#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
IQCC	55721	broad.mit.edu	37	1	32673193	32673193	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:32673193A>T	ENST00000291358.6	+	5	932	c.911A>T	c.(910-912)gAt>gTt	p.D304V	RP4-622L5.7_ENST00000421616.1_RNA|IQCC_ENST00000537469.1_Missense_Mutation_p.D384V|RP4-622L5.7_ENST00000373604.4_RNA|DCDC2B_ENST00000409358.1_5'Flank	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	304								p.D304V(1)		endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGCCAGACGATGGAAGACAG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											49.0	50.0	49.0					1																	32673193		2203	4300	6503	32445780	SO:0001583	missense	55721			AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.911A>T	1.37:g.32673193A>T	ENSP00000291358:p.Asp304Val	Unknown		x	x	x	32445780	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Missense_Mutation	SNP	ENST00000291358.6	37	CCDS355.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	1.276	-0.611739	0.03690	.	.	ENSG00000160051	ENST00000537469;ENST00000291358	T;T	0.10192	2.9;2.9	3.98	-7.96	0.01144	.	2.588410	0.01144	N	0.006277	T	0.03477	0.0100	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33854	-0.9852	10	0.23891	T	0.37	22.044	1.2754	0.02030	0.3868:0.1077:0.2912:0.2143	.	384;304	F5H7T8;Q4KMZ1	.;IQCC_HUMAN	V	384;304	ENSP00000442291:D384V;ENSP00000291358:D304V	ENSP00000291358:D304V	D	+	2	0	IQCC	32445780	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.808000	0.00756	-2.111000	0.00836	-0.723000	0.03601	GAT		0.547	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134		Missense_Mutation
MAP7D1	55700	broad.mit.edu	37	1	36645538	36645538	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:36645538G>C	ENST00000373151.2	+	16	2601	c.2385G>C	c.(2383-2385)caG>caC	p.Q795H	MAP7D1_ENST00000316156.4_Missense_Mutation_p.Q757H|MAP7D1_ENST00000373148.4_Missense_Mutation_p.Q331H|MAP7D1_ENST00000373150.4_Missense_Mutation_p.Q762H	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	795					microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)		p.Q795H(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CAGCACACCAGGAGAATGGCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											49.0	49.0	49.0					1																	36645538		2203	4300	6503	36418125	SO:0001583	missense	55700			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.2385G>C	1.37:g.36645538G>C	ENSP00000362244:p.Gln795His	Unknown		x	x	x	36418125	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	ENST00000373151.2	37	CCDS30673.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212212	0.58452	.	.	ENSG00000116871	ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373153;ENST00000373148	T;T;T;T	0.15372	2.66;2.86;2.85;2.43	5.24	5.24	0.73138	.	0.000000	0.38164	N	0.001786	T	0.17152	0.0412	N	0.24115	0.695	0.35609	D	0.808464	P;B;B;P;B	0.46395	0.877;0.218;0.324;0.552;0.417	P;B;B;B;B	0.53861	0.736;0.078;0.095;0.135;0.064	T	0.11275	-1.0594	10	0.21014	T	0.42	-29.6849	7.4278	0.27109	0.0867:0.1693:0.744:0.0	.	331;794;757;762;795	Q3KQU3-3;D3DPS3;Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;.;.;MA7D1_HUMAN	H	757;762;795;118;331	ENSP00000320228:Q757H;ENSP00000362243:Q762H;ENSP00000362244:Q795H;ENSP00000362241:Q331H	ENSP00000320228:Q757H	Q	+	3	2	MAP7D1	36418125	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.542000	0.23222	2.732000	0.93576	0.655000	0.94253	CAG		0.597	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067		Missense_Mutation
PRKAA2	5563	broad.mit.edu	37	1	57140178	57140178	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0904-01	TCGA-13-0904-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:57140178T>A	ENST00000371244.4	+	2	285	c.219T>A	c.(217-219)caT>caA	p.H73Q		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	73	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.H73Q(1)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	TCTTTCGTCATCCTCATATTA	0.254																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	68.0	65.0					1																	57140178		2200	4295	6495	56912766	SO:0001583	missense	5563			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.219T>A	1.37:g.57140178T>A	ENSP00000360290:p.His73Gln	Somatic		x	x	x	56912766	Q9H1E8|Q9UD43	Missense_Mutation	SNP	ENST00000371244.4	37	CCDS605.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	18.22	3.575250	0.65878	.	.	ENSG00000162409	ENST00000371244	T	0.78481	-1.18	5.47	1.89	0.25635	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.094859	0.64402	D	0.000001	D	0.90174	0.6929	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.88669	0.3194	10	0.87932	D	0	-29.1127	8.6265	0.33892	0.0:0.4581:0.0:0.5419	.	73	P54646	AAPK2_HUMAN	Q	73	ENSP00000360290:H73Q	ENSP00000360290:H73Q	H	+	3	2	PRKAA2	56912766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.704000	0.25661	0.127000	0.18452	0.533000	0.62120	CAT		0.254	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252		Missense_Mutation
BTBD8	284697	broad.mit.edu	37	1	92568090	92568090	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:92568090G>T	ENST00000342818.3	+	3	644	c.408G>T	c.(406-408)aaG>aaT	p.K136N	BTBD8_ENST00000540648.1_Missense_Mutation_p.K136N|BTBD8_ENST00000370382.3_Missense_Mutation_p.K136N	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	136			K -> R (in dbSNP:rs17131602).			nucleus (GO:0005634)		p.K136N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TTAGGAAAAAGATAATGGAGA	0.289																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	59.0	59.0					1																	92568090		2203	4299	6502	92340678	SO:0001583	missense	284697			AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.408G>T	1.37:g.92568090G>T	ENSP00000343686:p.Lys136Asn	Unknown		x	x	x	92340678	Q6V9S5	Missense_Mutation	SNP	ENST00000342818.3	37	CCDS737.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	9.271	1.045703	0.19748	.	.	ENSG00000189195	ENST00000370382;ENST00000342818;ENST00000540648	T;T;T	0.65549	1.85;-0.16;1.83	5.66	3.76	0.43208	BTB/POZ-like (1);BTB/POZ fold (1);	0.279011	0.30584	N	0.009314	T	0.27967	0.0689	L	0.55481	1.735	0.19300	N	0.999975	B	0.19445	0.036	B	0.16289	0.015	T	0.18053	-1.0349	10	0.16420	T	0.52	-5.708	5.3726	0.16148	0.167:0.0:0.67:0.163	.	136	Q5XKL5	BTBD8_HUMAN	N	136	ENSP00000359408:K136N;ENSP00000343686:K136N;ENSP00000443397:K136N	ENSP00000343686:K136N	K	+	3	2	BTBD8	92340678	0.998000	0.40836	0.593000	0.28771	0.512000	0.34134	2.678000	0.46900	0.706000	0.31912	-0.229000	0.12294	AAG		0.289	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028372.1	NM_183242		Missense_Mutation
LRIG2	9860	broad.mit.edu	37	1	113666711	113666711	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:113666711T>G	ENST00000361127.5	+	18	3384	c.3186T>G	c.(3184-3186)agT>agG	p.S1062R	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	1062					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1062R(1)|p.S1062S(1)		breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AAGATGGTAGTGAGGGCACAT	0.438																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	1											84.0	74.0	78.0					1																	113666711		2203	4300	6503	113468234	SO:0001583	missense	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.3186T>G	1.37:g.113666711T>G	ENSP00000355396:p.Ser1062Arg	Unknown		x	x	x	113468234	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336698	0.24253	.	.	ENSG00000198799	ENST00000361127	T	0.61627	0.09	5.9	-0.81	0.10860	.	0.478673	0.22630	N	0.057586	T	0.12092	0.0294	N	0.16478	0.41	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.16600	-1.0397	10	0.25751	T	0.34	.	1.1107	0.01704	0.208:0.2471:0.1072:0.4377	.	1062	O94898	LRIG2_HUMAN	R	1062	ENSP00000355396:S1062R	ENSP00000355396:S1062R	S	+	3	2	LRIG2	113468234	0.060000	0.20803	0.569000	0.28460	0.597000	0.36814	-0.241000	0.08940	0.143000	0.18926	0.528000	0.53228	AGT		0.438	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813		Missense_Mutation
SLC22A15	55356	broad.mit.edu	37	1	116562225	116562225	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:116562225C>A	ENST00000369503.4	+	3	453	c.323C>A	c.(322-324)tCc>tAc	p.S108Y	RP11-159M11.2_ENST00000453128.1_RNA|SLC22A15_ENST00000369502.1_Missense_Mutation_p.S108Y	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	108					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.S108Y(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GCCAACAGATCCTACAAAGTC	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											150.0	127.0	134.0					1																	116562225		1830	4089	5919	116363748	SO:0001583	missense	55356			AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.323C>A	1.37:g.116562225C>A	ENSP00000358515:p.Ser108Tyr	Somatic		x	x	x	116363748	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	37	CCDS44198.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086286	0.76642	.	.	ENSG00000163393	ENST00000369503;ENST00000369502	T;T	0.76448	-1.02;-0.65	5.26	5.26	0.73747	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.113338	0.64402	D	0.000008	D	0.83963	0.5368	M	0.70108	2.13	0.41184	D	0.986257	D;D	0.67145	0.994;0.996	D;P	0.64410	0.925;0.878	D	0.83422	0.0033	10	0.46703	T	0.11	.	17.2158	0.86943	0.0:1.0:0.0:0.0	.	108;108	Q8IZD6;Q8IZD6-2	S22AF_HUMAN;.	Y	108	ENSP00000358515:S108Y;ENSP00000358514:S108Y	ENSP00000358514:S108Y	S	+	2	0	SLC22A15	116363748	1.000000	0.71417	0.996000	0.52242	0.904000	0.53231	5.851000	0.69481	2.731000	0.93534	0.655000	0.94253	TCC		0.368	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420		Missense_Mutation
RNF115	27246	broad.mit.edu	37	1	145682046	145682046	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:145682046G>A	ENST00000369291.5	+	5	656	c.452G>A	c.(451-453)gGa>gAa	p.G151E		NM_014455.2	NP_055270.1			ring finger protein 115									p.G151E(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						ATCTTTGCAGGATTCTTTGCA	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											199.0	192.0	194.0					1																	145682046		2203	4300	6503	144393403	SO:0001583	missense	27246			AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.452G>A	1.37:g.145682046G>A	ENSP00000358297:p.Gly151Glu	Unknown		x	x	x	144393403		Missense_Mutation	SNP	ENST00000369291.5	37	CCDS922.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430902	0.62844	.	.	ENSG00000121848	ENST00000369291	T	0.12569	2.67	4.93	4.02	0.46733	.	0.110858	0.64402	N	0.000009	T	0.12902	0.0313	M	0.72894	2.215	0.54753	D	0.999987	D	0.64830	0.994	P	0.50537	0.643	T	0.02844	-1.1103	10	0.35671	T	0.21	-3.7531	10.8007	0.46487	0.0915:0.0:0.9085:0.0	.	151	Q9Y4L5	RN115_HUMAN	E	151	ENSP00000358297:G151E	ENSP00000358297:G151E	G	+	2	0	RNF115	144393403	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.230000	0.65321	1.295000	0.44724	0.655000	0.94253	GGA		0.353	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038554.2	NM_014455		Missense_Mutation
SPRR2E	6704	broad.mit.edu	37	1	153066108	153066108	+	Silent	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:153066108C>T	ENST00000368751.1	-	2	194	c.120G>A	c.(118-120)aaG>aaA	p.K40K	SPRR2B_ENST00000368752.4_Intron|SPRR2E_ENST00000368750.3_Silent_p.K40K			P22531	SPR2E_HUMAN	small proline-rich protein 2E	40	3 X 9 AA tandem repeats of P-K-C-P-[EQ]- P-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	structural molecule activity (GO:0005198)	p.K40K(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGTGGACACTTTGGTGGTG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	1											153.0	150.0	151.0					1																	153066108		2203	4300	6503	151332732	SO:0001819	synonymous_variant	6704			AF333955	CCDS30866.1	1q21-q22	2008-02-05			ENSG00000203785	ENSG00000203785			11265	protein-coding gene	gene with protein product						8325635	Standard	NM_001024209		Approved		uc001fbh.3	P22531	OTTHUMG00000014397	ENST00000368751.1:c.120G>A	1.37:g.153066108C>T		Unknown		x	x	x	151332732	Q5T9T4|Q96RM2	Silent	SNP	ENST00000368751.1	37	CCDS30866.1	SNP	20	Broad																																																																																				0.622	SPRR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040054.1			Silent
ISG20L2	81875	broad.mit.edu	37	1	156693229	156693229	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:156693229A>G	ENST00000313146.6	-	3	1756	c.974T>C	c.(973-975)gTg>gCg	p.V325A	ISG20L2_ENST00000472824.2_5'UTR|ISG20L2_ENST00000368219.1_Missense_Mutation_p.V325A	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	325	Exonuclease.				ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)	p.V325A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCATCTTCCACAGAGGAATG	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											161.0	151.0	154.0					1																	156693229		2203	4300	6503	154959853	SO:0001583	missense	81875			AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.974T>C	1.37:g.156693229A>G	ENSP00000323424:p.Val325Ala	Unknown		x	x	x	154959853	D3DVC6|Q64KA2	Missense_Mutation	SNP	ENST00000313146.6	37	CCDS1153.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	32	5.128437	0.94473	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.22743	1.94;1.94	5.61	5.61	0.85477	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.64402	D	0.000001	T	0.37705	0.1013	M	0.71871	2.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.26326	-1.0106	10	0.72032	D	0.01	-15.3649	14.9148	0.70789	1.0:0.0:0.0:0.0	.	325	Q9H9L3	I20L2_HUMAN	A	325	ENSP00000323424:V325A;ENSP00000357202:V325A	ENSP00000323424:V325A	V	-	2	0	ISG20L2	154959853	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.052000	0.93855	2.255000	0.74692	0.533000	0.62120	GTG		0.517	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098969.1	NM_030980		Missense_Mutation
