0.911:0.0	.	653;652	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	D	652;652;652;653	ENSP00000424254:G652D;ENSP00000426387:G652D;ENSP00000406955:G652D;ENSP00000372635:G653D	.	G	+	2	0	ZBTB38	142645875	0.004000	0.15560	0.786000	0.31890	0.864000	0.49448	0.389000	0.20751	2.603000	0.88011	0.650000	0.86243	GGT		0.438	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			Missense_Mutation
PABPC1P2	728773	genome.wustl.edu	37	2	147346101	147346101	+	IGR	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:147346101A>C								RNU7-2P (443316 upstream) : AC103881.1 (249215 downstream)														p.L187F(1)									ATGTAGCTTTAGCTCAGTGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	2																																								147062571	SO:0001628	intergenic_variant																																2.37:g.147346101A>C		Somatic		Capture	Illumina GAIIx	4	147062571		Missense_Mutation	SNP		37		SNP	15	WashU																																																																																			0	0.483									Missense_Mutation
HIST2H2BE	8349	genome.wustl.edu	37	1	149857962	149857962	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:149857962C>G	ENST00000369155.2	-	1	270	c.229G>C	c.(229-231)Gag>Cag	p.E77Q	HIST2H2AC_ENST00000331380.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	77					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CGGGAAGCCTCTCCCGCGATG	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	106.0	110.0					1																	149857962		2203	4298	6501	148124586	SO:0001583	missense	8349			AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.229G>C	1.37:g.149857962C>G	ENSP00000358151:p.Glu77Gln	Somatic		Capture	Illumina GAIIx	4	148124586	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	37	CCDS936.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	30	5.057209	0.93846	.	.	ENSG00000184678	ENST00000369155	T	0.36340	1.26	5.88	5.88	0.94601	Histone-fold (2);Histone core (1);	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	M	0.92077	3.27	0.41984	D	0.990813	D	0.61697	0.99	P	0.61658	0.892	T	0.72057	-0.4405	10	0.87932	D	0	.	18.8885	0.92389	0.0:1.0:0.0:0.0	.	77	Q16778	H2B2E_HUMAN	Q	77	ENSP00000358151:E77Q	ENSP00000358151:E77Q	E	-	1	0	HIST2H2BE	148124586	1.000000	0.71417	0.977000	0.42913	0.918000	0.54935	5.981000	0.70524	2.806000	0.96561	0.580000	0.79431	GAG		0.642	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528		Missense_Mutation
PRMT9	90826	genome.wustl.edu	37	4	148594893	148594893	+	Silent	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:148594893A>T	ENST00000322396.6	-	3	713	c.471T>A	c.(469-471)ctT>ctA	p.L157L	PRMT10_ENST00000541232.1_Silent_p.L44L	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		157	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.L157L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TGGTGTCATTAAGCATGATAA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	4											102.0	101.0	102.0					4																	148594893		2203	4300	6503	148814343	SO:0001819	synonymous_variant	90826																														ENST00000322396.6:c.471T>A	4.37:g.148594893A>T		Somatic		Capture	Illumina GAIIx	4	148814343	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Silent	SNP	ENST00000322396.6	37	CCDS3771.1	SNP	13	WashU																																																																																				0.403	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1			Silent
TIGD6	81789	genome.wustl.edu	37	5	149374598	149374598	+	Silent	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:149374598G>A	ENST00000296736.3	-	2	2088	c.1314C>T	c.(1312-1314)gaC>gaT	p.D438D	TIGD6_ENST00000515406.2_Silent_p.D438D	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	438						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D438D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CAGCCACCATGTCCTGGATGA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	5											160.0	151.0	154.0					5																	149374598		2203	4300	6503	149354791	SO:0001819	synonymous_variant	81789			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.1314C>T	5.37:g.149374598G>A		Somatic		Capture	Illumina GAIIx	4	149354791	B3KTZ8|Q96MQ4|Q9H0X7	Silent	SNP	ENST00000296736.3	37	CCDS4301.1	SNP	48	WashU																																																																																				0.448	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1	NM_030953		Silent
MAGEA1	4100	genome.wustl.edu	37	X	152482178	152482178	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:152482178T>A	ENST00000356661.5	-	3	1051	c.833A>T	c.(832-834)aAa>aTa	p.K278I		NM_004988.4	NP_004979.3	P43355	MAGA1_HUMAN	melanoma antigen family A, 1 (directs expression of antigen MZ2-E)	278	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.		K -> T (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase binding (GO:0042826)	p.K278I(1)|p.K278T(1)		breast(1)|central_nervous_system(7)|kidney(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCAAGGACTTTCACATAGCT	0.542																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	X											136.0	130.0	132.0					X																	152482178		2203	4300	6503	152135372	SO:0001583	missense	4100				CCDS76051.1	Xq28	2010-05-26			ENSG00000198681	ENSG00000198681			6796	protein-coding gene	gene with protein product	"""melanoma-associated antigen 1"", ""melanoma-associated antigen MZ2-E"", ""melanoma antigen MAGE-1"", ""melanoma antigen family A 1"", ""cancer/testis antigen family 1, member 1"""	300016		MAGE1		1840703	Standard	NM_004988		Approved	MGC9326, CT1.1	uc004fhf.2	P43355	OTTHUMG00000024192	ENST00000356661.5:c.833A>T	X.37:g.152482178T>A	ENSP00000349085:p.Lys278Ile	Somatic		Capture	Illumina GAIIx	4	152135372	B2RC81|O00346	Missense_Mutation	SNP	ENST00000356661.5	37	CCDS14720.1	SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	11.97	1.797696	0.31777	.	.	ENSG00000198681	ENST00000356661	T	0.06371	3.31	1.28	-0.0372	0.13885	.	0.520953	0.22824	N	0.055200	T	0.25754	0.0627	H	0.95574	3.69	0.09310	N	1	D	0.56035	0.974	D	0.67231	0.95	T	0.09596	-1.0667	10	0.87932	D	0	.	3.1216	0.06393	0.0:0.2841:0.0:0.7159	.	278	P43355	MAGA1_HUMAN	I	278	ENSP00000349085:K278I	ENSP00000349085:K278I	K	-	2	0	MAGEA1	152135372	0.288000	0.24324	0.001000	0.08648	0.037000	0.13140	0.283000	0.18846	-0.062000	0.13088	0.158000	0.16466	AAA		0.542	MAGEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060940.1	NM_004988		Missense_Mutation
DNAJB6	10049	genome.wustl.edu	37	7	157178309	157178309	+	Intron	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:157178309A>T	ENST00000262177.4	+	8	896				DNAJB6_ENST00000452797.2_Intron|DNAJB6_ENST00000429029.2_Missense_Mutation_p.K232M|DNAJB6_ENST00000443280.1_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.?(1)		central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ATAAATGGTAAGGAGCAGCTG	0.358																																					Esophageal Squamous(46;195 967 1350 20350 43814)											1	Unknown(1)	ovary(1)	7											113.0	113.0	113.0					7																	157178309		2203	4300	6503	156871070	SO:0001627	intron_variant	10049			AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.691+4A>T	7.37:g.157178309A>T		Somatic		Capture	Illumina GAIIx	4	156871070	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Missense_Mutation	SNP	ENST00000262177.4	37	CCDS5946.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	22.4	4.281293	0.80692	.	.	ENSG00000105993	ENST00000429029	T	0.61980	0.06	5.7	5.7	0.88788	.	.	.	.	.	T	0.80336	0.4604	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82557	-0.0398	9	0.59425	D	0.04	.	15.9611	0.79930	1.0:0.0:0.0:0.0	.	232	O75190-2	.	M	232	ENSP00000397556:K232M	ENSP00000397556:K232M	K	+	2	0	DNAJB6	156871070	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.369000	0.73109	2.171000	0.68590	0.533000	0.62120	AAG		0.358	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2			Missense_Mutation
OR10J3	441911	genome.wustl.edu	37	1	159283647	159283647	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:159283647G>A	ENST00000332217.5	-	1	802	c.803C>T	c.(802-804)tCc>tTc	p.S268F		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S268F(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					CTGTCCCAGGGAACTCTGGGA	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	111.0	116.0					1																	159283647		2203	4300	6503	157550271	SO:0001583	missense	441911				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.803C>T	1.37:g.159283647G>A	ENSP00000331789:p.Ser268Phe	Somatic		Capture	Illumina GAIIx	4	157550271		Missense_Mutation	SNP	ENST00000332217.5	37	CCDS30909.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514638	0.27123	.	.	ENSG00000196266	ENST00000332217	T	0.00277	8.34	5.34	2.49	0.30216	.	0.000000	0.32190	U	0.006441	T	0.00144	0.0004	M	0.86343	2.81	0.09310	N	1	B	0.17465	0.022	B	0.29598	0.104	T	0.48479	-0.9032	10	0.72032	D	0.01	.	8.9957	0.36050	0.2355:0.0:0.7645:0.0	.	268	Q5JRS4	O10J3_HUMAN	F	268	ENSP00000331789:S268F	ENSP00000331789:S268F	S	-	2	0	OR10J3	157550271	0.328000	0.24687	0.031000	0.17742	0.774000	0.43823	1.428000	0.34892	0.396000	0.25283	0.655000	0.94253	TCC		0.532	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1			Missense_Mutation
APCS	325	genome.wustl.edu	37	1	159558179	159558179	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:159558179A>T	ENST00000255040.2	+	2	450	c.353A>T	c.(352-354)gAg>gTg	p.E118V		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	118	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					GTGAGCTGGGAGTCCTCATCA	0.448																																																0			1											78.0	78.0	78.0					1																	159558179		2203	4300	6503	157824803	SO:0001583	missense	325				CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.353A>T	1.37:g.159558179A>T	ENSP00000255040:p.Glu118Val	Somatic		Capture	Illumina GAIIx	4	157824803		Missense_Mutation	SNP	ENST00000255040.2	37	CCDS1186.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	14.19	2.461010	0.43736	.	.	ENSG00000132703	ENST00000255040	T	0.64991	-0.13	4.11	1.68	0.24146	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.058029	0.64402	D	0.000001	T	0.72277	0.3440	M	0.92317	3.295	0.46416	D	0.99903	D	0.76494	0.999	D	0.81914	0.995	T	0.71761	-0.4495	10	0.87932	D	0	-14.3854	4.7749	0.13175	0.7384:0.0:0.0959:0.1656	.	118	P02743	SAMP_HUMAN	V	118	ENSP00000255040:E118V	ENSP00000255040:E118V	E	+	2	0	APCS	157824803	1.000000	0.71417	0.755000	0.31263	0.223000	0.24884	5.013000	0.64023	0.206000	0.20587	0.533000	0.62120	GAG		0.448	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639		Missense_Mutation
GRB14	2888	genome.wustl.edu	37	2	165349680	165349680	+	Missense_Mutation	SNP	C	C	A	rs372841700		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:165349680C>A	ENST00000263915.3	-	14	2027	c.1489G>T	c.(1489-1491)Ggt>Tgt	p.G497C	GRB14_ENST00000497306.1_5'UTR|GRB14_ENST00000543549.1_Missense_Mutation_p.G410C	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	497	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.G497C(1)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						AACATTTCACCGTCATCTTCT	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	100.0	95.0					2																	165349680		2203	4300	6503	165057926	SO:0001583	missense	2888				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1489G>T	2.37:g.165349680C>A	ENSP00000263915:p.Gly497Cys	Somatic		Capture	Illumina GAIIx	4	165057926	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	37	CCDS2222.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885983	0.72410	.	.	ENSG00000115290	ENST00000263915;ENST00000543549	T;T	0.44482	0.92;0.92	5.48	5.48	0.80851	SH2 motif (4);	0.047212	0.85682	D	0.000000	T	0.76550	0.4003	H	0.95816	3.725	0.58432	D	0.999996	D;D	0.89917	0.999;1.0	D;D	0.83275	0.969;0.996	D	0.84001	0.0343	10	0.87932	D	0	-10.9655	19.3681	0.94473	0.0:1.0:0.0:0.0	.	410;497	B7Z7F9;Q14449	.;GRB14_HUMAN	C	497;410	ENSP00000263915:G497C;ENSP00000443699:G410C	ENSP00000263915:G497C	G	-	1	0	GRB14	165057926	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	5.920000	0.70017	2.556000	0.86216	0.655000	0.94253	GGT		0.393	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2			Missense_Mutation
