#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
EFNA4	1945	broad.mit.edu	37	1	155041419	155041419	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0899-01	TCGA-13-0899-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr1:155041419T>C	ENST00000368409.3	+	4	653	c.560T>C	c.(559-561)tTg>tCg	p.L187S	EFNA4_ENST00000359751.4_Intron|EFNA3_ENST00000556931.1_Intron|EFNA3_ENST00000505139.1_Intron|EFNA4_ENST00000427683.2_Intron	NM_005227.2	NP_005218.1	P52798	EFNA4_HUMAN	ephrin-A4	187					axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)	p.L187S(1)		breast(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CTCTGTCTCTTGCTATTACTG	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	115.0	114.0					1																	155041419		2203	4300	6503	153308043	SO:0001583	missense	1945			AJ006352	CCDS1089.1, CCDS41407.1, CCDS44237.1	1q21-q22	2011-03-09			ENSG00000243364	ENSG00000243364		"""Ephrins"""	3224	protein-coding gene	gene with protein product		601380		EPLG4		8660976	Standard	NM_182690		Approved	LERK4		P52798	OTTHUMG00000035309	ENST00000368409.3:c.560T>C	1.37:g.155041419T>C	ENSP00000357394:p.Leu187Ser	Somatic		x	x	x	153308043	C9JHJ8|G3XAK2|O95457|Q5SR71|Q6FI57	Missense_Mutation	SNP	ENST00000368409.3	37	CCDS1089.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	11.13	1.547587	0.27652	.	.	ENSG00000243364	ENST00000368409	D	0.93659	-3.26	4.67	4.67	0.58626	.	0.000000	0.32055	N	0.006658	D	0.89451	0.6719	N	0.19112	0.55	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.86992	0.2111	10	0.16420	T	0.52	.	10.6851	0.45837	0.0:0.0:0.0:1.0	.	187	P52798	EFNA4_HUMAN	S	187	ENSP00000357394:L187S	ENSP00000357394:L187S	L	+	2	0	EFNA4	153308043	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	3.318000	0.51975	2.097000	0.63578	0.533000	0.62120	TTG		0.587	EFNA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000085421.2	NM_005227		Missense_Mutation
DUSP27	92235	broad.mit.edu	37	1	167095770	167095770	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr1:167095770G>A	ENST00000361200.2	+	6	1568	c.1402G>A	c.(1402-1404)Gca>Aca	p.A468T	DUSP27_ENST00000271385.5_Missense_Mutation_p.A468T|DUSP27_ENST00000443333.1_Missense_Mutation_p.A468T|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	468					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A468T(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GAGGCGCCGCGCAGACTCGAT	0.652																																																1	Substitution - Missense(1)	ovary(1)	1											22.0	22.0	22.0					1																	167095770		2202	4300	6502	165362394	SO:0001583	missense	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1402G>A	1.37:g.167095770G>A	ENSP00000354483:p.Ala468Thr	Somatic		x	x	x	165362394	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	7.926	0.739646	0.15642	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03004	4.08;4.08;4.08	5.02	1.26	0.21427	.	0.382941	0.24476	N	0.038182	T	0.00580	0.0019	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46456	-0.9190	10	0.26408	T	0.33	-1.9731	5.9806	0.19405	0.275:0.0:0.3482:0.3768	.	468	Q5VZP5	DUS27_HUMAN	T	468	ENSP00000354483:A468T;ENSP00000271385:A468T;ENSP00000404874:A468T	ENSP00000271385:A468T	A	+	1	0	DUSP27	165362394	0.193000	0.23313	0.639000	0.29394	0.198000	0.23893	0.345000	0.19979	-0.055000	0.13244	-1.215000	0.01618	GCA		0.652	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426		Missense_Mutation
NLRP3	114548	broad.mit.edu	37	1	247588162	247588162	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr1:247588162G>A	ENST00000336119.3	+	3	2163	c.1417G>A	c.(1417-1419)Gct>Act	p.A473T	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Missense_Mutation_p.A473T|NLRP3_ENST00000391828.3_Missense_Mutation_p.A473T|NLRP3_ENST00000366496.2_Missense_Mutation_p.A473T|NLRP3_ENST00000348069.2_Missense_Mutation_p.A473T|NLRP3_ENST00000391827.2_Missense_Mutation_p.A473T	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	473	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.A473T(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CTGCTCTTTGGCTGCAGATGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											27.0	28.0	27.0					1																	247588162		2203	4300	6503	245654785	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1417G>A	1.37:g.247588162G>A	ENSP00000337383:p.Ala473Thr	Unknown		x	x	x	245654785	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234809	0.58886	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	4.17	4.17	0.49024	NACHT nucleoside triphosphatase (1);	0.000000	0.52532	D	0.000063	D	0.91994	0.7464	M	0.91038	3.17	0.47341	D	0.999396	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;0.995	D;D;D;D;D	0.97110	0.995;0.998;1.0;0.993;0.95	D	0.92958	0.6386	10	0.87932	D	0	.	12.2773	0.54744	0.0:0.0:1.0:0.0	.	473;473;473;473;473	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	T	473	ENSP00000375704:A473T;ENSP00000355453:A473T;ENSP00000337383:A473T;ENSP00000294752:A473T;ENSP00000355452:A473T;ENSP00000375703:A473T	ENSP00000337383:A473T	A	+	1	0	NLRP3	245654785	1.000000	0.71417	0.905000	0.35620	0.116000	0.19942	2.580000	0.46068	2.612000	0.88384	0.655000	0.94253	GCT		0.582	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895		Missense_Mutation
UPF2	26019	broad.mit.edu	37	10	12001237	12001237	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr10:12001237C>T	ENST00000356352.2	-	11	2776	c.2303G>A	c.(2302-2304)cGt>cAt	p.R768H	UPF2_ENST00000397053.2_Missense_Mutation_p.R768H|UPF2_ENST00000357604.5_Missense_Mutation_p.R768H			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	768	Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)	p.R768H(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				GAGAGGAGGACGTTTCTTTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	10											199.0	168.0	178.0					10																	12001237		2203	4300	6503	12041243	SO:0001583	missense	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2303G>A	10.37:g.12001237C>T	ENSP00000348708:p.Arg768His	Somatic		x	x	x	12041243	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	37	CCDS7086.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.172123	0.94807	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.54279	0.58;0.58;0.58	5.12	5.12	0.69794	Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.64402	D	0.000001	T	0.77432	0.4129	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.80482	-0.1363	10	0.46703	T	0.11	.	18.5419	0.91031	0.0:1.0:0.0:0.0	.	768	Q9HAU5	RENT2_HUMAN	H	768	ENSP00000348708:R768H;ENSP00000350221:R768H;ENSP00000380244:R768H	ENSP00000348708:R768H	R	-	2	0	UPF2	12041243	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	5.725000	0.68507	2.391000	0.81399	0.585000	0.79938	CGT		0.408	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1			Missense_Mutation
TET1	80312	broad.mit.edu	37	10	70451227	70451227	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr10:70451227G>A	ENST00000373644.4	+	12	6276	c.6067G>A	c.(6067-6069)Gcc>Acc	p.A2023T		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	2023					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.A2023T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GATTGAGTGTGCCCGGCGAGA	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											104.0	97.0	100.0					10																	70451227		2203	4300	6503	70121233	SO:0001583	missense	80312			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.6067G>A	10.37:g.70451227G>A	ENSP00000362748:p.Ala2023Thr	Somatic		x	x	x	70121233	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960196	0.92791	.	.	ENSG00000138336	ENST00000373644	T	0.21031	2.03	5.6	5.6	0.85130	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.103999	0.64402	D	0.000003	T	0.51432	0.1674	M	0.77313	2.365	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.52215	-0.8605	10	0.87932	D	0	.	19.9855	0.97347	0.0:0.0:1.0:0.0	.	2023	Q8NFU7	TET1_HUMAN	T	2023	ENSP00000362748:A2023T	ENSP00000362748:A2023T	A	+	1	0	TET1	70121233	1.000000	0.71417	0.985000	0.45067	0.468000	0.32798	9.378000	0.97191	2.806000	0.96561	0.655000	0.94253	GCC		0.507	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625		Missense_Mutation