UCHL5	51377	broad.mit.edu	37	1	193018899	193018899	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:193018899C>G	ENST00000367455.4	-	3	458	c.223G>C	c.(223-225)Gac>Cac	p.D75H	UCHL5_ENST00000483156.1_5'UTR|UCHL5_ENST00000367454.1_Missense_Mutation_p.D75H|UCHL5_ENST00000367452.4_5'UTR|UCHL5_ENST00000530098.2_Intron|UCHL5_ENST00000367449.1_Missense_Mutation_p.D75H|UCHL5_ENST00000367451.4_Missense_Mutation_p.D75H|UCHL5_ENST00000367448.1_Missense_Mutation_p.D75H	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	75					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)	p.D75H(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						AATATCGTGTCAAGTCGGGAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	69.0	68.0					1																	193018899		2203	4300	6503	191285522	SO:0001583	missense	51377				CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.223G>C	1.37:g.193018899C>G	ENSP00000356425:p.Asp75His	Unknown		x	x	x	191285522	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	ENST00000367455.4	37	CCDS1378.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	28.9	4.959609	0.92791	.	.	ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451;ENST00000367448;ENST00000367449;ENST00000391991;ENST00000421683	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.3	5.3	0.74995	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.046749	0.85682	D	0.000000	T	0.61185	0.2327	M	0.80028	2.48	0.80722	D	1	P;P;P;B	0.49862	0.563;0.929;0.476;0.215	P;P;B;B	0.53062	0.472;0.717;0.139;0.102	T	0.66728	-0.5850	10	0.72032	D	0.01	-12.2225	18.0784	0.89435	0.0:1.0:0.0:0.0	.	75;75;75;75	Q9Y5K5-2;Q9Y5K5-4;Q9Y5K5-3;Q9Y5K5	.;.;.;UCHL5_HUMAN	H	75;75;87;75;75;75;65;66	ENSP00000356425:D75H;ENSP00000356424:D75H;ENSP00000356420:D87H;ENSP00000356421:D75H;ENSP00000356418:D75H;ENSP00000356419:D75H;ENSP00000389563:D66H	ENSP00000356418:D75H	D	-	1	0	UCHL5	191285522	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.963000	0.76055	2.638000	0.89438	0.591000	0.81541	GAC		0.408	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	216052179	216052179	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr1:216052179C>A	ENST00000307340.3	-	42	8871	c.8485G>T	c.(8485-8487)Gtg>Ttg	p.V2829L	USH2A_ENST00000366943.2_Missense_Mutation_p.V2829L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2829	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.V2829L(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTGGAATCACAGACAATGGG	0.448										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											138.0	127.0	131.0					1																	216052179		2203	4300	6503	214118802	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8485G>T	1.37:g.216052179C>A	ENSP00000305941:p.Val2829Leu	Unknown		x	x	x	214118802	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	8.672	0.902980	0.17760	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.59638	0.25;0.25	5.8	3.92	0.45320	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.821323	0.09906	N	0.740461	T	0.57695	0.2071	M	0.72118	2.19	0.36963	D	0.893423	B	0.24258	0.1	B	0.26094	0.066	T	0.55270	-0.8167	10	0.44086	T	0.13	.	9.136	0.36875	0.0:0.7452:0.1212:0.1336	.	2829	O75445	USH2A_HUMAN	L	2829	ENSP00000305941:V2829L;ENSP00000355910:V2829L	ENSP00000305941:V2829L	V	-	1	0	USH2A	214118802	0.247000	0.23920	0.001000	0.08648	0.019000	0.09904	1.435000	0.34969	0.776000	0.33473	-0.145000	0.13849	GTG		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
PRTFDC1	56952	broad.mit.edu	37	10	25160959	25160959	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:25160959C>T	ENST00000320152.6	-	4	401	c.373G>A	c.(373-375)Gga>Aga	p.G125R	PRTFDC1_ENST00000376378.1_Missense_Mutation_p.G125R	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	125					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)	p.G125R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TCATCGCCTCCGATTATCTGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	10											276.0	237.0	250.0					10																	25160959		2203	4300	6503	25200965	SO:0001583	missense	56952			AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.373G>A	10.37:g.25160959C>T	ENSP00000318602:p.Gly125Arg	Unknown		x	x	x	25200965	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	ENST00000320152.6	37	CCDS7145.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887726	0.72410	.	.	ENSG00000099256	ENST00000320152;ENST00000358336;ENST00000376378	D;D	0.99319	-5.74;-5.74	5.7	4.8	0.61643	Phosphoribosyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.99121	0.9697	M	0.73753	2.245	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.81914	0.5;0.995	D	0.99421	1.0933	10	0.26408	T	0.33	.	10.6276	0.45516	0.0:0.9119:0.0:0.0881	.	125;125	Q9NRG1-2;Q9NRG1	.;PRDC1_HUMAN	R	125	ENSP00000318602:G125R;ENSP00000365558:G125R	ENSP00000318602:G125R	G	-	1	0	PRTFDC1	25200965	0.987000	0.35691	0.956000	0.39512	0.875000	0.50365	2.977000	0.49297	1.414000	0.47017	0.655000	0.94253	GGA		0.453	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047243.2	NM_020200		Missense_Mutation
ANKRD30A	91074	broad.mit.edu	37	10	37430846	37430846	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:37430846T>A	ENST00000602533.1	+	7	952	c.853T>A	c.(853-855)Tgt>Agt	p.C285S	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.C285S|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.C285S			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	341					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C285S(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CAAAATTCAATGTTTGGAGAA	0.448																																																1	Substitution - Missense(1)	ovary(1)	10											74.0	75.0	75.0					10																	37430846		1885	4127	6012	37470852	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.853T>A	10.37:g.37430846T>A	ENSP00000473551:p.Cys285Ser	Unknown		x	x	x	37470852	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	.	0.248	-1.008562	0.02112	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05139	3.49;3.49	0.627	-0.672	0.11377	.	.	.	.	.	T	0.10637	0.0260	L	0.40543	1.245	0.09310	N	1	P	0.50156	0.932	P	0.60789	0.879	T	0.30179	-0.9987	8	0.24483	T	0.36	.	.	.	.	.	341	Q9BXX3	AN30A_HUMAN	S	285	ENSP00000354432:C285S;ENSP00000363792:C285S	ENSP00000354432:C285S	C	+	1	0	ANKRD30A	37470852	0.177000	0.23109	0.001000	0.08648	0.008000	0.06430	0.269000	0.18589	-0.275000	0.09219	0.321000	0.21382	TGT		0.448	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		Missense_Mutation
SLC18A3	6572	broad.mit.edu	37	10	50820329	50820329	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:50820329C>G	ENST00000374115.3	+	1	1983	c.1543C>G	c.(1543-1545)Cct>Gct	p.P515A	CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000351556.3_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	515					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.P515A(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TCGCAGCCCGCCTGGCCCTTT	0.642																																																1	Substitution - Missense(1)	ovary(1)	10											56.0	64.0	62.0					10																	50820329		2201	4296	6497	50490335	SO:0001583	missense	6572			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1543C>G	10.37:g.50820329C>G	ENSP00000363229:p.Pro515Ala	Unknown		x	x	x	50490335	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861143	0.32884	.	.	ENSG00000187714	ENST00000374115	T	0.03831	3.79	4.72	2.87	0.33458	.	0.291902	0.29009	U	0.013423	T	0.01592	0.0051	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47699	-0.9097	10	0.06365	T	0.9	-0.1354	5.6125	0.17414	0.0:0.6045:0.2137:0.1818	.	515	Q16572	VACHT_HUMAN	A	515	ENSP00000363229:P515A	ENSP00000363229:P515A	P	+	1	0	SLC18A3	50490335	0.005000	0.15991	0.004000	0.12327	0.354000	0.29330	0.337000	0.19841	0.430000	0.26230	0.555000	0.69702	CCT		0.642	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055		Missense_Mutation
MYOZ1	58529	broad.mit.edu	37	10	75393678	75393678	+	Silent	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:75393678G>T	ENST00000359322.4	-	5	1012	c.648C>A	c.(646-648)ccC>ccA	p.P216P	RP11-464F9.22_ENST00000609434.1_lincRNA	NM_021245.3	NP_067068.1			myozenin 1									p.P216P(1)		central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					ACTTATATTTGGGAAGTTCAG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	10											175.0	163.0	167.0					10																	75393678		2203	4300	6503	75063684	SO:0001819	synonymous_variant	58529			AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.648C>A	10.37:g.75393678G>T		Unknown		x	x	x	75063684		Silent	SNP	ENST00000359322.4	37	CCDS7330.1	SNP	47	Broad																																																																																				0.488	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1			Silent
ELOVL3	83401	broad.mit.edu	37	10	103988950	103988950	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:103988950C>A	ENST00000370005.3	+	4	975	c.754C>A	c.(754-756)Cac>Aac	p.H252N		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	252					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.H252N(1)		breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CCTCTTTGCCCACTTCTTCTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											171.0	153.0	159.0					10																	103988950		2203	4300	6503	103978940	SO:0001583	missense	83401			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.754C>A	10.37:g.103988950C>A	ENSP00000359022:p.His252Asn	Unknown		x	x	x	103978940	Q5VZL3|Q8N180	Missense_Mutation	SNP	ENST00000370005.3	37	CCDS7531.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	8.684	0.905928	0.17760	.	.	ENSG00000119915	ENST00000370005	T	0.19669	2.13	5.44	2.41	0.29592	.	0.557127	0.17281	N	0.180003	T	0.12347	0.0300	N	0.25031	0.7	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.30179	-0.9987	10	0.02654	T	1	-15.6472	14.3255	0.66518	0.6084:0.3916:0.0:0.0	.	252	Q9HB03	ELOV3_HUMAN	N	252	ENSP00000359022:H252N	ENSP00000359022:H252N	H	+	1	0	ELOVL3	103978940	0.000000	0.05858	0.065000	0.19835	0.227000	0.25037	-0.343000	0.07791	0.634000	0.30469	0.650000	0.86243	CAC		0.498	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050030.1	NM_152310		Missense_Mutation
FRG2B	441581	broad.mit.edu	37	10	135438800	135438800	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr10:135438800G>A	ENST00000425520.1	-	4	692	c.640C>T	c.(640-642)Cgg>Tgg	p.R214W	FRG2B_ENST00000443774.1_Missense_Mutation_p.R215W	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	214						nucleus (GO:0005634)		p.R215W(1)		endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AGAGGCCCCCGGAGCCGAGTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											7.0	9.0	8.0					10																	135438800		1667	3744	5411	135288790	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.640C>T	10.37:g.135438800G>A	ENSP00000401310:p.Arg214Trp	Unknown		x	x	x	135288790	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	.	9.078	0.998596	0.19121	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.47869	0.83;0.83	.	.	.	.	1.446430	0.04657	N	0.408159	T	0.47967	0.1474	N	0.12182	0.205	0.19775	N	0.99995	D	0.76494	0.999	D	0.76575	0.988	T	0.47045	-0.9147	8	0.49607	T	0.09	-1.5836	.	.	.	.	214	Q96QU4	FRG2B_HUMAN	W	215;214	ENSP00000408343:R215W;ENSP00000401310:R214W	ENSP00000401310:R214W	R	-	1	2	FRG2B	135288790	0.016000	0.18221	0.640000	0.29408	0.646000	0.38490	0.308000	0.19314	0.119000	0.18210	0.121000	0.15741	CGG		0.582	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998		Missense_Mutation
DCHS1	8642	broad.mit.edu	37	11	6652957	6652957	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr11:6652957G>T	ENST00000299441.3	-	7	3976	c.3565C>A	c.(3565-3567)Cca>Aca	p.P1189T	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1189	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P1189T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGCGGGGTGGGCTCCCTCCA	0.617																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	53.0	56.0					11																	6652957		2201	4296	6497	6609533	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3565C>A	11.37:g.6652957G>T	ENSP00000299441:p.Pro1189Thr	Unknown		x	x	x	6609533	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319905	0.60634	.	.	ENSG00000166341	ENST00000299441	T	0.01665	4.7	5.2	5.2	0.72013	Cadherin (4);Cadherin-like (1);	0.000000	0.44688	D	0.000425	T	0.13286	0.0322	M	0.87682	2.9	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	T	0.00160	-1.1973	10	0.62326	D	0.03	.	17.9063	0.88919	0.0:0.0:1.0:0.0	.	1189	Q96JQ0	PCD16_HUMAN	T	1189	ENSP00000299441:P1189T	ENSP00000299441:P1189T	P	-	1	0	DCHS1	6609533	1.000000	0.71417	0.976000	0.42696	0.461000	0.32589	7.251000	0.78297	2.711000	0.92665	0.655000	0.94253	CCA		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737		Missense_Mutation
DDB2	1643	broad.mit.edu	37	11	47256952	47256952	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr11:47256952A>C	ENST00000256996.4	+	7	1207	c.1012A>C	c.(1012-1014)Aca>Cca	p.T338P	DDB2_ENST00000378601.3_3'UTR|DDB2_ENST00000378603.3_Missense_Mutation_p.T274P|DDB2_ENST00000378600.3_Intron	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	338					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)	p.T338P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						CCAGCACCTCACACCCATCAA	0.627			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	1	Substitution - Missense(1)	ovary(1)	11											51.0	44.0	46.0					11																	47256952		2201	4298	6499	47213528	SO:0001583	missense	1643	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.1012A>C	11.37:g.47256952A>C	ENSP00000256996:p.Thr338Pro	Unknown		x	x	x	47213528	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	ENST00000256996.4	37	CCDS7927.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	24.9	4.580029	0.86645	.	.	ENSG00000134574	ENST00000256996;ENST00000378603	T;T	0.74632	-0.86;2.89	5.85	4.72	0.59763	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.042196	0.85682	D	0.000000	D	0.84515	0.5489	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.976	D	0.85394	0.1127	10	0.72032	D	0.01	-26.4236	11.8955	0.52654	0.932:0.0:0.068:0.0	.	274;338	Q92466-4;Q92466	.;DDB2_HUMAN	P	338;274	ENSP00000256996:T338P;ENSP00000367866:T274P	ENSP00000256996:T338P	T	+	1	0	DDB2	47213528	1.000000	0.71417	0.953000	0.39169	0.994000	0.84299	7.153000	0.77428	1.038000	0.40049	0.533000	0.62120	ACA		0.627	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000107		Missense_Mutation