MPZL1	9019	genome.wustl.edu	37	1	167742563	167742563	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:167742563C>G	ENST00000359523.2	+	4	765	c.563C>G	c.(562-564)gCt>gGt	p.A188G	MPZL1_ENST00000474859.1_Missense_Mutation_p.A188G|MPZL1_ENST00000392121.3_Intron	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	188					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)	p.A188G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					ATGATTCTGGCTGTCCTCTAT	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											136.0	128.0	130.0					1																	167742563		2203	4300	6503	166009187	SO:0001583	missense	9019			AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.563C>G	1.37:g.167742563C>G	ENSP00000352513:p.Ala188Gly	Somatic		Capture	Illumina GAIIx	4	166009187	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	ENST00000359523.2	37	CCDS1264.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768504	0.49680	.	.	ENSG00000197965	ENST00000359523;ENST00000474859;ENST00000367853	D;D;D	0.97505	-3.94;-4.41;-4.39	4.36	3.43	0.39272	.	0.275580	0.27411	N	0.019495	D	0.90007	0.6880	L	0.27053	0.805	0.23036	N	0.9984	P;P	0.44816	0.844;0.629	B;B	0.44278	0.445;0.191	D	0.86934	0.2075	9	0.28530	T	0.3	.	8.738	0.34541	0.0:0.7044:0.1991:0.0965	.	188;188	O95297-3;O95297	.;MPZL1_HUMAN	G	188;188;162	ENSP00000352513:A188G;ENSP00000420455:A188G;ENSP00000356827:A162G	ENSP00000352513:A188G	A	+	2	0	MPZL1	166009187	0.999000	0.42202	0.996000	0.52242	0.997000	0.91878	2.209000	0.42806	1.113000	0.41760	0.563000	0.77884	GCT		0.458	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083655.2	NM_024569		Missense_Mutation
FAM20B	9917	genome.wustl.edu	37	1	179013242	179013242	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:179013242T>G	ENST00000263733.4	+	2	596	c.260T>G	c.(259-261)gTc>gGc	p.V87G		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	87						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.V87G(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						CTGGGGGCAGTCATGCATGCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	67.0	67.0					1																	179013242		2203	4300	6503	177279865	SO:0001583	missense	9917			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.260T>G	1.37:g.179013242T>G	ENSP00000263733:p.Val87Gly	Somatic		Capture	Illumina GAIIx	4	177279865	Q5W0C3|Q5W0C4	Missense_Mutation	SNP	ENST00000263733.4	37	CCDS1328.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499679	0.85176	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	D	0.89552	-2.53	6.03	6.03	0.97812	.	0.217366	0.47852	D	0.000208	D	0.89280	0.6670	M	0.67397	2.05	0.51767	D	0.999932	B	0.30021	0.265	B	0.33690	0.168	D	0.88297	0.2947	10	0.87932	D	0	-16.0459	16.5724	0.84622	0.0:0.0:0.0:1.0	.	87	O75063	XYLK_HUMAN	G	87	ENSP00000263733:V87G	ENSP00000263733:V87G	V	+	2	0	FAM20B	177279865	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.665000	0.83852	2.313000	0.78055	0.455000	0.32223	GTC		0.527	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179407087	179407087	+	Missense_Mutation	SNP	C	C	T	rs55915651		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:179407087C>T	ENST00000591111.1	-	299	92697	c.92473G>A	c.(92473-92475)Gaa>Aaa	p.E30825K	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E32466K|TTN_ENST00000359218.5_Missense_Mutation_p.E23526K|TTN_ENST00000460472.2_Missense_Mutation_p.E23401K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E29898K|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E23593K|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30825	Fibronectin type-III 124. {ECO:0000255|PROSITE-ProRule:PRU00316}.		E -> K. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E29896K(1)|p.E23401K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATTTCCTTCGGTGAGTCTG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		19196	0.001		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(2)	2											77.0	73.0	74.0					2																	179407087		2042	4202	6244	179115333	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92473G>A	2.37:g.179407087C>T	ENSP00000465570:p.Glu30825Lys	Somatic		Capture	Illumina GAIIx	4	179115333	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.809229	0.96975	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	6.06	6.06	0.98353	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68879	0.3049	L	0.42487	1.325	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.68450	-0.5405	9	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	rs55915651	23401;23526;23593;30825	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	29898;23401;23593;23526;23398	ENSP00000343764:E29898K;ENSP00000434586:E23401K;ENSP00000340554:E23593K;ENSP00000352154:E23526K	ENSP00000340554:E23593K	E	-	1	0	TTN	179115333	1.000000	0.71417	0.978000	0.43139	0.996000	0.88848	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	GAA		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
MAML1	9794	genome.wustl.edu	37	5	179192580	179192580	+	Missense_Mutation	SNP	G	G	A	rs113636707		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:179192580G>A	ENST00000292599.3	+	2	832	c.569G>A	c.(568-570)cGt>cAt	p.R190H	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)									p.R190H(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AACAAAAAGCGTCTGGCTGAC	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		17356	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	HIS/ARG	7,4399	11.4+/-27.6	0,7,2196	37.0	40.0	39.0		569	4.9	1.0	5	dbSNP_132	39	27,8573	19.2+/-60.6	0,27,4273	yes	missense	MAML1	NM_014757.4	29	0,34,6469	AA,AG,GG		0.314,0.1589,0.2614	possibly-damaging	190/1017	179192580	34,12972	2203	4300	6503	179125186	SO:0001583	missense	9794			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.569G>A	5.37:g.179192580G>A	ENSP00000292599:p.Arg190His	Somatic		Capture	Illumina GAIIx	4	179125186		Missense_Mutation	SNP	ENST00000292599.3	37	CCDS34315.1	SNP	40	WashU	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	13.04	2.117249	0.37339	0.001589	0.00314	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.44881	0.91	4.9	4.9	0.64082	.	0.143880	0.49305	D	0.000144	T	0.26774	0.0655	N	0.19112	0.55	0.27413	N	0.95453	P;B	0.34909	0.475;0.005	B;B	0.21151	0.033;0.001	T	0.08953	-1.0697	10	0.27082	T	0.32	-0.4315	18.0605	0.89375	0.0:0.0:1.0:0.0	.	227;190	Q59GH4;Q92585	.;MAML1_HUMAN	H	190;227	ENSP00000292599:R190H	ENSP00000292599:R190H	R	+	2	0	MAML1	179125186	1.000000	0.71417	0.987000	0.45799	0.515000	0.34225	2.634000	0.46528	2.251000	0.74343	0.455000	0.32223	CGT		0.562	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179664223	179664223	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:179664223G>T	ENST00000591111.1	-	6	1129	c.905C>A	c.(904-906)tCt>tAt	p.S302Y	TTN_ENST00000589042.1_Missense_Mutation_p.S302Y|TTN_ENST00000359218.5_Missense_Mutation_p.S302Y|TTN_ENST00000460472.2_Missense_Mutation_p.S302Y|TTN_ENST00000360870.5_Missense_Mutation_p.S302Y|TTN_ENST00000342992.6_Missense_Mutation_p.S302Y|TTN_ENST00000342175.6_Missense_Mutation_p.S302Y			Q8WZ42	TITIN_HUMAN	titin	0	ZIS1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGACCGGAGATGGGGTCGG	0.562																																																0			2											53.0	56.0	55.0					2																	179664223		2203	4300	6503	179372468	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.905C>A	2.37:g.179664223G>T	ENSP00000465570:p.Ser302Tyr	Somatic		Capture	Illumina GAIIx	4	179372468	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440041	0.63067	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.65732	-0.17;0.04;0.02;0.01;0.23	5.64	5.64	0.86602	.	.	.	.	.	T	0.76227	0.3958	L	0.51422	1.61	0.39356	D	0.965843	D;D;D;D;D	0.76494	0.991;0.991;0.991;0.991;0.999	P;P;P;P;D	0.73380	0.77;0.77;0.77;0.77;0.98	T	0.78285	-0.2263	9	0.87932	D	0	.	19.7063	0.96072	0.0:0.0:1.0:0.0	.	302;302;302;302;302	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Y	302	ENSP00000343764:S302Y;ENSP00000434586:S302Y;ENSP00000340554:S302Y;ENSP00000352154:S302Y;ENSP00000354117:S302Y	ENSP00000340554:S302Y	S	-	2	0	TTN	179372468	1.000000	0.71417	0.995000	0.50966	0.502000	0.33828	9.718000	0.98758	2.662000	0.90505	0.561000	0.74099	TCT		0.562	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
DHX9	1660	genome.wustl.edu	37	1	182845604	182845604	+	Silent	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:182845604A>G	ENST00000367549.3	+	18	2162	c.2052A>G	c.(2050-2052)ctA>ctG	p.L684L		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	684	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.L684L(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						ATCAGATTCTACCCCTGCATT	0.388																																					Colon(69;210 1162 3697 13559 39565)											1	Substitution - coding silent(1)	ovary(1)	1											98.0	85.0	89.0					1																	182845604		1838	4086	5924	181112227	SO:0001819	synonymous_variant	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2052A>G	1.37:g.182845604A>G		Somatic		Capture	Illumina GAIIx	4	181112227	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Silent	SNP	ENST00000367549.3	37	CCDS41444.1	SNP	14	WashU																																																																																				0.388	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		Silent
RGL1	23179	genome.wustl.edu	37	1	183881302	183881302	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:183881302G>C	ENST00000360851.3	+	15	1827	c.1649G>C	c.(1648-1650)aGc>aCc	p.S550T	RGL1_ENST00000536277.1_Missense_Mutation_p.S548T|RGL1_ENST00000304685.4_Missense_Mutation_p.S585T|RGL1_ENST00000539189.1_Missense_Mutation_p.S521T			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	550	Ser-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.S585T(1)		breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						TCTGGTGAAAGCATGGACTCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											89.0	80.0	83.0					1																	183881302		2203	4300	6503	182147925	SO:0001583	missense	23179			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1649G>C	1.37:g.183881302G>C	ENSP00000354097:p.Ser550Thr	Somatic		Capture	Illumina GAIIx	4	182147925	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	ENST00000360851.3	37		SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203671	0.38905	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000543395;ENST00000360851;ENST00000539189	T;T;T;T;T	0.50277	0.78;0.78;0.79;0.79;0.75	5.32	5.32	0.75619	.	0.088928	0.85682	D	0.000000	T	0.57125	0.2032	L	0.36672	1.1	0.80722	D	1	B;B;D;B;B	0.56035	0.376;0.259;0.974;0.259;0.259	B;B;D;B;B	0.70487	0.104;0.048;0.969;0.048;0.048	T	0.52147	-0.8614	10	0.33141	T	0.24	.	14.2285	0.65875	0.0:0.1496:0.8504:0.0	.	521;548;355;550;585	F5H6U6;B7Z2W5;F5H3C3;Q9NZL6;Q5SXQ6	.;.;.;RGL1_HUMAN;.	T	585;585;548;355;550;521	ENSP00000303192:S585T;ENSP00000356501:S585T;ENSP00000438662:S548T;ENSP00000354097:S550T;ENSP00000437355:S521T	ENSP00000303192:S585T	S	+	2	0	RGL1	182147925	1.000000	0.71417	0.995000	0.50966	0.917000	0.54804	7.055000	0.76656	2.474000	0.83562	0.491000	0.48974	AGC		0.542	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149		Missense_Mutation
