#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CHL1	10752	genome.wustl.edu	37	3	443318	443318	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:443318A>T	ENST00000256509.2	+	27	4037	c.3395A>T	c.(3394-3396)aAg>aTg	p.K1132M	CHL1_ENST00000397491.2_Missense_Mutation_p.K1116M	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.K1132M(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GTTAAAGAAAAGGAAGATTTG	0.313																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	69.0	68.0					3																	443318		2203	4297	6500	418318	SO:0001583	missense	10752			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.3395A>T	3.37:g.443318A>T	ENSP00000256509:p.Lys1132Met	Somatic		Capture	Illumina GAIIx	4	418318	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	CCDS2556.1	SNP	3	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.97|19.97	3.926008|3.926008	0.73327|0.73327	.|.	.|.	ENSG00000134121|ENSG00000134121	ENST00000256509;ENST00000397491|ENST00000445697	D;D|.	0.89681|.	-2.55;-2.55|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80292|0.80292	0.4596|0.4596	M|M	0.88450|0.88450	2.955|2.955	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	D|D	0.83927|0.83927	0.0304|0.0304	10|5	0.87932|.	D|.	0|.	.|.	15.0817|15.0817	0.72119|0.72119	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1116;1132|.	O00533;O00533-2|.	CHL1_HUMAN;.|.	M|W	1132;1116|266	ENSP00000256509:K1132M;ENSP00000380628:K1116M|.	ENSP00000256509:K1132M|.	K|R	+|+	2|1	0|2	CHL1|CHL1	418318|418318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.766000|0.766000	0.43426|0.43426	8.233000|8.233000	0.89799|0.89799	1.960000|1.960000	0.56953|0.56953	0.482000|0.482000	0.46254|0.46254	AAG|AGG		0.313	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		Missense_Mutation
SDCBP2	27111	genome.wustl.edu	37	20	1301033	1301033	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:1301033C>G	ENST00000360779.3	-	2	201	c.28G>C	c.(28-30)Gac>Cac	p.D10H	SDCBP2_ENST00000381812.1_Missense_Mutation_p.D10H|SDCBP2_ENST00000339987.3_Missense_Mutation_p.D10H	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	10					intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D10H(1)		endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						ACTTTTAGGTCCTCTAGAGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	20											159.0	153.0	155.0					20																	1301033		1951	4136	6087	1249033	SO:0001583	missense	27111			AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.28G>C	20.37:g.1301033C>G	ENSP00000354013:p.Asp10His	Somatic		Capture	Illumina GAIIx	4	1249033	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	37	CCDS42848.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091569	0.55968	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.52754	0.65;0.65;0.65	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.72382	0.3453	M	0.86268	2.805	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.77867	-0.2428	10	0.87932	D	0	-6.042	16.8536	0.86000	0.0:1.0:0.0:0.0	.	10;10	B4DKI5;Q9H190	.;SDCB2_HUMAN	H	10	ENSP00000371233:D10H;ENSP00000354013:D10H;ENSP00000342935:D10H	ENSP00000342935:D10H	D	-	1	0	SDCBP2	1249033	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	6.380000	0.73158	2.507000	0.84556	0.561000	0.74099	GAC		0.557	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489		Missense_Mutation
SLC23A2	9962	genome.wustl.edu	37	20	4883179	4883179	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:4883179C>G	ENST00000379333.1	-	5	625	c.233G>C	c.(232-234)aGc>aCc	p.S78T	SLC23A2_ENST00000338244.1_Missense_Mutation_p.S78T|SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000424750.2_Missense_Mutation_p.S78T	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	78					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.S78T(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						ACTGCCAGTGCTATCCAGGGT	0.512																																																1	Substitution - Missense(1)	ovary(1)	20											80.0	78.0	78.0					20																	4883179		2203	4300	6503	4831179	SO:0001583	missense	9962			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.233G>C	20.37:g.4883179C>G	ENSP00000368637:p.Ser78Thr	Somatic		Capture	Illumina GAIIx	4	4831179	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032406	0.54790	.	.	ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750	T;T;T	0.18657	2.24;2.24;2.2	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.15132	0.0365	N	0.24115	0.695	0.34205	D	0.673571	B;B;B	0.27882	0.192;0.031;0.031	B;B;B	0.24006	0.05;0.01;0.01	T	0.14282	-1.0478	10	0.15499	T	0.54	-20.4667	17.3301	0.87259	0.0:1.0:0.0:0.0	.	78;78;78	B4DJZ1;A0MSJ5;Q9UGH3	.;.;S23A2_HUMAN	T	78	ENSP00000368637:S78T;ENSP00000344322:S78T;ENSP00000406601:S78T	ENSP00000344322:S78T	S	-	2	0	SLC23A2	4831179	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.798000	0.85924	2.430000	0.82344	0.643000	0.83706	AGC		0.512	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1			Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0903-01	TCGA-13-0903-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	17											136.0	121.0	126.0					17																	7578235		2203	4300	6503	7518960	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys	Somatic		Capture	Illumina GAIIx	4	7518960	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	WashU	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
STK33	65975	genome.wustl.edu	37	11	8414132	8414132	+	Silent	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr11:8414132C>T	ENST00000447869.1	-	12	2388	c.1470G>A	c.(1468-1470)gtG>gtA	p.V490V	STK33_ENST00000473980.1_5'UTR|STK33_ENST00000396672.1_Silent_p.V490V|STK33_ENST00000534493.1_Silent_p.V449V|STK33_ENST00000358872.3_Silent_p.V303V|STK33_ENST00000315204.1_Silent_p.V490V|STK33_ENST00000396673.1_Silent_p.V424V			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	490					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.V490V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		GGCTTGGAGTCACAGGGGTTT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	11											208.0	195.0	199.0					11																	8414132		2201	4296	6497	8370708	SO:0001819	synonymous_variant	65975			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1470G>A	11.37:g.8414132C>T		Somatic		Capture	Illumina GAIIx	4	8370708	Q658S6|Q8NEF5	Silent	SNP	ENST00000447869.1	37	CCDS7789.1	SNP	29	WashU																																																																																				0.473	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	NM_030906		Silent
DOCK6	57572	genome.wustl.edu	37	19	11311437	11311437	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr19:11311437C>T	ENST00000294618.7	-	46	5905	c.5894G>A	c.(5893-5895)cGg>cAg	p.R1965Q	DOCK6_ENST00000319867.7_Missense_Mutation_p.R1304Q|DOCK6_ENST00000586702.1_5'UTR|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1965	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.R1967Q(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GTTGTGATGCCGGAAGAGCTT	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											45.0	44.0	44.0					19																	11311437		1894	4116	6010	11172437	SO:0001583	missense	57572				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5894G>A	19.37:g.11311437C>T	ENSP00000294618:p.Arg1965Gln	Somatic		Capture	Illumina GAIIx	4	11172437	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	36	5.604675	0.96626	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.17528	2.27;2.27	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.33469	0.0864	L	0.43152	1.355	0.80722	D	1	D;P;D	0.76494	0.997;0.89;0.999	P;P;D	0.69654	0.873;0.478;0.965	T	0.09400	-1.0676	10	0.72032	D	0.01	-22.0202	15.8801	0.79197	0.0:1.0:0.0:0.0	.	1304;1965;1304	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	Q	1965;1304	ENSP00000294618:R1965Q;ENSP00000321556:R1304Q	ENSP00000294618:R1965Q	R	-	2	0	DOCK6	11172437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.695000	0.84257	2.026000	0.59711	0.650000	0.86243	CGG		0.592	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812		Missense_Mutation
DNAH9	1770	genome.wustl.edu	37	17	11808979	11808979	+	Splice_Site	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr17:11808979G>T	ENST00000262442.4	+	61	11670	c.11602G>T	c.(11602-11604)Gat>Tat	p.D3868Y	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Splice_Site_p.D180Y|DNAH9_ENST00000454412.2_Splice_Site_p.D3868Y	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3868	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.D3868Y(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCTGGCAGAGATTTTGTTGA	0.378																																																1	Substitution - Missense(1)	ovary(1)	17											70.0	73.0	72.0					17																	11808979		2203	4300	6503	11749704	SO:0001630	splice_region_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11601-1G>T	17.37:g.11808979G>T		Somatic		Capture	Illumina GAIIx	4	11749704	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	8.294	0.818287	0.16607	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.09073	3.02;3.02;3.02	4.67	3.7	0.42460	Dynein heavy chain (1);	0.154328	0.56097	D	0.000032	T	0.11324	0.0276	M	0.67700	2.07	0.80722	D	1	B;B	0.17852	0.002;0.024	B;B	0.21546	0.009;0.035	T	0.03473	-1.1033	10	0.51188	T	0.08	.	9.731	0.40361	0.1594:0.0:0.8406:0.0	.	221;3868	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	Y	3868;3868;2450;180;221	ENSP00000262442:D3868Y;ENSP00000414874:D3868Y;ENSP00000379323:D180Y	ENSP00000262442:D3868Y	D	+	1	0	DNAH9	11749704	1.000000	0.71417	1.000000	0.80357	0.276000	0.26787	2.274000	0.43390	1.323000	0.45263	-0.137000	0.14449	GAT		0.378	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	Missense_Mutation	Missense_Mutation
LIPI	149998	genome.wustl.edu	37	21	15535806	15535806	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0903-01	TCGA-13-0903-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr21:15535806T>A	ENST00000536861.1	-	7	939	c.940A>T	c.(940-942)Agg>Tgg	p.R314W	LIPI_ENST00000344577.2_Missense_Mutation_p.R335W			Q6XZB0	LIPI_HUMAN	lipase, member I	314					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)	p.R335W(1)		endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		CCTTCCATCCTTTCTTTTAAA	0.299																																																1	Substitution - Missense(1)	ovary(1)	21											106.0	114.0	112.0					21																	15535806		2203	4297	6500	14457677	SO:0001583	missense	149998			BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.940A>T	21.37:g.15535806T>A	ENSP00000440381:p.Arg314Trp	Somatic		Capture	Illumina GAIIx	4	14457677	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666533	0.47677	.	.	ENSG00000188992	ENST00000344577;ENST00000536861	D;D	0.88975	-2.45;-2.43	5.12	2.74	0.32292	.	0.879656	0.09618	N	0.777943	D	0.92172	0.7518	M	0.75884	2.315	0.09310	N	1	D	0.65815	0.995	P	0.60789	0.879	T	0.80679	-0.1275	10	0.87932	D	0	.	6.052	0.19790	0.0:0.0858:0.1649:0.7493	.	335	Q6XZB0-2	.	W	335;314	ENSP00000343331:R335W;ENSP00000440381:R314W	ENSP00000343331:R335W	R	-	1	2	LIPI	14457677	0.007000	0.16637	0.014000	0.15608	0.005000	0.04900	0.875000	0.28079	0.369000	0.24510	-0.389000	0.06534	AGG		0.299	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996		Missense_Mutation