LRP5	4041	broad.mit.edu	37	11	68192614	68192614	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr11:68192614A>G	ENST00000294304.7	+	15	3387	c.3281A>G	c.(3280-3282)gAa>gGa	p.E1094G		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1094	Beta-propeller 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.E1094G(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCCAAGATCGAACGCGCAGCC	0.662																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	70.0	80.0					11																	68192614		2200	4294	6494	67949190	SO:0001583	missense	4041			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3281A>G	11.37:g.68192614A>G	ENSP00000294304:p.Glu1094Gly	Unknown		x	x	x	67949190	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611635	0.87258	.	.	ENSG00000162337	ENST00000294304	D	0.91295	-2.82	4.93	4.93	0.64822	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	U	0.000169	D	0.95020	0.8388	M	0.82517	2.595	0.80722	D	1	P;P	0.40302	0.712;0.712	P;P	0.58266	0.836;0.836	D	0.95418	0.8504	10	0.62326	D	0.03	.	14.7732	0.69696	1.0:0.0:0.0:0.0	.	1094;1094	Q9UES7;O75197	.;LRP5_HUMAN	G	1094	ENSP00000294304:E1094G	ENSP00000294304:E1094G	E	+	2	0	LRP5	67949190	1.000000	0.71417	0.988000	0.46212	0.771000	0.43674	8.514000	0.90545	2.084000	0.62774	0.397000	0.26171	GAA		0.662	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335		Missense_Mutation
VWF	7450	broad.mit.edu	37	12	6184517	6184517	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr12:6184517G>A	ENST00000261405.5	-	7	1112	c.858C>T	c.(856-858)acC>acT	p.T286T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	286					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T286T(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CGCTGTGGTCGGTCCAGCCGT	0.682																																																1	Substitution - coding silent(1)	ovary(1)	12											62.0	53.0	56.0					12																	6184517		2203	4300	6503	6054778	SO:0001819	synonymous_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.858C>T	12.37:g.6184517G>A		Unknown		x	x	x	6054778	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1	SNP	39	Broad																																																																																				0.682	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		Silent
KRT6C	286887	broad.mit.edu	37	12	52863578	52863578	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr12:52863578G>A	ENST00000252250.6	-	7	1347	c.1300C>T	c.(1300-1302)Ctg>Ttg	p.L434L		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	434	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.L434L(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GCCTTCTGCAGGGCATCCTCC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	12											76.0	62.0	66.0					12																	52863578		2203	4291	6494	51149845	SO:0001819	synonymous_variant	286887			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.1300C>T	12.37:g.52863578G>A		Unknown		x	x	x	51149845	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Silent	SNP	ENST00000252250.6	37	CCDS8829.1	SNP	35	Broad																																																																																				0.597	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404976.1	NM_173086		Silent
C12orf66	144577	broad.mit.edu	37	12	64609703	64609703	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr12:64609703G>A	ENST00000398055.3	-	2	329	c.276C>T	c.(274-276)acC>acT	p.T92T	C12orf66_ENST00000544871.1_Silent_p.T39T|C12orf66_ENST00000311915.8_Silent_p.T92T	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	92								p.T92T(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						AAGTATAGATGGTGCGGATGG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											49.0	52.0	51.0					12																	64609703		2006	4172	6178	62895970	SO:0001819	synonymous_variant	144577				CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.276C>T	12.37:g.64609703G>A		Unknown		x	x	x	62895970	C9JX54|Q8IYA0	Silent	SNP	ENST00000398055.3	37	CCDS41803.1	SNP	47	Broad																																																																																				0.507	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	NM_152440		Silent
SACS	26278	broad.mit.edu	37	13	23912946	23912946	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr13:23912946A>T	ENST00000382292.3	-	9	5342	c.5069T>A	c.(5068-5070)gTa>gAa	p.V1690E	SACS_ENST00000402364.1_Missense_Mutation_p.V940E|SACS_ENST00000382298.3_Missense_Mutation_p.V1690E			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1690					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.V1543E(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CATTGACTTTACACTCTGAGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	13											62.0	62.0	62.0					13																	23912946		2203	4299	6502	22810946	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5069T>A	13.37:g.23912946A>T	ENSP00000371729:p.Val1690Glu	Somatic		x	x	x	22810946	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290309	0.40494	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.94576	-3.46;-3.46;-3.46	5.54	5.54	0.83059	ATPase-like, ATP-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96833	0.8966	M	0.69823	2.125	0.54753	D	0.999988	D	0.89917	1.0	D	0.83275	0.996	D	0.97443	1.0023	10	0.87932	D	0	.	15.6797	0.77357	1.0:0.0:0.0:0.0	.	1690	Q9NZJ4	SACS_HUMAN	E	1690;940;1690	ENSP00000371729:V1690E;ENSP00000385844:V940E;ENSP00000371735:V1690E	ENSP00000371729:V1690E	V	-	2	0	SACS	22810946	1.000000	0.71417	0.900000	0.35374	0.025000	0.11179	8.946000	0.92992	2.110000	0.64415	0.496000	0.49642	GTA		0.348	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		Missense_Mutation
ATP8A2	51761	broad.mit.edu	37	13	26144928	26144928	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr13:26144928G>T	ENST00000381655.2	+	17	1639	c.1497G>T	c.(1495-1497)gaG>gaT	p.E499D	ATP8A2_ENST00000255283.8_Missense_Mutation_p.E459D|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	459					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E499D(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GCATTCAGGAGTTCCTCACCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	13											99.0	100.0	100.0					13																	26144928		2083	4214	6297	25042928	SO:0001583	missense	51761			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1497G>T	13.37:g.26144928G>T	ENSP00000371070:p.Glu499Asp	Somatic		x	x	x	25042928	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886737	0.51908	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.63913	-0.07;-0.07	4.82	3.97	0.46021	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.69160	0.3080	L	0.50993	1.605	0.53005	D	0.999967	B;P;D;B	0.69078	0.163;0.552;0.997;0.163	B;P;D;B	0.68039	0.33;0.447;0.955;0.33	T	0.68603	-0.5365	10	0.49607	T	0.09	.	8.5203	0.33270	0.1793:0.0:0.8207:0.0	.	459;279;459;459	B7Z880;F5GZN5;Q9NTI2-3;Q9NTI2	.;.;.;AT8A2_HUMAN	D	499;459;279	ENSP00000371070:E499D;ENSP00000255283:E459D	ENSP00000255283:E459D	E	+	3	2	ATP8A2	25042928	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.040000	0.57333	1.237000	0.43756	0.563000	0.77884	GAG		0.567	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529		Missense_Mutation
INTS6	26512	broad.mit.edu	37	13	51948392	51948392	+	Missense_Mutation	SNP	T	T	C	rs572515264	byFrequency	TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr13:51948392T>C	ENST00000311234.4	-	15	2528	c.2056A>G	c.(2056-2058)Aca>Gca	p.T686A	INTS6_ENST00000425000.1_Missense_Mutation_p.T254A|INTS6_ENST00000490542.1_Missense_Mutation_p.T370A|INTS6_ENST00000463928.1_Intron|INTS6_ENST00000497989.1_Missense_Mutation_p.T508A|INTS6_ENST00000398119.2_Missense_Mutation_p.T673A	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	686					signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)	p.T686A(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		GCTTGAGTTGTAGGTGCAGGT	0.398													T|||	7	0.00139776	0.0	0.0	5008	,	,		17970	0.0069		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	13											180.0	168.0	172.0					13																	51948392		2203	4300	6503	50846393	SO:0001583	missense	26512			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.2056A>G	13.37:g.51948392T>C	ENSP00000310260:p.Thr686Ala	Unknown		x	x	x	50846393	Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	ENST00000311234.4	37	CCDS9428.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	3.688	-0.064033	0.07273	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000497989;ENST00000425000;ENST00000490542	.	.	.	5.68	-7.27	0.01461	.	1.787830	0.01831	N	0.034689	T	0.14830	0.0358	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27571	-1.0070	9	0.07030	T	0.85	3.9647	7.5755	0.27933	0.0:0.4151:0.2327:0.3522	.	686	Q9UL03	INT6_HUMAN	A	686;673;508;254;370	.	ENSP00000310260:T686A	T	-	1	0	INTS6	50846393	0.000000	0.05858	0.013000	0.15412	0.341000	0.28922	-0.374000	0.07484	-1.465000	0.01899	-0.326000	0.08463	ACA		0.398	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141		Missense_Mutation
GRK1	6011	broad.mit.edu	37	13	114324122	114324122	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr13:114324122G>T	ENST00000335678.6	+	2	1052	c.820G>T	c.(820-822)Gac>Tac	p.D274Y		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	274	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)	p.K40N(1)		ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			GAACGGAGGTGACATCAGGTA	0.587																																																1	Substitution - Missense(1)	ovary(1)	13											90.0	89.0	89.0					13																	114324122		1973	4161	6134	113372123	SO:0001583	missense	6011					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.820G>T	13.37:g.114324122G>T	ENSP00000334876:p.Asp274Tyr	Somatic		x	x	x	113372123	Q53X14	Missense_Mutation	SNP	ENST00000335678.6	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	g	16.17	3.046393	0.55110	.	.	ENSG00000185974	ENST00000335678	T	0.29655	1.56	4.36	4.36	0.52297	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.049439	0.85682	D	0.000000	T	0.56470	0.1987	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63301	-0.6668	9	0.87932	D	0	-40.1128	14.7555	0.69560	0.0:0.0:1.0:0.0	.	274	Q15835	RK_HUMAN	Y	274	ENSP00000334876:D274Y	ENSP00000334876:D274Y	D	+	1	0	GRK1	113372123	1.000000	0.71417	0.469000	0.27204	0.317000	0.28152	6.714000	0.74692	2.131000	0.65755	0.511000	0.50034	GAC		0.587	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929		Missense_Mutation
LRRC16B	90668	broad.mit.edu	37	14	24531755	24531755	+	Silent	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr14:24531755C>G	ENST00000342740.5	+	28	2701	c.2547C>G	c.(2545-2547)ctC>ctG	p.L849L	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	849						cytoplasm (GO:0005737)		p.L849L(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TGCAAGAGCTCTACCATTCCC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	14											133.0	125.0	127.0					14																	24531755		2203	4300	6503	23601595	SO:0001819	synonymous_variant	90668			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2547C>G	14.37:g.24531755C>G		Unknown		x	x	x	23601595	Q8TEF7|Q96HS9	Silent	SNP	ENST00000342740.5	37	CCDS32054.1	SNP	32	Broad																																																																																				0.562	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360		Silent
PCNXL4	64430	broad.mit.edu	37	14	60591812	60591812	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr14:60591812G>C	ENST00000406854.1	+	9	3477	c.2923G>C	c.(2923-2925)Gta>Cta	p.V975L	PCNXL4_ENST00000404681.2_Missense_Mutation_p.V975L|PCNXL4_ENST00000535349.1_Missense_Mutation_p.V182L|PCNXL4_ENST00000317623.4_Missense_Mutation_p.V741L|PCNXL4_ENST00000406949.1_Missense_Mutation_p.V741L			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	975						integral component of membrane (GO:0016021)		p.V741L(1)									TGTTCATACAGTAATGACTTG	0.363																																																1	Substitution - Missense(1)	ovary(1)	14											84.0	87.0	86.0					14																	60591812		2202	4300	6502	59661565	SO:0001583	missense	64430			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.2923G>C	14.37:g.60591812G>C	ENSP00000384801:p.Val975Leu	Unknown		x	x	x	59661565	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217945	0.39201	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681;ENST00000535349	T;T;T;T;T	0.39787	1.64;1.64;1.58;1.64;1.06	4.91	4.91	0.64330	.	0.244211	0.41500	D	0.000864	T	0.33847	0.0877	L	0.47716	1.5	0.44247	D	0.997091	B;B	0.30281	0.071;0.275	B;B	0.29785	0.077;0.107	T	0.14364	-1.0475	10	0.35671	T	0.21	.	8.7123	0.34391	0.0806:0.1528:0.7665:0.0	.	975;741	Q63HM2;B5MC47	CN135_HUMAN;.	L	741;975;741;975;182	ENSP00000317396:V741L;ENSP00000384801:V975L;ENSP00000385201:V741L;ENSP00000385713:V975L;ENSP00000445644:V182L	ENSP00000317396:V741L	V	+	1	0	C14orf135	59661565	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	5.105000	0.64591	2.422000	0.82143	0.305000	0.20034	GTA		0.363	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495		Missense_Mutation
SPTB	6710	broad.mit.edu	37	14	65260199	65260199	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr14:65260199G>C	ENST00000389721.5	-	13	2214	c.2182C>G	c.(2182-2184)Ctg>Gtg	p.L728V	SPTB_ENST00000556626.1_Missense_Mutation_p.L728V|SPTB_ENST00000542895.1_Missense_Mutation_p.L728V|SPTB_ENST00000389720.3_Missense_Mutation_p.L728V|SPTB_ENST00000389722.3_Missense_Mutation_p.L728V	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	728					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.L728V(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGGTCCTTCAGCTGGTCCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	14											56.0	53.0	54.0					14																	65260199		2203	4300	6503	64329952	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2182C>G	14.37:g.65260199G>C	ENSP00000374371:p.Leu728Val	Somatic		x	x	x	64329952	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709179	0.68615	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42	4.69	3.79	0.43588	.	0.000000	0.64402	D	0.000002	D	0.83908	0.5356	M	0.92026	3.265	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.79108	0.991;0.992	D	0.86827	0.2008	10	0.87932	D	0	.	12.4302	0.55569	0.0853:0.0:0.9147:0.0	.	728;732	P11277;Q59FP5	SPTB1_HUMAN;.	V	732;728;728;728;728;728	ENSP00000374372:L728V;ENSP00000451752:L728V;ENSP00000374371:L728V;ENSP00000443882:L728V;ENSP00000374370:L728V	ENSP00000374370:L728V	L	-	1	2	SPTB	64329952	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.926000	0.48892	1.074000	0.40909	0.561000	0.74099	CTG		0.582	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1			Missense_Mutation