CCAR1	55749	broad.mit.edu	37	10	70547778	70547778	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr10:70547778C>T	ENST00000265872.6	+	22	3094	c.2975C>T	c.(2974-2976)tCt>tTt	p.S992F	CCAR1_ENST00000543719.1_Missense_Mutation_p.S977F|CCAR1_ENST00000535016.1_Missense_Mutation_p.S977F	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	992					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)	p.S992F(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CATGAAGAGTCTGAGTCATTG	0.308																																																1	Substitution - Missense(1)	ovary(1)	10											73.0	76.0	75.0					10																	70547778		2203	4300	6503	70217784	SO:0001583	missense	55749			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.2975C>T	10.37:g.70547778C>T	ENSP00000265872:p.Ser992Phe	Unknown		x	x	x	70217784	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	ENST00000265872.6	37	CCDS7282.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181481	0.57800	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539	T;T;T;T	0.00363	7.83;7.83;7.83;7.83	5.41	3.5	0.40072	.	0.273216	0.38005	N	0.001844	T	0.00412	0.0013	L	0.43152	1.355	0.35413	D	0.792579	D	0.61080	0.989	P	0.56700	0.804	T	0.79524	-0.1768	10	0.59425	D	0.04	-2.9755	10.0991	0.42493	0.0:0.6686:0.2609:0.0705	.	992	Q8IX12	CCAR1_HUMAN	F	992;977;977;977	ENSP00000265872:S992F;ENSP00000441820:S977F;ENSP00000445254:S977F;ENSP00000439252:S977F	ENSP00000265872:S992F	S	+	2	0	CCAR1	70217784	0.005000	0.15991	0.844000	0.33320	0.965000	0.64279	1.286000	0.33273	0.599000	0.29845	0.563000	0.77884	TCT		0.308	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237		Missense_Mutation
ZNF511	118472	broad.mit.edu	37	10	135123388	135123388	+	Silent	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr10:135123388C>T	ENST00000359035.3	+	3	339	c.336C>T	c.(334-336)tgC>tgT	p.C112C	ZNF511_ENST00000463816.2_Intron|TUBGCP2_ENST00000368563.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank|ZNF511_ENST00000361518.5_Silent_p.C112C|ZNF511_ENST00000368554.4_Silent_p.C47C|TUBGCP2_ENST00000417178.2_5'Flank			Q8NB15	ZN511_HUMAN	zinc finger protein 511	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C112C(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		GCTCCTTTTGCAAGCGGGCCT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	10											100.0	71.0	81.0					10																	135123388		2203	4300	6503	134973378	SO:0001819	synonymous_variant	118472			AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.336C>T	10.37:g.135123388C>T		Unknown		x	x	x	134973378	A8K8L5|Q8WUP1|Q96BV2	Silent	SNP	ENST00000359035.3	37		SNP	25	Broad																																																																																				0.612	ZNF511-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051143.1	NM_145806		Silent
SHISA2	387914	broad.mit.edu	37	13	26620663	26620663	+	Silent	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr13:26620663C>T	ENST00000319420.3	-	2	931	c.876G>A	c.(874-876)gcG>gcA	p.A292A		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	292					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A292A(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						ATACAGTCACCGCTGGGTACA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	13											83.0	76.0	79.0					13																	26620663		2203	4300	6503	25518663	SO:0001819	synonymous_variant	387914				CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.876G>A	13.37:g.26620663C>T		Unknown		x	x	x	25518663	B9EH70|Q5W0G8	Silent	SNP	ENST00000319420.3	37	CCDS31951.1	SNP	23	Broad																																																																																				0.557	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538		Silent
CGNL1	84952	broad.mit.edu	37	15	57730517	57730517	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr15:57730517C>T	ENST00000281282.5	+	2	398	c.320C>T	c.(319-321)cCa>cTa	p.P107L		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	107	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)	p.P107L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CCAGAAAACCCATACGCCCAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											44.0	48.0	47.0					15																	57730517		2192	4292	6484	55517809	SO:0001583	missense	84952			AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.320C>T	15.37:g.57730517C>T	ENSP00000281282:p.Pro107Leu	Unknown		x	x	x	55517809	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	7.707	0.694429	0.15039	.	.	ENSG00000128849	ENST00000281282	T	0.78364	-1.17	4.88	4.88	0.63580	.	0.141249	0.33040	N	0.005359	T	0.74574	0.3734	M	0.66939	2.045	0.47276	D	0.999377	P	0.49090	0.919	B	0.40165	0.321	T	0.79117	-0.1935	10	0.62326	D	0.03	-19.7895	12.8111	0.57639	0.1744:0.8255:0.0:0.0	.	107	Q0VF96	CGNL1_HUMAN	L	107	ENSP00000281282:P107L	ENSP00000281282:P107L	P	+	2	0	CGNL1	55517809	0.992000	0.36948	0.890000	0.34922	0.010000	0.07245	3.665000	0.54532	2.522000	0.85027	0.655000	0.94253	CCA		0.498	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866		Missense_Mutation
MCTP2	55784	broad.mit.edu	37	15	94910908	94910908	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr15:94910908G>T	ENST00000357742.4	+	10	1376	c.1376G>T	c.(1375-1377)gGg>gTg	p.G459V	MCTP2_ENST00000331706.4_Missense_Mutation_p.G47V|MCTP2_ENST00000557742.1_Missense_Mutation_p.G47V|MCTP2_ENST00000451018.3_Missense_Mutation_p.G459V	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	459					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.G459V(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AGCTGTCTGGGGGCTCTCCTT	0.527																																																1	Substitution - Missense(1)	ovary(1)	15											85.0	87.0	86.0					15																	94910908		2197	4298	6495	92711912	SO:0001583	missense	55784			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1376G>T	15.37:g.94910908G>T	ENSP00000350377:p.Gly459Val	Unknown		x	x	x	92711912	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376368	0.82682	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.78707	1.77;-1.2;1.77	5.33	5.33	0.75918	C2 calcium/lipid-binding domain, CaLB (1);	0.050716	0.85682	D	0.000000	D	0.88724	0.6514	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.982;1.0;1.0	D	0.89878	0.4028	10	0.87932	D	0	.	19.0292	0.92948	0.0:0.0:1.0:0.0	.	459;47;459	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	V	459;47;459	ENSP00000395109:G459V;ENSP00000329646:G47V;ENSP00000350377:G459V	ENSP00000329646:G47V	G	+	2	0	MCTP2	92711912	1.000000	0.71417	0.804000	0.32291	0.991000	0.79684	8.162000	0.89657	2.490000	0.84030	0.650000	0.86243	GGG		0.527	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349		Missense_Mutation
DCUN1D3	123879	broad.mit.edu	37	16	20871268	20871268	+	Silent	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr16:20871268C>T	ENST00000324344.4	-	3	1140	c.855G>A	c.(853-855)ggG>ggA	p.G285G	DCUN1D3_ENST00000563934.1_Silent_p.G285G|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	285					negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		CTCTCCCTTCCCCTTCTCTTT	0.567																																																0			16											74.0	65.0	68.0					16																	20871268		2201	4300	6501	20778769	SO:0001819	synonymous_variant	123879			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.855G>A	16.37:g.20871268C>T		Unknown		x	x	x	20778769	B3KVY4	Silent	SNP	ENST00000324344.4	37	CCDS10592.1	SNP	22	Broad																																																																																				0.567	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475		Silent