CYP4F3	4051	genome.wustl.edu	37	19	15756570	15756570	+	Silent	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr19:15756570G>A	ENST00000221307.8	+	3	287	c.240G>A	c.(238-240)ctG>ctA	p.L80L	CYP4F3_ENST00000591058.1_Intron|CYP4F3_ENST00000585846.1_Intron|CYP4F3_ENST00000586182.2_Intron	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	80					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)	p.L80L(1)		endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CACAAAGCCTGGCATGCACCT	0.557																																																1	Substitution - coding silent(1)	ovary(1)	19											127.0	119.0	122.0					19																	15756570		2203	4300	6503	15617570	SO:0001819	synonymous_variant	4051			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.240G>A	19.37:g.15756570G>A		Somatic		Capture	Illumina GAIIx	4	15617570	B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	CCDS12332.1	SNP	47	WashU																																																																																				0.557	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896		Silent
SATB1	6304	genome.wustl.edu	37	3	18436359	18436359	+	Silent	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:18436359G>C	ENST00000338745.6	-	7	2535	c.801C>G	c.(799-801)gtC>gtG	p.V267V	SATB1_ENST00000475083.1_5'Flank|SATB1_ENST00000454909.2_Silent_p.V267V|SATB1_ENST00000417717.2_Silent_p.V267V|TBC1D5_ENST00000414318.2_Intron	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	267	Nuclear matrix targeting sequence (NMTS).				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V267V(1)		NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GGCCAAAATTGACATGATTGG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	3											75.0	66.0	69.0					3																	18436359		2203	4300	6503	18411363	SO:0001819	synonymous_variant	6304				CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.801C>G	3.37:g.18436359G>C		Somatic		Capture	Illumina GAIIx	4	18411363	B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	37	CCDS2631.1	SNP	45	WashU																																																																																				0.517	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010		Silent
SEC23B	10483	genome.wustl.edu	37	20	18496360	18496360	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:18496360A>C	ENST00000336714.3	+	4	778	c.346A>C	c.(346-348)Aca>Cca	p.T116P	SEC23B_ENST00000494645.1_3'UTR|SEC23B_ENST00000377475.3_Missense_Mutation_p.T116P|SEC23B_ENST00000377465.1_Missense_Mutation_p.T116P|SEC23B_ENST00000262544.2_Missense_Mutation_p.T116P	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	116					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.T116P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						CCAGTTTTCTACAATTGAGTA	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											175.0	125.0	142.0					20																	18496360		2203	4300	6503	18444360	SO:0001583	missense	10483			X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.346A>C	20.37:g.18496360A>C	ENSP00000338844:p.Thr116Pro	Somatic		Capture	Illumina GAIIx	4	18444360	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	37	CCDS13137.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	26.4	4.736438	0.89482	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.04	5.04	0.67666	Zinc finger, Sec23/Sec24-type (1);	0.000000	0.85682	D	0.000000	D	0.94653	0.8276	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.96	D	0.96106	0.9073	10	0.87932	D	0	-15.7323	14.4009	0.67044	1.0:0.0:0.0:0.0	.	116;116	B4DJW8;Q15437	.;SC23B_HUMAN	P	116	ENSP00000403971:T116P;ENSP00000338844:T116P;ENSP00000262544:T116P;ENSP00000366695:T116P;ENSP00000366685:T116P	ENSP00000262544:T116P	T	+	1	0	SEC23B	18444360	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	8.929000	0.92859	2.241000	0.73720	0.528000	0.53228	ACA		0.378	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5			Missense_Mutation
OR4L1	122742	genome.wustl.edu	37	14	20529108	20529108	+	Missense_Mutation	SNP	G	G	T	rs144249994	byFrequency	TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr14:20529108G>T	ENST00000315683.1	+	1	905	c.905G>T	c.(904-906)cGg>cTg	p.R302L		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R302L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AGAAAATTACGGTTCCAATAT	0.303																																																1	Substitution - Missense(1)	ovary(1)	14											51.0	57.0	55.0					14																	20529108		2203	4298	6501	19598948	SO:0001583	missense	122742				CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.905G>T	14.37:g.20529108G>T	ENSP00000319217:p.Arg302Leu	Somatic		Capture	Illumina GAIIx	4	19598948	Q6IEZ5	Missense_Mutation	SNP	ENST00000315683.1	37	CCDS32029.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	.	0.958	-0.704240	0.03255	.	.	ENSG00000176246	ENST00000315683	T	0.26660	1.72	4.37	-8.75	0.00834	.	2.575630	0.01495	N	0.017262	T	0.05640	0.0148	N	0.00427	-1.505	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.26155	-1.0111	10	0.11485	T	0.65	.	7.2034	0.25893	0.5851:0.0:0.1268:0.2881	.	302	Q8NH43	OR4L1_HUMAN	L	302	ENSP00000319217:R302L	ENSP00000319217:R302L	R	+	2	0	OR4L1	19598948	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.435000	0.02423	-2.238000	0.00712	-2.498000	0.00192	CGG		0.303	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1			Missense_Mutation
SLCO1C1	53919	genome.wustl.edu	37	12	20890148	20890149	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-13-0903-01	TCGA-13-0903-10	CA	CA	CA	AG	CA	CA	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr12:20890148_20890149CA>AG	ENST00000266509.2	+	11	1858_1859	c.1490_1491CA>AG	c.(1489-1491)aCA>aAG	p.T497K	SLCO1C1_ENST00000545102.1_Missense_Mutation_p.T379K|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.T497K|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.T497K|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.T448K	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	497	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	AATGGAATCACATATGTATCAG	0.411																																																0			12																																								20781416	SO:0001583	missense	53919			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	Exception_encountered	12.37:g.20890148_20890149delinsAG	ENSP00000266509:p.Thr497Lys	Somatic		Capture	Illumina GAIIx	4	20781415	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense	DNP	ENST00000266509.2	37	CCDS8683.1	DNP	17	WashU																																																																																				0.411	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435		Missense
FOXA2	3170	genome.wustl.edu	37	20	22563343	22563343	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:22563343C>A	ENST00000377115.4	-	3	700	c.519G>T	c.(517-519)caG>caT	p.Q173H	FOXA2_ENST00000419308.2_Missense_Mutation_p.Q179H	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	173					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q173H(1)		breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					TGGGGCTCTGCTGGATGGCCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											127.0	110.0	116.0					20																	22563343		2203	4300	6503	22511343	SO:0001583	missense	3170			AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.519G>T	20.37:g.22563343C>A	ENSP00000366319:p.Gln173His	Somatic		Capture	Illumina GAIIx	4	22511343	Q8WUW4|Q96DF7	Missense_Mutation	SNP	ENST00000377115.4	37	CCDS13147.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	19.64	3.864828	0.71949	.	.	ENSG00000125798	ENST00000377115;ENST00000419308;ENST00000319993;ENST00000444877	D;D;D	0.95690	-3.78;-3.78;-3.78	4.98	4.02	0.46733	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.64402	U	0.000018	D	0.95364	0.8495	M	0.79693	2.465	0.80722	D	1	P;B	0.35600	0.511;0.273	B;B	0.40199	0.239;0.322	D	0.96047	0.9028	10	0.87932	D	0	.	13.4035	0.60898	0.0:0.9206:0.0:0.0794	.	173;179	Q9Y261;B0ZTD4	FOXA2_HUMAN;.	H	173;173;179;59	ENSP00000366319:Q173H;ENSP00000400341:Q173H;ENSP00000315955:Q179H	ENSP00000315955:Q179H	Q	-	3	2	FOXA2	22511343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.299000	0.51826	2.304000	0.77564	0.574000	0.79327	CAG		0.622	FOXA2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078289.1			Missense_Mutation
ZNF723P	646864	genome.wustl.edu	37	19	23040689	23040689	+	IGR	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr19:23040689G>A								ZNF99 (73780 upstream) : CTD-2579N5.3 (49198 downstream)																							CTACACATAAGAGAATTCATA	0.403																																																0			19																																								22832529	SO:0001628	intergenic_variant	646864																															19.37:g.23040689G>A		Somatic		Capture	Illumina GAIIx	4	22832529		Silent	SNP		37		SNP	33	WashU																																																																																			0	0.403									Silent
ATAD2B	54454	genome.wustl.edu	37	2	24092546	24092546	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0903-01	TCGA-13-0903-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:24092546T>C	ENST00000238789.5	-	9	1406	c.1063A>G	c.(1063-1065)Aga>Gga	p.R355G		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	355						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)	p.R355G(1)		central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCTTGCTCTTGCCATGCTC	0.318																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	103.0	110.0					2																	24092546		1828	4081	5909	23946050	SO:0001583	missense	54454			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1063A>G	2.37:g.24092546T>C	ENSP00000238789:p.Arg355Gly	Somatic		Capture	Illumina GAIIx	4	23946050	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	19.49	3.838171	0.71373	.	.	ENSG00000119778	ENST00000238789;ENST00000442596;ENST00000439915	D;T	0.92699	-3.09;0.05	5.3	4.07	0.47477	.	.	.	.	.	D	0.92391	0.7585	L	0.42245	1.32	0.43377	D	0.995475	D;P	0.65815	0.995;0.895	P;P	0.61800	0.894;0.652	D	0.90134	0.4208	9	0.25106	T	0.35	.	12.8662	0.57941	0.0:0.0:0.1349:0.865	.	369;355	C9JG15;Q9ULI0	.;ATD2B_HUMAN	G	355;207;369	ENSP00000238789:R355G;ENSP00000403177:R369G	ENSP00000238789:R355G	R	-	1	2	ATAD2B	23946050	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.087000	0.50167	2.145000	0.66743	0.454000	0.30748	AGA		0.318	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552		Missense_Mutation
MFSD2B	388931	genome.wustl.edu	37	2	24239080	24239080	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:24239080G>T	ENST00000406420.3	+	3	293	c.277G>T	c.(277-279)Gct>Tct	p.A93S	MFSD2B_ENST00000338315.4_Missense_Mutation_p.A93S	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	93					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.A93S(1)		cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						GTCTGGGGCGGCTGCTGACCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											48.0	52.0	51.0					2																	24239080		1921	4118	6039	24092584	SO:0001583	missense	388931				CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.277G>T	2.37:g.24239080G>T	ENSP00000385527:p.Ala93Ser	Somatic		Capture	Illumina GAIIx	4	24092584	B5MC32	Missense_Mutation	SNP	ENST00000406420.3	37	CCDS46228.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604613	0.87157	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	D;D	0.87571	-2.27;-2.27	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);	0.231774	0.34750	U	0.003714	D	0.83755	0.5323	L	0.36672	1.1	0.26112	N	0.980679	P	0.37276	0.589	B	0.43018	0.405	T	0.79366	-0.1833	10	0.72032	D	0.01	-6.9471	10.5369	0.45009	0.0884:0.0:0.9116:0.0	.	93	A6NFX1	MFS2B_HUMAN	S	93	ENSP00000385527:A93S;ENSP00000342501:A93S	ENSP00000342501:A93S	A	+	1	0	MFSD2B	24092584	0.062000	0.20869	1.000000	0.80357	0.976000	0.68499	1.115000	0.31209	2.721000	0.93114	0.511000	0.50034	GCT		0.597	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000324307.1	NM_001080473		Missense_Mutation