PTPN21	11099	broad.mit.edu	37	14	88936359	88936359	+	Silent	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr14:88936359G>C	ENST00000556564.1	-	16	3191	c.2907C>G	c.(2905-2907)gcC>gcG	p.A969A	PTPN21_ENST00000328736.3_Silent_p.A969A	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	969	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)	p.A969A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GTCCCTGTGTGGCAATATAAT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	14											111.0	106.0	108.0					14																	88936359		2203	4300	6503	88006112	SO:0001819	synonymous_variant	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2907C>G	14.37:g.88936359G>C		Somatic		x	x	x	88006112		Silent	SNP	ENST00000556564.1	37	CCDS9884.1	SNP	47	Broad																																																																																				0.398	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1			Silent
IGDCC4	57722	broad.mit.edu	37	15	65702612	65702612	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr15:65702612T>A	ENST00000352385.2	-	3	676	c.467A>T	c.(466-468)gAg>gTg	p.E156V		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	156	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E156V(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TGTCCCGTTCTCCTCCACCGT	0.577																																																1	Substitution - Missense(1)	ovary(1)	15											81.0	71.0	74.0					15																	65702612		2201	4299	6500	63489665	SO:0001583	missense	57722				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.467A>T	15.37:g.65702612T>A	ENSP00000319623:p.Glu156Val	Unknown		x	x	x	63489665	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	15.20	2.764297	0.49574	.	.	ENSG00000103742	ENST00000352385	T	0.78924	-1.22	5.48	3.0	0.34707	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.564774	0.18012	N	0.154509	T	0.62514	0.2434	L	0.37561	1.115	0.29990	N	0.816946	B	0.11235	0.004	B	0.19666	0.026	T	0.50591	-0.8810	10	0.02654	T	1	-27.7544	9.0984	0.36653	0.2922:0.0:0.0:0.7078	.	156	Q8TDY8	IGDC4_HUMAN	V	156	ENSP00000319623:E156V	ENSP00000319623:E156V	E	-	2	0	IGDCC4	63489665	0.996000	0.38824	1.000000	0.80357	0.991000	0.79684	0.721000	0.25911	0.897000	0.36392	-0.333000	0.08304	GAG		0.577	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962		Missense_Mutation
CERS3	204219	broad.mit.edu	37	15	101024822	101024822	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr15:101024822C>A	ENST00000394113.1	-	7	1030	c.340G>T	c.(340-342)Gaa>Taa	p.E114*	CERS3_ENST00000538112.2_Nonsense_Mutation_p.E114*|CERS3_ENST00000284382.4_Nonsense_Mutation_p.E114*|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	114					ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.E114*(1)									AACCATCTTTCCACCTGGCGC	0.468																																																1	Substitution - Nonsense(1)	ovary(1)	15											86.0	71.0	76.0					15																	101024822		2203	4300	6503	98842345	SO:0001587	stop_gained	204219				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.340G>T	15.37:g.101024822C>A	ENSP00000377672:p.Glu114*	Unknown		x	x	x	98842345	Q8NE64|Q8NEN6	Nonsense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	40	8.151437	0.98678	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	.	.	.	5.26	5.26	0.73747	.	0.049616	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.801	17.6304	0.88104	0.0:1.0:0.0:0.0	.	.	.	.	X	114;125;114	.	ENSP00000284382:E114X	E	-	1	0	CERS3	98842345	0.996000	0.38824	0.965000	0.40720	0.994000	0.84299	3.004000	0.49513	2.448000	0.82819	0.655000	0.94253	GAA		0.468	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842		Nonsense_Mutation
PRR35	146325	broad.mit.edu	37	16	613412	613413	+	Missense_Mutation	DNP	TT	TT	CC			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:613412_613413TT>CC	ENST00000409413.3	+	2	397_398	c.118_119TT>CC	c.(118-120)TTc>CCc	p.F40P		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		40								p.F40P(1)		central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						CTACAAATGCTTCCAGTGCCCC	0.609																																																1	Substitution - Missense(1)	ovary(1)	16																																								553414	SO:0001583	missense	146325																														Exception_encountered	16.37:g.613412_613413delinsCC	ENSP00000386499:p.Phe40Pro	Unknown		x	x	x	553413	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	DNP	ENST00000409413.3	37	CCDS45365.1	DNP	56	Broad																																																																																				0.609	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1			Missense_Mutation
ZG16B	124220	broad.mit.edu	37	16	2881990	2881990	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:2881990T>C	ENST00000382280.3	+	4	536	c.457T>C	c.(457-459)Tcc>Ccc	p.S153P	ZG16B_ENST00000572863.1_Missense_Mutation_p.S123P	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B	153					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)	p.S153P(1)		central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						TGGCCAGATCTCCTCTGCCTA	0.512																																																1	Substitution - Missense(1)	ovary(1)	16											63.0	67.0	66.0					16																	2881990		1959	4160	6119	2821991	SO:0001583	missense	124220			BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.457T>C	16.37:g.2881990T>C	ENSP00000371715:p.Ser153Pro	Unknown		x	x	x	2821991	A6NIY1|B2R4F6|Q6UW28	Missense_Mutation	SNP	ENST00000382280.3	37	CCDS10479.2	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	t	11.79	1.742925	0.30865	.	.	ENSG00000162078	ENST00000382280	T	0.30182	1.54	3.28	3.28	0.37604	Mannose-binding lectin (3);	0.240617	0.21735	N	0.069917	T	0.15782	0.0380	N	0.08118	0	0.09310	N	1	B	0.26708	0.157	B	0.28305	0.088	T	0.16897	-1.0387	10	0.72032	D	0.01	-39.7456	8.3184	0.32115	0.0:0.0:0.0:1.0	.	153	Q96DA0	ZG16B_HUMAN	P	153	ENSP00000371715:S153P	ENSP00000371715:S153P	S	+	1	0	ZG16B	2821991	0.036000	0.19791	0.003000	0.11579	0.104000	0.19210	1.720000	0.38022	1.746000	0.51805	0.454000	0.30748	TCC		0.512	ZG16B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250912.1	NM_145252		Missense_Mutation
MMP2	4313	broad.mit.edu	37	16	55525730	55525730	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:55525730G>C	ENST00000219070.4	+	8	1707	c.1198G>C	c.(1198-1200)Gtg>Ctg	p.V400L	MMP2_ENST00000570308.1_Missense_Mutation_p.V324L|MMP2_ENST00000437642.2_Missense_Mutation_p.V350L|MMP2_ENST00000543485.1_Missense_Mutation_p.V324L	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	400	Collagenase-like 2.		Missing (in MONA). {ECO:0000269|PubMed:16542393}.		angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.V400L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	CCTGTTCCTCGTGGCAGCCCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											66.0	63.0	64.0					16																	55525730		2198	4300	6498	54083231	SO:0001583	missense	4313				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1198G>C	16.37:g.55525730G>C	ENSP00000219070:p.Val400Leu	Somatic		x	x	x	54083231	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	CCDS10752.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036122	0.93630	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	D;D;D	0.82984	-1.67;-1.67;-1.67	4.93	4.93	0.64822	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91600	0.7346	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.998	D	0.92751	0.6216	10	0.87932	D	0	.	18.5104	0.90914	0.0:0.0:1.0:0.0	.	350;400	E9PE45;P08253	.;MMP2_HUMAN	L	400;324;350	ENSP00000219070:V400L;ENSP00000444143:V324L;ENSP00000394237:V350L	ENSP00000219070:V400L	V	+	1	0	MMP2	54083231	1.000000	0.71417	0.995000	0.50966	0.954000	0.61252	9.813000	0.99286	2.442000	0.82660	0.467000	0.42956	GTG		0.577	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3			Missense_Mutation
MMP15	4324	broad.mit.edu	37	16	58077230	58077230	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:58077230C>T	ENST00000219271.3	+	8	2205	c.1420C>T	c.(1420-1422)Ccc>Tcc	p.P474S		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	474					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P474S(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	CTGGTGGGAGCCCACAGGCCA	0.627																																																1	Substitution - Missense(1)	ovary(1)	16											33.0	33.0	33.0					16																	58077230		2198	4300	6498	56634731	SO:0001583	missense	4324			Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1420C>T	16.37:g.58077230C>T	ENSP00000219271:p.Pro474Ser	Somatic		x	x	x	56634731	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219366	0.79464	.	.	ENSG00000102996	ENST00000219271	T	0.02236	4.38	5.16	4.19	0.49359	Hemopexin/matrixin (2);	0.157646	0.64402	D	0.000020	T	0.03434	0.0099	L	0.47716	1.5	0.80722	D	1	B	0.31769	0.339	B	0.37692	0.256	T	0.51395	-0.8711	10	0.12103	T	0.63	.	13.6208	0.62136	0.1565:0.8435:0.0:0.0	.	474	P51511	MMP15_HUMAN	S	474	ENSP00000219271:P474S	ENSP00000219271:P474S	P	+	1	0	MMP15	56634731	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.734000	0.84928	1.144000	0.42321	0.655000	0.94253	CCC		0.627	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428		Missense_Mutation
RLTPR	146206	broad.mit.edu	37	16	67682009	67682009	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:67682009G>C	ENST00000334583.6	+	14	1454	c.1126G>C	c.(1126-1128)Ggc>Cgc	p.G376R	RLTPR_ENST00000545661.1_Missense_Mutation_p.G376R	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	376					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)		p.G376R(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GAATCTCGCAGGCACCGACAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	16											40.0	43.0	42.0					16																	67682009		2081	4183	6264	66239510	SO:0001583	missense	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1126G>C	16.37:g.67682009G>C	ENSP00000334958:p.Gly376Arg	Unknown		x	x	x	66239510	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042409	0.93685	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.54479	0.57;2.46	4.67	2.61	0.31194	.	0.280410	0.34580	N	0.003851	T	0.60702	0.2289	L	0.58669	1.825	0.29243	N	0.872492	D;D	0.67145	0.974;0.996	P;D	0.64687	0.694;0.928	T	0.54840	-0.8233	10	0.46703	T	0.11	-14.2749	7.0258	0.24940	0.0894:0.0:0.7415:0.1691	.	376;376	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	R	376	ENSP00000334958:G376R;ENSP00000441481:G376R	ENSP00000334958:G376R	G	+	1	0	RLTPR	66239510	0.869000	0.29996	0.989000	0.46669	0.826000	0.46750	2.112000	0.41892	0.962000	0.38057	0.462000	0.41574	GGC		0.672	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838		Missense_Mutation
CA5A	763	broad.mit.edu	37	16	87925429	87925429	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr16:87925429C>A	ENST00000309893.2	-	6	815	c.750G>T	c.(748-750)gaG>gaT	p.E250D	GS1-21A4.1_ENST00000562644.1_RNA	NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial	250					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.E250D(1)		large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	CTTCAACGGGCTCCTTCTGGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	16											15.0	15.0	15.0					16																	87925429		2198	4297	6495	86482930	SO:0001583	missense	763			L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.750G>T	16.37:g.87925429C>A	ENSP00000309649:p.Glu250Asp	Unknown		x	x	x	86482930	B2RPF2	Missense_Mutation	SNP	ENST00000309893.2	37	CCDS10965.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	13.66	2.304075	0.40795	.	.	ENSG00000174990	ENST00000309893	T	0.64260	-0.09	4.35	3.39	0.38822	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.665356	0.15124	N	0.279237	T	0.49932	0.1586	L	0.42744	1.35	0.24928	N	0.991934	B	0.25007	0.116	B	0.24541	0.054	T	0.44862	-0.9300	10	0.54805	T	0.06	-0.6976	5.845	0.18661	0.0:0.7747:0.0:0.2253	.	250	P35218	CAH5A_HUMAN	D	250	ENSP00000309649:E250D	ENSP00000309649:E250D	E	-	3	2	CA5A	86482930	0.409000	0.25368	0.188000	0.23233	0.712000	0.41017	0.583000	0.23849	1.959000	0.56917	0.313000	0.20887	GAG		0.637	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269164.1	NM_001739		Missense_Mutation
UNC45B	146862	broad.mit.edu	37	17	33482456	33482456	+	Silent	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:33482456C>A	ENST00000268876.5	+	7	878	c.781C>A	c.(781-783)Cga>Aga	p.R261R	UNC45B_ENST00000591048.1_Silent_p.R261R|UNC45B_ENST00000433649.1_Silent_p.R261R|UNC45B_ENST00000378449.1_Silent_p.R261R|UNC45B_ENST00000394570.2_Silent_p.R261R	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	261					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.R261R(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GCGGGAGCATCGAGGGAAGGA	0.527																																																1	Substitution - coding silent(1)	ovary(1)	17											205.0	144.0	165.0					17																	33482456		2203	4300	6503	30506569	SO:0001819	synonymous_variant	146862			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.781C>A	17.37:g.33482456C>A		Unknown		x	x	x	30506569	Q495Q8|Q495Q9	Silent	SNP	ENST00000268876.5	37	CCDS11292.1	SNP	31	Broad																																																																																				0.527	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167		Silent
UNC45B	146862	broad.mit.edu	37	17	33513323	33513323	+	Silent	SNP	C	C	A	rs201746299		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:33513323C>A	ENST00000268876.5	+	20	2638	c.2541C>A	c.(2539-2541)acC>acA	p.T847T	UNC45B_ENST00000591048.1_Silent_p.T766T|UNC45B_ENST00000433649.1_Silent_p.T845T|RP11-799D4.2_ENST00000590144.1_RNA|UNC45B_ENST00000378449.1_Silent_p.T766T|UNC45B_ENST00000394570.2_Silent_p.T845T	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	847					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.T847T(2)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TCCAGACAACCCAGTGGTTGG	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		20301	0.001		0.0	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|lung(1)	17											77.0	78.0	78.0					17																	33513323		2203	4300	6503	30537436	SO:0001819	synonymous_variant	146862			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2541C>A	17.37:g.33513323C>A		Unknown		x	x	x	30537436	Q495Q8|Q495Q9	Silent	SNP	ENST00000268876.5	37	CCDS11292.1	SNP	22	Broad																																																																																				0.557	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167		Silent