NLRC5	84166	broad.mit.edu	37	16	57070075	57070075	+	Silent	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr16:57070075G>A	ENST00000262510.6	+	14	2916	c.2691G>A	c.(2689-2691)ctG>ctA	p.L897L	NLRC5_ENST00000539144.1_Silent_p.L897L|NLRC5_ENST00000308149.7_Silent_p.L897L|NLRC5_ENST00000436936.1_Silent_p.L897L	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	897					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.L897L(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CATCCCAGCTGCACATCGCCA	0.617																																																1	Substitution - coding silent(1)	ovary(1)	16											47.0	44.0	45.0					16																	57070075		2198	4300	6498	55627576	SO:0001819	synonymous_variant	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2691G>A	16.37:g.57070075G>A		Unknown		x	x	x	55627576	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	CCDS10773.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	6.745	0.506188	0.12883	.	.	ENSG00000140853	ENST00000538805	.	.	.	5.17	3.15	0.36227	.	.	.	.	.	T	0.57533	0.2060	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51702	-0.8672	4	.	.	.	.	7.9039	0.29750	0.0:0.1459:0.4909:0.3632	.	.	.	.	T	650	.	.	A	+	1	0	NLRC5	55627576	0.440000	0.25618	0.995000	0.50966	0.622000	0.37654	0.414000	0.21164	0.709000	0.31976	0.561000	0.74099	GCA		0.617	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		Silent
TUBB3	10381	broad.mit.edu	37	16	90001762	90001762	+	Silent	SNP	C	C	T	rs143913140	byFrequency	TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr16:90001762C>T	ENST00000315491.7	+	4	1026	c.903C>T	c.(901-903)gcC>gcT	p.A301A	TUBB3_ENST00000554444.1_Silent_p.A229A|TUBB3_ENST00000556922.1_Silent_p.A648A|TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000304984.5_Silent_p.A229A	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	301					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A301A(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	ACATGATGGCCGCCTGCGACC	0.687																																																1	Substitution - coding silent(1)	ovary(1)	16						T	,	2,4392	4.2+/-10.8	0,2,2195	67.0	70.0	69.0		687,903	-9.2	0.1	16	dbSNP_134	69	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	TUBB3	NM_001197181.1,NM_006086.3	,	0,2,6493	TT,TC,CC		0.0,0.0455,0.0154	,	229/379,301/451	90001762	2,12988	2197	4298	6495	88529263	SO:0001819	synonymous_variant	10381			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.903C>T	16.37:g.90001762C>T		Unknown		x	x	x	88529263	A8K854|Q9BTZ0|Q9BW10	Silent	SNP	ENST00000315491.7	37	CCDS10988.1	SNP	23	Broad																																																																																				0.687	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086		Silent
ITGAE	3682	broad.mit.edu	37	17	3651261	3651261	+	Missense_Mutation	SNP	G	G	A	rs189112267	byFrequency	TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr17:3651261G>A	ENST00000263087.4	-	17	2208	c.2110C>T	c.(2110-2112)Cgt>Tgt	p.R704C		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	704					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.R704C(2)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		AAACATAAACGGACATTCACG	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		17870	0.0		0.002	False		,,,				2504	0.0				NSCLC(182;635 2928 8995 38788)											2	Substitution - Missense(2)	ovary(1)|haematopoietic_and_lymphoid_tissue(1)	17											85.0	78.0	80.0					17																	3651261		2203	4300	6503	3598010	SO:0001583	missense	3682			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.2110C>T	17.37:g.3651261G>A	ENSP00000263087:p.Arg704Cys	Unknown		x	x	x	3598010	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	CCDS32531.1	SNP	39	Broad	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	2.033	-0.421994	0.04734	.	.	ENSG00000083457	ENST00000263087	T	0.56275	0.47	4.68	-9.37	0.00626	Integrin alpha-2 (1);	.	.	.	.	T	0.17238	0.0414	N	0.01048	-1.04	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.51942	-0.8641	9	0.48119	T	0.1	.	5.5333	0.16997	0.198:0.1365:0.074:0.5916	.	704	P38570	ITAE_HUMAN	C	704	ENSP00000263087:R704C	ENSP00000263087:R704C	R	-	1	0	ITGAE	3598010	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.653000	0.00107	-6.022000	0.00007	-0.896000	0.02909	CGT		0.537	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7576897	7576897	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr17:7576897G>A	ENST00000269305.4	-	9	1138	c.949C>T	c.(949-951)Cag>Tag	p.Q317*	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q317*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	317	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		Q -> H (in a kidney cancer with no family history; germline mutation and in a sporadic cancer; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).|Q -> P (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q317*(29)|p.0?(8)|p.Q317K(3)|p.S315fs*22(1)|p.?(1)|p.S314fs*25(1)|p.L308fs*15(1)|p.Q317fs*28(1)|p.Q317fs*45(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTTTGGCTGGGGAGAGGAG	0.473		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Nonsense(29)|Whole gene deletion(8)|Deletion - Frameshift(4)|Substitution - Missense(3)|Insertion - Frameshift(1)|Unknown(1)	breast(7)|large_intestine(5)|skin(4)|bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|ovary(3)|central_nervous_system(2)|lung(2)|NS(2)|pancreas(2)|thyroid(1)|stomach(1)|soft_tissue(1)|liver(1)|endometrium(1)|oesophagus(1)	17											129.0	119.0	122.0					17																	7576897		2203	4300	6503	7517622	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.949C>T	17.37:g.7576897G>A	ENSP00000269305:p.Gln317*	Somatic		x	x	x	7517622	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032676	0.93575	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.96	2.84	0.33178	.	1.146690	0.06159	N	0.675692	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-0.0856	5.403	0.16306	0.1029:0.0:0.6855:0.2116	.	.	.	.	X	317;317;317;317;317;306;185	.	ENSP00000269305:Q317X	Q	-	1	0	TP53	7517622	0.001000	0.12720	0.022000	0.16811	0.871000	0.50021	0.741000	0.26202	1.318000	0.45170	0.561000	0.74099	CAG		0.473	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
DHX8	1659	broad.mit.edu	37	17	41570102	41570102	+	Missense_Mutation	SNP	G	G	A	rs377681392		TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr17:41570102G>A	ENST00000262415.3	+	6	629	c.557G>A	c.(556-558)cGa>cAa	p.R186Q	DHX8_ENST00000540306.1_Missense_Mutation_p.R186Q	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	186	Arg/Ser-rich (RS domain).				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R186Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		aaccgagatcgagacagagat	0.483																																					NSCLC(56;1548 1661 49258 49987)											1	Substitution - Missense(1)	ovary(1)	17						G	GLN/ARG	0,4406		0,0,2203	107.0	103.0	104.0		557	5.2	0.2	17		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX8	NM_004941.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	186/1221	41570102	1,13005	2203	4300	6503	38925628	SO:0001583	missense	1659			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.557G>A	17.37:g.41570102G>A	ENSP00000262415:p.Arg186Gln	Unknown		x	x	x	38925628		Missense_Mutation	SNP	ENST00000262415.3	37	CCDS11464.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	10.43	1.346842	0.24426	0.0	1.16E-4	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.58652	0.32;0.32	5.18	5.18	0.71444	.	0.000000	0.41938	D	0.000783	T	0.62841	0.2461	L	0.32530	0.975	0.58432	D	0.999996	D;D	0.69078	0.997;0.983	D;P	0.66847	0.947;0.885	T	0.55742	-0.8093	10	0.13853	T	0.58	.	15.8583	0.79000	0.0:0.0:1.0:0.0	.	186;186	F5H658;Q14562	.;DHX8_HUMAN	Q	186	ENSP00000437886:R186Q;ENSP00000262415:R186Q	ENSP00000262415:R186Q	R	+	2	0	DHX8	38925628	0.893000	0.30496	0.167000	0.22817	0.239000	0.25481	6.052000	0.71080	2.409000	0.81822	0.561000	0.74099	CGA		0.483	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1			Missense_Mutation