GOLGA8M	653720	genome.wustl.edu	37	15	28952979	28952979	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr15:28952979C>T	ENST00000563027.1	-	8	505	c.506G>A	c.(505-507)cGc>cAc	p.R169H	GOLGA8M_ENST00000563213.1_5'Flank|GOLGA8M_ENST00000340249.3_Missense_Mutation_p.R88H					golgin A8 family, member M																		ATGTTGCAGGCGGACAGCCAG	0.512																																																0			15																																								26752020	SO:0001583	missense	653720				CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000563027.1:c.506G>A	15.37:g.28952979C>T	ENSP00000456927:p.Arg169His	Somatic		Capture	Illumina GAIIx	4	26752020		Missense_Mutation	SNP	ENST00000563027.1	37		SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	.	5.094	0.203074	0.09704	.	.	ENSG00000188626	ENST00000340249	T	0.22134	1.97	0.798	-0.208	0.13185	.	.	.	.	.	T	0.26629	0.0651	M	0.74258	2.255	0.09310	N	1	.	.	.	.	.	.	T	0.24476	-1.0159	7	0.31617	T	0.26	.	5.226	0.15396	0.0:0.7656:0.0:0.2344	.	.	.	.	H	88	ENSP00000344295:R88H	ENSP00000344295:R88H	R	-	2	0	AC055876.1	26752020	0.984000	0.35163	0.013000	0.15412	0.004000	0.04260	0.954000	0.29175	-0.075000	0.12798	-1.206000	0.01644	CGC		0.512	GOLGA8M-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000431777.1			Missense_Mutation
GTF3C1	2975	genome.wustl.edu	37	16	27509110	27509110	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr16:27509110C>T	ENST00000356183.4	-	14	2213	c.2198G>A	c.(2197-2199)gGg>gAg	p.G733E	GTF3C1_ENST00000561623.1_Missense_Mutation_p.G733E	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	733					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.G733E(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TTCTGCCTCCCCTTGGGGCAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	16											99.0	93.0	95.0					16																	27509110		2197	4300	6497	27416611	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2198G>A	16.37:g.27509110C>T	ENSP00000348510:p.Gly733Glu	Somatic		Capture	Illumina GAIIx	4	27416611	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	1.308	-0.603029	0.03744	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.19806	2.12	5.69	-5.9	0.02275	.	0.738886	0.13321	N	0.396656	T	0.04452	0.0122	N	0.02213	-0.635	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.33777	-0.9855	10	0.02654	T	1	-25.6014	4.9016	0.13777	0.1007:0.1894:0.1011:0.6088	.	733;733	Q12789;Q12789-3	TF3C1_HUMAN;.	E	733;731	ENSP00000348510:G733E	ENSP00000348510:G733E	G	-	2	0	GTF3C1	27416611	0.001000	0.12720	0.002000	0.10522	0.872000	0.50106	-0.363000	0.07593	-0.987000	0.03494	-0.142000	0.14014	GGG		0.473	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520		Missense_Mutation
CPVL	54504	genome.wustl.edu	37	7	29111387	29111387	+	Splice_Site	SNP	A	A	C			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr7:29111387A>C	ENST00000409850.1	-	13	1511		c.e13+1		CPVL_ENST00000396276.3_Splice_Site|CPVL_ENST00000265394.5_Splice_Site			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like							extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)	p.?(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						CCCAGAACTCACTTCAAAGGC	0.488																																																1	Unknown(1)	ovary(1)	7											96.0	87.0	90.0					7																	29111387		2203	4300	6503	29077912	SO:0001630	splice_region_variant	54504			AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.864+1T>G	7.37:g.29111387A>C		Somatic		Capture	Illumina GAIIx	4	29077912	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Splice_Site_SNP	SNP	ENST00000409850.1	37	CCDS5419.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809409	0.70797	.	.	ENSG00000106066	ENST00000265394;ENST00000396276;ENST00000432534;ENST00000455893;ENST00000409850;ENST00000542995;ENST00000448959	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.851	0.70297	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CPVL	29077912	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.339000	0.90041	2.150000	0.67090	0.482000	0.46254	.		0.488	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029	Intron	Splice_Site_SNP
MECR	51102	genome.wustl.edu	37	1	29522725	29522725	+	Silent	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:29522725G>A	ENST00000263702.6	-	8	901	c.876C>T	c.(874-876)ccC>ccT	p.P292P	MECR_ENST00000373791.3_Silent_p.P216P			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	292					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)	p.P292P(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		AGGCTACGACGGGCTGCTTGG	0.597																																																1	Substitution - coding silent(1)	ovary(1)	1											61.0	58.0	59.0					1																	29522725		2203	4300	6503	29395312	SO:0001819	synonymous_variant	51102				CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.876C>T	1.37:g.29522725G>A		Somatic		Capture	Illumina GAIIx	4	29395312	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722162	0.30503	.	.	ENSG00000116353	ENST00000373792;ENST00000453185	.	.	.	5.18	-5.13	0.02884	.	.	.	.	.	T	0.55033	0.1895	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61569	-0.7036	5	0.87932	D	0	.	5.4374	0.16488	0.5502:0.0:0.2158:0.234	.	.	.	.	C	253;180	.	ENSP00000362897:R253C	R	-	1	0	MECR	29395312	0.000000	0.05858	0.662000	0.29724	0.946000	0.59487	-2.516000	0.00954	-0.703000	0.05049	0.561000	0.74099	CGT		0.597	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011		Missense_Mutation
ITGAL	3683	genome.wustl.edu	37	16	30486634	30486634	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr16:30486634G>A	ENST00000356798.6	+	3	352	c.172G>A	c.(172-174)Gtg>Atg	p.V58M	ITGAL_ENST00000454514.2_Missense_Mutation_p.V58M|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000358164.5_Missense_Mutation_p.V58M|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	58					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.V58M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CAGGGTCATCGTGGGAGCTCC	0.572																																					NSCLC(110;1462 1641 3311 33990 49495)											1	Substitution - Missense(1)	ovary(1)	16											84.0	86.0	85.0					16																	30486634		2197	4300	6497	30394135	SO:0001583	missense	3683				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.172G>A	16.37:g.30486634G>A	ENSP00000349252:p.Val58Met	Somatic		Capture	Illumina GAIIx	4	30394135	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083529	0.76642	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000454514	D;T;D	0.95482	-3.72;-1.04;-3.72	5.55	5.55	0.83447	.	0.000000	0.51477	D	0.000094	D	0.98002	0.9342	M	0.89968	3.075	0.44395	D	0.997304	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98344	1.0540	10	0.87932	D	0	.	14.8857	0.70567	0.0:0.0:1.0:0.0	.	58;58	Q96HB1;P20701	.;ITAL_HUMAN	M	58	ENSP00000349252:V58M;ENSP00000350886:V58M;ENSP00000408615:V58M	ENSP00000349252:V58M	V	+	1	0	ITGAL	30394135	0.998000	0.40836	0.980000	0.43619	0.698000	0.40448	3.447000	0.52936	2.894000	0.99253	0.591000	0.81541	GTG		0.572	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2			Missense_Mutation
LARGE	9215	genome.wustl.edu	37	22	33712112	33712112	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr22:33712112G>C	ENST00000354992.2	-	12	1981	c.1410C>G	c.(1408-1410)gaC>gaG	p.D470E	LARGE_ENST00000452586.2_Missense_Mutation_p.D269E|LARGE_ENST00000402320.1_Missense_Mutation_p.D418E|LARGE_ENST00000397394.2_Missense_Mutation_p.D470E|LARGE_ENST00000437602.2_Missense_Mutation_p.D470E|LARGE_ENST00000337431.2_Missense_Mutation_p.D418E	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	470					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.D470E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CGTCCGTGCTGTCTGCTGCAG	0.607																																					Colon(70;397 1175 4573 19089 45288)											1	Substitution - Missense(1)	ovary(1)	22											142.0	103.0	116.0					22																	33712112		2203	4300	6503	32042112	SO:0001583	missense	9215			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1410C>G	22.37:g.33712112G>C	ENSP00000347088:p.Asp470Glu	Somatic		Capture	Illumina GAIIx	4	32042112	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	6.741	0.505488	0.12822	.	.	ENSG00000133424	ENST00000443693;ENST00000429788;ENST00000445431;ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.54279	1.05;1.07;1.05;1.07;0.62;0.58	5.26	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	L	0.35723	1.085	0.58432	D	0.999994	B;B;B;B	0.19706	0.038;0.002;0.013;0.017	B;B;B;B	0.17979	0.013;0.008;0.02;0.013	T	0.16394	-1.0404	10	0.17832	T	0.49	2.7168	10.9792	0.47483	0.1498:0.0:0.8502:0.0	.	470;269;418;470	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	E	147;147;147;470;418;470;418;269;470	ENSP00000347088:D470E;ENSP00000336636:D418E;ENSP00000380549:D470E;ENSP00000385223:D418E;ENSP00000407917:D269E;ENSP00000388544:D470E	ENSP00000336636:D418E	D	-	3	2	LARGE	32042112	1.000000	0.71417	0.418000	0.26571	0.053000	0.15095	2.511000	0.45476	1.225000	0.43566	-0.136000	0.14681	GAC		0.607	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642		Missense_Mutation
NOTCH4	4855	genome.wustl.edu	37	6	32188798	32188798	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr6:32188798C>T	ENST00000375023.3	-	4	894	c.756G>A	c.(754-756)atG>atA	p.M252I		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	252	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.M252I(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTTTCTCTGGCATCAGCTGGC	0.657																																																1	Substitution - Missense(1)	ovary(1)	6											82.0	69.0	74.0					6																	32188798		1511	2709	4220	32296776	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.756G>A	6.37:g.32188798C>T	ENSP00000364163:p.Met252Ile	Somatic		Capture	Illumina GAIIx	4	32296776	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	5.899	0.349925	0.11182	.	.	ENSG00000204301	ENST00000375023	T	0.09163	3.01	4.74	-0.0803	0.13707	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.611312	0.13453	N	0.386756	T	0.01092	0.0036	N	0.01779	-0.725	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.19666	0.026;0.005	T	0.42783	-0.9431	10	0.22109	T	0.4	.	5.8924	0.18921	0.4623:0.2882:0.2495:0.0	.	252;252	Q6P3V5;Q99466	.;NOTC4_HUMAN	I	252	ENSP00000364163:M252I	ENSP00000364163:M252I	M	-	3	0	NOTCH4	32296776	0.014000	0.17966	0.978000	0.43139	0.464000	0.32679	-0.038000	0.12144	0.125000	0.18397	0.491000	0.48974	ATG		0.657	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2			Missense_Mutation
LINC00669	647946	genome.wustl.edu	37	18	36914917	36914917	+	lincRNA	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr18:36914917G>C	ENST00000591629.1	-	0	440					NR_024391.1				long intergenic non-protein coding RNA 669																		GACCCAGGACGTTGCCGCCCC	0.488																																																0			18																																								35168915						AK090603, BG220862, DB038664		18q12.2-q12.3	2012-10-12				ENSG00000267374		"""Long non-coding RNAs"""	44332	non-coding RNA	RNA, long non-coding							Standard	NR_024391		Approved		uc002lak.1				18.37:g.36914917G>C		Somatic		Capture	Illumina GAIIx	4	35168915		Missense_Mutation	SNP	ENST00000591629.1	37		SNP	40	WashU																																																																																				0.488	LINC00669-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000441462.1	NR_024391		Missense_Mutation
UNC5D	137970	genome.wustl.edu	37	8	35544091	35544091	+	Silent	SNP	A	A	G			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr8:35544091A>G	ENST00000404895.2	+	7	1276	c.948A>G	c.(946-948)gaA>gaG	p.E316E	UNC5D_ENST00000420357.1_Silent_p.E260E|UNC5D_ENST00000416672.1_Silent_p.E316E|UNC5D_ENST00000453357.2_Silent_p.E311E|UNC5D_ENST00000287272.2_Silent_p.E260E	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	316	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.E311E(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGTGGAGCGAATGGTCCGTCT	0.527																																																1	Substitution - coding silent(1)	ovary(1)	8											127.0	113.0	118.0					8																	35544091		2203	4300	6503	35663633	SO:0001819	synonymous_variant	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.948A>G	8.37:g.35544091A>G		Somatic		Capture	Illumina GAIIx	4	35663633	Q8WYP7	Silent	SNP	ENST00000404895.2	37	CCDS6093.2	SNP	4	WashU																																																																																				0.527	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2			Silent