MYL12BP2	391722	genome.wustl.edu	37	4	185220684	185220684	+	IGR	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:185220684G>C								RN7SL28P (20300 upstream) : RP11-290F5.2 (41224 downstream)																							GATCAATCATGTTGAAGGCCT	0.478																																																0			4																																								185457678	SO:0001628	intergenic_variant	391722																															4.37:g.185220684G>C		Somatic		Capture	Illumina GAIIx	4	185457678		Missense_Mutation	SNP		37		SNP	48	WashU																																																																																			0	0.478									Missense_Mutation
RYR2	6262	genome.wustl.edu	37	1	237880635	237880635	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:237880635G>C	ENST00000366574.2	+	72	10778	c.10461G>C	c.(10459-10461)gaG>gaC	p.E3487D	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.E3485D|RYR2_ENST00000542537.1_Missense_Mutation_p.E3471D	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3487					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E3485D(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGACCAGGAGCTCATTGCTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	81.0	79.0					1																	237880635		1924	4116	6040	235947258	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10461G>C	1.37:g.237880635G>C	ENSP00000355533:p.Glu3487Asp	Somatic		Capture	Illumina GAIIx	4	235947258	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	10.63	1.404938	0.25378	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97016	-4.21;-4.18;-4.21	5.33	-2.93	0.05598	.	0.085593	0.44285	D	0.000474	D	0.90342	0.6978	L	0.33792	1.035	0.41668	D	0.98922	B	0.10296	0.003	B	0.13407	0.009	T	0.75741	-0.3211	10	0.27082	T	0.32	-15.7454	8.7918	0.34854	0.5402:0.0:0.3609:0.0989	.	3487	Q92736	RYR2_HUMAN	D	3487;3485;3471;442	ENSP00000355533:E3487D;ENSP00000353174:E3485D;ENSP00000443798:E3471D	ENSP00000353174:E3485D	E	+	3	2	RYR2	235947258	0.998000	0.40836	0.979000	0.43373	0.978000	0.69477	0.443000	0.21644	-0.367000	0.08052	0.655000	0.94253	GAG		0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
COL6A3	1293	genome.wustl.edu	37	2	238274597	238274597	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:238274597T>A	ENST00000295550.4	-	12	6034	c.5582A>T	c.(5581-5583)aAg>aTg	p.K1861M	COL6A3_ENST00000409809.1_Missense_Mutation_p.K1655M|COL6A3_ENST00000353578.4_Missense_Mutation_p.K1655M|COL6A3_ENST00000347401.3_Missense_Mutation_p.K1660M|COL6A3_ENST00000346358.4_Missense_Mutation_p.K1661M|COL6A3_ENST00000472056.1_Missense_Mutation_p.K1254M	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1861	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCGTCCACCTTGGACTCGAA	0.557																																																0			2											81.0	81.0	81.0					2																	238274597		2203	4300	6503	237939336	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5582A>T	2.37:g.238274597T>A	ENSP00000295550:p.Lys1861Met	Somatic		Capture	Illumina GAIIx	4	237939336	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	6.919	0.539237	0.13250	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35	5.44	3.06	0.35304	von Willebrand factor, type A (2);	0.467365	0.17735	N	0.163777	T	0.49081	0.1536	L	0.57536	1.79	0.40770	D	0.983083	D;D;P	0.71674	0.997;0.998;0.927	D;D;P	0.65573	0.922;0.936;0.498	T	0.41142	-0.9525	10	0.34782	T	0.22	.	8.7197	0.34434	0.0:0.219:0.0:0.781	.	1254;1655;1861	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	M	1861;1660;1655;1254;1655;1661	ENSP00000295550:K1861M;ENSP00000315609:K1660M;ENSP00000315873:K1655M;ENSP00000418285:K1254M;ENSP00000386844:K1655M;ENSP00000295546:K1661M	ENSP00000295550:K1861M	K	-	2	0	COL6A3	237939336	0.999000	0.42202	0.997000	0.53966	0.247000	0.25773	3.029000	0.49712	1.002000	0.39104	0.533000	0.62120	AAG		0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Missense_Mutation
KIF26B	55083	genome.wustl.edu	37	1	245704225	245704225	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:245704225G>C	ENST00000407071.2	+	5	1763	c.1323G>C	c.(1321-1323)aaG>aaC	p.K441N	KIF26B_ENST00000366518.4_Missense_Mutation_p.K60N	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	441					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.K441N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTGTCAACAAGGTGAAGGACA	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											35.0	38.0	37.0					1																	245704225		1861	4085	5946	243770848	SO:0001583	missense	55083			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1323G>C	1.37:g.245704225G>C	ENSP00000385545:p.Lys441Asn	Somatic		Capture	Illumina GAIIx	4	243770848	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	14.50	2.555320	0.45487	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.17213	2.29;2.29	5.29	3.18	0.36537	.	.	.	.	.	T	0.25531	0.0621	M	0.66939	2.045	0.47737	D	0.9995	P;P	0.52577	0.954;0.78	P;P	0.51582	0.59;0.674	T	0.02477	-1.1153	9	0.87932	D	0	.	6.3641	0.21445	0.4211:0.0:0.5789:0.0	.	60;441	B7WPD9;Q2KJY2	.;KI26B_HUMAN	N	441;60;57	ENSP00000385545:K441N;ENSP00000355475:K60N	ENSP00000355475:K60N	K	+	3	2	KIF26B	243770848	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.980000	0.49321	1.232000	0.43678	-0.136000	0.14681	AAG		0.607	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354		Missense_Mutation
OR14K1	343170	genome.wustl.edu	37	1	247902812	247902812	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:247902812T>C	ENST00000283225.2	+	1	896	c.896T>C	c.(895-897)cTg>cCg	p.L299P	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						AAATCCGCTCTGAGTAAAGTC	0.408																																																0			1											76.0	68.0	70.0					1																	247902812		1906	4122	6028	245969435	SO:0001583	missense	343170			BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.896T>C	1.37:g.247902812T>C	ENSP00000283225:p.Leu299Pro	Somatic		Capture	Illumina GAIIx	4	245969435	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	ENST00000283225.2	37		SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347946	0.41599	.	.	ENSG00000153230	ENST00000283225	T	0.48522	0.81	3.65	3.65	0.41850	.	0.616394	0.12101	U	0.499555	T	0.51770	0.1694	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.47275	-0.9130	7	0.87932	D	0	.	11.1927	0.48693	0.0:0.0:0.0:1.0	.	.	.	.	P	299	ENSP00000283225:L299P	ENSP00000283225:L299P	L	+	2	0	OR14K1	245969435	0.005000	0.15991	0.003000	0.11579	0.013000	0.08279	0.903000	0.28475	1.492000	0.48499	0.418000	0.28097	CTG		0.408	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000096868.1	NM_001004732		Missense_Mutation
BRCA2	675	genome.wustl.edu	37	13	32912708	32912711	+	Frame_Shift_Del	DEL	AAAG	AAAG	-	rs80359435		TCGA-13-0885-01	TCGA-13-0885-10	AAAG	AAAG	AAAG	-	AAAG	AAAG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:32912708_32912711delAAAG	ENST00000380152.3	+	11	4449_4452	c.4216_4219delAAAG	c.(4216-4221)aaagaafs	p.KE1406fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.KE1406fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1406	Interaction with POLH.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.K1406fs*3(1)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TACTTCAAATAAAGAACAGTTAAC	0.333			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	1	Deletion - Frameshift(1)	ovary(1)	13																																								31810711	SO:0001589	frameshift_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4216_4219delAAAG	13.37:g.32912708_32912711delAAAG	ENSP00000369497:p.Lys1406fs	Somatic		Capture	Illumina GAIIx	4	31810708	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	ENST00000380152.3	37	CCDS9344.1	DEL	13	WashU																																																																																				0.333	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		Frame_Shift_Del
LAIR1	3903	genome.wustl.edu	37	19	54867969	54867974	+	In_Frame_Del	DEL	GCTGTG	GCTGTG	-	rs141607224		TCGA-13-0885-01	TCGA-13-0885-10	GCTGTG	GCTGTG	GCTGTG	-	GCTGTG	GCTGTG	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:54867969_54867974delGCTGTG	ENST00000391742.2	-	7	769_774	c.617_622delCACAGC	c.(616-624)ccacagcag>cag	p.PQ206del	LAIR1_ENST00000348231.4_In_Frame_Del_p.PQ189del|LAIR1_ENST00000434277.2_In_Frame_Del_p.PQ205del|LAIR1_ENST00000391743.3_In_Frame_Del_p.PQ188del|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000313038.6_In_Frame_Del_p.PQ199del|LAIR1_ENST00000474878.1_In_Frame_Del_p.PQ188del			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	206					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P206_Q207del(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CCTCACCTCTGCTGTGGCTTCTGCTC	0.592																																																1	Deletion - In frame(1)	ovary(1)	19																																								59559786	SO:0001651	inframe_deletion	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.617_622delCACAGC	19.37:g.54867969_54867974delGCTGTG	ENSP00000375622:p.Pro206_Gln207del	Somatic		Capture	Illumina GAIIx	4	59559781		In_Frame_Del	DEL	ENST00000391742.2	37	CCDS12891.1	DEL	46	WashU																																																																																				0.592	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1			In_Frame_Del
ADAMTS9	56999	genome.wustl.edu	37	3	64606856	64606856	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0885-01	TCGA-13-0885-10	T	T	G	T	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:64606856T>G	ENST00000498707.1	-	19	3089	c.2747A>C	c.(2746-2748)cAa>cCa	p.Q916P	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.Q888P	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	916	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q916P(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		ATCGCATCTTTGATCAGAAAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											68.0	70.0	69.0					3																	64606856		2203	4300	6503	64581896	SO:0001583	missense	56999			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2747A>C	3.37:g.64606856T>G	ENSP00000418735:p.Gln916Pro	Somatic		Capture	Illumina GAIIx	Phase_III	64581896	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	19.78	3.891459	0.72524	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.60797	0.16;0.16	5.96	5.96	0.96718	.	0.064020	0.64402	D	0.000005	T	0.78438	0.4283	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.89917	0.999;0.997;1.0;0.994	D;D;D;P	0.87578	0.961;0.956;0.998;0.885	T	0.80788	-0.1226	10	0.56958	D	0.05	.	16.4221	0.83766	0.0:0.0:0.0:1.0	.	888;916;916;916	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	P	888;916	ENSP00000295903:Q888P;ENSP00000418735:Q916P	ENSP00000295903:Q888P	Q	-	2	0	ADAMTS9	64581896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.334000	0.79224	2.283000	0.76528	0.477000	0.44152	CAA		0.453	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1			Missense_Mutation