CBX8	57332	broad.mit.edu	37	17	77768808	77768808	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr17:77768808G>A	ENST00000269385.4	-	5	913	c.796C>T	c.(796-798)Cct>Tct	p.P266S	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	266					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)	p.P266S(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCTGAGCTAGGGCTGGTCACA	0.642																																																1	Substitution - Missense(1)	ovary(1)	17											43.0	40.0	41.0					17																	77768808		2203	4299	6502	75383403	SO:0001583	missense	57332			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.796C>T	17.37:g.77768808G>A	ENSP00000269385:p.Pro266Ser	Unknown		x	x	x	75383403	Q96H39|Q9NR07	Missense_Mutation	SNP	ENST00000269385.4	37	CCDS11765.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	g	13.76	2.334572	0.41297	.	.	ENSG00000141570	ENST00000269385;ENST00000427800	T	0.52983	0.64	4.34	3.36	0.38483	.	0.662303	0.14092	N	0.341952	T	0.32194	0.0821	L	0.39898	1.24	0.26477	N	0.975173	B	0.11235	0.004	B	0.09377	0.004	T	0.21245	-1.0251	10	0.12766	T	0.61	-11.3794	5.2547	0.15540	0.1705:0.0:0.6649:0.1645	.	266	Q9HC52	CBX8_HUMAN	S	266;241	ENSP00000269385:P266S	ENSP00000269385:P266S	P	-	1	0	CBX8	75383403	1.000000	0.71417	0.988000	0.46212	0.959000	0.62525	4.162000	0.58177	1.187000	0.43000	0.450000	0.29827	CCT		0.642	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318011.1	NM_020649		Missense_Mutation
MEP1B	4225	broad.mit.edu	37	18	29787335	29787335	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr18:29787335C>T	ENST00000269202.6	+	8	715	c.668C>T	c.(667-669)aCa>aTa	p.T223I	MEP1B_ENST00000581447.1_Missense_Mutation_p.T223I	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	223	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T223I(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						ACAGAGCCGACAATTGTCACA	0.398																																																1	Substitution - Missense(1)	ovary(1)	18											73.0	68.0	70.0					18																	29787335		1918	4124	6042	28041333	SO:0001583	missense	4225			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.668C>T	18.37:g.29787335C>T	ENSP00000269202:p.Thr223Ile	Unknown		x	x	x	28041333	B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	ENST00000269202.6	37	CCDS45846.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	18.51	3.638744	0.67130	.	.	ENSG00000141434	ENST00000269202	T	0.78126	-1.15	5.6	5.6	0.85130	Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91925	0.7443	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93642	0.6965	10	0.87932	D	0	-18.2579	19.6094	0.95599	0.0:1.0:0.0:0.0	.	223	Q16820	MEP1B_HUMAN	I	223	ENSP00000269202:T223I	ENSP00000269202:T223I	T	+	2	0	MEP1B	28041333	1.000000	0.71417	0.076000	0.20297	0.174000	0.22865	7.818000	0.86416	2.647000	0.89833	0.591000	0.81541	ACA		0.398	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447755.1	NM_005925		Missense_Mutation
C19orf47	126526	broad.mit.edu	37	19	40834416	40834416	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr19:40834416G>A	ENST00000582783.1	-	6	466	c.454C>T	c.(454-456)Cca>Tca	p.P152S	C19orf47_ENST00000392035.2_Missense_Mutation_p.P85S	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	152						nucleus (GO:0005634)		p.P85S(1)		endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			GTGCTGGGTGGAGAGTCATGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											178.0	181.0	180.0					19																	40834416		2203	4300	6503	45526256	SO:0001583	missense	126526			AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.454C>T	19.37:g.40834416G>A	ENSP00000463159:p.Pro152Ser	Unknown		x	x	x	45526256	Q8IZ33|Q8N0V9	Missense_Mutation	SNP	ENST00000582783.1	37	CCDS58662.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005708	0.74932	.	.	ENSG00000160392	ENST00000357884;ENST00000392035	D	0.99582	-6.22	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99655	1.0992	10	0.32370	T	0.25	0.1439	17.9782	0.89132	0.0:0.0:1.0:0.0	.	152	Q8N9M1	CS047_HUMAN	S	152;85	ENSP00000375889:P85S	ENSP00000350556:P152S	P	-	1	0	C19orf47	45526256	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	9.091000	0.94151	2.623000	0.88846	0.462000	0.41574	CCA		0.602	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444488.1	NM_178830		Missense_Mutation
ZNF331	55422	broad.mit.edu	37	19	54080392	54080392	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr19:54080392G>A	ENST00000253144.9	+	7	1911	c.578G>A	c.(577-579)gGg>gAg	p.G193E	ZNF331_ENST00000512387.1_Missense_Mutation_p.G193E|ZNF331_ENST00000513265.1_Intron|ZNF331_ENST00000449416.1_Missense_Mutation_p.G193E|ZNF331_ENST00000511593.2_Missense_Mutation_p.G193E|ZNF331_ENST00000511154.1_Missense_Mutation_p.G193E|ZNF331_ENST00000411977.2_Missense_Mutation_p.G193E|ZNF331_ENST00000513999.1_Missense_Mutation_p.G193E	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G193E(1)		NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		AAAGACTGTGGGAAGGCTTTT	0.438			T	?	follicular thyroid adenoma																																		Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	1	Substitution - Missense(1)	ovary(1)	19											63.0	70.0	68.0					19																	54080392		2203	4300	6503	58772204	SO:0001583	missense	55422			AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.578G>A	19.37:g.54080392G>A	ENSP00000253144:p.Gly193Glu	Somatic		x	x	x	58772204	Q96GJ4	Missense_Mutation	SNP	ENST00000253144.9	37	CCDS33102.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312750	0.60414	.	.	ENSG00000130844	ENST00000253144;ENST00000511593;ENST00000449416;ENST00000411977;ENST00000511154;ENST00000513999;ENST00000512387	T;T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35;0.35;0.35	3.35	3.35	0.38373	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59569	0.2203	L	0.61218	1.895	0.27610	N	0.948695	D	0.65815	0.995	P	0.51297	0.665	T	0.55661	-0.8106	9	0.66056	D	0.02	.	12.5614	0.56283	0.0:0.0:1.0:0.0	.	193	Q9NQX6	ZN331_HUMAN	E	193	ENSP00000253144:G193E;ENSP00000427439:G193E;ENSP00000393817:G193E;ENSP00000393336:G193E;ENSP00000421014:G193E;ENSP00000423156:G193E;ENSP00000421728:G193E	ENSP00000253144:G193E	G	+	2	0	ZNF331	58772204	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	4.192000	0.58378	1.872000	0.54250	0.563000	0.77884	GGG		0.438	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555		Missense_Mutation
EGR4	1961	broad.mit.edu	37	2	73519430	73519430	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr2:73519430C>T	ENST00000545030.1	-	2	999	c.925G>A	c.(925-927)Gcg>Acg	p.A309T	EGR4_ENST00000436467.2_Missense_Mutation_p.A206T	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	309	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A206T(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TCCCAGGGCGCGTAGGGACCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	2											13.0	17.0	16.0					2																	73519430		2198	4293	6491	73372938	SO:0001583	missense	1961				CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.925G>A	2.37:g.73519430C>T	ENSP00000445626:p.Ala309Thr	Unknown		x	x	x	73372938	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	ENST00000545030.1	37	CCDS1925.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730534	0.30684	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.14640	2.49;2.84	4.18	2.31	0.28768	.	0.465774	0.19239	N	0.119218	T	0.07999	0.0200	N	0.14661	0.345	0.09310	N	1	B;P	0.35700	0.382;0.516	B;B	0.31751	0.064;0.135	T	0.19549	-1.0302	10	0.59425	D	0.04	-0.9196	11.4184	0.49967	0.3281:0.6719:0.0:0.0	.	206;309	Q05215;G3V1T5	EGR4_HUMAN;.	T	309;206	ENSP00000445626:A309T;ENSP00000419687:A206T	ENSP00000419687:A206T	A	-	1	0	EGR4	73372938	0.001000	0.12720	0.167000	0.22817	0.623000	0.37688	0.099000	0.15210	0.378000	0.24764	0.462000	0.41574	GCG		0.682	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965		Missense_Mutation