CSNK1E	1454	genome.wustl.edu	37	22	38757523	38757523	+	5'UTR	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr22:38757523G>A	ENST00000400206.2	-	0	235				RP3-449O17.1_ENST00000457665.1_RNA			P49674	KC1E_HUMAN	casein kinase 1, epsilon						cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GGTCGGCAAGGACGAGAGTGA	0.289																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)											1	Unknown(1)	ovary(1)	22																																								37087469	SO:0001623	5_prime_UTR_variant	0				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000400206.2:c.-231C>T	22.37:g.38757523G>A		Somatic		Capture	Illumina GAIIx	4	37087469		Silent	SNP	ENST00000400206.2	37	CCDS13970.1	SNP	41	WashU																																																																																				0.289	CSNK1E-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321460.1	NM_001894		Silent
FAM21A	387680	genome.wustl.edu	37	10	47911108	47911108	+	Splice_Site	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr10:47911108G>C	ENST00000358474.5	+	12	976	c.976G>C	c.(976-978)Gga>Cga	p.G326R		NM_018232.1	NP_060702.1	Q5SNT6	FA21B_HUMAN		326					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.G326R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						TGTATTTTTAGGTAACATAAC	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											2.0	2.0	2.0					10																	47911108		651	2025	2676	47431114	SO:0001630	splice_region_variant	55747																														ENST00000358474.5:c.976+1G>C	10.37:g.47911108G>C		Somatic		Capture	Illumina GAIIx	4	47431114		Missense_Mutation	SNP	ENST00000358474.5	37	CCDS44379.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	.	9.487	1.099624	0.20552	.	.	ENSG00000152726	ENST00000358474;ENST00000535219;ENST00000355876	.	.	.	2.3	2.3	0.28687	.	0.098275	0.64402	D	0.000001	T	0.71091	0.3299	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.72625	0.978;0.963	T	0.72769	-0.4193	9	0.72032	D	0.01	-8.182	8.1604	0.31196	0.0:0.0:1.0:0.0	.	326;414	Q5SNT6;B7ZME8	FA21B_HUMAN;.	R	326;163;317	.	ENSP00000348138:G317R	G	+	1	0	FAM21B	47431114	1.000000	0.71417	0.993000	0.49108	0.458000	0.32498	5.848000	0.69458	1.299000	0.44798	0.152000	0.16155	GGA		0.358	FAM21B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047871.2		Missense_Mutation	Missense_Mutation
DPM1	8813	genome.wustl.edu	37	20	49575512	49575512	+	5'Flank	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:49575512C>A	ENST00000371588.5	-	0	0				MOCS3_ENST00000244051.1_Missense_Mutation_p.P45T|DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)	p.P45T(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						ACGGCTGGTTCCGGTGTCGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											32.0	39.0	37.0					20																	49575512		2142	4203	6345	49008919	SO:0001631	upstream_gene_variant	27304			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575512C>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	49008919	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777058	0.31411	.	.	ENSG00000124217	ENST00000244051	T	0.71817	-0.6	5.02	0.685	0.18009	Molybdenum cofactor biosynthesis, MoeB (1);	0.812175	0.11582	N	0.549650	T	0.55000	0.1893	L	0.31476	0.935	0.09310	N	1	B	0.24258	0.1	B	0.21708	0.036	T	0.36866	-0.9730	9	.	.	.	-19.624	9.6597	0.39947	0.0:0.52:0.4053:0.0747	.	45	O95396	MOCS3_HUMAN	T	45	ENSP00000244051:P45T	.	P	+	1	0	MOCS3	49008919	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.123000	0.10611	0.076000	0.16826	-0.165000	0.13383	CCG		0.622	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859		Missense_Mutation
NFATC2	4773	genome.wustl.edu	37	20	50140459	50140459	+	Silent	SNP	C	C	T	rs568487915		TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr20:50140459C>T	ENST00000396009.3	-	2	540	c.321G>A	c.(319-321)tcG>tcA	p.S107S	NFATC2_ENST00000414705.1_Silent_p.S87S|NFATC2_ENST00000609943.1_Silent_p.S87S|NFATC2_ENST00000371564.3_Silent_p.S107S|NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609507.1_Intron	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	107					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S107S(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGCTCAGGCCCGAGGCCCCTG	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		13719	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	20											30.0	35.0	33.0					20																	50140459		2192	4282	6474	49573866	SO:0001819	synonymous_variant	4773			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.321G>A	20.37:g.50140459C>T		Somatic		Capture	Illumina GAIIx	4	49573866	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Silent	SNP	ENST00000396009.3	37	CCDS13437.1	SNP	23	WashU																																																																																				0.687	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340		Silent
MYO5A	4644	genome.wustl.edu	37	15	52718156	52718156	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr15:52718156G>C	ENST00000399231.3	-	4	569	c.326C>G	c.(325-327)gCt>gGt	p.A109G	MYO5A_ENST00000356338.6_Missense_Mutation_p.A109G|MYO5A_ENST00000358212.6_Missense_Mutation_p.A109G|MYO5A_ENST00000553916.1_Missense_Mutation_p.A109G|MYO5A_ENST00000399233.2_Missense_Mutation_p.A109G	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	109	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.A109G(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GGGATTTATAGCTACTAGGAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	15											72.0	66.0	68.0					15																	52718156		1841	4095	5936	50505448	SO:0001583	missense	4644				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.326C>G	15.37:g.52718156G>C	ENSP00000382177:p.Ala109Gly	Somatic		Capture	Illumina GAIIx	4	50505448	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	34	5.292490	0.95546	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000553916	D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45	6.05	6.05	0.98169	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.97390	0.9146	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	0.987;1.0	D;D	0.83275	0.957;0.996	D	0.97764	1.0222	10	0.56958	D	0.05	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	109;109	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	G	109	ENSP00000382177:A109G;ENSP00000382179:A109G;ENSP00000348693:A109G;ENSP00000350945:A109G;ENSP00000451109:A109G	ENSP00000348693:A109G	A	-	2	0	MYO5A	50505448	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	GCT		0.383	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259		Missense_Mutation
SLC35F4	341880	genome.wustl.edu	37	14	58063464	58063464	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr14:58063464G>T	ENST00000339762.6	-	1	151	c.152C>A	c.(151-153)tCa>tAa	p.S51*	SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000554729.1_Intron|SLC35F4_ENST00000557430.1_Intron			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	51					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.S51*(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCACACCAGTGATTTATCTTC	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	14											150.0	149.0	149.0					14																	58063464		1921	4143	6064	57133217	SO:0001587	stop_gained	341880					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.152C>A	14.37:g.58063464G>T	ENSP00000342518:p.Ser51*	Somatic		Capture	Illumina GAIIx	4	57133217	A6NDQ3	Nonsense_Mutation	SNP	ENST00000339762.6	37		SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784596	0.49997	.	.	ENSG00000151812	ENST00000339762	.	.	.	4.04	-4.7	0.03288	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.7438	0.02958	0.4671:0.1336:0.2646:0.1347	.	.	.	.	X	51	.	ENSP00000342518:S51X	S	-	2	0	SLC35F4	57133217	0.002000	0.14202	0.000000	0.03702	0.214000	0.24535	-0.382000	0.07408	-1.033000	0.03299	0.650000	0.86243	TCA		0.403	SLC35F4-201	KNOWN	basic	protein_coding	protein_coding		XM_292260		Nonsense_Mutation
TBK1	29110	genome.wustl.edu	37	12	64889316	64889316	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr12:64889316A>T	ENST00000331710.5	+	14	1914	c.1575A>T	c.(1573-1575)agA>agT	p.R525S		NM_013254.3	NP_037386.1	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	525					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of gene expression (GO:0010629)|negative regulation of type I interferon production (GO:0032480)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon production (GO:0032606)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)	ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R525S(1)		breast(2)|central_nervous_system(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)	20				GBM - Glioblastoma multiforme(28;0.0386)		TCGACAGCAGATTATCTCCAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	12											152.0	146.0	148.0					12																	64889316		2203	4300	6503	63175583	SO:0001583	missense	29110			AF191838	CCDS8968.1	12q14.2	2006-06-10			ENSG00000183735	ENSG00000183735			11584	protein-coding gene	gene with protein product		604834				10581243, 10783893	Standard	NM_013254		Approved	NAK	uc001ssc.2	Q9UHD2	OTTHUMG00000168796	ENST00000331710.5:c.1575A>T	12.37:g.64889316A>T	ENSP00000329967:p.Arg525Ser	Somatic		Capture	Illumina GAIIx	4	63175583	A8K4S4|Q8IYV3|Q9NUJ5	Missense_Mutation	SNP	ENST00000331710.5	37	CCDS8968.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	1.013	-0.687252	0.03328	.	.	ENSG00000183735	ENST00000331710	T	0.67698	-0.28	4.64	-2.14	0.07123	.	0.251769	0.44902	D	0.000420	T	0.35828	0.0945	N	0.08118	0	0.22401	N	0.999135	B	0.09022	0.002	B	0.09377	0.004	T	0.18147	-1.0346	9	.	.	.	-1.8332	6.7944	0.23717	0.5611:0.1191:0.3199:0.0	.	525	Q9UHD2	TBK1_HUMAN	S	525	ENSP00000329967:R525S	.	R	+	3	2	TBK1	63175583	0.994000	0.37717	0.011000	0.14972	0.038000	0.13279	0.511000	0.22739	-0.471000	0.06891	-0.460000	0.05396	AGA		0.438	TBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401130.1	NM_013254		Missense_Mutation
CCDC88B	283234	genome.wustl.edu	37	11	64111502	64111502	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr11:64111502G>C	ENST00000356786.5	+	14	1533	c.1489G>C	c.(1489-1491)Gtt>Ctt	p.V497L	CCDC88B_ENST00000301897.4_5'Flank|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	497						membrane (GO:0016020)		p.V497L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AGAGGACCCTGTTCTTCCAGT	0.662																																																1	Substitution - Missense(1)	ovary(1)	11											33.0	34.0	34.0					11																	64111502		2200	4297	6497	63868078	SO:0001583	missense	283234			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1489G>C	11.37:g.64111502G>C	ENSP00000349238:p.Val497Leu	Somatic		Capture	Illumina GAIIx	4	63868078	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	N	6.626	0.483853	0.12581	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.23552	1.9	3.82	-7.65	0.01281	.	.	.	.	.	T	0.10078	0.0247	N	0.12182	0.205	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.27400	-1.0075	9	0.37606	T	0.19	.	4.2579	0.10726	0.1989:0.1409:0.521:0.1392	.	497;146;497	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	L	497	ENSP00000349238:V497L	ENSP00000349238:V497L	V	+	1	0	CCDC88B	63868078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.243000	0.08915	-1.551000	0.01706	-0.696000	0.03686	GTT		0.662	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251		Missense_Mutation