DGKE	8526	broad.mit.edu	37	17	54912222	54912222	+	Silent	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:54912222G>C	ENST00000284061.3	+	2	246	c.66G>C	c.(64-66)ctG>ctC	p.L22L	DGKE_ENST00000572810.1_Silent_p.L22L|C17orf67_ENST00000575658.1_5'Flank|C17orf67_ENST00000487705.1_Intron|C17orf67_ENST00000397861.2_5'Flank|DGKE_ENST00000576869.1_3'UTR	NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	22					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.L22L(1)		breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					ACGGGCACCTGATCTTGTGGA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	17											85.0	115.0	105.0					17																	54912222		2203	4299	6502	52267221	SO:0001819	synonymous_variant	8526			U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.66G>C	17.37:g.54912222G>C		Unknown		x	x	x	52267221	Q8TBM4|Q9UKQ3	Silent	SNP	ENST00000284061.3	37	CCDS11590.1	SNP	45	Broad																																																																																				0.642	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647		Silent
MGAT5B	146664	broad.mit.edu	37	17	74878254	74878254	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:74878254G>A	ENST00000569840.2	+	3	777	c.203G>A	c.(202-204)cGc>cAc	p.R68H	MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000301618.4_Missense_Mutation_p.R68H|MGAT5B_ENST00000565675.1_Missense_Mutation_p.R68H|MGAT5B_ENST00000428789.2_Missense_Mutation_p.R79H	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	68					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)	p.R68H(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCCGAGTCCCGCGGCGTCCTG	0.682																																																1	Substitution - Missense(1)	ovary(1)	17											26.0	25.0	25.0					17																	74878254		2200	4291	6491	72389849	SO:0001583	missense	146664			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.203G>A	17.37:g.74878254G>A	ENSP00000456037:p.Arg68His	Unknown		x	x	x	72389849	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	CCDS59299.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441158	0.83993	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	T;T	0.58797	0.33;0.31	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.70325	0.3211	L	0.54323	1.7	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.68036	-0.5515	10	0.35671	T	0.21	-18.8997	14.2918	0.66284	0.0:0.0:1.0:0.0	.	79;68	Q3V5L5-2;Q3V5L5-5	.;.	H	68;68;79	ENSP00000301618:R68H;ENSP00000391227:R79H	ENSP00000301618:R68H	R	+	2	0	MGAT5B	72389849	1.000000	0.71417	0.943000	0.38184	0.538000	0.34931	7.814000	0.86154	2.428000	0.82296	0.561000	0.74099	CGC		0.682	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677		Missense_Mutation
USP14	9097	broad.mit.edu	37	18	198094	198094	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr18:198094T>G	ENST00000261601.7	+	9	814	c.723T>G	c.(721-723)agT>agG	p.S241R	USP14_ENST00000582707.1_Missense_Mutation_p.S206R|USP14_ENST00000400266.3_Missense_Mutation_p.S230R|USP14_ENST00000383589.2_Missense_Mutation_p.S195R	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	241	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S241R(1)		endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				AAAAGAAAAGTTTAATCGATC	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											71.0	73.0	72.0					18																	198094		2203	4300	6503	188094	SO:0001583	missense	9097			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.723T>G	18.37:g.198094T>G	ENSP00000261601:p.Ser241Arg	Unknown		x	x	x	188094	J3QRZ5|Q53XY5	Missense_Mutation	SNP	ENST00000261601.7	37	CCDS32780.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	15.54	2.865123	0.51482	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T	0.35605	1.3;1.3	6.17	0.576	0.17380	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.037204	0.85682	D	0.000000	T	0.42494	0.1205	M	0.69523	2.12	0.52501	D	0.999958	B;B;B	0.21309	0.054;0.053;0.03	B;B;B	0.37387	0.248;0.089;0.114	T	0.39901	-0.9591	10	0.52906	T	0.07	-15.6353	11.1506	0.48455	0.0:0.4556:0.0:0.5444	.	230;206;241	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	R	241;206;230	ENSP00000261601:S241R;ENSP00000383125:S230R	ENSP00000261601:S241R	S	+	3	2	USP14	188094	0.998000	0.40836	0.997000	0.53966	0.993000	0.82548	0.512000	0.22755	-0.112000	0.11979	-0.274000	0.10170	AGT		0.318	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151		Missense_Mutation
CEP192	55125	broad.mit.edu	37	18	13056284	13056284	+	Missense_Mutation	SNP	C	C	G	rs73950982		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr18:13056284C>G	ENST00000325971.8	+	17	3500	c.1907C>G	c.(1906-1908)aCa>aGa	p.T636R	CEP192_ENST00000506447.1_Missense_Mutation_p.T1232R|CEP192_ENST00000430049.2_Missense_Mutation_p.T757R			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	636					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.T636R(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCCAGCAGCACAGTTCACAGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	18											66.0	59.0	62.0					18																	13056284		2203	4300	6503	13046284	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1907C>G	18.37:g.13056284C>G	ENSP00000317156:p.Thr636Arg	Unknown		x	x	x	13046284	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	5.768	0.326163	0.10900	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.05447	3.44;3.44;3.44	5.01	-1.88	0.07713	.	3.214460	0.01250	N	0.008857	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B;B;B	0.18968	0.013;0.013;0.032	B;B;B	0.15870	0.004;0.005;0.014	T	0.34502	-0.9826	10	0.14656	T	0.56	9.7209	2.0793	0.03631	0.5175:0.2275:0.0897:0.1653	.	757;1232;636	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	R	1232;636;636;757	ENSP00000427550:T1232R;ENSP00000317156:T636R;ENSP00000389190:T757R	ENSP00000317156:T636R	T	+	2	0	CEP192	13046284	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.193000	0.17116	-0.551000	0.06175	0.655000	0.94253	ACA		0.517	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		Missense_Mutation
CCBE1	147372	broad.mit.edu	37	18	57107037	57107037	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr18:57107037G>T	ENST00000439986.4	-	8	824	c.787C>A	c.(787-789)Cca>Aca	p.P263T	CCBE1_ENST00000398179.2_Intron	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	263	Collagen-like 1.				lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)	p.P263T(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				CTTCCCTTTGGTCCTGGTGAG	0.597																																					NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)											1	Substitution - Missense(1)	ovary(1)	18											34.0	39.0	37.0					18																	57107037		2203	4300	6503	55258017	SO:0001583	missense	147372			AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.787C>A	18.37:g.57107037G>T	ENSP00000404464:p.Pro263Thr	Unknown		x	x	x	55258017	Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	ENST00000439986.4	37	CCDS32838.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335323	0.60853	.	.	ENSG00000183287	ENST00000439986	T	0.78481	-1.18	4.22	4.22	0.49857	.	0.155765	0.64402	D	0.000017	D	0.84606	0.5509	L	0.55834	1.745	0.80722	D	1	D;D	0.71674	0.986;0.998	D;D	0.68943	0.922;0.961	D	0.86669	0.1909	10	0.72032	D	0.01	-2.5783	15.7832	0.78281	0.0:0.0:1.0:0.0	.	263;72	Q6UXH8;Q6UXH8-3	CCBE1_HUMAN;.	T	263	ENSP00000404464:P263T	ENSP00000404464:P263T	P	-	1	0	CCBE1	55258017	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.961000	0.93122	2.049000	0.60858	0.650000	0.86243	CCA		0.597	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459		Missense_Mutation
SERPINB5	5268	broad.mit.edu	37	18	61170746	61170746	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr18:61170746A>T	ENST00000382771.4	+	7	1211	c.919A>T	c.(919-921)Atg>Ttg	p.M307L		NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	307					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.M307L(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						TTTCTCTGGAATGTCAGAGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	18											96.0	82.0	87.0					18																	61170746		2203	4300	6503	59321726	SO:0001583	missense	5268			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.919A>T	18.37:g.61170746A>T	ENSP00000372221:p.Met307Leu	Somatic		x	x	x	59321726	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	ENST00000382771.4	37	CCDS32839.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673665	0.47781	.	.	ENSG00000206075	ENST00000382771	D	0.84146	-1.81	5.95	3.42	0.39159	Serpin domain (3);	0.211041	0.49305	D	0.000145	T	0.76292	0.3967	L	0.35341	1.055	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74917	-0.3501	10	0.66056	D	0.02	.	9.64	0.39833	0.7218:0.1722:0.0:0.1059	.	307	P36952	SPB5_HUMAN	L	307	ENSP00000372221:M307L	ENSP00000372221:M307L	M	+	1	0	SERPINB5	59321726	0.995000	0.38212	1.000000	0.80357	0.970000	0.65996	3.365000	0.52335	2.285000	0.76669	0.533000	0.62120	ATG		0.433	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280629.1	NM_002639		Missense_Mutation
CD97	976	broad.mit.edu	37	19	14508896	14508896	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr19:14508896A>T	ENST00000242786.5	+	9	922	c.842A>T	c.(841-843)aAa>aTa	p.K281I	CD97_ENST00000357355.3_Missense_Mutation_p.K232I|CD97_ENST00000358600.3_Missense_Mutation_p.K188I	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	281					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.K281I(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TTCTTCGACAAAGTCCAGGAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	68.0	69.0					19																	14508896		2203	4300	6503	14369896	SO:0001583	missense	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.842A>T	19.37:g.14508896A>T	ENSP00000242786:p.Lys281Ile	Unknown		x	x	x	14369896	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	18.54	3.647013	0.67358	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.72615	-0.67;-0.57;-0.18	4.4	-1.56	0.08532	.	0.976965	0.08318	N	0.964375	T	0.72779	0.3503	L	0.46157	1.445	0.09310	N	1	D;D;B	0.55800	0.973;0.973;0.06	P;P;B	0.59825	0.807;0.864;0.065	T	0.62826	-0.6772	10	0.31617	T	0.26	.	8.5643	0.33530	0.6194:0.0:0.3806:0.0	.	188;232;281	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	I	281;232;188;231	ENSP00000242786:K281I;ENSP00000349918:K232I;ENSP00000351413:K188I	ENSP00000242786:K281I	K	+	2	0	CD97	14369896	0.001000	0.12720	0.013000	0.15412	0.293000	0.27360	-0.278000	0.08490	-0.469000	0.06911	0.459000	0.35465	AAA		0.582	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		Missense_Mutation
EHD2	30846	broad.mit.edu	37	19	48219981	48219981	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr19:48219981G>T	ENST00000263277.3	+	2	363	c.112G>T	c.(112-114)Gag>Tag	p.E38*	EHD2_ENST00000538399.1_Intron|CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	38					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)	p.E38*(1)		endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		GCCGCTGGAGGAGCACTACCG	0.701																																																1	Substitution - Nonsense(1)	ovary(1)	19											32.0	27.0	28.0					19																	48219981		2203	4299	6502	52911793	SO:0001587	stop_gained	30846			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.112G>T	19.37:g.48219981G>T	ENSP00000263277:p.Glu38*	Unknown		x	x	x	52911793	B2RDH9|B4DNU6|Q96CB6	Nonsense_Mutation	SNP	ENST00000263277.3	37	CCDS12704.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	38	6.658345	0.97739	.	.	ENSG00000024422	ENST00000263277;ENST00000539439;ENST00000540364	.	.	.	3.88	3.88	0.44766	.	0.207947	0.40728	N	0.001032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-35.8769	13.7066	0.62644	0.0:0.0:1.0:0.0	.	.	.	.	X	38	.	ENSP00000263277:E38X	E	+	1	0	EHD2	52911793	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	3.200000	0.51051	2.185000	0.69588	0.511000	0.50034	GAG		0.701	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465851.1			Nonsense_Mutation
AP2A1	160	broad.mit.edu	37	19	50295254	50295254	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr19:50295254C>T	ENST00000359032.5	+	5	536	c.536C>T	c.(535-537)tCg>tTg	p.S179L	AP2A1_ENST00000354293.5_Missense_Mutation_p.S179L|AP2A1_ENST00000600199.1_3'UTR	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	179					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.S179L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		TACAAGGCCTCGCCTGACCTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	80.0	76.0					19																	50295254		2178	4259	6437	54987066	SO:0001583	missense	160			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.536C>T	19.37:g.50295254C>T	ENSP00000351926:p.Ser179Leu	Unknown		x	x	x	54987066	Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	ENST00000359032.5	37	CCDS46148.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163622	0.38217	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.27557	1.66;1.66	5.01	5.01	0.66863	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.43612	0.1255	L	0.37630	1.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.12915	-1.0529	10	0.11794	T	0.64	.	17.1021	0.86652	0.0:1.0:0.0:0.0	.	179;179	O95782-2;O95782	.;AP2A1_HUMAN	L	179	ENSP00000346246:S179L;ENSP00000351926:S179L	ENSP00000346246:S179L	S	+	2	0	AP2A1	54987066	1.000000	0.71417	0.993000	0.49108	0.068000	0.16541	7.818000	0.86416	2.334000	0.79466	0.655000	0.94253	TCG		0.642	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1			Missense_Mutation