SLC4A5	57835	broad.mit.edu	37	2	74459626	74459626	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr2:74459626G>A	ENST00000377634.4	-	24	3143	c.2744C>T	c.(2743-2745)cCt>cTt	p.P915L	SLC4A5_ENST00000423644.1_Intron|SLC4A5_ENST00000394019.2_Missense_Mutation_p.P915L|SLC4A5_ENST00000346834.4_Missense_Mutation_p.P915L|SLC4A5_ENST00000357822.5_Missense_Mutation_p.P915L|SLC4A5_ENST00000359484.4_Missense_Mutation_p.P813L|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000377632.1_Missense_Mutation_p.P915L|SLC4A5_ENST00000358683.4_Missense_Mutation_p.P813L|SLC4A5_ENST00000483195.1_Intron					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.P915L(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CTGCTCCCCAGGGGCACTGGT	0.627																																																1	Substitution - Missense(1)	ovary(1)	2											70.0	77.0	75.0					2																	74459626		2203	4300	6503	74313134	SO:0001583	missense	57835			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.2744C>T	2.37:g.74459626G>A	ENSP00000366861:p.Pro915Leu	Unknown		x	x	x	74313134		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912805	0.92178	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634	D;D;T;T;D;D;D	0.88431	-2.38;-2.38;-1.29;-1.29;-2.38;-2.38;-2.38	5.12	5.12	0.69794	Bicarbonate transporter, C-terminal (1);	0.107097	0.64402	D	0.000004	D	0.95802	0.8634	M	0.93638	3.44	0.80722	D	1	D;D;P;D	0.89917	0.996;0.979;0.88;1.0	D;P;P;D	0.80764	0.937;0.897;0.752;0.994	D	0.96522	0.9386	10	0.72032	D	0.01	.	16.111	0.81263	0.0:0.0:1.0:0.0	.	915;813;915;915	Q9BY07-4;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;S4A5_HUMAN;.	L	915;915;915;813;813;915;915;915	ENSP00000377587:P915L;ENSP00000251768:P915L;ENSP00000352461:P813L;ENSP00000351513:P813L;ENSP00000350475:P915L;ENSP00000366859:P915L;ENSP00000366861:P915L	ENSP00000251768:P915L	P	-	2	0	SLC4A5	74313134	1.000000	0.71417	0.991000	0.47740	0.983000	0.72400	9.544000	0.98092	2.681000	0.91329	0.563000	0.77884	CCT		0.627	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3			Missense_Mutation
SCN2A	6326	broad.mit.edu	37	2	166198844	166198844	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr2:166198844G>T	ENST00000375437.2	+	15	2717	c.2427G>T	c.(2425-2427)aaG>aaT	p.K809N	SCN2A_ENST00000357398.3_Missense_Mutation_p.K809N|SCN2A_ENST00000375427.2_Missense_Mutation_p.K809N|SCN2A_ENST00000283256.6_Missense_Mutation_p.K809N	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	809					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.K809N(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGTTTCTCAAGATAATTGCCA	0.338																																																1	Substitution - Missense(1)	ovary(1)	2											133.0	136.0	135.0					2																	166198844		2203	4300	6503	165907090	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2427G>T	2.37:g.166198844G>T	ENSP00000364586:p.Lys809Asn	Unknown		x	x	x	165907090	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288666	0.80914	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.99129	-5.46;-5.46;-5.46;-5.46	5.59	3.8	0.43715	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99521	0.9829	H	0.97896	4.1	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98321	1.0528	10	0.87932	D	0	.	11.4895	0.50373	0.1437:0.0:0.8563:0.0	.	809;809	Q99250-2;Q99250	.;SCN2A_HUMAN	N	809	ENSP00000364586:K809N;ENSP00000349973:K809N;ENSP00000283256:K809N;ENSP00000364576:K809N	ENSP00000283256:K809N	K	+	3	2	SCN2A	165907090	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.533000	0.53561	0.729000	0.32403	0.643000	0.83706	AAG		0.338	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007		Missense_Mutation
FAM171B	165215	broad.mit.edu	37	2	187615987	187615987	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0899-01	TCGA-13-0899-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr2:187615987G>C	ENST00000304698.5	+	5	1054	c.851G>C	c.(850-852)aGt>aCt	p.S284T		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	284						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.S284T(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AATGATATAAGTGCAGGGGAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	91.0	89.0					2																	187615987		2203	4300	6503	187324232	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.851G>C	2.37:g.187615987G>C	ENSP00000304108:p.Ser284Thr	Somatic		x	x	x	187324232	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	2.679	-0.275873	0.05679	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.29917	1.55	5.49	0.836	0.18891	.	0.422543	0.29053	N	0.013297	T	0.12263	0.0298	N	0.04508	-0.205	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.15870	0.014;0.014	T	0.25882	-1.0119	10	0.25751	T	0.34	-2.1067	8.3902	0.32524	0.7768:0.0:0.2232:0.0	.	284;285	Q6P995;A8K122	F171B_HUMAN;.	T	284	ENSP00000304108:S284T	ENSP00000272804:S284T	S	+	2	0	FAM171B	187324232	0.636000	0.27207	0.018000	0.16275	0.232000	0.25224	1.263000	0.33004	-0.006000	0.14370	0.609000	0.83330	AGT		0.363	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		Missense_Mutation
PLTP	5360	broad.mit.edu	37	20	44538259	44538259	+	Silent	SNP	A	A	C			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr20:44538259A>C	ENST00000477313.1	-	4	975	c.381T>G	c.(379-381)acT>acG	p.T127T	PLTP_ENST00000354050.4_Intron|PLTP_ENST00000372431.3_Silent_p.T127T|PLTP_ENST00000542937.1_Silent_p.T147T|PLTP_ENST00000420868.2_Intron|PLTP_ENST00000372420.1_Silent_p.T39T			P55058	PLTP_HUMAN	phospholipid transfer protein	127					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.T127T(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GCTCCAGACCAGTGCGGATGG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	20											85.0	86.0	85.0					20																	44538259		2203	4300	6503	43971666	SO:0001819	synonymous_variant	5360			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.381T>G	20.37:g.44538259A>C		Unknown		x	x	x	43971666	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Silent	SNP	ENST00000477313.1	37	CCDS13386.1	SNP	7	Broad																																																																																				0.582	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227		Silent
CD40	958	broad.mit.edu	37	20	44751328	44751328	+	Silent	SNP	G	G	A	rs267605960		TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr20:44751328G>A	ENST00000372285.3	+	4	408	c.336G>A	c.(334-336)acG>acA	p.T112T	CD40_ENST00000372276.3_Silent_p.T112T|CD40_ENST00000489304.1_3'UTR	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	112				T -> A (in Ref. 4; BAD96616). {ECO:0000305}.	B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)	p.T112T(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				GGCACTGTACGAGTGAGGCCT	0.567									Immune Deficiency with Hyper-IgM																																							1	Substitution - coding silent(1)	ovary(1)	20											120.0	106.0	111.0					20																	44751328		2203	4300	6503	44184735	SO:0001819	synonymous_variant	958	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.336G>A	20.37:g.44751328G>A		Somatic		x	x	x	44184735	E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Silent	SNP	ENST00000372285.3	37	CCDS13393.1	SNP	37	Broad																																																																																				0.567	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250		Silent
SON	6651	broad.mit.edu	37	21	34925258	34925258	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr21:34925258G>A	ENST00000356577.4	+	3	4196	c.3721G>A	c.(3721-3723)Gta>Ata	p.V1241I	SON_ENST00000290239.6_Missense_Mutation_p.V1241I|SON_ENST00000300278.4_Missense_Mutation_p.V1241I|SON_ENST00000381679.4_Missense_Mutation_p.V1241I|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1241					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V1241I(1)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTCAGTTTTAGTATCAGAGGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	21											141.0	148.0	145.0					21																	34925258		2203	4300	6503	33847128	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.3721G>A	21.37:g.34925258G>A	ENSP00000348984:p.Val1241Ile	Unknown		x	x	x	33847128	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126297	0.37533	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.12569	2.86;2.86;2.85;2.67	5.54	2.26	0.28386	.	0.729009	0.12327	N	0.478733	T	0.11665	0.0284	L	0.39898	1.24	0.09310	N	0.999999	B;P;B;B;B	0.36483	0.43;0.555;0.034;0.43;0.43	B;B;B;B;B	0.32211	0.142;0.062;0.036;0.142;0.108	T	0.13872	-1.0493	10	0.52906	T	0.07	.	11.2875	0.49230	0.2433:0.0:0.7567:0.0	.	1241;1241;922;1241;1241	P18583-10;P18583;P18583-2;P18583-3;P18583-6	.;SON_HUMAN;.;.;.	I	1241	ENSP00000348984:V1241I;ENSP00000290239:V1241I;ENSP00000300278:V1241I;ENSP00000371095:V1241I	ENSP00000290239:V1241I	V	+	1	0	SON	33847128	0.542000	0.26426	0.820000	0.32676	0.768000	0.43524	1.237000	0.32695	0.692000	0.31613	0.563000	0.77884	GTA		0.473	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		Missense_Mutation