FOS	2353	genome.wustl.edu	37	14	75747717	75747717	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr14:75747717A>C	ENST00000303562.4	+	4	942	c.733A>C	c.(733-735)Aat>Cat	p.N245H	FOS_ENST00000535987.1_Missense_Mutation_p.N209H|FOS_ENST00000555686.1_Missense_Mutation_p.N131H|FOS_ENST00000555347.1_Missense_Mutation_p.N97H	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	245					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N245H(1)		central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	GCCTCTCCTCAATGACCCTGA	0.582																																																1	Substitution - Missense(1)	ovary(1)	14											72.0	72.0	72.0					14																	75747717		2203	4300	6503	74817470	SO:0001583	missense	2353			K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.733A>C	14.37:g.75747717A>C	ENSP00000306245:p.Asn245His	Somatic		Capture	Illumina GAIIx	4	74817470	A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	ENST00000303562.4	37	CCDS9841.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	1.166	-0.642303	0.03531	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555672;ENST00000555347	T;T;T	0.64618	0.47;0.9;-0.11	4.96	3.76	0.43208	.	1.407340	0.04142	N	0.319814	T	0.53867	0.1823	L	0.29908	0.895	0.09310	N	1	P;B	0.36837	0.571;0.437	B;B	0.38755	0.281;0.201	T	0.44050	-0.9353	10	0.22109	T	0.4	-9.5848	9.9237	0.41478	0.7855:0.2145:0.0:0.0	.	209;245	B4DQ65;P01100	.;FOS_HUMAN	H	245;209;131;95;97	ENSP00000306245:N245H;ENSP00000442268:N209H;ENSP00000452590:N131H	ENSP00000306245:N245H	N	+	1	0	FOS	74817470	0.000000	0.05858	0.876000	0.34364	0.297000	0.27493	0.558000	0.23469	1.991000	0.58162	0.460000	0.39030	AAT		0.582	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415044.1	NM_005252		Missense_Mutation
MSH4	4438	genome.wustl.edu	37	1	76355052	76355052	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:76355052G>T	ENST00000263187.3	+	16	2328	c.2224G>T	c.(2224-2226)Gag>Tag	p.E742*		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	742					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.E742*(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						AGAAATGAAAGAGGTACCCAA	0.259								Mismatch excision repair (MMR)																																								1	Substitution - Nonsense(1)	ovary(1)	1											49.0	57.0	55.0					1																	76355052		2188	4254	6442	76127640	SO:0001587	stop_gained	4438			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2224G>T	1.37:g.76355052G>T	ENSP00000263187:p.Glu742*	Somatic		Capture	Illumina GAIIx	4	76127640	Q5T4U6|Q8NEB3|Q9UNP8	Nonsense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	40	8.296275	0.98747	.	.	ENSG00000057468	ENST00000263187	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.0364	18.9808	0.92755	0.0:0.0:1.0:0.0	.	.	.	.	X	742	.	ENSP00000263187:E742X	E	+	1	0	MSH4	76127640	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.471000	0.97696	2.495000	0.84180	0.650000	0.86243	GAG		0.259	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440		Nonsense_Mutation
ZNF592	9640	genome.wustl.edu	37	15	85343119	85343119	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr15:85343119G>C	ENST00000560079.2	+	10	3472	c.3184G>C	c.(3184-3186)Gag>Cag	p.E1062Q	ZNF592_ENST00000299927.3_Missense_Mutation_p.E1062Q	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1062					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E1062Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTCCCTTCTGGAGAGCCACAT	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											101.0	96.0	98.0					15																	85343119		2203	4299	6502	83144123	SO:0001583	missense	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3184G>C	15.37:g.85343119G>C	ENSP00000452877:p.Glu1062Gln	Somatic		Capture	Illumina GAIIx	4	83144123	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426112	0.83667	.	.	ENSG00000166716	ENST00000299927	T	0.52057	0.68	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);	0.050554	0.85682	D	0.000000	T	0.44582	0.1300	N	0.04686	-0.185	0.33736	D	0.618789	D	0.60575	0.988	P	0.58721	0.844	T	0.59495	-0.7444	10	0.45353	T	0.12	-30.473	16.944	0.86226	0.0:0.0:1.0:0.0	.	1062	Q92610	ZN592_HUMAN	Q	1062	ENSP00000299927:E1062Q	ENSP00000299927:E1062Q	E	+	1	0	ZNF592	83144123	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.958000	0.70330	2.589000	0.87451	0.563000	0.77884	GAG		0.597	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		Missense_Mutation
KCMF1	56888	genome.wustl.edu	37	2	85273306	85273306	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:85273306C>T	ENST00000409785.4	+	5	865	c.506C>T	c.(505-507)tCa>tTa	p.S169L		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	169							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S169L(1)		ovary(3)	3						GCTCGTAGATCAAACATGCAC	0.443																																																1	Substitution - Missense(1)	ovary(1)	2											108.0	99.0	102.0					2																	85273306		1886	4102	5988	85126817	SO:0001583	missense	56888			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.506C>T	2.37:g.85273306C>T	ENSP00000386738:p.Ser169Leu	Somatic		Capture	Illumina GAIIx	4	85126817	Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Missense_Mutation	SNP	ENST00000409785.4	37	CCDS46350.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804620	0.90623	.	.	ENSG00000176407	ENST00000409785;ENST00000453448	T	0.48522	0.81	5.83	5.83	0.93111	Drought induced 19/ RING finger protein 114 (1);	0.056188	0.64402	D	0.000002	T	0.46268	0.1384	L	0.39245	1.2	0.54753	D	0.999982	B	0.25169	0.119	B	0.33846	0.171	T	0.28839	-1.0031	10	0.34782	T	0.22	-12.235	17.6156	0.88066	0.0:1.0:0.0:0.0	.	169	Q9P0J7	KCMF1_HUMAN	L	169;118	ENSP00000386738:S169L	ENSP00000386738:S169L	S	+	2	0	KCMF1	85126817	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.789000	0.85783	2.763000	0.94921	0.561000	0.74099	TCA		0.443	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328942.4	NM_020122		Missense_Mutation
IQGAP1	8826	genome.wustl.edu	37	15	91019971	91019971	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0903-01	TCGA-13-0903-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr15:91019971A>G	ENST00000268182.5	+	24	2985	c.2861A>G	c.(2860-2862)cAg>cGg	p.Q954R	IQGAP1_ENST00000560738.1_Missense_Mutation_p.Q382R	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	954					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)	p.Q954R(1)		breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			ATAAATAAACAGAAGGGAGGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	15											138.0	159.0	152.0					15																	91019971		2198	4298	6496	88820975	SO:0001583	missense	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.2861A>G	15.37:g.91019971A>G	ENSP00000268182:p.Gln954Arg	Somatic		Capture	Illumina GAIIx	4	88820975	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	17.30	3.353734	0.61293	.	.	ENSG00000140575	ENST00000268182	T	0.02280	4.36	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.01189	0.0039	N	0.01352	-0.895	0.80722	D	1	B	0.18310	0.027	B	0.18561	0.022	T	0.63470	-0.6630	10	0.16420	T	0.52	-22.4352	15.165	0.72818	1.0:0.0:0.0:0.0	.	954	P46940	IQGA1_HUMAN	R	954	ENSP00000268182:Q954R	ENSP00000268182:Q954R	Q	+	2	0	IQGAP1	88820975	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.204000	0.95041	2.178000	0.69098	0.533000	0.62120	CAG		0.368	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870		Missense_Mutation
MMP8	4317	genome.wustl.edu	37	11	102587063	102587063	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr11:102587063A>G	ENST00000236826.3	-	6	970	c.872T>C	c.(871-873)cTc>cCc	p.L291P		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	291					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.L291P(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	TTCTCCACGGAGTGTGGTGAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	11											119.0	123.0	122.0					11																	102587063		2203	4299	6502	102092273	SO:0001583	missense	4317			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.872T>C	11.37:g.102587063A>G	ENSP00000236826:p.Leu291Pro	Somatic		Capture	Illumina GAIIx	4	102092273	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918433	0.73098	.	.	ENSG00000118113	ENST00000236826;ENST00000544383;ENST00000534942	T	0.02974	4.09	5.03	5.03	0.67393	Hemopexin/matrixin (2);	0.139843	0.33005	N	0.005383	T	0.17152	0.0412	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.993;0.998	T	0.00367	-1.1785	10	0.87932	D	0	.	12.2782	0.54749	1.0:0.0:0.0:0.0	.	291;226;291	A8K9E4;F5GXB5;P22894	.;.;MMP8_HUMAN	P	291;268;226	ENSP00000236826:L291P	ENSP00000236826:L291P	L	-	2	0	MMP8	102092273	0.975000	0.34042	0.990000	0.47175	0.983000	0.72400	8.402000	0.90205	1.885000	0.54596	0.460000	0.39030	CTC		0.378	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424		Missense_Mutation
RGPD3	653489	genome.wustl.edu	37	2	107053016	107053016	+	Silent	SNP	G	G	A	rs555496035	byFrequency	TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:107053016G>A	ENST00000409886.3	-	11	1575	c.1488C>T	c.(1486-1488)agC>agT	p.S496S	RGPD3_ENST00000304514.7_Silent_p.S496S	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	496					protein targeting to Golgi (GO:0000042)			p.S496S(1)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						ATTGTAAGTGGCTGGTATATA	0.328													.|||	99	0.0197684	0.0719	0.0029	5008	,	,		17825	0.0		0.002	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	2											5.0	5.0	5.0					2																	107053016		112	603	715	106419448	SO:0001819	synonymous_variant	653489				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.1488C>T	2.37:g.107053016G>A		Somatic		Capture	Illumina GAIIx	4	106419448	B8ZZM4	Silent	SNP	ENST00000409886.3	37	CCDS46379.1	SNP	42	WashU																																																																																				0.328	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931		Silent
ACACB	32	genome.wustl.edu	37	12	109660684	109660684	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr12:109660684G>T	ENST00000338432.7	+	26	3878	c.3759G>T	c.(3757-3759)atG>atT	p.M1253I	ACACB_ENST00000377848.3_Missense_Mutation_p.M1253I|ACACB_ENST00000377854.5_Missense_Mutation_p.M1183I			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1253					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.M1253I(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CCATTGACATGTACGGCCACC	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	65.0	74.0					12																	109660684		2203	4300	6503	108145067	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3759G>T	12.37:g.109660684G>T	ENSP00000341044:p.Met1253Ile	Somatic		Capture	Illumina GAIIx	4	108145067	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322187	0.41096	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	T;T;T	0.41065	1.01;1.01;1.01	5.07	4.17	0.49024	Acetyl-CoA carboxylase, central domain (1);	0.125647	0.64402	D	0.000001	T	0.37128	0.0992	L	0.53249	1.67	0.80722	D	1	B	0.12013	0.005	B	0.15870	0.014	T	0.14392	-1.0474	10	0.22706	T	0.39	.	13.2796	0.60207	0.0767:0.0:0.9233:0.0	.	1253	O00763	ACACB_HUMAN	I	1253;1253;1183;484	ENSP00000341044:M1253I;ENSP00000367079:M1253I;ENSP00000367085:M1183I	ENSP00000341044:M1253I	M	+	3	0	ACACB	108145067	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.963000	0.87922	2.525000	0.85131	0.650000	0.86243	ATG		0.612	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093		Missense_Mutation