FPR2	2358	broad.mit.edu	37	19	52272397	52272397	+	Silent	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr19:52272397C>G	ENST00000598776.1	+	2	1258	c.486C>G	c.(484-486)ctC>ctG	p.L162L	FPR2_ENST00000340023.6_Silent_p.L162L|FPR2_ENST00000598953.1_Silent_p.L162L	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	162					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)	p.L162L(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						CAGTTTTCCTCTTTTTGACTA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	19											125.0	118.0	120.0					19																	52272397		2203	4300	6503	56964209	SO:0001819	synonymous_variant	2358			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.486C>G	19.37:g.52272397C>G		Unknown		x	x	x	56964209	A8K3E2	Silent	SNP	ENST00000598776.1	37	CCDS12840.1	SNP	32	Broad																																																																																				0.507	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738		Silent
MEMO1	51072	broad.mit.edu	37	2	32143001	32143001	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:32143001A>T	ENST00000295065.5	-	5	740	c.431T>A	c.(430-432)aTg>aAg	p.M144K	MEMO1_ENST00000404530.1_Missense_Mutation_p.M144K|AL121652.1_ENST00000408399.1_RNA|DPY30_ENST00000446765.1_5'UTR|MEMO1_ENST00000490459.1_5'UTR|MEMO1_ENST00000379383.3_Missense_Mutation_p.M147K|MEMO1_ENST00000426310.2_Missense_Mutation_p.M121K	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	144					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.M144K(1)		NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					ATACCTTTCCATGGCTTTAGC	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	74.0	76.0					2																	32143001		2203	4300	6503	31996505	SO:0001583	missense	51072			AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.431T>A	2.37:g.32143001A>T	ENSP00000295065:p.Met144Lys	Unknown		x	x	x	31996505	B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Missense_Mutation	SNP	ENST00000295065.5	37	CCDS1776.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	25.8	4.673958	0.88445	.	.	ENSG00000162959	ENST00000295065;ENST00000379383;ENST00000404530;ENST00000426310	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.79076	0.4385	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	0.978;1.0	P;D	0.97110	0.888;1.0	T	0.81737	-0.0796	9	0.87932	D	0	-6.8456	15.6519	0.77104	1.0:0.0:0.0:0.0	.	121;144	Q9Y316-2;Q9Y316	.;MEMO1_HUMAN	K	144;147;144;121	.	ENSP00000295065:M144K	M	-	2	0	MEMO1	31996505	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.045000	0.93812	2.238000	0.73509	0.477000	0.44152	ATG		0.348	MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250251.2	NM_015955		Missense_Mutation
CLEC4F	165530	broad.mit.edu	37	2	71044223	71044223	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:71044223T>C	ENST00000272367.2	-	4	366	c.290A>G	c.(289-291)gAg>gGg	p.E97G	CLEC4F_ENST00000426626.1_Missense_Mutation_p.E97G	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	97					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.E97G(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CATTTCTGCCTCCCTGCCAAA	0.488																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											51.0	47.0	48.0					2																	71044223		2203	4300	6503	70897731	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.290A>G	2.37:g.71044223T>C	ENSP00000272367:p.Glu97Gly	Unknown		x	x	x	70897731	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	9.861	1.196342	0.22037	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.01933	4.6;4.55	4.82	-3.21	0.05140	.	2.075290	0.02696	N	0.111199	T	0.02267	0.0070	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.47812	-0.9088	10	0.48119	T	0.1	.	6.4441	0.21867	0.2717:0.1317:0.0:0.5966	.	97;97	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	G	97	ENSP00000272367:E97G;ENSP00000390581:E97G	ENSP00000272367:E97G	E	-	2	0	CLEC4F	70897731	0.000000	0.05858	0.000000	0.03702	0.255000	0.26057	-1.089000	0.03376	-0.325000	0.08577	0.383000	0.25322	GAG		0.488	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535		Missense_Mutation
SNRNP200	23020	broad.mit.edu	37	2	96957181	96957181	+	Silent	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:96957181G>T	ENST00000323853.5	-	18	2447	c.2370C>A	c.(2368-2370)acC>acA	p.T790T	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	790	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.T790T(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GGTCAACCCTGGTCATGCCTG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											144.0	144.0	144.0					2																	96957181		2203	4300	6503	96320908	SO:0001819	synonymous_variant	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.2370C>A	2.37:g.96957181G>T		Unknown		x	x	x	96320908	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	47	Broad																																																																																				0.502	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Silent
PTPN18	26469	broad.mit.edu	37	2	131126721	131126721	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:131126721T>C	ENST00000175756.5	+	6	531	c.430T>C	c.(430-432)Tac>Cac	p.Y144H	PTPN18_ENST00000347849.3_Missense_Mutation_p.Y37H	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	144	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.Y144H(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					GTGTGAGCGGTACTGGGCCCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	158.0	154.0					2																	131126721		2203	4300	6503	130843191	SO:0001583	missense	26469			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.430T>C	2.37:g.131126721T>C	ENSP00000175756:p.Tyr144His	Somatic		x	x	x	130843191	B4E1E6|Q53P42	Missense_Mutation	SNP	ENST00000175756.5	37	CCDS2161.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	19.73	3.882309	0.72294	.	.	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	D;D	0.93712	-3.27;-3.27	4.39	4.39	0.52855	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.33670	N	0.004667	D	0.97343	0.9131	H	0.95004	3.61	0.50467	D	0.999872	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.982;0.998;0.999	D	0.98016	1.0368	10	0.87932	D	0	.	12.207	0.54358	0.0:0.0:0.0:1.0	.	144;144;37	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	H	144;37;144	ENSP00000175756:Y144H;ENSP00000310092:Y37H	ENSP00000175756:Y144H	Y	+	1	0	PTPN18	130843191	1.000000	0.71417	0.948000	0.38648	0.955000	0.61496	3.936000	0.56568	1.928000	0.55862	0.528000	0.53228	TAC		0.537	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2			Missense_Mutation
ARHGEF4	50649	broad.mit.edu	37	2	131785570	131785570	+	Missense_Mutation	SNP	C	C	A	rs372979735		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:131785570C>A	ENST00000326016.5	+	5	999	c.480C>A	c.(478-480)agC>agA	p.S160R	ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.S160R|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.S160R|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.S89R|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.S160R	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	160					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.S160R(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AAGTGGGGAGCGAGGAGGACC	0.632																																																1	Substitution - Missense(1)	ovary(1)	2											48.0	43.0	45.0					2																	131785570		2203	4300	6503	131502040	SO:0001583	missense	50649			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.480C>A	2.37:g.131785570C>A	ENSP00000316845:p.Ser160Arg	Unknown		x	x	x	131502040	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462414	0.63513	.	.	ENSG00000136002	ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	T;T;T;T;T	0.73258	-0.42;-0.53;-0.53;-0.73;-0.45	4.94	-4.53	0.03462	.	0.000000	0.85682	D	0.000000	T	0.75635	0.3876	L	0.55990	1.75	0.46113	D	0.998876	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.81914	0.988;0.995;0.988	T	0.75351	-0.3348	10	0.72032	D	0.01	.	12.5047	0.55975	0.0:0.2952:0.0:0.7048	.	160;160;160	E9PEM0;Q9NR80-4;Q9NR80	.;.;ARHG4_HUMAN	R	160;160;160;160;89	ENSP00000316845:S160R;ENSP00000376680:S160R;ENSP00000432267:S160R;ENSP00000387285:S160R;ENSP00000348017:S89R	ENSP00000316845:S160R	S	+	3	2	ARHGEF4	131502040	0.725000	0.28048	0.673000	0.29887	0.750000	0.42670	-0.495000	0.06443	-0.919000	0.03803	0.561000	0.74099	AGC		0.632	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4			Missense_Mutation
ACVR1	90	broad.mit.edu	37	2	158636974	158636974	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:158636974C>A	ENST00000263640.3	-	4	635	c.206G>T	c.(205-207)gGc>gTc	p.G69V	ACVR1_ENST00000434821.1_Missense_Mutation_p.G69V|ACVR1_ENST00000409283.2_Missense_Mutation_p.G69V|ACVR1_ENST00000487456.1_5'UTR|ACVR1_ENST00000410057.2_Missense_Mutation_p.G69V	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	69					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.G69V(1)		endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	CTGGAAGCAGCCTTTCTGGTA	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											117.0	113.0	115.0					2																	158636974		2203	4300	6503	158345220	SO:0001583	missense	90				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.206G>T	2.37:g.158636974C>A	ENSP00000263640:p.Gly69Val	Unknown		x	x	x	158345220		Missense_Mutation	SNP	ENST00000263640.3	37	CCDS2206.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.081604	0.94050	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057;ENST00000412025;ENST00000440523;ENST00000539637;ENST00000424669	D;D;D;D;D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37;-4.37;-4.37;-4.37;-2.98	5.26	5.26	0.73747	TGF-beta receptor/activin receptor, type I/II (1);	0.000000	0.85682	D	0.000000	D	0.98441	0.9481	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99453	1.0941	10	0.66056	D	0.02	.	18.4837	0.90821	0.0:1.0:0.0:0.0	.	69	Q04771	ACVR1_HUMAN	V	69	ENSP00000263640:G69V;ENSP00000387273:G69V;ENSP00000405004:G69V;ENSP00000387127:G69V;ENSP00000403006:G69V;ENSP00000401189:G69V;ENSP00000440091:G69V;ENSP00000400767:G69V	ENSP00000263640:G69V	G	-	2	0	ACVR1	158345220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.701000	0.84566	2.458000	0.83093	0.655000	0.94253	GGC		0.562	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105		Missense_Mutation
KCNH7	90134	broad.mit.edu	37	2	163253380	163253380	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:163253380A>T	ENST00000332142.5	-	11	2582	c.2483T>A	c.(2482-2484)cTc>cAc	p.L828H		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	828					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.L828H(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ACAGTATGTGAGGGCTCTTAC	0.353																																					GBM(196;1492 2208 17507 24132 45496)											1	Substitution - Missense(1)	ovary(1)	2											88.0	88.0	88.0					2																	163253380		2203	4300	6503	162961626	SO:0001583	missense	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2483T>A	2.37:g.163253380A>T	ENSP00000331727:p.Leu828His	Unknown		x	x	x	162961626	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512362	0.85389	.	.	ENSG00000184611	ENST00000332142	D	0.93859	-3.3	5.67	5.67	0.87782	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000001	D	0.97365	0.9138	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98285	1.0510	10	0.87932	D	0	.	15.9118	0.79477	1.0:0.0:0.0:0.0	.	828	Q9NS40	KCNH7_HUMAN	H	828	ENSP00000331727:L828H	ENSP00000331727:L828H	L	-	2	0	KCNH7	162961626	1.000000	0.71417	0.960000	0.40013	0.960000	0.62799	9.339000	0.96797	2.162000	0.67917	0.477000	0.44152	CTC		0.353	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272		Missense_Mutation
SCN9A	6335	broad.mit.edu	37	2	167149753	167149753	+	Missense_Mutation	SNP	G	G	C	rs201596319		TCGA-13-0904-01	TCGA-13-0904-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:167149753G>C	ENST00000409435.1	-	8	1094	c.1095C>G	c.(1093-1095)aaC>aaG	p.N365K	SCN9A_ENST00000303354.6_Missense_Mutation_p.N366K|SCN9A_ENST00000409672.1_Missense_Mutation_p.N365K|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Missense_Mutation_p.N366K			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	365					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.N365K(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTTGGTAAAGGTTTTCCCAGT	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											38.0	39.0	39.0					2																	167149753		1945	4166	6111	166857999	SO:0001583	missense	6335			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1095C>G	2.37:g.167149753G>C	ENSP00000386330:p.Asn365Lys	Somatic		x	x	x	166857999	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499156	0.64298	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41;-4.41	5.88	2.74	0.32292	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.97241	0.9098	M	0.69248	2.105	0.49213	D	0.999763	D;D;P	0.61697	0.982;0.99;0.609	P;D;B	0.73708	0.883;0.981;0.413	D	0.95825	0.8853	10	0.62326	D	0.03	.	5.2824	0.15682	0.5429:0.0:0.4571:0.0	.	365;365;366	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	K	365;366;366;365;230;230	ENSP00000386306:N365K;ENSP00000364536:N366K;ENSP00000304748:N366K;ENSP00000386330:N365K;ENSP00000413212:N230K;ENSP00000393141:N230K	ENSP00000304748:N366K	N	-	3	2	SCN9A	166857999	0.518000	0.26234	1.000000	0.80357	0.990000	0.78478	-0.096000	0.11059	0.825000	0.34637	0.585000	0.79938	AAC		0.403	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179576748	179576748	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:179576748T>C	ENST00000591111.1	-	94	27082	c.26858A>G	c.(26857-26859)aAt>aGt	p.N8953S	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N9270S|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N8026S			Q8WZ42	TITIN_HUMAN	titin	13098	Ig-like 72.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.N8026S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCACTATCATTAATATCAAC	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											83.0	85.0	84.0					2																	179576748		1836	4091	5927	179284993	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26858A>G	2.37:g.179576748T>C	ENSP00000465570:p.Asn8953Ser	Somatic		x	x	x	179284993	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	8.675	0.903816	0.17760	.	.	ENSG00000155657	ENST00000342992	T	0.38077	1.16	5.47	0.137	0.14787	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.15435	0.0372	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25502	-1.0130	9	0.87932	D	0	.	10.7416	0.46156	0.0:0.3223:0.0:0.6777	.	8953	Q8WZ42	TITIN_HUMAN	S	8026	ENSP00000343764:N8026S	ENSP00000343764:N8026S	N	-	2	0	TTN	179284993	0.000000	0.05858	0.042000	0.18584	0.980000	0.70556	0.020000	0.13466	-0.134000	0.11516	0.533000	0.62120	AAT		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