BAP1	8314	broad.mit.edu	37	3	52440373	52440373	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr3:52440373G>A	ENST00000460680.1	-	9	1150	c.679C>T	c.(679-681)Cgc>Tgc	p.R227C	BAP1_ENST00000296288.5_Intron	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R227C(2)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGTTGAAGCGGATGTCGTGG	0.627			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	2	Substitution - Missense(2)	ovary(2)	3											89.0	69.0	75.0					3																	52440373		2203	4300	6503	52415413	SO:0001583	missense	8314			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.679C>T	3.37:g.52440373G>A	ENSP00000417132:p.Arg227Cys	Unknown		x	x	x	52415413	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995807	0.74703	.	.	ENSG00000163930	ENST00000460680	T	0.49432	0.78	6.04	6.04	0.98038	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (2);	0.000000	0.85682	D	0.000000	T	0.57431	0.2053	M	0.73217	2.22	0.80722	D	1	D	0.60160	0.987	P	0.49387	0.609	T	0.61608	-0.7028	10	0.72032	D	0.01	-4.619	15.3219	0.74129	0.0:0.0:0.8603:0.1397	.	227	Q92560	BAP1_HUMAN	C	227	ENSP00000417132:R227C	ENSP00000417132:R227C	R	-	1	0	BAP1	52415413	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.828000	0.86729	2.876000	0.98609	0.650000	0.86243	CGC		0.627	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1			Missense_Mutation
CRIPAK	285464	broad.mit.edu	37	4	1389118	1389118	+	Silent	SNP	G	G	A	rs527832969		TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr4:1389118G>A	ENST00000324803.4	+	1	3779	c.819G>A	c.(817-819)acG>acA	p.T273T		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	273					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T273T(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCTGCTCACGTGCCGATGTG	0.682																																																1	Substitution - coding silent(1)	ovary(1)	4											152.0	139.0	144.0					4																	1389118		2202	4299	6501	1379118	SO:0001819	synonymous_variant	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.819G>A	4.37:g.1389118G>A		Unknown		x	x	x	1379118	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	SNP	40	Broad																																																																																				0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918		Silent
THAP9	79725	broad.mit.edu	37	4	83838349	83838349	+	Silent	SNP	T	T	C			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr4:83838349T>C	ENST00000302236.5	+	5	1035	c.984T>C	c.(982-984)ggT>ggC	p.G328G	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	328					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)	p.G328G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				TGGCAGTGGGTATTTTTGGCC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	4											124.0	120.0	121.0					4																	83838349		2203	4300	6503	84057373	SO:0001819	synonymous_variant	79725			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.984T>C	4.37:g.83838349T>C		Unknown		x	x	x	84057373	B3KRE2|Q59AC9	Silent	SNP	ENST00000302236.5	37	CCDS3598.1	SNP	57	Broad																																																																																				0.423	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672		Silent
PLA2G12A	81579	broad.mit.edu	37	4	110639873	110639873	+	Missense_Mutation	SNP	G	G	A	rs368449766		TCGA-13-0899-01	TCGA-13-0899-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr4:110639873G>A	ENST00000243501.5	-	2	518	c.251C>T	c.(250-252)cCg>cTg	p.P84L	PLA2G12A_ENST00000502283.1_Missense_Mutation_p.P84L|PLA2G12A_ENST00000502772.1_5'UTR	NM_030821.4	NP_110448.2	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA	84					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)	p.P84L(1)		kidney(1)|lung(1)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		ACATCCATTCGGTGGGGAGGG	0.299																																																1	Substitution - Missense(1)	ovary(1)	4						G	LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	62.0	59.0	60.0		251	4.8	0.4	4		60	0,8600		0,0,4300	no	missense	PLA2G12A	NM_030821.4	98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	84/190	110639873	1,13005	2203	4300	6503	110859322	SO:0001583	missense	81579				CCDS3686.1	4q25	2010-11-24	2004-01-13	2004-01-14	ENSG00000123739	ENSG00000123739	3.1.1.4		18554	protein-coding gene	gene with protein product		611652	"""phospholipase A2, group XII"""	PLA2G12		11031251	Standard	NM_030821		Approved		uc003hzp.3	Q9BZM1	OTTHUMG00000131915	ENST00000243501.5:c.251C>T	4.37:g.110639873G>A	ENSP00000243501:p.Pro84Leu	Somatic		x	x	x	110859322	Q9BZ89	Missense_Mutation	SNP	ENST00000243501.5	37	CCDS3686.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609795	0.87258	2.27E-4	0.0	ENSG00000123739	ENST00000243501;ENST00000502283	.	.	.	5.66	4.82	0.62117	Phospholipase A2 (1);	0.000000	0.85682	D	0.000000	T	0.66528	0.2798	M	0.81341	2.54	0.80722	D	1	D;D	0.56746	0.977;0.977	P;P	0.47915	0.561;0.561	T	0.73733	-0.3890	9	0.87932	D	0	-8.1349	14.4463	0.67352	0.0704:0.0:0.9296:0.0	.	84;84	Q542Y6;Q9BZM1	.;PG12A_HUMAN	L	84	.	ENSP00000243501:P84L	P	-	2	0	PLA2G12A	110859322	1.000000	0.71417	0.445000	0.26908	0.994000	0.84299	9.012000	0.93624	1.401000	0.46761	0.655000	0.94253	CCG		0.299	PLA2G12A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254868.3			Missense_Mutation
MAB21L2	10586	broad.mit.edu	37	4	151504974	151504974	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr4:151504974C>A	ENST00000317605.4	+	1	1898	c.793C>A	c.(793-795)Ccc>Acc	p.P265T	LRBA_ENST00000510413.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000357115.3_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	265					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.P265T(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CCTGGAGCTACCCGGCCAGCC	0.627																																																1	Substitution - Missense(1)	ovary(1)	4											52.0	52.0	52.0					4																	151504974		2203	4300	6503	151724424	SO:0001583	missense	10586			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.793C>A	4.37:g.151504974C>A	ENSP00000324701:p.Pro265Thr	Unknown		x	x	x	151724424	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113648	0.37339	.	.	ENSG00000181541	ENST00000317605	T	0.07800	3.16	5.14	4.29	0.51040	Ricin B lectin (1);	0.000000	0.85682	D	0.000000	T	0.10637	0.0260	L	0.59436	1.845	0.80722	D	1	B	0.23990	0.095	B	0.25987	0.065	T	0.06481	-1.0824	10	0.09590	T	0.72	-18.0284	16.0884	0.81073	0.0:0.8659:0.1341:0.0	.	265	Q9Y586	MB212_HUMAN	T	265	ENSP00000324701:P265T	ENSP00000324701:P265T	P	+	1	0	MAB21L2	151724424	1.000000	0.71417	0.992000	0.48379	0.976000	0.68499	6.022000	0.70839	1.263000	0.44181	0.462000	0.41574	CCC		0.627	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439		Missense_Mutation
KIF2A	3796	broad.mit.edu	37	5	61668334	61668334	+	Intron	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr5:61668334C>T	ENST00000401507.3	+	17	1957				KIF2A_ENST00000381103.2_Intron|KIF2A_ENST00000506857.1_Intron|KIF2A_ENST00000407818.3_Silent_p.L572L|KIF2A_ENST00000509663.2_Intron	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		GCCCTGATCTCTCTCCTTCTT	0.388																																																0			5											92.0	88.0	89.0					5																	61668334		1861	4105	5966	61704091	SO:0001627	intron_variant	3796			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1647-1180C>T	5.37:g.61668334C>T		Unknown		x	x	x	61704091	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Silent	SNP	ENST00000401507.3	37	CCDS3980.2	SNP	32	Broad																																																																																				0.388	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520		Silent