FDXACB1	91893	genome.wustl.edu	37	11	111746390	111746390	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr11:111746390A>T	ENST00000260257.4	-	5	1178	c.1131T>A	c.(1129-1131)ttT>ttA	p.F377L	ALG9_ENST00000524880.1_Intron|FDXACB1_ENST00000542429.1_Missense_Mutation_p.F228L|ALG9_ENST00000527377.1_Intron	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	377					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)	p.F377L(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						GGCACTTCTGAAAGACAGGTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											192.0	186.0	188.0					11																	111746390		1948	4160	6108	111251600	SO:0001583	missense					CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.1131T>A	11.37:g.111746390A>T	ENSP00000260257:p.Phe377Leu	Somatic		Capture	Illumina GAIIx	4	111251600	A0PJW7|B4DUU2	Missense_Mutation	SNP	ENST00000260257.4	37	CCDS44729.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	19.52	3.842759	0.71488	.	.	ENSG00000255561	ENST00000260257;ENST00000542429;ENST00000528274	T;T;T	0.37235	1.21;1.21;1.21	6.17	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.54631	0.1870	M	0.70275	2.135	0.58432	D	0.99999	D	0.76494	0.999	D	0.80764	0.994	T	0.56854	-0.7910	10	0.66056	D	0.02	.	9.3276	0.38001	0.7864:0.0:0.2136:0.0	.	377	Q9BRP7	FDXA1_HUMAN	L	377;228;288	ENSP00000260257:F377L;ENSP00000441304:F228L;ENSP00000435572:F288L	ENSP00000260257:F377L	F	-	3	2	FDXACB1	111251600	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.831000	0.39141	2.371000	0.80710	0.533000	0.62120	TTT		0.438	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378		Missense_Mutation
FKBP15	23307	genome.wustl.edu	37	9	115931598	115931598	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr9:115931598A>T	ENST00000238256.3	-	26	3508	c.3391T>A	c.(3391-3393)Tcc>Acc	p.S1131T		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	1131					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)		p.S1156T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GGACCGGTGGAGCTAGTGACA	0.597																																																1	Substitution - Missense(1)	ovary(1)	9											76.0	79.0	78.0					9																	115931598		2096	4209	6305	114971419	SO:0001583	missense	23307			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.3391T>A	9.37:g.115931598A>T	ENSP00000238256:p.Ser1131Thr	Somatic		Capture	Illumina GAIIx	4	114971419	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	ENST00000238256.3	37	CCDS48007.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	8.283	0.815929	0.16607	.	.	ENSG00000119321	ENST00000446284;ENST00000238256	T;T	0.22539	1.95;1.96	4.46	-0.798	0.10905	.	.	.	.	.	T	0.12008	0.0292	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.001	T	0.30238	-0.9985	9	0.39692	T	0.17	-0.08	3.7413	0.08532	0.3524:0.0:0.1118:0.5358	.	712;1131	B4DVS2;Q5T1M5	.;FKB15_HUMAN	T	1156;1131	ENSP00000416158:S1156T;ENSP00000238256:S1131T	ENSP00000238256:S1131T	S	-	1	0	FKBP15	114971419	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.334000	0.19787	0.052000	0.16007	0.482000	0.46254	TCC		0.597	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258		Missense_Mutation
KIAA1407	57577	genome.wustl.edu	37	3	113753853	113753853	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0903-01	TCGA-13-0903-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:113753853T>A	ENST00000295878.3	-	6	883	c.737A>T	c.(736-738)gAa>gTa	p.E246V	KIAA1407_ENST00000545063.1_Missense_Mutation_p.E77V	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	246								p.E246V(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						AATCTCCTCTTCCTCTTTCTT	0.478																																																1	Substitution - Missense(1)	ovary(1)	3											199.0	191.0	194.0					3																	113753853		2203	4300	6503	115236543	SO:0001583	missense	57577			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.737A>T	3.37:g.113753853T>A	ENSP00000295878:p.Glu246Val	Somatic		Capture	Illumina GAIIx	4	115236543	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	16.29	3.080493	0.55753	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.65178	0.43;-0.14;-0.09	5.72	3.33	0.38152	.	0.108912	0.64402	D	0.000007	T	0.62380	0.2423	M	0.65498	2.005	0.80722	D	1	P;P;P	0.40515	0.719;0.51;0.719	B;B;B	0.44085	0.44;0.241;0.44	T	0.62001	-0.6946	10	0.87932	D	0	.	8.5741	0.33587	0.0:0.0672:0.1309:0.8019	.	233;122;246	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	V	246;77;233	ENSP00000295878:E246V;ENSP00000446381:E77V;ENSP00000418099:E233V	ENSP00000295878:E246V	E	-	2	0	KIAA1407	115236543	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	4.140000	0.58031	0.436000	0.26393	-0.299000	0.09455	GAA		0.478	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817		Missense_Mutation
GOLGB1	2804	genome.wustl.edu	37	3	121409831	121409831	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:121409831C>T	ENST00000340645.5	-	14	8490	c.8365G>A	c.(8365-8367)Gcc>Acc	p.A2789T	GOLGB1_ENST00000393667.3_Missense_Mutation_p.A2794T	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2789					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.A2789T(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATTGAAAAGGCGGTTTCAGAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											117.0	108.0	111.0					3																	121409831		2203	4300	6503	122892521	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8365G>A	3.37:g.121409831C>T	ENSP00000341848:p.Ala2789Thr	Somatic		Capture	Illumina GAIIx	4	122892521	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.869484	0.00547	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.15834	2.39;2.39	5.3	-7.44	0.01379	.	1.036540	0.07611	N	0.925375	T	0.09598	0.0236	L	0.41027	1.25	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.08055	0.003;0.002;0.002	T	0.36138	-0.9760	10	0.13108	T	0.6	.	5.1782	0.15146	0.3579:0.2669:0.0:0.3752	.	2794;2794;2789	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	T	2789;2794	ENSP00000341848:A2789T;ENSP00000377275:A2794T	ENSP00000341848:A2789T	A	-	1	0	GOLGB1	122892521	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.783000	0.04638	-2.029000	0.00930	-3.295000	0.00046	GCC		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		Missense_Mutation
RC3H2	54542	genome.wustl.edu	37	9	125622280	125622280	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr9:125622280A>G	ENST00000373670.1	-	10	2365	c.1765T>C	c.(1765-1767)Tat>Cat	p.Y589H	RC3H2_ENST00000357244.2_Missense_Mutation_p.Y589H|RC3H2_ENST00000423239.2_Missense_Mutation_p.Y589H			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	589	Pro-rich.				B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y589H(1)		breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TGCGGAGGATATACTGGTACT	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											215.0	213.0	213.0					9																	125622280		1845	4097	5942	124662101	SO:0001583	missense	54542			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1765T>C	9.37:g.125622280A>G	ENSP00000362774:p.Tyr589His	Somatic		Capture	Illumina GAIIx	4	124662101	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	SNP	16	WashU	.	.	.	.	.	.	.	.	.	.	A	24.0	4.486768	0.84854	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.48522	0.81;0.81;0.83	5.87	5.87	0.94306	.	0.065139	0.64402	D	0.000006	T	0.56514	0.1990	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.75484	0.969;0.986	T	0.55792	-0.8085	10	0.42905	T	0.14	-8.9463	14.3157	0.66450	1.0:0.0:0.0:0.0	.	589;589	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	H	589;589;460;589	ENSP00000362774:Y589H;ENSP00000349783:Y589H;ENSP00000411767:Y589H	ENSP00000349783:Y589H	Y	-	1	0	RC3H2	124662101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.076000	0.71267	2.371000	0.80710	0.533000	0.62120	TAT		0.433	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835		Missense_Mutation
ARHGAP36	158763	genome.wustl.edu	37	X	130220567	130220567	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chrX:130220567C>A	ENST00000276211.5	+	11	1759	c.1414C>A	c.(1414-1416)Ctt>Att	p.L472I	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.L336I|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.L460I	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	472					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.L472I(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GGATGCACTACTTTCTGATCC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											115.0	100.0	105.0					X																	130220567		2203	4300	6503	130048248	SO:0001583	missense	158763				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1414C>A	X.37:g.130220567C>A	ENSP00000276211:p.Leu472Ile	Somatic		Capture	Illumina GAIIx	4	130048248	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	SNP	20	WashU	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102971	0.20632	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.11604	2.76;2.76;2.77;2.77	4.32	3.43	0.39272	.	0.000000	0.43110	D	0.000611	T	0.04907	0.0132	N	0.08118	0	0.27202	N	0.960137	B;B;B	0.32101	0.356;0.356;0.243	B;B;B	0.29598	0.104;0.104;0.048	T	0.36672	-0.9738	10	0.25751	T	0.34	.	8.9596	0.35838	0.0:0.7793:0.2207:0.0	.	441;460;472	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	I	472;460;441;336	ENSP00000276211:L472I;ENSP00000359960:L460I;ENSP00000408515:L441I;ENSP00000359959:L336I	ENSP00000276211:L472I	L	+	1	0	ARHGAP36	130048248	0.608000	0.26966	0.998000	0.56505	0.889000	0.51656	0.907000	0.28531	1.123000	0.41961	0.594000	0.82650	CTT		0.473	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967		Missense_Mutation
ABO	28	genome.wustl.edu	37	9	136135222	136135222	+	RNA	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr9:136135222C>T	ENST00000453660.2	-	0	215							P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		TGACATTATACCTTGGCAACG	0.527																																																0			9											109.0	105.0	106.0					9																	136135222		2121	4231	6352	135125043			28			AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136135222C>T		Somatic		Capture	Illumina GAIIx	4	135125043	B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	Splice_Site_SNP	SNP	ENST00000453660.2	37		SNP	18	WashU																																																																																				0.527	ABO-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054907.4	NM_020469		Splice_Site_SNP
PCDHA3	56145	genome.wustl.edu	37	5	140181418	140181418	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr5:140181418A>G	ENST00000522353.2	+	1	636	c.636A>G	c.(634-636)atA>atG	p.I212M	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.I212M|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	212	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I212M(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTACTAATAACAGCAATTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											59.0	62.0	61.0					5																	140181418		2203	4300	6503	140161602	SO:0001583	missense	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.636A>G	5.37:g.140181418A>G	ENSP00000429808:p.Ile212Met	Somatic		Capture	Illumina GAIIx	4	140161602	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	SNP	13	WashU	.	.	.	.	.	.	.	.	.	.	a	12.47	1.949088	0.34377	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.26373	1.74;1.74	4.86	-0.73	0.11154	Cadherin (4);Cadherin-like (1);	0.180194	0.25575	U	0.029738	T	0.26085	0.0636	M	0.65498	2.005	0.21473	N	0.999675	P;P	0.52842	0.956;0.892	P;P	0.49597	0.55;0.616	T	0.20840	-1.0263	10	0.87932	D	0	.	0.2045	0.00149	0.2512:0.2725:0.2109:0.2655	.	212;212	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	M	212	ENSP00000429808:I212M;ENSP00000434086:I212M	ENSP00000429808:I212M	I	+	3	3	PCDHA3	140161602	0.000000	0.05858	0.011000	0.14972	0.910000	0.53928	-4.656000	0.00202	-0.040000	0.13580	0.383000	0.25322	ATA		0.403	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		Missense_Mutation