PIP4K2A	5305	genome.wustl.edu	37	10	22826149	22826149	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr10:22826149A>T	ENST00000376573.4	-	10	1430	c.1202T>A	c.(1201-1203)aTt>aAt	p.I401N	PIP4K2A_ENST00000545335.1_Missense_Mutation_p.I342N|PIP4K2A_ENST00000323883.7_Missense_Mutation_p.I261N	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	401	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)	p.I401N(1)		endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						GATGTGGCCAATAAAGTCCAA	0.463																																																1	Substitution - Missense(1)	ovary(1)	10											135.0	112.0	120.0					10																	22826149		2203	4300	6503	22866155	SO:0001583	missense	5305			S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.1202T>A	10.37:g.22826149A>T	ENSP00000365757:p.Ile401Asn	Somatic		Capture	Illumina GAIIx	Phase_III	22866155	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Missense_Mutation	SNP	ENST00000376573.4	37	CCDS7141.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391925	0.83011	.	.	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335	T;T;T	0.36520	1.25;1.25;1.25	5.71	5.71	0.89125	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	H	0.95470	3.675	0.80722	D	1	D;D	0.61697	0.985;0.99	D;D	0.70935	0.951;0.971	T	0.81075	-0.1097	10	0.87932	D	0	-28.499	16.0042	0.80349	1.0:0.0:0.0:0.0	.	261;401	B4DH09;P48426	.;PI42A_HUMAN	N	401;261;342	ENSP00000365757:I401N;ENSP00000326294:I261N;ENSP00000442098:I342N	ENSP00000326294:I261N	I	-	2	0	PIP4K2A	22866155	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.962000	0.93254	2.171000	0.68590	0.528000	0.53228	ATT		0.463	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028		Missense_Mutation
Unknown	0	genome.wustl.edu	37	13	0	0	+	IGR	DEL	AGAA	AGAA	-			TCGA-13-0885-01	TCGA-13-0885-10							Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	3730_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr13:0delAGAA								None (None upstream) : None (None downstream)																							NNNNNNNNNN	0.0																																																0			13																																								31810714	SO:0001628	intergenic_variant	675																															13.37:g.0delAGAA		Somatic		Capture	Illumina GAIIx	Phase_III	31810710		Frame_Shift_Del	DEL		37		DEL	3	WashU																																																																																			0	0.000									Frame_Shift_Del
NES	10763	genome.wustl.edu	37	1	156639556	156639556	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:156639556C>T	ENST00000368223.3	-	4	4556	c.4424G>A	c.(4423-4425)gGt>gAt	p.G1475D		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1475	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.G1475D(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCCACTGCACCCCTCAAGCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											49.0	53.0	51.0					1																	156639556		2203	4300	6503	154906180	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4424G>A	1.37:g.156639556C>T	ENSP00000357206:p.Gly1475Asp	Somatic		Capture	Illumina GAIIx	PhaseIII	154906180	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009774	0.35415	.	.	ENSG00000132688	ENST00000368223	D	0.86366	-2.11	4.55	-0.312	0.12758	.	0.254138	0.20733	N	0.086679	T	0.68714	0.3031	M	0.65498	2.005	0.09310	N	1	B	0.27997	0.197	B	0.21546	0.035	T	0.62992	-0.6736	10	0.87932	D	0	.	3.46	0.07529	0.0:0.3458:0.2055:0.4487	.	1475	P48681	NEST_HUMAN	D	1475	ENSP00000357206:G1475D	ENSP00000357206:G1475D	G	-	2	0	NES	154906180	0.000000	0.05858	0.002000	0.10522	0.535000	0.34838	-1.241000	0.02911	0.029000	0.15352	0.557000	0.71058	GGT		0.592	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		Missense_Mutation
ASTN1	460	genome.wustl.edu	37	1	177001899	177001899	+	Silent	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:177001899G>C	ENST00000367654.3	-	3	769	c.558C>G	c.(556-558)gtC>gtG	p.V186V	ASTN1_ENST00000367657.3_Silent_p.V186V|ASTN1_ENST00000424564.2_Silent_p.V186V|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000361833.2_Silent_p.V186V	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	186					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.V186V(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GGGGCTGCGGGACCCGGCGGC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											39.0	39.0	39.0					1																	177001899		2203	4300	6503	175268522	SO:0001819	synonymous_variant	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.558C>G	1.37:g.177001899G>C		Somatic		Capture	Illumina GAIIx	PhaseIII	175268522	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	37		SNP	41	WashU																																																																																				0.607	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		Silent
SWT1	54823	genome.wustl.edu	37	1	185143927	185143927	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:185143927C>T	ENST00000367500.4	+	5	813	c.648C>T	c.(646-648)aaC>aaT	p.N216N	SWT1_ENST00000367501.3_Silent_p.N216N	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	216								p.N216N(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						AGGATTATAACTCCAACAAGA	0.348																																																1	Substitution - coding silent(1)	ovary(1)	1											68.0	77.0	74.0					1																	185143927		2195	4298	6493	183410550	SO:0001819	synonymous_variant	54823			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.648C>T	1.37:g.185143927C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	183410550	Q8NEK9|Q9BZQ7|Q9NXQ0	Silent	SNP	ENST00000367500.4	37	CCDS1367.1	SNP	20	WashU																																																																																				0.348	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673		Silent
HMCN1	83872	genome.wustl.edu	37	1	185892578	185892578	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:185892578G>A	ENST00000271588.4	+	8	1307	c.1078G>A	c.(1078-1080)Gat>Aat	p.D360N	HMCN1_ENST00000367492.2_Missense_Mutation_p.D360N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	360					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.D360N(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGCTAGAATAGATCTTCTTGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	79.0	79.0					1																	185892578		2203	4300	6503	184159201	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1078G>A	1.37:g.185892578G>A	ENSP00000271588:p.Asp360Asn	Somatic		Capture	Illumina GAIIx	PhaseIII	184159201	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	32	5.121995	0.94429	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.64260	-0.08;-0.09	5.4	5.4	0.78164	.	0.045343	0.85682	D	0.000000	T	0.75369	0.3840	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	D	0.64144	0.922	T	0.74118	-0.3768	10	0.41790	T	0.15	.	19.194	0.93679	0.0:0.0:1.0:0.0	.	360	Q96RW7	HMCN1_HUMAN	N	360	ENSP00000271588:D360N;ENSP00000356462:D360N	ENSP00000271588:D360N	D	+	1	0	HMCN1	184159201	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.320000	0.72876	2.521000	0.84997	0.655000	0.94253	GAT		0.338	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935		Missense_Mutation
AVPR1B	553	genome.wustl.edu	37	1	206225003	206225003	+	Missense_Mutation	SNP	C	C	A	rs201027590		TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:206225003C>A	ENST00000367126.4	+	1	1028	c.563C>A	c.(562-564)gCa>gAa	p.A188E	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	188					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.A188E(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	GACTGCTGGGCAGACTTCGGC	0.637													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16441	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1						C	GLU/ALA	2,4402		0,2,2200	49.0	48.0	48.0		563	5.9	1.0	1		48	0,8584		0,0,4292	no	missense	AVPR1B	NM_000707.3	107	0,2,6492	AA,AC,CC		0.0,0.0454,0.0154	probably-damaging	188/425	206225003	2,12986	2202	4292	6494	204391626	SO:0001583	missense	553			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.563C>A	1.37:g.206225003C>A	ENSP00000356094:p.Ala188Glu	Somatic		Capture	Illumina GAIIx	PhaseIII	204391626	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	SNP	25	WashU	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	23.3	4.403448	0.83230	4.54E-4	0.0	ENSG00000198049	ENST00000367126	T	0.36157	1.27	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.69248	2.105	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.53049	-0.8493	10	0.34782	T	0.22	-15.6684	19.8771	0.96880	0.0:1.0:0.0:0.0	.	188	P47901	V1BR_HUMAN	E	188	ENSP00000356094:A188E	ENSP00000356094:A188E	A	+	2	0	AVPR1B	204391626	0.998000	0.40836	0.993000	0.49108	0.992000	0.81027	3.486000	0.53215	2.786000	0.95864	0.563000	0.77884	GCA		0.637	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707		Missense_Mutation
RYR2	6262	genome.wustl.edu	37	1	237656263	237656263	+	Missense_Mutation	SNP	G	G	A	rs397516520		TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:237656263G>A	ENST00000366574.2	+	19	2154	c.1837G>A	c.(1837-1839)Gtc>Atc	p.V613I	RYR2_ENST00000360064.6_Missense_Mutation_p.V611I|RYR2_ENST00000542537.1_Missense_Mutation_p.V597I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	613	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V611I(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGTTCTGGATGTCTTGTGCTC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	157.0	153.0					1																	237656263		1993	4164	6157	235722886	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1837G>A	1.37:g.237656263G>A	ENSP00000355533:p.Val613Ile	Somatic		Capture	Illumina GAIIx	PhaseIII	235722886	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112769	0.37242	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95690	-3.78;-3.78;-3.78	6.06	5.15	0.70609	Intracellular calcium-release channel (1);B30.2/SPRY domain (1);	0.000000	0.56097	D	0.000028	D	0.95242	0.8457	M	0.81497	2.545	0.80722	D	1	B	0.20164	0.042	B	0.25506	0.061	D	0.93322	0.6693	10	0.48119	T	0.1	.	15.3418	0.74303	0.0665:0.0:0.9335:0.0	.	613	Q92736	RYR2_HUMAN	I	613;611;597	ENSP00000355533:V613I;ENSP00000353174:V611I;ENSP00000443798:V597I	ENSP00000353174:V611I	V	+	1	0	RYR2	235722886	1.000000	0.71417	0.311000	0.25182	0.003000	0.03518	7.881000	0.87252	1.582000	0.49881	-0.142000	0.14014	GTC		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
FSHB	2488	genome.wustl.edu	37	11	30255171	30255171	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:30255171A>G	ENST00000417547.1	+	3	253	c.214A>G	c.(214-216)Aag>Gag	p.K72E	FSHB_ENST00000254122.3_Missense_Mutation_p.K72E|FSHB_ENST00000533718.1_Missense_Mutation_p.K72E	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	72					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)	p.K72E(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						ATGTACCTTCAAGGAACTGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											104.0	93.0	96.0					11																	30255171		2202	4299	6501	30211747	SO:0001583	missense	2488				CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.214A>G	11.37:g.30255171A>G	ENSP00000416606:p.Lys72Glu	Somatic		Capture	Illumina GAIIx	4	30211747	A2TF08|A5JVV3|Q14D61	Missense_Mutation	SNP	ENST00000417547.1	37	CCDS7868.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	27.5	4.834588	0.91036	.	.	ENSG00000131808	ENST00000254122;ENST00000417547;ENST00000533718	D;D;D	0.90732	-2.72;-2.72;-2.72	6.17	6.17	0.99709	Cystine knot (1);	0.161123	0.53938	D	0.000060	D	0.94095	0.8107	M	0.85630	2.765	0.58432	D	0.999997	P	0.44627	0.839	P	0.49999	0.628	D	0.94572	0.7772	10	0.72032	D	0.01	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	72	P01225	FSHB_HUMAN	E	72	ENSP00000254122:K72E;ENSP00000416606:K72E;ENSP00000433424:K72E	ENSP00000254122:K72E	K	+	1	0	FSHB	30211747	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	6.587000	0.74071	2.371000	0.80710	0.533000	0.62120	AAG		0.483	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1	NM_000510		Missense_Mutation