PCDHA13	56136	broad.mit.edu	37	5	140262567	140262567	+	Silent	SNP	C	C	T	rs139888237	byFrequency	TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr5:140262567C>T	ENST00000289272.2	+	1	714	c.714C>T	c.(712-714)aaC>aaT	p.N238N	PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA13_ENST00000409494.1_Silent_p.N238N|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N238N(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAATGACAACGCCCCGGAAT	0.453													.|||	2	0.000399361	0.0	0.0	5008	,	,		19765	0.002		0.0	False		,,,				2504	0.0				Melanoma(147;1739 1852 5500 27947 37288)											1	Substitution - coding silent(1)	ovary(1)	5											67.0	65.0	66.0					5																	140262567		2203	4300	6503	140242751	SO:0001819	synonymous_variant	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.714C>T	5.37:g.140262567C>T		Unknown		x	x	x	140242751	O75277	Silent	SNP	ENST00000289272.2	37	CCDS4240.1	SNP	19	Broad																																																																																				0.453	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904		Silent
HIST1H2BD	3017	broad.mit.edu	37	6	26158462	26158462	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0899-01	TCGA-13-0899-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr6:26158462C>G	ENST00000289316.2	+	1	89	c.65C>G	c.(64-66)gCt>gGt	p.A22G	HIST1H2BD_ENST00000377777.4_Missense_Mutation_p.A22G	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	22					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A22G(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						GTGACTAAGGCTCAGAAGAAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											132.0	129.0	130.0					6																	26158462		2203	4300	6503	26266441	SO:0001583	missense	3017			M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.65C>G	6.37:g.26158462C>G	ENSP00000289316:p.Ala22Gly	Somatic		x	x	x	26266441		Missense_Mutation	SNP	ENST00000289316.2	37	CCDS4587.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	.	15.75	2.925185	0.52759	.	.	ENSG00000158373	ENST00000377777;ENST00000289316	T;T	0.20332	2.08;2.08	4.58	3.71	0.42584	Histone-fold (2);	0.000000	0.41294	D	0.000910	T	0.10981	0.0268	L	0.44542	1.39	0.37370	D	0.911583	B	0.27013	0.166	B	0.33254	0.16	T	0.05022	-1.0911	10	0.59425	D	0.04	.	12.2744	0.54726	0.0:0.9161:0.0:0.0839	.	22	P58876	H2B1D_HUMAN	G	22	ENSP00000367008:A22G;ENSP00000289316:A22G	ENSP00000289316:A22G	A	+	2	0	HIST1H2BD	26266441	0.996000	0.38824	1.000000	0.80357	0.460000	0.32559	3.103000	0.50298	1.259000	0.44117	0.644000	0.83932	GCT		0.537	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040088.1	NM_021063		Missense_Mutation
MOG	4340	broad.mit.edu	37	6	29641002	29641002	+	IGR	SNP	T	T	G			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr6:29641002T>G	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Silent_p.R276R|ZFP57_ENST00000488757.1_Silent_p.R296R|ZFP57_ENST00000376881.3_Silent_p.R276R	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R276R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						CCTGGAATCCTCAAAGTACAC	0.557																																																1	Substitution - coding silent(1)	ovary(1)	6											153.0	160.0	158.0					6																	29641002		1240	2546	3786	29748981	SO:0001628	intergenic_variant	346171				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29641002T>G		Unknown		x	x	x	29748981	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	ENST00000376917.3	37	CCDS34370.1	SNP	54	Broad																																																																																				0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076160.3	NM_002433		Silent
MAPK14	1432	broad.mit.edu	37	6	35995964	35995964	+	Silent	SNP	G	G	C			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr6:35995964G>C	ENST00000229794.4	+	1	418	c.30G>C	c.(28-30)cgG>cgC	p.R10R	MAPK14_ENST00000310795.4_Silent_p.R10R|MAPK14_ENST00000229795.3_Silent_p.R10R|MAPK14_ENST00000468133.1_Intron	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	10					3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)	p.R10R(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						CGTTCTACCGGCAGGAGCTGA	0.657																																					Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)											1	Substitution - coding silent(1)	ovary(1)	6											58.0	60.0	59.0					6																	35995964		2203	4300	6503	36103942	SO:0001819	synonymous_variant	1432			L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.30G>C	6.37:g.35995964G>C		Unknown		x	x	x	36103942	A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Silent	SNP	ENST00000229794.4	37	CCDS4816.1	SNP	42	Broad																																																																																				0.657	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315		Silent
OPRM1	4988	broad.mit.edu	37	6	154411138	154411138	+	Silent	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr6:154411138C>T	ENST00000330432.7	+	2	705	c.468C>T	c.(466-468)agC>agT	p.S156S	OPRM1_ENST00000452687.2_Silent_p.S156S|OPRM1_ENST00000518759.1_Silent_p.S75S|OPRM1_ENST00000419506.2_Silent_p.S156S|OPRM1_ENST00000524163.1_Silent_p.S156S|OPRM1_ENST00000414028.2_Silent_p.S156S|OPRM1_ENST00000434900.2_Silent_p.S249S|OPRM1_ENST00000522236.1_Silent_p.S56S|OPRM1_ENST00000360422.4_Silent_p.S156S|OPRM1_ENST00000522555.1_Silent_p.S56S|OPRM1_ENST00000435918.2_Silent_p.S156S|OPRM1_ENST00000428397.2_Silent_p.S156S|OPRM1_ENST00000520708.1_Silent_p.S56S|OPRM1_ENST00000229768.5_Silent_p.S156S|OPRM1_ENST00000337049.4_Silent_p.S156S	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1	156					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)	p.S156S(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TGTTCACCAGCATATTCACCC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	6											254.0	246.0	249.0					6																	154411138		2145	4269	6414	154452831	SO:0001819	synonymous_variant	4988			L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.468C>T	6.37:g.154411138C>T		Unknown		x	x	x	154452831	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Silent	SNP	ENST00000330432.7	37	CCDS55070.1	SNP	25	Broad																																																																																				0.443	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914		Silent
TNS3	64759	broad.mit.edu	37	7	47451348	47451348	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr7:47451348G>A	ENST00000398879.1	-	13	1066	c.700C>T	c.(700-702)Cag>Tag	p.Q234*	TNS3_ENST00000442536.2_Nonsense_Mutation_p.Q234*|TNS3_ENST00000311160.9_Nonsense_Mutation_p.Q234*|TNS3_ENST00000355730.3_Nonsense_Mutation_p.Q234*|TNS3_ENST00000458317.2_Nonsense_Mutation_p.Q234*			Q68CZ2	TENS3_HUMAN	tensin 3	234	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.Q234*(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TTCAGAAGCTGGGCCGGCTCG	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	7											57.0	65.0	62.0					7																	47451348		2054	4177	6231	47417873	SO:0001587	stop_gained	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.700C>T	7.37:g.47451348G>A	ENSP00000381854:p.Gln234*	Unknown		x	x	x	47417873	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Nonsense_Mutation	SNP	ENST00000398879.1	37	CCDS5506.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.812107	0.98504	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718;ENST00000450444;ENST00000442536;ENST00000458317	.	.	.	5.17	5.17	0.71159	.	0.060006	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-29.1564	14.219	0.65812	0.0:0.0:1.0:0.0	.	.	.	.	X	234;344;234;234;337;323;234;234	.	ENSP00000312143:Q234X	Q	-	1	0	TNS3	47417873	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	7.807000	0.86032	2.416000	0.81992	0.555000	0.69702	CAG		0.517	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748		Nonsense_Mutation