HDAC3	8841	genome.wustl.edu	37	5	141009426	141009426	+	Splice_Site	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr5:141009426C>A	ENST00000305264.3	-	5	500		c.e5+1			NM_003883.3	NP_003874.2	O15379	HDAC3_HUMAN	histone deacetylase 3						cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|protein deacetylation (GO:0006476)|regulation of mitotic cell cycle (GO:0007346)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|cyclin binding (GO:0030332)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.?(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	TCCTCACTCACCTCAAACTTC	0.517																																																1	Unknown(1)	ovary(1)	5											123.0	103.0	110.0					5																	141009426		2203	4300	6503	140989610	SO:0001630	splice_region_variant	8841			AF059650	CCDS4264.1	5q31.1-q31.2	2008-07-18			ENSG00000171720	ENSG00000171720	3.5.1.98		4854	protein-coding gene	gene with protein product		605166				9501169, 9464271	Standard	NM_003883		Approved	RPD3, HD3, RPD3-2	uc003llf.2	O15379	OTTHUMG00000129629	ENST00000305264.3:c.420+1G>T	5.37:g.141009426C>A		Somatic		Capture	Illumina GAIIx	4	140989610	D3DQE1|O43268|Q9UEI5|Q9UEV0	Splice_Site_SNP	SNP	ENST00000305264.3	37	CCDS4264.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	18.04	3.533654	0.64972	.	.	ENSG00000171720	ENST00000305264;ENST00000523088	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4739	0.94976	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HDAC3	140989610	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.605000	0.82844	2.708000	0.92522	0.650000	0.86243	.		0.517	HDAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251824.2	NM_003883	Intron	Splice_Site_SNP
FCRL3	115352	genome.wustl.edu	37	1	157648557	157648557	+	Silent	SNP	T	T	C			TCGA-13-0903-01	TCGA-13-0903-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:157648557T>C	ENST00000368184.3	-	15	2439	c.2148A>G	c.(2146-2148)gaA>gaG	p.E716E	FCRL3_ENST00000368186.5_Silent_p.E716E|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	716						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E716E(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CTTCATCATCTTCTTCATGGG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											162.0	139.0	147.0					1																	157648557		2203	4300	6503	155915181	SO:0001819	synonymous_variant	115352			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.2148A>G	1.37:g.157648557T>C		Somatic		Capture	Illumina GAIIx	4	155915181	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1	SNP	56	WashU																																																																																				0.502	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939		Silent
MME	4311	genome.wustl.edu	37	3	154834718	154834718	+	Silent	SNP	C	C	G			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:154834718C>G	ENST00000460393.1	+	7	717	c.597C>G	c.(595-597)gtC>gtG	p.V199V	MME_ENST00000462745.1_Silent_p.V199V|MME_ENST00000360490.2_Silent_p.V199V|MME_ENST00000493237.1_Silent_p.V199V|MME_ENST00000492661.1_Silent_p.V199V	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	199					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)	p.V199V(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	GGAAAAAAGTCCTTATTAATT	0.289																																																1	Substitution - coding silent(1)	ovary(1)	3											58.0	61.0	60.0					3																	154834718		2202	4296	6498	156317412	SO:0001819	synonymous_variant	4311				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.597C>G	3.37:g.154834718C>G		Somatic		Capture	Illumina GAIIx	4	156317412	A8K6U6|D3DNJ9|Q3MIX4	Silent	SNP	ENST00000460393.1	37	CCDS3172.1	SNP	30	WashU																																																																																				0.289	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902		Silent
PAPPA2	60676	genome.wustl.edu	37	1	176668547	176668547	+	Missense_Mutation	SNP	G	G	T	rs201517784		TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:176668547G>T	ENST00000367662.3	+	8	4222	c.3058G>T	c.(3058-3060)Gtg>Ttg	p.V1020L		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1020					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1020L(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGTGTCGGGGGTGAAAGTCTA	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19502	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											139.0	145.0	143.0					1																	176668547		2109	4238	6347	174935170	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3058G>T	1.37:g.176668547G>T	ENSP00000356634:p.Val1020Leu	Somatic		Capture	Illumina GAIIx	4	174935170	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	SNP	44	WashU	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	11.99	1.804680	0.31961	.	.	ENSG00000116183	ENST00000367662	T	0.42131	0.98	5.38	4.47	0.54385	Fibronectin, type III (2);	0.320145	0.33875	N	0.004479	T	0.42966	0.1226	M	0.70275	2.135	0.58432	D	0.999993	B	0.29188	0.236	B	0.29176	0.099	T	0.46748	-0.9169	10	0.72032	D	0.01	-7.2083	11.1339	0.48362	0.1492:0.0:0.8508:0.0	.	1020	Q9BXP8	PAPP2_HUMAN	L	1020	ENSP00000356634:V1020L	ENSP00000356634:V1020L	V	+	1	0	PAPPA2	174935170	1.000000	0.71417	0.973000	0.42090	0.730000	0.41778	2.530000	0.45641	1.503000	0.48686	0.655000	0.94253	GTG		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			Missense_Mutation
EVX2	344191	genome.wustl.edu	37	2	176947137	176947137	+	Silent	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:176947137C>A	ENST00000308618.4	-	2	604	c.468G>T	c.(466-468)tcG>tcT	p.S156S		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	156					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S156S(1)		kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		AGCCCGACGCCGACGTCGTGG	0.711																																																1	Substitution - coding silent(1)	ovary(1)	2											18.0	20.0	19.0					2																	176947137		2014	4024	6038	176655383	SO:0001819	synonymous_variant	344191				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.468G>T	2.37:g.176947137C>A		Somatic		Capture	Illumina GAIIx	4	176655383		Silent	SNP	ENST00000308618.4	37	CCDS33333.1	SNP	23	WashU																																																																																				0.711	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359252.1			Silent
PGAP1	80055	genome.wustl.edu	37	2	197757953	197757953	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0903-01	TCGA-13-0903-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:197757953T>C	ENST00000354764.4	-	8	1058	c.944A>G	c.(943-945)aAg>aGg	p.K315R	PGAP1_ENST00000409475.1_Missense_Mutation_p.K315R|PGAP1_ENST00000409188.1_Missense_Mutation_p.K273R|PGAP1_ENST00000485830.1_5'UTR	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	315					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.K315R(1)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						CAGTTTCTTCTTGGAATTTTG	0.318																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	106.0	105.0					2																	197757953		2203	4299	6502	197466198	SO:0001583	missense	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.944A>G	2.37:g.197757953T>C	ENSP00000346809:p.Lys315Arg	Somatic		Capture	Illumina GAIIx	4	197466198	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	15.93	2.978575	0.53720	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475;ENST00000409188;ENST00000374738	.	.	.	4.9	4.9	0.64082	.	0.195026	0.48767	D	0.000172	T	0.48909	0.1526	N	0.19112	0.55	0.34103	D	0.66204	P;P;D	0.63880	0.483;0.775;0.993	B;B;D	0.70935	0.084;0.306;0.971	T	0.53704	-0.8401	9	0.16420	T	0.52	-9.6702	12.3993	0.55404	0.0:0.0:0.0:1.0	.	273;315;315	B4DYY6;Q75T13-3;Q75T13	.;.;PGAP1_HUMAN	R	95;315;315;273;95	.	ENSP00000346809:K315R	K	-	2	0	PGAP1	197466198	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.221000	0.51215	2.064000	0.61679	0.460000	0.39030	AAG		0.318	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989		Missense_Mutation
ANKRD44	91526	genome.wustl.edu	37	2	197866488	197866488	+	Silent	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:197866488C>T	ENST00000328737.2	-	22	2425	c.2349G>A	c.(2347-2349)ctG>ctA	p.L783L	ANKRD44_ENST00000450567.1_Silent_p.L783L|ANKRD44_ENST00000337207.5_Silent_p.L783L|ANKRD44_ENST00000282272.8_Silent_p.L800L			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	808								p.L783L(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTGCACAGTGCAGTGGAGTAA	0.318																																																1	Substitution - coding silent(1)	ovary(1)	2											104.0	104.0	104.0					2																	197866488		2203	4300	6503	197574733	SO:0001819	synonymous_variant	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2349G>A	2.37:g.197866488C>T		Somatic		Capture	Illumina GAIIx	4	197574733	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000328737.2	37		SNP	25	WashU																																																																																				0.318	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		Silent
STK11IP	114790	genome.wustl.edu	37	2	220466798	220466798	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0903-01	TCGA-13-0903-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:220466798C>T	ENST00000456909.1	+	5	521	c.431C>T	c.(430-432)gCa>gTa	p.A144V	STK11IP_ENST00000295641.10_Missense_Mutation_p.A155V|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	155					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)	p.A144V(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCTCCAGGCATTAGAGGTA	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											26.0	25.0	26.0					2																	220466798		1986	4156	6142	220175042	SO:0001583	missense	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.431C>T	2.37:g.220466798C>T	ENSP00000389383:p.Ala144Val	Somatic		Capture	Illumina GAIIx	4	220175042	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	ENST00000456909.1	37		SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653151	0.88056	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05447	3.44;3.44	4.93	4.93	0.64822	.	0.629307	0.16429	N	0.214808	T	0.16471	0.0396	L	0.47716	1.5	0.27675	N	0.946637	B;P;P;D	0.69078	0.101;0.932;0.775;0.997	B;P;B;P	0.61397	0.098;0.472;0.273;0.888	T	0.01496	-1.1340	10	0.56958	D	0.05	-1.1989	13.6658	0.62393	0.0:0.8449:0.155:0.0	.	155;155;155;155	B4DUE4;B4DII2;Q8N1F8-2;Q8N1F8	.;.;.;S11IP_HUMAN	V	144;155;155	ENSP00000389383:A144V;ENSP00000295641:A155V	ENSP00000295641:A155V	A	+	2	0	STK11IP	220175042	0.997000	0.39634	0.994000	0.49952	0.847000	0.48162	3.846000	0.55888	2.549000	0.85964	0.655000	0.94253	GCA		0.572	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902		Missense_Mutation
LYST	1130	genome.wustl.edu	37	1	235969927	235969927	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:235969927G>A	ENST00000389794.3	-	6	2683	c.2509C>T	c.(2509-2511)Cca>Tca	p.P837S	LYST_ENST00000389793.2_Missense_Mutation_p.P837S|LYST_ENST00000536965.1_Missense_Mutation_p.P837S			Q99698	LYST_HUMAN	lysosomal trafficking regulator	837					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.P837S(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCAATATCTGGAACTGAGGCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											223.0	214.0	217.0					1																	235969927		2203	4300	6503	234036550	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.2509C>T	1.37:g.235969927G>A	ENSP00000374444:p.Pro837Ser	Somatic		Capture	Illumina GAIIx	4	234036550	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	9.538	1.112634	0.20795	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.61510	0.1;0.1;1.26	5.48	3.57	0.40892	.	0.407398	0.28140	N	0.016444	T	0.37839	0.1018	L	0.33485	1.01	0.24115	N	0.99583	B;B	0.18013	0.025;0.012	B;B	0.18871	0.023;0.021	T	0.27806	-1.0063	10	0.05833	T	0.94	.	7.3156	0.26499	0.1483:0.1394:0.7122:0.0	.	837;837	Q99698-3;Q99698	.;LYST_HUMAN	S	837	ENSP00000374444:P837S;ENSP00000374443:P837S;ENSP00000438315:P837S	ENSP00000374443:P837S	P	-	1	0	LYST	234036550	0.983000	0.35010	0.005000	0.12908	0.940000	0.58332	1.964000	0.40462	0.662000	0.31006	0.655000	0.94253	CCA		0.388	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			Missense_Mutation