OR5T1	390155	genome.wustl.edu	37	11	56043751	56043751	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:56043751T>C	ENST00000313033.2	+	1	723	c.637T>C	c.(637-639)Tac>Cac	p.Y213H		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y213H(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TCTATTCTTCTACTTTGTGGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											225.0	214.0	218.0					11																	56043751		2201	4296	6497	55800327	SO:0001583	missense	390155			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.637T>C	11.37:g.56043751T>C	ENSP00000323612:p.Tyr213His	Somatic		Capture	Illumina GAIIx	4	55800327	B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	CCDS31525.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	10.41	1.342699	0.24339	.	.	ENSG00000181698	ENST00000313033	T	0.00099	8.73	3.44	-0.859	0.10685	GPCR, rhodopsin-like superfamily (1);	0.580703	0.14149	N	0.338136	T	0.00109	0.0003	L	0.38175	1.15	0.09310	N	1	B	0.24721	0.11	B	0.27262	0.078	T	0.16660	-1.0395	10	0.18276	T	0.48	.	0.5893	0.00725	0.386:0.1155:0.1705:0.328	.	213	Q8NG75	OR5T1_HUMAN	H	213	ENSP00000323612:Y213H	ENSP00000323612:Y213H	Y	+	1	0	OR5T1	55800327	0.000000	0.05858	0.000000	0.03702	0.778000	0.44026	-1.213000	0.02991	0.063000	0.16370	0.381000	0.24937	TAC		0.418	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745		Missense_Mutation
ROM1	6094	genome.wustl.edu	37	11	62381310	62381310	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr11:62381310G>A	ENST00000278833.3	+	1	1098	c.557G>A	c.(556-558)cGt>cAt	p.R186H	EML3_ENST00000494176.2_5'Flank|EML3_ENST00000278845.4_5'Flank|ROM1_ENST00000534093.1_Intron|EML3_ENST00000531557.1_5'Flank|EML3_ENST00000529309.1_5'Flank|EML3_ENST00000394773.2_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	186					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)		p.R186H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						GTCAGCAGCCGTTACCTGGAT	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											67.0	76.0	73.0					11																	62381310		2202	4299	6501	62137886	SO:0001583	missense	6094			L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.557G>A	11.37:g.62381310G>A	ENSP00000278833:p.Arg186His	Somatic		Capture	Illumina GAIIx	PhaseIII	62137886	B2R978	Missense_Mutation	SNP	ENST00000278833.3	37	CCDS8024.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806390	0.70682	.	.	ENSG00000149489	ENST00000278833	T	0.80304	-1.36	4.89	3.01	0.34805	Tetraspanin, EC2 domain (1);	0.059654	0.64402	D	0.000005	D	0.87382	0.6163	M	0.82823	2.61	0.52099	D	0.999947	D	0.76494	0.999	D	0.64687	0.928	D	0.86337	0.1702	10	0.66056	D	0.02	-14.7368	8.2261	0.31570	0.0877:0.1591:0.7532:0.0	.	186	Q03395	ROM1_HUMAN	H	186	ENSP00000278833:R186H	ENSP00000278833:R186H	R	+	2	0	ROM1	62137886	1.000000	0.71417	0.998000	0.56505	0.600000	0.36913	7.222000	0.78025	0.653000	0.30826	0.313000	0.20887	CGT		0.612	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394929.1	NM_000327		Missense_Mutation
CLEC9A	283420	genome.wustl.edu	37	12	10206914	10206914	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr12:10206914G>C	ENST00000355819.1	+	5	749	c.136G>C	c.(136-138)Gga>Cga	p.G46R		NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	46					positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G46R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						TTTCTGCATGGGATTATTAAC	0.318																																																1	Substitution - Missense(1)	ovary(1)	12											173.0	142.0	152.0					12																	10206914		2203	4300	6503	10098181	SO:0001583	missense	283420				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.136G>C	12.37:g.10206914G>C	ENSP00000348074:p.Gly46Arg	Somatic		Capture	Illumina GAIIx	4	10098181	B0ZBM2	Missense_Mutation	SNP	ENST00000355819.1	37	CCDS8611.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050022	0.36181	.	.	ENSG00000197992	ENST00000355819	T	0.01446	4.88	3.89	3.0	0.34707	.	0.157757	0.30219	N	0.010125	T	0.06462	0.0166	M	0.64404	1.975	0.20821	N	0.999842	D	0.89917	1.0	D	0.77004	0.989	T	0.09357	-1.0678	10	0.51188	T	0.08	.	7.3063	0.26449	0.1191:0.0:0.8809:0.0	.	46	Q6UXN8	CLC9A_HUMAN	R	46	ENSP00000348074:G46R	ENSP00000348074:G46R	G	+	1	0	CLEC9A	10098181	0.180000	0.23148	0.194000	0.23346	0.485000	0.33311	1.175000	0.31944	1.210000	0.43336	0.591000	0.81541	GGA		0.318	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000399564.1	NM_207345		Missense_Mutation
GABRA5	2558	genome.wustl.edu	37	15	27128497	27128497	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr15:27128497A>T	ENST00000335625.5	+	6	1178	c.290A>T	c.(289-291)gAc>gTc	p.D97V	GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000355395.5_Missense_Mutation_p.D97V|GABRA5_ENST00000557449.1_Intron|GABRA5_ENST00000400081.3_Missense_Mutation_p.D97V	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	97					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.D97V(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TACACCATAGACGTGTTTTTC	0.592																																																1	Substitution - Missense(1)	ovary(1)	15											95.0	102.0	100.0					15																	27128497		2025	4193	6218	24679590	SO:0001583	missense	2558				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.290A>T	15.37:g.27128497A>T	ENSP00000335592:p.Asp97Val	Somatic		Capture	Illumina GAIIx	4	24679590	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	SNP	10	WashU	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378960	0.82682	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599;ENST00000554083	T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.4	5.4	0.78164	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92580	0.7643	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94614	0.7807	10	0.87932	D	0	.	14.9054	0.70715	1.0:0.0:0.0:0.0	.	97	P31644	GBRA5_HUMAN	V	97;97;65;97;97;97;65	ENSP00000335592:D97V;ENSP00000347557:D97V;ENSP00000450653:D65V;ENSP00000382953:D97V;ENSP00000450806:D97V;ENSP00000450717:D97V;ENSP00000450529:D65V	ENSP00000335592:D97V	D	+	2	0	GABRA5	24679590	1.000000	0.71417	0.458000	0.27068	0.825000	0.46686	8.992000	0.93519	2.177000	0.69029	0.459000	0.35465	GAC		0.592	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1			Missense_Mutation
ERN2	10595	genome.wustl.edu	37	16	23711932	23711932	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr16:23711932C>T	ENST00000457008.2	-	12	1335	c.1297G>A	c.(1297-1299)Ggg>Agg	p.G433R	ERN2_ENST00000256797.4_Missense_Mutation_p.G533R					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CGGCTGGCCCCCGAGTGCAGG	0.622																																																0			16											71.0	72.0	71.0					16																	23711932		2197	4300	6497	23619433	SO:0001583	missense	10595			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1297G>A	16.37:g.23711932C>T	ENSP00000413812:p.Gly433Arg	Somatic		Capture	Illumina GAIIx	4	23619433		Missense_Mutation	SNP	ENST00000457008.2	37		SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	3.067	-0.191937	0.06299	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.59906	0.23;0.27	3.9	1.4	0.22301	.	1.304430	0.04908	N	0.452624	T	0.31857	0.0810	N	0.04508	-0.205	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.001;0.002	T	0.19679	-1.0298	10	0.13853	T	0.58	.	5.4088	0.16336	0.0:0.6669:0.0:0.3331	.	433;485	E7ETG2;A5YM65	.;.	R	533;433	ENSP00000256797:G533R;ENSP00000413812:G433R	ENSP00000256797:G533R	G	-	1	0	ERN2	23619433	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.543000	0.23237	0.373000	0.24621	0.561000	0.74099	GGG		0.622	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1			Missense_Mutation
ZNF764	92595	genome.wustl.edu	37	16	30567208	30567208	+	Silent	SNP	G	G	A			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr16:30567208G>A	ENST00000252797.2	-	3	614	c.534C>T	c.(532-534)taC>taT	p.Y178Y	AC002310.13_ENST00000568114.1_Intron|ZNF764_ENST00000395091.2_Silent_p.Y177Y	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y178Y(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						TCCCGCACACGTAGCAGCCAT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	16											21.0	22.0	21.0					16																	30567208		2194	4297	6491	30474709	SO:0001819	synonymous_variant	92595			BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.534C>T	16.37:g.30567208G>A		Somatic		Capture	Illumina GAIIx	4	30474709	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Silent	SNP	ENST00000252797.2	37	CCDS10683.1	SNP	40	WashU																																																																																				0.652	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1	NM_033410		Silent
EXOC3L1	283849	genome.wustl.edu	37	16	67220960	67220960	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr16:67220960A>C	ENST00000314586.6	-	6	1362	c.1122T>G	c.(1120-1122)atT>atG	p.I374M	EXOC3L1_ENST00000562887.1_5'UTR	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	374					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)		p.I374M(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CCAGCTGCTCAATGTTCTCCA	0.557																																																2	Substitution - Missense(2)	ovary(2)	16											109.0	110.0	110.0					16																	67220960		2198	4300	6498	65778461	SO:0001583	missense	283849			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1122T>G	16.37:g.67220960A>C	ENSP00000325674:p.Ile374Met	Somatic		Capture	Illumina GAIIx	PhaseIII	65778461	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	ENST00000314586.6	37	CCDS10832.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	14.67	2.605132	0.46423	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	T;T	0.20069	3.22;2.1	4.61	-9.23	0.00672	.	0.512901	0.20508	N	0.090945	T	0.24586	0.0596	M	0.63428	1.95	0.29614	N	0.84673	D;D;D	0.63880	0.993;0.988;0.966	P;P;P	0.62298	0.878;0.9;0.787	T	0.05273	-1.0895	10	0.52906	T	0.07	-1.3945	2.8909	0.05676	0.3184:0.2351:0.3524:0.0941	.	313;313;374	F5H4W1;B7Z6U0;Q86VI1	.;.;EX3L1_HUMAN	M	374;313;318	ENSP00000325674:I374M;ENSP00000439910:I313M	ENSP00000325008:I318M	I	-	3	3	EXOC3L1	65778461	0.003000	0.15002	0.268000	0.24571	0.720000	0.41350	-1.534000	0.02212	-1.810000	0.01230	0.374000	0.22700	ATT		0.557	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516		Missense_Mutation
CARD14	79092	genome.wustl.edu	37	17	78169022	78169022	+	Silent	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr17:78169022C>A	ENST00000573882.1	+	12	1925	c.1389C>A	c.(1387-1389)tcC>tcA	p.S463S	CARD14_ENST00000344227.2_Silent_p.S463S|CARD14_ENST00000392434.2_Silent_p.S226S|CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000570421.1_Silent_p.S463S			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	463					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)	p.S463S(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GTGCCACGTCCAGCCGCGAGC	0.672																																																1	Substitution - coding silent(1)	ovary(1)	17											38.0	37.0	38.0					17																	78169022		2203	4300	6503	75783617	SO:0001819	synonymous_variant	79092			AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1389C>A	17.37:g.78169022C>A		Somatic		Capture	Illumina GAIIx	4	75783617	B8QQJ3|Q9BVB5	Silent	SNP	ENST00000573882.1	37	CCDS11768.1	SNP	21	WashU																																																																																				0.672	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1			Silent