PPP1R7	5510	broad.mit.edu	37	2	242105809	242105809	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr2:242105809T>C	ENST00000234038.6	+	8	1246	c.772T>C	c.(772-774)Tac>Cac	p.Y258H	PPP1R7_ENST00000401987.1_Missense_Mutation_p.Y215H|PPP1R7_ENST00000406106.3_Missense_Mutation_p.Y258H|PPP1R7_ENST00000485630.1_3'UTR|PPP1R7_ENST00000402734.1_Missense_Mutation_p.Y199H|PPP1R7_ENST00000407025.1_Missense_Mutation_p.Y258H|PPP1R7_ENST00000404405.3_Missense_Mutation_p.Y252H|PPP1R7_ENST00000272983.8_Missense_Mutation_p.Y215H	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	258					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)	p.Y258H(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		GCGGGAGCTGTACCTTAGCCA	0.592																																					NSCLC(62;446 1299 5417 11238 27640)											1	Substitution - Missense(1)	ovary(1)	2											111.0	91.0	98.0					2																	242105809		2203	4300	6503	241754482	SO:0001583	missense	5510			AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.772T>C	2.37:g.242105809T>C	ENSP00000234038:p.Tyr258His	Somatic		x	x	x	241754482	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Missense_Mutation	SNP	ENST00000234038.6	37	CCDS2546.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	25.5	4.647181	0.87958	.	.	ENSG00000115685	ENST00000438799;ENST00000402734;ENST00000423280;ENST00000407025;ENST00000272983;ENST00000234038;ENST00000404405;ENST00000406106;ENST00000401987	T;T;T;T;T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98	5.38	5.38	0.77491	.	0.110080	0.64402	D	0.000004	T	0.20820	0.0501	N	0.21448	0.665	0.80722	D	1	D;D;D;D;D;D	0.89917	0.978;0.997;1.0;0.997;0.985;0.996	P;D;D;D;P;D	0.91635	0.895;0.945;0.999;0.986;0.754;0.978	T	0.02683	-1.1124	10	0.52906	T	0.07	-10.1054	15.074	0.72063	0.0:0.0:0.0:1.0	.	242;199;215;258;258;252	C9JD73;C9J177;Q15435-2;Q15435;Q15435-3;B5MBZ8	.;.;.;PP1R7_HUMAN;.;.	H	242;199;199;258;215;258;252;258;215	ENSP00000396376:Y242H;ENSP00000385012:Y199H;ENSP00000412092:Y199H;ENSP00000385657:Y258H;ENSP00000272983:Y215H;ENSP00000234038:Y258H;ENSP00000385498:Y252H;ENSP00000385022:Y258H;ENSP00000385466:Y215H	ENSP00000234038:Y258H	Y	+	1	0	PPP1R7	241754482	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.889000	0.87307	2.035000	0.60131	0.533000	0.62120	TAC		0.592	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257244.4	NM_002712		Missense_Mutation
SIGLEC1	6614	broad.mit.edu	37	20	3672593	3672593	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr20:3672593G>A	ENST00000344754.4	-	16	4286	c.4287C>T	c.(4285-4287)aaC>aaT	p.N1429N	SIGLEC1_ENST00000202578.4_Silent_p.N1429N	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1429	Ig-like C2-type 14.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.N1429N(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						AGCCCAGCAAGTTTTGGGCTG	0.592																																																1	Substitution - coding silent(1)	ovary(1)	20											63.0	52.0	56.0					20																	3672593		2203	4300	6503	3620593	SO:0001819	synonymous_variant	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.4287C>T	20.37:g.3672593G>A		Somatic		x	x	x	3620593	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.471	-0.884384	0.02530	.	.	ENSG00000088827	ENST00000419548	.	.	.	5.61	0.584	0.17422	.	.	.	.	.	T	0.31420	0.0796	.	.	.	0.22378	N	0.999152	.	.	.	.	.	.	T	0.25916	-1.0118	4	.	.	.	.	6.9291	0.24432	0.623:0.0:0.377:0.0	.	.	.	.	F	243	.	.	L	-	1	0	SIGLEC1	3620593	0.317000	0.24589	0.017000	0.16124	0.259000	0.26198	0.494000	0.22467	0.206000	0.20587	-0.140000	0.14226	CTT		0.592	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068		Silent
SIGLEC1	6614	broad.mit.edu	37	20	3674093	3674093	+	Splice_Site	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr20:3674093C>A	ENST00000344754.4	-	13	3508		c.e13+1		SIGLEC1_ENST00000202578.4_Splice_Site	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin						cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.?(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GCCAGACTCACAGAGGACGTC	0.647																																																1	Unknown(1)	ovary(1)	20											27.0	32.0	30.0					20																	3674093		2202	4300	6502	3622093	SO:0001630	splice_region_variant	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3508+1G>T	20.37:g.3674093C>A		Unknown		x	x	x	3622093	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Splice_Site_SNP	SNP	ENST00000344754.4	37	CCDS13060.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984059	0.35036	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9452	0.71026	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIGLEC1	3622093	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	4.214000	0.58527	2.612000	0.88384	0.655000	0.94253	.		0.647	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	Intron	Splice_Site_SNP
ZNF133	7692	broad.mit.edu	37	20	18297068	18297068	+	Silent	SNP	C	C	A	rs201405771	byFrequency	TCGA-13-0904-01	TCGA-13-0904-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr20:18297068C>A	ENST00000316358.4	+	4	1670	c.1573C>A	c.(1573-1575)Cga>Aga	p.R525R	RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000396026.3_Silent_p.R528R|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000401790.1_Silent_p.R525R|ZNF133_ENST00000377671.3_Silent_p.R524R|ZNF133_ENST00000402618.2_Silent_p.R462R|ZNF133_ENST00000538547.1_Silent_p.R430R|ZNF133_ENST00000535822.1_Silent_p.R430R	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	525					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R524R(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						GTATGTGTGCCGAGAGTGCGG	0.622																																																1	Substitution - coding silent(1)	ovary(1)	20											73.0	72.0	72.0					20																	18297068		2203	4300	6503	18245068	SO:0001819	synonymous_variant	7692			AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1573C>A	20.37:g.18297068C>A		Somatic		x	x	x	18245068	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Silent	SNP	ENST00000316358.4	37		SNP	23	Broad																																																																																				0.622	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434		Silent
MYH7B	57644	broad.mit.edu	37	20	33585285	33585285	+	Missense_Mutation	SNP	G	G	C	rs542735186		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr20:33585285G>C	ENST00000262873.7	+	30	3807	c.3715G>C	c.(3715-3717)Gcg>Ccg	p.A1239P		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1197						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.A1239P(1)		NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGCCACAGTGGCGGCACTGCG	0.746																																																1	Substitution - Missense(1)	ovary(1)	20											6.0	9.0	8.0					20																	33585285		1971	3900	5871	33048946	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3715G>C	20.37:g.33585285G>C	ENSP00000262873:p.Ala1239Pro	Unknown		x	x	x	33048946	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138255	0.77775	.	.	ENSG00000078814	ENST00000262873	T	0.80033	-1.33	4.73	4.73	0.59995	Myosin tail (1);	0.000000	0.37669	N	0.001987	D	0.92126	0.7504	H	0.95574	3.69	0.58432	D	0.999999	D	0.69078	0.997	P	0.62089	0.898	D	0.94593	0.7789	10	0.87932	D	0	.	17.9076	0.88923	0.0:0.0:1.0:0.0	.	1197	A7E2Y1	MYH7B_HUMAN	P	1239	ENSP00000262873:A1239P	ENSP00000262873:A1239P	A	+	1	0	MYH7B	33048946	1.000000	0.71417	0.994000	0.49952	0.393000	0.30537	5.428000	0.66489	2.456000	0.83038	0.563000	0.77884	GCG		0.746	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884		Missense_Mutation
NCOA3	8202	broad.mit.edu	37	20	46264826	46264826	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr20:46264826G>T	ENST00000371998.3	+	12	1887	c.1696G>T	c.(1696-1698)Gat>Tat	p.D566Y	NCOA3_ENST00000372004.3_Missense_Mutation_p.D566Y|NCOA3_ENST00000371997.3_Missense_Mutation_p.D576Y|NCOA3_ENST00000341724.6_Missense_Mutation_p.D576Y			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	566	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.D566Y(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						AAGCAATCAGGATTCCAAGAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	20											84.0	83.0	83.0					20																	46264826		2203	4300	6503	45698233	SO:0001583	missense	8202			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1696G>T	20.37:g.46264826G>T	ENSP00000361066:p.Asp566Tyr	Somatic		x	x	x	45698233	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135621	0.77662	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.72	5.72	0.89469	.	0.068211	0.64402	D	0.000014	T	0.50205	0.1602	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.998;1.0;0.998	D;D;D;D;D;D	0.75484	0.968;0.982;0.968;0.95;0.986;0.91	T	0.50074	-0.8870	10	0.87932	D	0	-24.9807	19.8674	0.96824	0.0:0.0:1.0:0.0	.	566;576;570;566;566;566	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	Y	566;576;566;566;576	ENSP00000342123:D576Y;ENSP00000361073:D566Y;ENSP00000361066:D566Y;ENSP00000361065:D576Y	ENSP00000345671:D566Y	D	+	1	0	NCOA3	45698233	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	9.230000	0.95299	2.690000	0.91761	0.655000	0.94253	GAT		0.423	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534		Missense_Mutation
IL17RA	23765	broad.mit.edu	37	22	17589845	17589845	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr22:17589845T>G	ENST00000319363.6	+	13	1869	c.1736T>G	c.(1735-1737)gTc>gGc	p.V579G		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	579					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.V579G(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GACTGGCAGGTCCGCTGTCCC	0.662																																																1	Substitution - Missense(1)	ovary(1)	22											14.0	14.0	14.0					22																	17589845		2192	4292	6484	15969845	SO:0001583	missense	23765			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.1736T>G	22.37:g.17589845T>G	ENSP00000320936:p.Val579Gly	Unknown		x	x	x	15969845	O43844|Q20WK1	Missense_Mutation	SNP	ENST00000319363.6	37	CCDS13739.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	1.371	-0.586111	0.03827	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.05855	3.38	4.95	-0.89	0.10577	.	1.292530	0.04879	N	0.447413	T	0.06416	0.0165	L	0.43152	1.355	0.09310	N	1	B;B	0.20887	0.049;0.012	B;B	0.19666	0.026;0.01	T	0.43861	-0.9365	10	0.25106	T	0.35	-1.6283	5.5317	0.16989	0.1231:0.5173:0.0:0.3596	.	527;579	D3YTB4;Q96F46	.;I17RA_HUMAN	G	527;579	ENSP00000320936:V579G	ENSP00000320936:V579G	V	+	2	0	IL17RA	15969845	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.627000	0.05521	-0.005000	0.14395	-0.232000	0.12228	GTC		0.662	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339		Missense_Mutation
MYO18B	84700	broad.mit.edu	37	22	26176162	26176162	+	Silent	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr22:26176162C>T	ENST00000407587.2	+	9	2377	c.2208C>T	c.(2206-2208)ctC>ctT	p.L736L	MYO18B_ENST00000335473.7_Silent_p.L736L|MYO18B_ENST00000536101.1_Silent_p.L736L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	736	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L736L(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTGCTCAGCTCCAGGTGAGGC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	22											15.0	16.0	16.0					22																	26176162		2095	4216	6311	24506162	SO:0001819	synonymous_variant	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2208C>T	22.37:g.26176162C>T		Unknown		x	x	x	24506162	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37		SNP	30	Broad																																																																																				0.647	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		Silent
TTLL8	164714	broad.mit.edu	37	22	50471792	50471792	+	Silent	SNP	C	C	A	rs374140159		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr22:50471792C>A	ENST00000266182.6	-	10	1121	c.1122G>T	c.(1120-1122)gtG>gtT	p.V374V	TTLL8_ENST00000440475.1_Silent_p.V354V			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	390	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.V374V(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		ACTTCTGGACCACCCACTTGT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	22											47.0	55.0	52.0					22																	50471792		2164	4270	6434	48813919	SO:0001819	synonymous_variant	164714					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.1122G>T	22.37:g.50471792C>A		Unknown		x	x	x	48813919	B5MDV0	Silent	SNP	ENST00000266182.6	37		SNP	21	Broad																																																																																				0.577	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001080447		Silent
C3orf20	84077	broad.mit.edu	37	3	14724304	14724304	+	Silent	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:14724304C>A	ENST00000253697.3	+	3	536	c.84C>A	c.(82-84)ctC>ctA	p.L28L	C3orf20_ENST00000435614.1_Intron|C3orf20_ENST00000412910.1_Intron	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	28						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L28L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TCTCCAAACTCCTCATGATCT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	3											110.0	118.0	116.0					3																	14724304		2203	4300	6503	14699308	SO:0001819	synonymous_variant	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.84C>A	3.37:g.14724304C>A		Unknown		x	x	x	14699308	Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	ENST00000253697.3	37	CCDS33706.1	SNP	30	Broad																																																																																				0.473	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		Silent