AKAP9	10142	broad.mit.edu	37	7	91709382	91709382	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0899-01	TCGA-13-0899-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr7:91709382A>T	ENST00000359028.2	+	32	8196	c.7971A>T	c.(7969-7971)gaA>gaT	p.E2657D	AKAP9_ENST00000358100.2_Missense_Mutation_p.E2657D|AKAP9_ENST00000356239.3_Missense_Mutation_p.E2645D			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2657	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.E2645D(1)|p.E2657D(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGCTGCTAGAACTACAGAAGC	0.323			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Missense(2)	ovary(2)	7											21.0	24.0	23.0					7																	91709382		2116	4254	6370	91547318	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7971A>T	7.37:g.91709382A>T	ENSP00000351922:p.Glu2657Asp	Somatic		x	x	x	91547318	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	11.89	1.775147	0.31411	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03920	3.84;3.84;3.83;3.76	4.69	-3.71	0.04424	.	0.405503	0.18120	N	0.151090	T	0.06872	0.0175	M	0.67953	2.075	0.23331	N	0.997895	P;P;P;P	0.46142	0.728;0.799;0.873;0.873	B;B;P;P	0.44811	0.366;0.272;0.461;0.461	T	0.13176	-1.0519	10	0.52906	T	0.07	.	8.8601	0.35251	0.4318:0.111:0.4572:0.0	.	2649;2657;2645;2637	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	D	2645;2657;2657;2649;491	ENSP00000348573:E2645D;ENSP00000351922:E2657D;ENSP00000350813:E2657D;ENSP00000378042:E491D	ENSP00000348573:E2645D	E	+	3	2	AKAP9	91547318	0.984000	0.35163	0.311000	0.25182	0.642000	0.38348	0.142000	0.16096	-0.268000	0.09312	0.482000	0.46254	GAA		0.323	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751		Missense_Mutation
ORAI2	80228	broad.mit.edu	37	7	102079522	102079522	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr7:102079522C>T	ENST00000356387.2	+	3	354	c.119C>T	c.(118-120)tCt>tTt	p.S40F	ORAI2_ENST00000488996.1_Intron|ORAI2_ENST00000403646.3_Missense_Mutation_p.S40F|ORAI2_ENST00000473939.1_Missense_Mutation_p.S40F|ORAI2_ENST00000478730.2_Missense_Mutation_p.S40F	NM_001126340.1|NM_001271818.1|NM_001271819.1|NM_032831.3	NP_001119812.1|NP_001258747.1|NP_001258748.1|NP_116220.1	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator 2	40						growth cone (GO:0030426)|integral component of membrane (GO:0016021)		p.S40F(1)		autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15						CTGGTCACCTCTAACCACCAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	76.0	81.0					7																	102079522		2203	4300	6503	101866527	SO:0001583	missense	80228			AF258552	CCDS5722.1	7q22.1	2007-08-14	2007-08-14	2007-08-14	ENSG00000160991	ENSG00000160991		"""ORAI calcium release-activated calcium modulators"""	21667	protein-coding gene	gene with protein product	"""CAP-binding protein complex interacting protein 2"""	610929	"""chromosome 7 open reading frame 19"", ""transmembrane protein 142B"""	C7orf19, TMEM142B		16582901	Standard	NM_001126340		Approved	CBCIP2, FLJ12474, FLJ14733, H_NH0514P08.8	uc003uzj.3	Q96SN7	OTTHUMG00000157722	ENST00000356387.2:c.119C>T	7.37:g.102079522C>T	ENSP00000348752:p.Ser40Phe	Unknown		x	x	x	101866527	Q6IA68|Q8WY94|Q9H9Y3	Missense_Mutation	SNP	ENST00000356387.2	37	CCDS5722.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142524	0.77888	.	.	ENSG00000160991	ENST00000495936;ENST00000356387;ENST00000478730;ENST00000468241;ENST00000403646;ENST00000498661;ENST00000473939	T;T;T;T;T;T;T	0.47869	1.44;1.44;1.44;1.43;1.44;0.83;1.44	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.32585	0.0834	N	0.24115	0.695	0.58432	D	0.99999	P	0.40302	0.712	B	0.34824	0.19	T	0.12319	-1.0552	9	.	.	.	-3.2051	16.4438	0.83909	0.0:1.0:0.0:0.0	.	40	Q96SN7	ORAI2_HUMAN	F	40	ENSP00000420178:S40F;ENSP00000348752:S40F;ENSP00000418140:S40F;ENSP00000417407:S40F;ENSP00000385489:S40F;ENSP00000418464:S40F;ENSP00000417928:S40F	.	S	+	2	0	ORAI2	101866527	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.712000	0.61888	2.349000	0.79799	0.563000	0.77884	TCT		0.647	ORAI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349509.2	NM_032831		Missense_Mutation
SNTG1	54212	broad.mit.edu	37	8	51449297	51449297	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr8:51449297G>A	ENST00000522124.1	+	11	1270	c.609G>A	c.(607-609)tgG>tgA	p.W203*	SNTG1_ENST00000276467.5_Nonsense_Mutation_p.W203*|SNTG1_ENST00000518864.1_Nonsense_Mutation_p.W203*|SNTG1_ENST00000517473.1_Nonsense_Mutation_p.W203*	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	203					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.W203*(2)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AGAAGCGATGGTGCGACCTCA	0.483																																																2	Substitution - Nonsense(2)	ovary(2)	8											216.0	190.0	199.0					8																	51449297		2203	4300	6503	51611850	SO:0001587	stop_gained	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.609G>A	8.37:g.51449297G>A	ENSP00000429842:p.Trp203*	Unknown		x	x	x	51611850	Q2M3Q0|Q9NY98	Nonsense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	39	7.504329	0.98325	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4512	0.83991	0.0:0.0:1.0:0.0	.	.	.	.	X	203	.	ENSP00000276467:W203X	W	+	3	0	SNTG1	51611850	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	8.094000	0.89533	2.223000	0.72356	0.491000	0.48974	TGG		0.483	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			Nonsense_Mutation
ZNF7	7553	broad.mit.edu	37	8	146068062	146068062	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chr8:146068062C>T	ENST00000528372.1	+	5	1810	c.1570C>T	c.(1570-1572)Ccc>Tcc	p.P524S	ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.P428S|ZNF7_ENST00000446747.2_Missense_Mutation_p.P535S|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000325241.6_Missense_Mutation_p.P524S			P17097	ZNF7_HUMAN	zinc finger protein 7	524					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P524S(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AGGAGAGAAGCCCTACGAATG	0.448																																																1	Substitution - Missense(1)	ovary(1)	8											79.0	85.0	83.0					8																	146068062		2203	4300	6503	146038866	SO:0001583	missense	7553			AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1570C>T	8.37:g.146068062C>T	ENSP00000432724:p.Pro524Ser	Unknown		x	x	x	146038866	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	37	CCDS6435.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671079	0.67814	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.28454	1.61;1.61;1.61;1.61	4.75	4.75	0.60458	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000274	T	0.50154	0.1599	L	0.54863	1.705	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.984	T	0.42241	-0.9463	9	.	.	.	-16.9102	16.6673	0.85256	0.0:1.0:0.0:0.0	.	535;524	B4DT08;P17097	.;ZNF7_HUMAN	S	524;535;428;524	ENSP00000320627:P524S;ENSP00000393260:P535S;ENSP00000439424:P428S;ENSP00000432724:P524S	.	P	+	1	0	ZNF7	146038866	0.621000	0.27077	0.942000	0.38095	0.866000	0.49608	2.500000	0.45381	2.462000	0.83206	0.655000	0.94253	CCC		0.448	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416		Missense_Mutation
ACRC	93953	broad.mit.edu	37	X	70823893	70823893	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0899-01	TCGA-13-0899-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0899-01	TCGA-13-0899-10	g.chrX:70823893G>A	ENST00000373695.1	+	7	1303	c.766G>A	c.(766-768)Gac>Aac	p.D256N	ACRC_ENST00000373696.3_Missense_Mutation_p.D256N			Q96QF7	ACRC_HUMAN	acidic repeat containing	256	Asp/Ser-rich.					nucleus (GO:0005634)		p.D256N(1)		autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					GGAAGCTCCCGACGACAGCAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	X											36.0	33.0	34.0					X																	70823893		1532	3179	4711	70740618	SO:0001583	missense	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.766G>A	X.37:g.70823893G>A	ENSP00000362799:p.Asp256Asn	Unknown		x	x	x	70740618	B9EG62	Missense_Mutation	SNP	ENST00000373695.1	37	CCDS35326.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396470	0.25205	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.37752	1.18;1.18	0.14	0.14	0.14804	.	.	.	.	.	T	0.17704	0.0425	N	0.19112	0.55	0.09310	N	1	D	0.57571	0.98	B	0.37780	0.258	T	0.13629	-1.0502	9	0.36615	T	0.2	.	5.9727	0.19361	6.0E-4:0.0:0.9994:0.0	.	256	Q96QF7	ACRC_HUMAN	N	256	ENSP00000362800:D256N;ENSP00000362799:D256N	ENSP00000362799:D256N	D	+	1	0	ACRC	70740618	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	0.108000	0.15396	0.168000	0.19655	0.169000	0.16792	GAC		0.562	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081856.1			Missense_Mutation