TMED1	11018	genome.wustl.edu	37	19	10945651	10945651	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:10945651C>T	ENST00000214869.2	-	3	522	c.424G>A	c.(424-426)Gag>Aag	p.E142K	TMED1_ENST00000588289.1_5'UTR|TMED1_ENST00000591695.1_Intron|C19orf38_ENST00000592854.1_5'Flank	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	142					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E142K(1)		breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						TCCTCGGGCTCCACAGCCTCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											173.0	161.0	165.0					19																	10945651		2203	4300	6503	10806651	SO:0001583	missense	11018			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.424G>A	19.37:g.10945651C>T	ENSP00000214869:p.Glu142Lys	Somatic		Capture	Illumina GAIIx	4	10806651		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069597	0.36470	.	.	ENSG00000099203	ENST00000214869	T	0.17054	2.3	5.02	5.02	0.67125	GOLD (1);	0.101810	0.64402	D	0.000003	T	0.22666	0.0547	M	0.76838	2.35	0.80722	D	1	B	0.26708	0.157	B	0.29267	0.1	T	0.14172	-1.0482	10	0.06365	T	0.9	-20.9249	17.1231	0.86706	0.0:1.0:0.0:0.0	.	142	Q13445	TMED1_HUMAN	K	142	ENSP00000214869:E142K	ENSP00000214869:E142K	E	-	1	0	TMED1	10806651	0.997000	0.39634	0.990000	0.47175	0.987000	0.75469	2.223000	0.42936	2.337000	0.79520	0.462000	0.41574	GAG		0.557	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858		Missense_Mutation
KMT2B	9757	genome.wustl.edu	37	19	36223567	36223567	+	Silent	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:36223567G>T	ENST00000222270.7	+	28	6117	c.6117G>T	c.(6115-6117)gtG>gtT	p.V2039V	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Silent_p.V2039V	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2039					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V2041V(1)									ACTTCCCTGTGACTGTGGTGT	0.692																																																1	Substitution - coding silent(1)	ovary(1)	19											22.0	26.0	25.0					19																	36223567		2011	4151	6162	40915407	SO:0001819	synonymous_variant	9757			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.6117G>T	19.37:g.36223567G>T		Somatic		Capture	Illumina GAIIx	4	40915407	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	SNP	45	WashU																																																																																				0.692	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727		Nonsense_Mutation
DPP10	57628	genome.wustl.edu	37	2	116520158	116520158	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:116520158T>C	ENST00000410059.1	+	12	1565	c.1085T>C	c.(1084-1086)aTg>aCg	p.M362T	DPP10_ENST00000393147.2_Missense_Mutation_p.M366T|DPP10_ENST00000409163.1_Missense_Mutation_p.M312T|DPP10_ENST00000310323.8_Missense_Mutation_p.M355T	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	362						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.M355T(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						AAATATGAGATGACATCAGAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											196.0	185.0	189.0					2																	116520158		2203	4300	6503	116236628	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1085T>C	2.37:g.116520158T>C	ENSP00000386565:p.Met362Thr	Somatic		Capture	Illumina GAIIx	PhaseIII	116236628	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	4.803	0.149246	0.09185	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	4.99	4.99	0.66335	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.460210	0.25159	N	0.032697	T	0.18215	0.0437	N	0.08118	0	0.39170	D	0.962576	B;B;B;B	0.23854	0.033;0.092;0.041;0.041	B;B;B;B	0.32090	0.086;0.039;0.103;0.14	T	0.12604	-1.0541	10	0.12430	T	0.62	-22.0884	14.0462	0.64706	0.0:0.0:0.0:1.0	.	355;366;358;362	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	T	362;312;366;355;312	ENSP00000386565:M362T;ENSP00000387038:M312T;ENSP00000376855:M366T;ENSP00000309066:M355T	ENSP00000309066:M355T	M	+	2	0	DPP10	116236628	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.004000	0.49513	2.106000	0.64143	0.454000	0.30748	ATG		0.353	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868		Missense_Mutation
KCNK3	3777	genome.wustl.edu	37	2	26950943	26950943	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:26950943G>T	ENST00000302909.3	+	2	817	c.692G>T	c.(691-693)gGc>gTc	p.G231V		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	231					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)	p.G231V(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	ATCCTTACGGGCCTCACGGTC	0.652																																					GBM(80;1457 1631 27100 45946)											1	Substitution - Missense(1)	ovary(1)	2											80.0	62.0	68.0					2																	26950943		2203	4300	6503	26804447	SO:0001583	missense	3777			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.692G>T	2.37:g.26950943G>T	ENSP00000306275:p.Gly231Val	Somatic		Capture	Illumina GAIIx	4	26804447	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	37	CCDS1727.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573576	0.65765	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.61859	0.07	5.01	5.01	0.66863	Ion transport 2 (1);	0.110742	0.64402	D	0.000009	D	0.82990	0.5157	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88261	0.2923	10	0.87932	D	0	.	16.1656	0.81754	0.0:0.0:1.0:0.0	.	231	O14649	KCNK3_HUMAN	V	108;231	ENSP00000306275:G231V	ENSP00000306275:G231V	G	+	2	0	KCNK3	26804447	1.000000	0.71417	0.992000	0.48379	0.577000	0.36160	9.638000	0.98445	2.467000	0.83353	0.561000	0.74099	GGC		0.652	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179640675	179640675	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr2:179640675T>A	ENST00000591111.1	-	28	6140	c.5916A>T	c.(5914-5916)gaA>gaT	p.E1972D	TTN_ENST00000589042.1_Missense_Mutation_p.E1972D|TTN_ENST00000359218.5_Missense_Mutation_p.E1926D|TTN_ENST00000460472.2_Missense_Mutation_p.E1926D|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E1972D|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E1972D|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E1926D			Q8WZ42	TITIN_HUMAN	titin	12793					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E1972D(2)|p.E1926D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCTTTGGTTTCAGTGGTGT	0.443																																																3	Substitution - Missense(3)	ovary(3)	2											158.0	162.0	161.0					2																	179640675		2203	4300	6503	179348920	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5916A>T	2.37:g.179640675T>A	ENSP00000465570:p.Glu1972Asp	Somatic		Capture	Illumina GAIIx	4	179348920	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	64	WashU	.	.	.	.	.	.	.	.	.	.	T	8.370	0.835141	0.16820	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.63744	-0.06;0.17;0.16;0.15;0.29	5.1	3.94	0.45596	Ribonuclease H-like (1);	.	.	.	.	T	0.57873	0.2083	N	0.24115	0.695	0.21627	N	0.999612	B;B;B;B;D	0.60575	0.231;0.231;0.231;0.231;0.988	B;B;B;B;P	0.54815	0.142;0.142;0.142;0.142;0.761	T	0.48375	-0.9041	9	0.87932	D	0	.	7.3272	0.26561	0.0:0.0763:0.1448:0.7789	.	1926;1926;1926;1972;1972	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	1972;1926;1926;1926;1926;1972	ENSP00000343764:E1972D;ENSP00000434586:E1926D;ENSP00000340554:E1926D;ENSP00000352154:E1926D;ENSP00000354117:E1972D	ENSP00000340554:E1926D	E	-	3	2	TTN	179348920	0.515000	0.26210	0.997000	0.53966	0.927000	0.56198	0.359000	0.20233	0.793000	0.33875	0.496000	0.49642	GAA		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
THUMPD3	25917	genome.wustl.edu	37	3	9412893	9412893	+	Silent	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:9412893T>C	ENST00000345094.3	+	4	814	c.480T>C	c.(478-480)aaT>aaC	p.N160N	SETD5-AS1_ENST00000468186.1_RNA|THUMPD3_ENST00000515662.2_Silent_p.N160N|THUMPD3_ENST00000452837.2_Silent_p.N160N	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	160						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.N160N(1)		NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		AGATTAATAATGGACAAGAAG	0.303																																																1	Substitution - coding silent(1)	ovary(1)	3											55.0	62.0	59.0					3																	9412893		2203	4300	6503	9387893	SO:0001819	synonymous_variant	25917			AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.480T>C	3.37:g.9412893T>C		Somatic		Capture	Illumina GAIIx	4	9387893	Q9H8V6|Q9NVC1|Q9UFS3	Silent	SNP	ENST00000345094.3	37	CCDS2573.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	1.471	-0.559926	0.03967	.	.	ENSG00000134077	ENST00000441127	.	.	.	5.94	3.38	0.38709	.	.	.	.	.	T	0.56202	0.1969	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.51593	-0.8686	4	.	.	.	-10.9426	7.2937	0.26380	0.2488:0.0:0.1292:0.6219	.	.	.	.	T	17	.	.	M	+	2	0	THUMPD3	9387893	0.111000	0.22076	0.915000	0.36163	0.248000	0.25809	0.252000	0.18278	1.037000	0.40024	0.459000	0.35465	ATG		0.303	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453		Silent
TRA2B	6434	genome.wustl.edu	37	3	185643401	185643401	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr3:185643401T>C	ENST00000453386.2	-	3	459	c.184A>G	c.(184-186)Aga>Gga	p.R62G	TRA2B_ENST00000382191.4_5'UTR|TRA2B_ENST00000471134.1_5'Flank	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	62	Arg/Ser-rich (RS1 domain).				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R62G(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						CGGGAGCTTCTTCTGGATCTA	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											91.0	90.0	90.0					3																	185643401		2203	4300	6503	187126095	SO:0001583	missense	6434			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.184A>G	3.37:g.185643401T>C	ENSP00000416959:p.Arg62Gly	Somatic		Capture	Illumina GAIIx	PhaseIII	187126095	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	ENST00000453386.2	37	CCDS33905.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	17.61	3.433488	0.62955	.	.	ENSG00000136527	ENST00000453386	T	0.21932	1.98	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.27454	0.0674	M	0.69823	2.125	0.80722	D	1	B;B	0.32409	0.37;0.37	B;B	0.30105	0.111;0.111	T	0.02444	-1.1158	10	0.49607	T	0.09	-7.0252	15.8048	0.78491	0.0:0.0:0.0:1.0	.	62;62	B2RDQ3;P62995	.;TRA2B_HUMAN	G	62	ENSP00000416959:R62G	ENSP00000416959:R62G	R	-	1	2	TRA2B	187126095	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.514000	0.67043	2.371000	0.80710	0.533000	0.62120	AGA		0.453	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344984.1	NM_004593		Missense_Mutation