RYR2	6262	genome.wustl.edu	37	1	237936860	237936860	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0903-01	TCGA-13-0903-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:237936860A>T	ENST00000366574.2	+	87	12004	c.11687A>T	c.(11686-11688)gAt>gTt	p.D3896V	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.D3880V|RYR2_ENST00000360064.6_Missense_Mutation_p.D3902V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3896					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.D3894V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTGGGAAAGATGTTATTGAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											113.0	107.0	109.0					1																	237936860		1829	4079	5908	236003483	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11687A>T	1.37:g.237936860A>T	ENSP00000355533:p.Asp3896Val	Somatic		Capture	Illumina GAIIx	4	236003483	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	12	WashU	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287871	0.80803	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97089	-4.24;-4.21;-4.24	5.13	5.13	0.70059	RyR/IP3R Homology associated domain (1);	0.000000	0.64402	U	0.000008	D	0.97879	0.9303	M	0.61703	1.905	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.72982	0.979;0.978	D	0.98917	1.0782	10	0.87932	D	0	-15.6106	15.2625	0.73634	1.0:0.0:0.0:0.0	.	870;3896	B4DGV4;Q92736	.;RYR2_HUMAN	V	3896;3902;3880;870	ENSP00000355533:D3896V;ENSP00000353174:D3902V;ENSP00000443798:D3880V	ENSP00000353174:D3902V	D	+	2	0	RYR2	236003483	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.319000	0.79040	2.057000	0.61298	0.523000	0.50628	GAT		0.318	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
ROR1	4919	genome.wustl.edu	37	1	64603116	64603116	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0903-01	TCGA-13-0903-10	G	G	A	G	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:64603116G>A	ENST00000371079.1	+	5	922	c.547G>A	c.(547-549)Ggc>Agc	p.G183S	ROR1_ENST00000545203.1_5'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.G183S|RP11-24J23.2_ENST00000424995.1_RNA|ROR1_ENST00000482426.1_3'UTR	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	183	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.G183S(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						AAGATTTATTGGCAACCGCAC	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											159.0	152.0	154.0					1																	64603116		2203	4300	6503	64375704	SO:0001583	missense	4919			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.547G>A	1.37:g.64603116G>A	ENSP00000360120:p.Gly183Ser	Somatic		Capture	Illumina GAIIx	Phase_III	64375704	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.429452	0.96131	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.53857	0.6;0.6	6.07	6.07	0.98685	Frizzled domain (2);	0.000000	0.43747	D	0.000532	T	0.55737	0.1939	L	0.45228	1.405	0.80722	D	1	P;D	0.63046	0.73;0.992	P;P	0.62184	0.644;0.899	T	0.53627	-0.8412	10	0.49607	T	0.09	.	16.0651	0.80865	0.0:0.1332:0.8668:0.0	.	183;183	Q01973;Q66K77	ROR1_HUMAN;.	S	183;183;186	ENSP00000360121:G183S;ENSP00000360120:G183S	ENSP00000360120:G183S	G	+	1	0	ROR1	64375704	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.851000	0.86920	2.885000	0.99019	0.655000	0.94253	GGC		0.413	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012		Missense_Mutation
OR2T34	127068	genome.wustl.edu	37	1	248737881	248737881	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr1:248737881G>T	ENST00000328782.2	-	1	199	c.178C>A	c.(178-180)Ctc>Atc	p.L60I		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L60I(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGGTGTGGAGGCGGGGCTCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											16.0	20.0	19.0					1																	248737881		2094	4233	6327	246804504	SO:0001583	missense	127068			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.178C>A	1.37:g.248737881G>T	ENSP00000330904:p.Leu60Ile	Somatic		Capture	Illumina GAIIx	4	246804504	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	.	26.0	4.698397	0.88830	.	.	ENSG00000183310	ENST00000328782	T	0.13778	2.56	2.35	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.47655	0.1457	H	0.95539	3.685	0.28231	N	0.926118	D	0.89917	1.0	D	0.91635	0.999	T	0.47983	-0.9074	9	0.87932	D	0	.	11.5824	0.50900	0.0:0.0:1.0:0.0	.	60	Q8NGX1	O2T34_HUMAN	I	60	ENSP00000330904:L60I	ENSP00000330904:L60I	L	-	1	0	OR2T34	246804504	1.000000	0.71417	0.194000	0.23346	0.842000	0.47809	4.308000	0.59129	1.159000	0.42565	0.395000	0.25975	CTC		0.572	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821		Missense_Mutation
TSC2	7249	genome.wustl.edu	37	16	2136353	2136353	+	Missense_Mutation	SNP	T	T	G	rs137854399		TCGA-13-0903-01	TCGA-13-0903-10	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr16:2136353T>G	ENST00000219476.3	+	37	5452	c.4822T>G	c.(4822-4824)Tac>Gac	p.Y1608D	TSC2_ENST00000350773.4_Missense_Mutation_p.Y1585D|TSC2_ENST00000353929.4_Missense_Mutation_p.Y1565D|TSC2_ENST00000568454.1_Missense_Mutation_p.Y1552D|TSC2_ENST00000439673.2_Missense_Mutation_p.Y1505D|TSC2_ENST00000382538.6_Missense_Mutation_p.Y1493D|TSC2_ENST00000401874.2_Missense_Mutation_p.Y1541D	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1608	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.Y1608D(2)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCAGTTCACCTACTGCTGGCA	0.667			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	2	Substitution - Missense(2)	ovary(2)	16											137.0	105.0	116.0					16																	2136353		2196	4299	6495	2076354	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4822T>G	16.37:g.2136353T>G	ENSP00000219476:p.Tyr1608Asp	Somatic		Capture	Illumina GAIIx	4	2076354	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894571	0.72639	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61;-3.61	4.21	4.21	0.49690	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.97034	0.9031	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.998;0.999;0.999;0.999;0.999;0.999	D	0.97626	1.0139	10	0.87932	D	0	-28.2122	13.441	0.61112	0.0:0.0:0.0:1.0	.	1493;1505;1585;383;1564;1541;1608	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	D	1608;1542;1565;1505;1493;1585	ENSP00000219476:Y1608D;ENSP00000248099:Y1565D;ENSP00000399232:Y1505D;ENSP00000371978:Y1493D;ENSP00000344383:Y1585D	ENSP00000219476:Y1608D	Y	+	1	0	TSC2	2076354	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	6.071000	0.71229	1.761000	0.52028	0.459000	0.35465	TAC		0.667	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548		Missense_Mutation
XDH	7498	genome.wustl.edu	37	2	31571183	31571183	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr2:31571183G>C	ENST00000379416.3	-	28	3146	c.3098C>G	c.(3097-3099)aCc>aGc	p.T1033S		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1033					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)	p.T1033S(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CCCCCCGTGGGTCAGCAGCAC	0.507																																					Colon(66;682 1445 30109 40147)											1	Substitution - Missense(1)	ovary(1)	2											74.0	68.0	70.0					2																	31571183		2203	4300	6503	31424687	SO:0001583	missense	7498			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3098C>G	2.37:g.31571183G>C	ENSP00000368727:p.Thr1033Ser	Somatic		Capture	Illumina GAIIx	4	31424687	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740006	0.30865	.	.	ENSG00000158125	ENST00000379416	T	0.35789	1.29	5.85	3.1	0.35709	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.088877	0.85682	N	0.000000	T	0.23492	0.0568	L	0.28776	0.89	0.54753	D	0.999987	B	0.17852	0.024	B	0.28638	0.092	T	0.05068	-1.0908	10	0.11182	T	0.66	.	7.6222	0.28191	0.0662:0.1261:0.6856:0.1221	.	1033	P47989	XDH_HUMAN	S	1033	ENSP00000368727:T1033S	ENSP00000368727:T1033S	T	-	2	0	XDH	31424687	1.000000	0.71417	0.980000	0.43619	0.947000	0.59692	5.701000	0.68325	0.385000	0.24970	0.655000	0.94253	ACC		0.507	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		Missense_Mutation
ABI3BP	25890	genome.wustl.edu	37	3	100605041	100605041	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0903-01	TCGA-13-0903-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr3:100605041G>C	ENST00000284322.5	-	5	718	c.609C>G	c.(607-609)gaC>gaG	p.D203E	ABI3BP_ENST00000495063.1_Missense_Mutation_p.D203E|ABI3BP_ENST00000471714.1_Missense_Mutation_p.D203E	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	203	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.D203E(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						CTTCCACATTGTCTTTCACTC	0.338																																																1	Substitution - Missense(1)	ovary(1)	3											129.0	117.0	121.0					3																	100605041		1827	4085	5912	102087731	SO:0001583	missense	25890			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.609C>G	3.37:g.100605041G>C	ENSP00000284322:p.Asp203Glu	Somatic		Capture	Illumina GAIIx	PhaseIII	102087731	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	37	CCDS46880.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662223	0.67700	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000495063;ENST00000527258;ENST00000530539	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;2.43	5.71	1.4	0.22301	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.148779	0.64402	D	0.000013	T	0.53610	0.1807	L	0.51422	1.61	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.997;0.996;0.994	T	0.51028	-0.8757	10	0.56958	D	0.05	-12.2852	10.2654	0.43452	0.3653:0.0:0.6347:0.0	.	196;203;203	Q9H717;Q5JPC9;Q7Z7G0	.;.;TARSH_HUMAN	E	203;203;203;122;143	ENSP00000420524:D203E;ENSP00000284322:D203E;ENSP00000433993:D203E;ENSP00000435319:D122E;ENSP00000436918:D143E	ENSP00000284322:D203E	D	-	3	2	ABI3BP	102087731	1.000000	0.71417	0.961000	0.40146	0.989000	0.77384	1.608000	0.36847	0.350000	0.24002	0.555000	0.69702	GAC		0.338	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1			Missense_Mutation
CEP131	22994	genome.wustl.edu	37	17	79173563	79173563	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0903-01	TCGA-13-0903-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0903-01	TCGA-13-0903-10	g.chr17:79173563C>A	ENST00000269392.4	-	9	1226	c.979G>T	c.(979-981)Gcc>Tcc	p.A327S	AZI1_ENST00000570482.2_5'Flank|AZI1_ENST00000374782.3_Missense_Mutation_p.A327S|AZI1_ENST00000575907.1_Missense_Mutation_p.A327S|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000450824.2_Missense_Mutation_p.A327S	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		327					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)	p.A327S(1)|p.A327fs*23(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCCTCCCGGGCCTTCCTCCTG	0.687																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|central_nervous_system(1)	17											69.0	65.0	66.0					17																	79173563		2202	4299	6501	76788158	SO:0001583	missense	22994																														ENST00000269392.4:c.979G>T	17.37:g.79173563C>A	ENSP00000269392:p.Ala327Ser	Somatic		Capture	Illumina GAIIx	PhaseIII	76788158	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37		SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	13.21	2.169236	0.38315	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.30981	1.51;1.51;1.51	3.67	2.68	0.31781	.	0.346962	0.28273	N	0.015943	T	0.30355	0.0762	L	0.51422	1.61	0.25005	N	0.991441	P;P;D;D	0.56287	0.882;0.93;0.975;0.974	B;P;P;P	0.52823	0.42;0.521;0.555;0.71	T	0.10870	-1.0611	10	0.09843	T	0.71	-18.4182	6.5789	0.22583	0.0:0.7713:0.0:0.2287	.	327;327;327;327	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	S	327	ENSP00000393583:A327S;ENSP00000363914:A327S;ENSP00000269392:A327S	ENSP00000269392:A327S	A	-	1	0	AZI1	76788158	0.974000	0.33945	1.000000	0.80357	0.087000	0.18053	1.779000	0.38624	2.038000	0.60285	0.313000	0.20887	GCC		0.687	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1			Missense_Mutation