CTBP1	1487	genome.wustl.edu	37	4	1244461	1244461	+	5'Flank	SNP	A	A	T			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:1244461A>T	ENST00000290921.6	-	0	0				CTBP1-AS2_ENST00000507044.1_RNA|CTBP1_ENST00000382952.3_5'Flank|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000581398.1_RNA	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R34W(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GGCCGGGTGCAGGGACGTACC	0.622																																																1	Substitution - Missense(1)	ovary(1)	4											77.0	77.0	77.0					4																	1244461		2203	4300	6503	1234461	SO:0001631	upstream_gene_variant	92070			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244461A>T	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	1234461	Q4W5N3|Q7Z2Q5	Missense_Mutation	SNP	ENST00000290921.6	37	CCDS3348.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	6.101	0.386927	0.11581	.	.	ENSG00000196810	ENST00000357591	.	.	.	1.41	1.41	0.22369	.	.	.	.	.	T	0.58308	0.2113	.	.	.	0.24973	N	0.991659	D	0.76494	0.999	D	0.65443	0.935	T	0.63866	-0.6540	6	0.87932	D	0	.	4.9462	0.13991	1.0:0.0:0.0:0.0	.	34	Q0VAR9	CD042_HUMAN	W	34	.	ENSP00000350204:R34W	R	+	1	2	C4orf42	1234461	0.000000	0.05858	0.007000	0.13788	0.040000	0.13550	-0.994000	0.03716	0.906000	0.36621	0.379000	0.24179	AGG		0.622	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328		Missense_Mutation
UCP1	7350	genome.wustl.edu	37	4	141481109	141481109	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr4:141481109A>G	ENST00000262999.3	-	6	940	c.865T>C	c.(865-867)Ttt>Ctt	p.F289L		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	289	Purine nucleotide binding. {ECO:0000250}.				brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)	p.F289L(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					AGTTGTTCAAAGCACACAAAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											187.0	150.0	162.0					4																	141481109		2203	4300	6503	141700559	SO:0001583	missense	7350			X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.865T>C	4.37:g.141481109A>G	ENSP00000262999:p.Phe289Leu	Somatic		Capture	Illumina GAIIx	PhaseIII	141700559	Q13218|Q4KMZ3|Q68G66	Missense_Mutation	SNP	ENST00000262999.3	37	CCDS3753.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474404	0.63737	.	.	ENSG00000109424	ENST00000262999	T	0.79352	-1.26	5.08	5.08	0.68730	Mitochondrial carrier domain (2);	0.188569	0.47455	D	0.000240	T	0.65291	0.2677	L	0.31752	0.955	0.46131	D	0.998882	P;P	0.47484	0.896;0.896	B;B	0.40602	0.334;0.334	T	0.63607	-0.6599	10	0.18710	T	0.47	.	13.1008	0.59218	1.0:0.0:0.0:0.0	.	288;289	Q4KMT7;P25874	.;UCP1_HUMAN	L	289	ENSP00000262999:F289L	ENSP00000262999:F289L	F	-	1	0	UCP1	141700559	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.838000	0.92115	2.041000	0.60428	0.482000	0.46254	TTT		0.393	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1			Missense_Mutation
IQGAP2	10788	genome.wustl.edu	37	5	75932981	75932981	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr5:75932981C>A	ENST00000274364.6	+	16	2200	c.1903C>A	c.(1903-1905)Ctc>Atc	p.L635I	IQGAP2_ENST00000396234.3_Missense_Mutation_p.L188I|IQGAP2_ENST00000379730.3_Missense_Mutation_p.L194I|IQGAP2_ENST00000502745.1_Missense_Mutation_p.L188I	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	635					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.L635I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AGAATCATGGCTCACAGGAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	5											104.0	102.0	103.0					5																	75932981		2203	4300	6503	75968737	SO:0001583	missense	10788			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1903C>A	5.37:g.75932981C>A	ENSP00000274364:p.Leu635Ile	Somatic		Capture	Illumina GAIIx	4	75968737	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093154	0.56075	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000514350;ENST00000505766;ENST00000514001;ENST00000396234;ENST00000545384;ENST00000502745	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.72	4.84	0.62591	.	0.066410	0.64402	N	0.000013	T	0.65831	0.2729	M	0.80982	2.52	0.45806	D	0.998688	D;D;D;D	0.64830	0.994;0.989;0.994;0.989	D;P;D;P	0.63877	0.919;0.831;0.919;0.831	T	0.66806	-0.5830	10	0.36615	T	0.2	-9.3943	12.0404	0.53450	0.1727:0.8273:0.0:0.0	.	194;585;188;635	F5H7S7;E7EWC2;Q13576-2;Q13576	.;.;.;IQGA2_HUMAN	I	635;194;608;585;188;188;188;188	ENSP00000274364:L635I;ENSP00000442313:L194I;ENSP00000423672:L608I;ENSP00000421097:L585I;ENSP00000422661:L188I;ENSP00000379535:L188I;ENSP00000426027:L188I	ENSP00000274364:L635I	L	+	1	0	IQGAP2	75968737	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	0.785000	0.26830	1.401000	0.46761	0.585000	0.79938	CTC		0.363	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633		Missense_Mutation
PIP	5304	genome.wustl.edu	37	7	142836252	142836252	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:142836252A>G	ENST00000291009.3	+	3	326	c.286A>G	c.(286-288)Aaa>Gaa	p.K96E		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	96					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)	p.K96E(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		CGACAATCCAAAAACCTTCTA	0.438																																																1	Substitution - Missense(1)	ovary(1)	7											118.0	106.0	110.0					7																	142836252		2203	4299	6502	142546374	SO:0001583	missense	5304				CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.286A>G	7.37:g.142836252A>G	ENSP00000291009:p.Lys96Glu	Somatic		Capture	Illumina GAIIx	PhaseIII	142546374	A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	ENST00000291009.3	37	CCDS34768.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	11.93	1.784328	0.31593	.	.	ENSG00000159763	ENST00000291009	T	0.15834	2.39	4.84	-0.831	0.10789	.	0.842865	0.10308	N	0.690317	T	0.06826	0.0174	N	0.08118	0	0.09310	N	1	P	0.36222	0.544	B	0.33690	0.168	T	0.30650	-0.9971	10	0.38643	T	0.18	.	4.1613	0.10285	0.4605:0.3495:0.19:0.0	.	96	P12273	PIP_HUMAN	E	96	ENSP00000291009:K96E	ENSP00000291009:K96E	K	+	1	0	PIP	142546374	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	0.501000	0.22578	0.058000	0.16222	0.528000	0.53228	AAA		0.438	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327089.1	NM_002652		Missense_Mutation
CCDC129	223075	genome.wustl.edu	37	7	31617984	31617984	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:31617984C>G	ENST00000407970.3	+	8	1144	c.1106C>G	c.(1105-1107)aCt>aGt	p.T369S	CCDC129_ENST00000451887.2_Missense_Mutation_p.T395S|CCDC129_ENST00000409210.1_Missense_Mutation_p.T277S|CCDC129_ENST00000319386.3_Intron	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	369										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TTATTTCAGACTAACAAGCTC	0.517																																																0			7											57.0	55.0	56.0					7																	31617984		1973	4155	6128	31584509	SO:0001583	missense	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1106C>G	7.37:g.31617984C>G	ENSP00000384416:p.Thr369Ser	Somatic		Capture	Illumina GAIIx	4	31584509	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390821	0.25118	.	.	ENSG00000180347	ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T	0.20332	2.33;2.32;2.08	5.61	1.59	0.23543	.	.	.	.	.	T	0.14356	0.0347	L	0.48362	1.52	0.09310	N	1	B;B;B	0.32753	0.383;0.176;0.176	B;B;B	0.26094	0.066;0.066;0.066	T	0.22103	-1.0226	8	.	.	.	-0.4085	3.932	0.09290	0.1383:0.6047:0.1339:0.1231	.	395;379;369	F5H3V5;F5H2J8;Q6ZRS4	.;.;CC129_HUMAN	S	369;395;379;277	ENSP00000384416:T369S;ENSP00000395835:T395S;ENSP00000387214:T277S	.	T	+	2	0	CCDC129	31584509	0.001000	0.12720	0.001000	0.08648	0.069000	0.16628	0.297000	0.19101	0.071000	0.16664	0.655000	0.94253	ACT		0.517	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300		Missense_Mutation
POLD2	5425	genome.wustl.edu	37	7	44155738	44155738	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:44155738T>C	ENST00000406581.2	-	9	1644	c.995A>G	c.(994-996)tAc>tGc	p.Y332C	POLD2_ENST00000223361.3_Missense_Mutation_p.Y332C|POLD2_ENST00000452185.1_Missense_Mutation_p.Y332C	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	332					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.Y332C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						GGTGGCCTGGTAGGGGTTGGT	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											58.0	61.0	60.0					7																	44155738		2203	4300	6503	44122263	SO:0001583	missense	5425				CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.995A>G	7.37:g.44155738T>C	ENSP00000386105:p.Tyr332Cys	Somatic		Capture	Illumina GAIIx	4	44122263	A4D2J4|B2R5S4	Missense_Mutation	SNP	ENST00000406581.2	37	CCDS5477.1	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259244	0.80246	.	.	ENSG00000106628	ENST00000406581;ENST00000223361;ENST00000452185;ENST00000436400;ENST00000436844	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.91	5.91	0.95273	DNA polymerase alpha/epsilon, subunit B (1);	0.129140	0.53938	D	0.000048	T	0.57475	0.2056	M	0.79011	2.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.974	T	0.59021	-0.7532	10	0.48119	T	0.1	-17.5018	16.0171	0.80450	0.0:0.0:0.0:1.0	.	332;332	P49005;F8W8R3	DPOD2_HUMAN;.	C	332;332;332;51;250	ENSP00000386105:Y332C;ENSP00000223361:Y332C;ENSP00000395231:Y332C;ENSP00000399447:Y51C;ENSP00000416203:Y250C	ENSP00000223361:Y332C	Y	-	2	0	POLD2	44122263	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.609000	0.54117	2.269000	0.75478	0.533000	0.62120	TAC		0.612	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218		Missense_Mutation
CYP3A7	1551	genome.wustl.edu	37	7	99314835	99314835	+	Silent	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:99314835C>T	ENST00000336374.2	-	6	488	c.486G>A	c.(484-486)cgG>cgA	p.R162R		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	162					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.R162R(1)		autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	TCTCTGCTTCCCGCCTCAGAT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	7											158.0	141.0	147.0					7																	99314835		2203	4300	6503	99152771	SO:0001819	synonymous_variant	1551			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.486G>A	7.37:g.99314835C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	99152771	A4D288|Q9H241	Silent	SNP	ENST00000336374.2	37	CCDS5673.1	SNP	22	WashU																																																																																				0.502	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1			Silent
SMARCD3	6604	genome.wustl.edu	37	7	150938634	150938634	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr7:150938634T>A	ENST00000262188.8	-	8	1293	c.883A>T	c.(883-885)Agg>Tgg	p.R295W	SMARCD3_ENST00000356800.2_Missense_Mutation_p.R282W|SMARCD3_ENST00000477169.1_5'Flank|SMARCD3_ENST00000392811.2_Missense_Mutation_p.R282W|RP4-548D19.3_ENST00000607902.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	295	SWIB.				cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R282W(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCTGCAGCCTGTTGGTCTTC	0.582																																																1	Substitution - Missense(1)	ovary(1)	7											47.0	41.0	43.0					7																	150938634		2203	4300	6503	150569567	SO:0001583	missense	6604			U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.883A>T	7.37:g.150938634T>A	ENSP00000262188:p.Arg295Trp	Somatic		Capture	Illumina GAIIx	PhaseIII	150569567	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	ENST00000262188.8	37	CCDS34780.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806936	0.70797	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.45668	0.89;0.89;0.89	5.48	3.17	0.36434	SWIB domain (1);SWIB/MDM2 domain (2);	0.045150	0.85682	D	0.000000	T	0.52980	0.1768	L	0.47190	1.495	0.40528	D	0.980903	D;D;D	0.76494	0.999;0.969;0.965	D;P;P	0.67900	0.954;0.783;0.838	T	0.56153	-0.8026	10	0.87932	D	0	-23.7279	10.9532	0.47343	0.0:0.0:0.355:0.645	.	295;282;295	B7Z4U8;Q6STE5-2;Q6STE5	.;.;SMRD3_HUMAN	W	295;282;282;247	ENSP00000262188:R295W;ENSP00000376558:R282W;ENSP00000349254:R282W	ENSP00000262188:R295W	R	-	1	2	SMARCD3	150569567	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.783000	0.38664	0.899000	0.36444	0.533000	0.62120	AGG		0.582	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801		Missense_Mutation
CDK5RAP2	55755	genome.wustl.edu	37	9	123234065	123234065	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr9:123234065T>A	ENST00000349780.4	-	16	1998	c.1819A>T	c.(1819-1821)Acc>Tcc	p.T607S	CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.T607S|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.T607S|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.T607S	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	607					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)	p.T607S(1)		breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						tcctccaaggtcttccgcaaa	0.463																																																1	Substitution - Missense(1)	ovary(1)	9											116.0	108.0	110.0					9																	123234065		2203	4300	6503	122273886	SO:0001583	missense	55755			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.1819A>T	9.37:g.123234065T>A	ENSP00000343818:p.Thr607Ser	Somatic		Capture	Illumina GAIIx	4	122273886	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	37	CCDS6823.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	13.15	2.151618	0.38021	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000345313	T;T;T;T;T	0.17528	3.97;3.86;3.96;3.87;2.27	5.32	1.22	0.21188	.	0.707951	0.13842	N	0.358936	T	0.09069	0.0224	L	0.27053	0.805	0.19775	N	0.999952	B;B;P;B	0.34615	0.077;0.047;0.459;0.028	B;B;B;B	0.33254	0.045;0.033;0.16;0.015	T	0.32613	-0.9900	10	0.09084	T	0.74	.	6.7888	0.23687	0.0:0.4632:0.0:0.5368	.	408;607;607;607	Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8	.;.;.;CK5P2_HUMAN	S	607;607;607;607;33;609	ENSP00000354065:T607S;ENSP00000352258:T607S;ENSP00000343818:T607S;ENSP00000353317:T607S;ENSP00000400395:T33S	ENSP00000341695:T609S	T	-	1	0	CDK5RAP2	122273886	0.644000	0.27277	0.674000	0.29902	0.558000	0.35554	0.496000	0.22499	0.291000	0.22468	0.533000	0.62120	ACC		0.463	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249		Missense_Mutation
KLHL15	80311	genome.wustl.edu	37	X	24006144	24006144	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:24006144C>T	ENST00000328046.8	-	4	1964	c.1709G>A	c.(1708-1710)tGg>tAg	p.W570*		NM_030624.2	NP_085127.2	Q96M94	KLH15_HUMAN	kelch-like family member 15	570					protein ubiquitination (GO:0016567)			p.W570*(1)		autonomic_ganglia(1)|breast(1)|endometrium(8)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	22						ATCTTCCTTCCACTTGTTTTC	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	X											153.0	127.0	136.0					X																	24006144		2203	4300	6503	23916065	SO:0001587	stop_gained	80311			AB051464	CCDS35217.1	Xp22.1-p21	2013-01-30	2013-01-30		ENSG00000174010	ENSG00000174010		"""Kelch-like"", ""BTB/POZ domain containing"""	29347	protein-coding gene	gene with protein product			"""kelch-like 15 (Drosophila)"""			11214970, 14702039	Standard	NM_030624		Approved	KIAA1677	uc004dba.4	Q96M94	OTTHUMG00000021261	ENST00000328046.8:c.1709G>A	X.37:g.24006144C>T	ENSP00000332791:p.Trp570*	Somatic		Capture	Illumina GAIIx	4	23916065	Q32MN3|Q8NDA3|Q96BM6|Q9C0I6	Nonsense_Mutation	SNP	ENST00000328046.8	37	CCDS35217.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	39	7.551050	0.98352	.	.	ENSG00000174010	ENST00000328046	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2359	0.93858	0.0:1.0:0.0:0.0	.	.	.	.	X	570	.	ENSP00000332791:W570X	W	-	2	0	KLHL15	23916065	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.494000	0.84150	0.506000	0.49869	TGG		0.463	KLHL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056078.1	XM_040383		Nonsense_Mutation
HTATSF1	27336	genome.wustl.edu	37	X	135579851	135579851	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:135579851G>C	ENST00000218364.4	+	1	182	c.8G>C	c.(7-9)gGc>gCc	p.G3A	HTATSF1_ENST00000535601.1_Missense_Mutation_p.G3A	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	3					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G3A(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AACATGAGCGGCACCAACTTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											143.0	132.0	136.0					X																	135579851		2203	4300	6503	135407517	SO:0001583	missense	27336			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.8G>C	X.37:g.135579851G>C	ENSP00000218364:p.Gly3Ala	Somatic		Capture	Illumina GAIIx	4	135407517	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	6.683	0.494647	0.12702	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000425695;ENST00000218364;ENST00000415377	T;T	0.27890	1.64;1.64	4.62	1.71	0.24356	.	0.320649	0.36066	N	0.002810	T	0.20536	0.0494	L	0.45581	1.43	0.21675	N	0.999595	B	0.30406	0.278	B	0.27887	0.084	T	0.19451	-1.0305	10	0.54805	T	0.06	-0.3891	2.3103	0.04185	0.1113:0.189:0.5014:0.1983	.	3	O43719	HTSF1_HUMAN	A	3	ENSP00000442699:G3A;ENSP00000218364:G3A	ENSP00000218364:G3A	G	+	2	0	HTATSF1	135407517	0.979000	0.34478	0.407000	0.26434	0.155000	0.21991	1.992000	0.40737	0.039000	0.15632	0.292000	0.19580	GGC		0.547	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500		Missense_Mutation
UBR4	23352	genome.wustl.edu	37	1	19443907	19443907	+	Splice_Site	SNP	T	T	A			TCGA-13-0885-01	TCGA-13-0885-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr1:19443907T>A	ENST00000375254.3	-	73	10658	c.10631A>T	c.(10630-10632)tAt>tTt	p.Y3544F	UBR4_ENST00000375218.3_5'UTR|UBR4_ENST00000375217.2_Splice_Site_p.Y3537F|UBR4_ENST00000375226.2_Splice_Site_p.Y3520F|UBR4_ENST00000375267.2_Splice_Site_p.Y3544F	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3544					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y3544F(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAGCTTGATATACTAAATACA	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											100.0	87.0	92.0					1																	19443907		2203	4300	6503	19316494	SO:0001630	splice_region_variant	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.10630-1A>T	1.37:g.19443907T>A		Somatic		Capture	Illumina GAIIx	PhaseIII	19316494	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	16.18	3.049773	0.55218	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.22134	1.97;1.97;1.98;1.98	5.21	5.21	0.72293	.	0.054171	0.64402	D	0.000001	T	0.10680	0.0261	N	0.08118	0	0.80722	D	1	B	0.28055	0.199	B	0.23419	0.046	T	0.21143	-1.0254	10	0.13470	T	0.59	.	14.2023	0.65712	0.0:0.0:0.0:1.0	.	3544	Q5T4S7	UBR4_HUMAN	F	3544;3544;3537;3520	ENSP00000364403:Y3544F;ENSP00000364416:Y3544F;ENSP00000364365:Y3537F;ENSP00000364374:Y3520F	ENSP00000364365:Y3537F	Y	-	2	0	UBR4	19316494	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.655000	0.83696	2.086000	0.62901	0.533000	0.62120	TAT		0.418	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	Missense_Mutation	Missense_Mutation
DHX34	9704	genome.wustl.edu	37	19	47856814	47856814	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0885-01	TCGA-13-0885-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr19:47856814A>C	ENST00000328771.4	+	2	876	c.527A>C	c.(526-528)aAg>aCg	p.K176T		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	176	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.K176T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CAGACGCTGAAGGAGCACCAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											37.0	41.0	40.0					19																	47856814		2203	4300	6503	52548654	SO:0001583	missense	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.527A>C	19.37:g.47856814A>C	ENSP00000331907:p.Lys176Thr	Somatic		Capture	Illumina GAIIx	PhaseIII	52548654	B4DMY8	Missense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	6.687	0.495387	0.12762	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.06218	3.33	5.26	-2.26	0.06867	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.845655	0.09965	N	0.732897	T	0.07279	0.0184	L	0.58810	1.83	0.09310	N	1	P;P	0.37781	0.601;0.608	B;B	0.39876	0.312;0.227	T	0.34254	-0.9836	10	0.23302	T	0.38	-1.208	6.7269	0.23361	0.3623:0.2443:0.3934:0.0	.	176;176	Q14147;B4E3G3	DHX34_HUMAN;.	T	176	ENSP00000331907:K176T	ENSP00000257252:K176T	K	+	2	0	DHX34	52548654	0.000000	0.05858	0.039000	0.18376	0.104000	0.19210	-0.126000	0.10563	-0.594000	0.05836	-0.388000	0.06559	AAG		0.642	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681		Missense_Mutation
USP25	29761	genome.wustl.edu	37	21	17242434	17242434	+	Silent	SNP	C	C	G			TCGA-13-0885-01	TCGA-13-0885-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chr21:17242434C>G	ENST00000285679.6	+	21	3012	c.2643C>G	c.(2641-2643)ctC>ctG	p.L881L	USP25_ENST00000351097.5_Silent_p.L276L|USP25_ENST00000400183.2_Silent_p.L951L|USP25_ENST00000285681.2_Silent_p.L913L	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	881					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.L881L(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		CTATGTATCTCATAATTGGGC	0.323																																																1	Substitution - coding silent(1)	ovary(1)	21											86.0	98.0	94.0					21																	17242434		2203	4295	6498	16164305	SO:0001819	synonymous_variant	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2643C>G	21.37:g.17242434C>G		Somatic		Capture	Illumina GAIIx	PhaseIII	16164305	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	8.799	0.932457	0.18131	.	.	ENSG00000155313	ENST00000449491	.	.	.	5.86	0.822	0.18806	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4879	0.22099	0.0:0.5328:0.1154:0.3517	.	.	.	.	X	180	.	.	S	+	2	0	USP25	16164305	0.997000	0.39634	0.995000	0.50966	0.994000	0.84299	0.441000	0.21611	-0.116000	0.11893	0.591000	0.81541	TCA		0.323	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			Silent
WNK3	65267	genome.wustl.edu	37	X	54319581	54319581	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0885-01	TCGA-13-0885-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0885-01	TCGA-13-0885-10	g.chrX:54319581G>C	ENST00000375159.2	-	8	1872	c.1873C>G	c.(1873-1875)Cag>Gag	p.Q625E	WNK3_ENST00000354646.2_Missense_Mutation_p.Q625E|WNK3_ENST00000375169.3_Missense_Mutation_p.Q625E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	625					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q625E(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GAAACTTGCTGGTAATGTCCT	0.348																																																1	Substitution - Missense(1)	ovary(1)	X											58.0	50.0	53.0					X																	54319581		2202	4299	6501	54336306	SO:0001583	missense	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1873C>G	X.37:g.54319581G>C	ENSP00000364301:p.Gln625Glu	Somatic		Capture	Illumina GAIIx	PhaseIII	54336306	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	CCDS14357.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302647	0.60195	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.49139	0.79;0.79;0.79	5.81	4.95	0.65309	.	0.308515	0.24705	N	0.036266	T	0.46347	0.1388	L	0.32530	0.975	0.30303	N	0.789237	P;D	0.61697	0.802;0.99	B;P	0.52909	0.33;0.713	T	0.43048	-0.9415	10	0.21014	T	0.42	0.8651	12.6775	0.56903	0.0825:0.0:0.9175:0.0	.	625;625	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	E	625	ENSP00000364312:Q625E;ENSP00000346667:Q625E;ENSP00000364301:Q625E	ENSP00000346667:Q625E	Q	-	1	0	WNK3	54336306	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	2.628000	0.46477	1.212000	0.43366	0.594000	0.82650	CAG		0.348	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		Missense_Mutation