SHQ1	55164	broad.mit.edu	37	3	72881527	72881527	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:72881527G>T	ENST00000325599.8	-	5	731	c.592C>A	c.(592-594)Cat>Aat	p.H198N	SHQ1_ENST00000463369.1_Missense_Mutation_p.H170N	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	198					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.H198N(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CACAGATAATGATCAGGATCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	3											65.0	72.0	70.0					3																	72881527		2203	4300	6503	72964217	SO:0001583	missense	55164			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.592C>A	3.37:g.72881527G>T	ENSP00000315182:p.His198Asn	Unknown		x	x	x	72964217	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	37	CCDS33788.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605778	0.87157	.	.	ENSG00000144736	ENST00000325599;ENST00000463369;ENST00000482785	T;T;T	0.44482	0.92;0.92;0.92	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	M	0.88570	2.965	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.74118	-0.3768	10	0.52906	T	0.07	-1.2867	19.1532	0.93499	0.0:0.0:1.0:0.0	.	198	Q6PI26	SHQ1_HUMAN	N	198;170;109	ENSP00000315182:H198N;ENSP00000417452:H170N;ENSP00000418398:H109N	ENSP00000315182:H198N	H	-	1	0	SHQ1	72964217	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.763000	0.85283	2.829000	0.97493	0.585000	0.79938	CAT		0.378	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130		Missense_Mutation
FRG2C	100288801	broad.mit.edu	37	3	75714986	75714986	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:75714986C>T	ENST00000308062.3	+	4	693	c.643C>T	c.(643-645)Cgg>Tgg	p.R215W	FRG2C_ENST00000464571.1_Missense_Mutation_p.R214W	NM_001124759.1	NP_001118231.1	A6NGY1	FRG2C_HUMAN	FSHD region gene 2 family, member C	215						nucleus (GO:0005634)		p.R215W(2)		breast(2)|ovary(1)	3						CACTCGGCTCCGGGGGCCTCT	0.587																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	3											1.0	1.0	1.0					3																	75714986		24	57	81	75797676	SO:0001583	missense	100288801				CCDS43108.1	3p12.3	2009-11-25			ENSG00000172969	ENSG00000172969			33626	protein-coding gene	gene with protein product							Standard	NM_001124759		Approved			A6NGY1	OTTHUMG00000158963	ENST00000308062.3:c.643C>T	3.37:g.75714986C>T	ENSP00000312299:p.Arg215Trp	Unknown		x	x	x	75797676		Missense_Mutation	SNP	ENST00000308062.3	37	CCDS43108.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	.	7.873	0.728487	0.15507	.	.	ENSG00000172969	ENST00000308062;ENST00000464571	T;T	0.47869	0.83;0.83	0.673	0.673	0.17941	.	1.460060	0.04596	N	0.397710	T	0.49457	0.1558	N	0.12182	0.205	0.09310	N	1	D	0.89917	1.0	D	0.76575	0.988	T	0.50783	-0.8787	9	0.49607	T	0.09	-1.5836	.	.	.	.	215	A6NGY1	FRG2C_HUMAN	W	215;214	ENSP00000312299:R215W;ENSP00000419432:R214W	ENSP00000312299:R215W	R	+	1	2	FRG2C	75797676	0.095000	0.21747	0.006000	0.13384	0.314000	0.28054	-0.435000	0.06931	0.648000	0.30732	0.173000	0.16961	CGG		0.587	FRG2C-001	KNOWN	NAGNAG_splice_site|not_best_in_genome_evidence|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352694.1	NM_001124759.1		Missense_Mutation
BCHE	590	broad.mit.edu	37	3	165547890	165547890	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:165547890C>A	ENST00000264381.3	-	2	1098	c.932G>T	c.(931-933)gGg>gTg	p.G311V	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	311					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.G311V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	CAAAGGAGTCCCATAGGGGAC	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											45.0	49.0	48.0					3																	165547890		2202	4295	6497	167030584	SO:0001583	missense	590			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.932G>T	3.37:g.165547890C>A	ENSP00000264381:p.Gly311Val	Somatic		x	x	x	167030584	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	0.270	-0.993690	0.02145	.	.	ENSG00000114200	ENST00000264381	D	0.95069	-3.6	5.29	-0.805	0.10879	Carboxylesterase, type B (1);	0.752409	0.13633	N	0.373588	D	0.86569	0.5964	L	0.28556	0.865	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.73418	-0.3989	10	0.30078	T	0.28	.	2.696	0.05135	0.129:0.433:0.1306:0.3074	.	311	P06276	CHLE_HUMAN	V	311	ENSP00000264381:G311V	ENSP00000264381:G311V	G	-	2	0	BCHE	167030584	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.025000	0.13577	-0.027000	0.13873	0.563000	0.77884	GGG		0.393	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1			Missense_Mutation
CPN2	1370	broad.mit.edu	37	3	194062783	194062783	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:194062783C>A	ENST00000323830.3	-	2	738	c.649G>T	c.(649-651)Ggc>Tgc	p.G217C	CPN2_ENST00000429275.1_Missense_Mutation_p.G217C	NM_001080513.2	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	217					protein stabilization (GO:0050821)|regulation of catalytic activity (GO:0050790)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme regulator activity (GO:0030234)	p.G217C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(5)|prostate(1)	27	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		TGCAGGCTGCCCAGTTTGCCA	0.617																																																1	Substitution - Missense(1)	ovary(1)	3											43.0	47.0	46.0					3																	194062783		2203	4300	6503	195544478	SO:0001583	missense	1370			J05158	CCDS33920.1	3q29	2012-02-10	2007-02-23		ENSG00000178772	ENSG00000178772	3.4.17.3		2313	protein-coding gene	gene with protein product		603104	"""carboxypeptidase N, polypeptide 2, 83kD"""	ACBP		2378615, 9628828	Standard	XM_005269280		Approved		uc003fts.3	P22792	OTTHUMG00000156047	ENST00000323830.3:c.649G>T	3.37:g.194062783C>A	ENSP00000319464:p.Gly217Cys	Unknown		x	x	x	195544478	B2RPE7|Q86SU4|Q8N5V4	Missense_Mutation	SNP	ENST00000323830.3	37	CCDS33920.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.26	1.587365	0.28268	.	.	ENSG00000178772	ENST00000323830;ENST00000429275	T;T	0.24723	1.84;1.84	4.77	-0.731	0.11151	.	0.789668	0.10420	N	0.676826	T	0.19846	0.0477	L	0.55834	1.745	0.09310	N	1	B	0.26041	0.14	B	0.25759	0.063	T	0.28681	-1.0036	10	0.38643	T	0.18	.	2.938	0.05820	0.1119:0.3663:0.3278:0.194	.	217	P22792	CPN2_HUMAN	C	217	ENSP00000319464:G217C;ENSP00000402232:G217C	ENSP00000319464:G217C	G	-	1	0	CPN2	195544478	0.000000	0.05858	0.364000	0.25888	0.525000	0.34531	-1.390000	0.02528	-0.404000	0.07610	0.561000	0.74099	GGC		0.617	CPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342856.2	NM_001080513		Missense_Mutation
PIGZ	80235	broad.mit.edu	37	3	196678888	196678888	+	Silent	SNP	T	T	A			TCGA-13-0904-01	TCGA-13-0904-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr3:196678888T>A	ENST00000412723.1	-	2	161	c.15A>T	c.(13-15)ggA>ggT	p.G5G	PIGZ_ENST00000443835.1_Silent_p.G5G	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	5					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)	p.G5G(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CTACGCTGGATCCACAGATCT	0.443																																																1	Substitution - coding silent(1)	ovary(1)	3											80.0	68.0	72.0					3																	196678888		2203	4300	6503	198163285	SO:0001819	synonymous_variant	80235			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.15A>T	3.37:g.196678888T>A		Somatic		x	x	x	198163285	Q9H9G6	Silent	SNP	ENST00000412723.1	37	CCDS3324.1	SNP	50	Broad																																																																																				0.443	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163		Silent
ATP10D	57205	broad.mit.edu	37	4	47559958	47559958	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:47559958A>T	ENST00000273859.3	+	12	2371	c.2102A>T	c.(2101-2103)gAt>gTt	p.D701V	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	701					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D701V(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CAACACGGTGATGCAGGCCTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	4											63.0	59.0	61.0					4																	47559958		2203	4300	6503	47254715	SO:0001583	missense	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2102A>T	4.37:g.47559958A>T	ENSP00000273859:p.Asp701Val	Unknown		x	x	x	47254715	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	11.36	1.614513	0.28712	.	.	ENSG00000145246	ENST00000273859	T	0.38401	1.14	5.24	-0.403	0.12400	HAD-like domain (1);	1.212230	0.05511	N	0.560312	T	0.28863	0.0716	L	0.38175	1.15	0.09310	N	1	B	0.21225	0.053	B	0.27380	0.079	T	0.33189	-0.9878	10	0.31617	T	0.26	-1.3712	6.38	0.21529	0.5764:0.2558:0.1678:0.0	.	701	Q9P241	AT10D_HUMAN	V	701	ENSP00000273859:D701V	ENSP00000273859:D701V	D	+	2	0	ATP10D	47254715	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.022000	0.13511	0.071000	0.16664	0.459000	0.35465	GAT		0.587	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453		Missense_Mutation
PPEF2	5470	broad.mit.edu	37	4	76797629	76797629	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:76797629G>T	ENST00000286719.7	-	11	1487	c.1131C>A	c.(1129-1131)tgC>tgA	p.C377*		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	377	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)	p.C377*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGGAACCGCTGCAGGGGATGC	0.662																																					NSCLC(105;1359 1603 15961 44567 47947)											1	Substitution - Nonsense(1)	ovary(1)	4											34.0	35.0	35.0					4																	76797629		2203	4300	6503	77016653	SO:0001587	stop_gained	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1131C>A	4.37:g.76797629G>T	ENSP00000286719:p.Cys377*	Unknown		x	x	x	77016653	O14831	Nonsense_Mutation	SNP	ENST00000286719.7	37	CCDS34013.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.965480	0.97151	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	.	.	.	5.02	2.32	0.28847	.	2.105260	0.01974	N	0.044318	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-8.0322	8.3212	0.32130	0.2726:0.0:0.7274:0.0	.	.	.	.	X	377	.	ENSP00000286719:C377X	C	-	3	2	PPEF2	77016653	0.987000	0.35691	0.269000	0.24586	0.128000	0.20619	1.954000	0.40362	0.159000	0.19401	-0.424000	0.05967	TGC		0.662	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239		Nonsense_Mutation
BMP3	651	broad.mit.edu	37	4	81967153	81967153	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:81967153A>G	ENST00000282701.2	+	2	898	c.578A>G	c.(577-579)gAt>gGt	p.D193G		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	193					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)	p.D193G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TCTCATCGAGATATTATGTCC	0.428																																																1	Substitution - Missense(1)	ovary(1)	4											138.0	147.0	144.0					4																	81967153		2203	4300	6503	82186177	SO:0001583	missense	651			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.578A>G	4.37:g.81967153A>G	ENSP00000282701:p.Asp193Gly	Unknown		x	x	x	82186177	Q4VAS5	Missense_Mutation	SNP	ENST00000282701.2	37	CCDS3588.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	10.69	1.422223	0.25639	.	.	ENSG00000152785	ENST00000282701	T	0.74421	-0.84	4.84	4.84	0.62591	Transforming growth factor-beta, N-terminal (1);	0.044027	0.85682	D	0.000000	D	0.82967	0.5152	M	0.70275	2.135	0.80722	D	1	D	0.67145	0.996	D	0.65684	0.937	T	0.81099	-0.1086	10	0.25751	T	0.34	.	14.5267	0.67894	1.0:0.0:0.0:0.0	.	193	P12645	BMP3_HUMAN	G	193	ENSP00000282701:D193G	ENSP00000282701:D193G	D	+	2	0	BMP3	82186177	1.000000	0.71417	0.827000	0.32855	0.003000	0.03518	6.834000	0.75339	2.173000	0.68751	0.533000	0.62120	GAT		0.428	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			Missense_Mutation
MMRN1	22915	broad.mit.edu	37	4	90816312	90816312	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:90816312G>T	ENST00000394980.1	+	2	509	c.190G>T	c.(190-192)Gag>Tag	p.E64*	MMRN1_ENST00000264790.2_Nonsense_Mutation_p.E64*|MMRN1_ENST00000394981.1_Nonsense_Mutation_p.E64*			Q13201	MMRN1_HUMAN	multimerin 1	64					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.E64*(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CATGTCGGCGGAGATAGCTAC	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	4											65.0	68.0	67.0					4																	90816312		2203	4300	6503	91035335	SO:0001587	stop_gained	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.190G>T	4.37:g.90816312G>T	ENSP00000378431:p.Glu64*	Unknown		x	x	x	91035335	Q4W5L1|Q6P3T8|Q6ZUL9	Nonsense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.201688	0.97371	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981	.	.	.	4.67	1.95	0.26073	.	0.124430	0.35349	N	0.003261	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	5.5262	0.16959	0.1884:0.1634:0.6481:0.0	.	.	.	.	X	64	.	ENSP00000264790:E64X	E	+	1	0	MMRN1	91035335	0.000000	0.05858	0.023000	0.16930	0.005000	0.04900	-0.055000	0.11807	0.250000	0.21479	0.563000	0.77884	GAG		0.463	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351		Nonsense_Mutation
MMRN1	22915	broad.mit.edu	37	4	90874314	90874314	+	Silent	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:90874314A>G	ENST00000394980.1	+	9	3751	c.3432A>G	c.(3430-3432)gtA>gtG	p.V1144V	MMRN1_ENST00000508372.1_Silent_p.V886V|MMRN1_ENST00000264790.2_Silent_p.V1144V|MMRN1_ENST00000394981.1_Silent_p.V447V			Q13201	MMRN1_HUMAN	multimerin 1	1144	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.V1144V(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		ATCTTGGAGTATATGTTTTCA	0.348																																																1	Substitution - coding silent(1)	ovary(1)	4											120.0	119.0	119.0					4																	90874314		2203	4300	6503	91093337	SO:0001819	synonymous_variant	22915			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3432A>G	4.37:g.90874314A>G		Unknown		x	x	x	91093337	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	37	CCDS3635.1	SNP	16	Broad																																																																																				0.348	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351		Silent
TNIP3	79931	broad.mit.edu	37	4	122068296	122068296	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:122068296G>A	ENST00000509841.1	-	10	952	c.874C>T	c.(874-876)Cga>Tga	p.R292*	TNIP3_ENST00000511909.1_5'UTR|TNIP3_ENST00000057513.3_Nonsense_Mutation_p.R215*|TNIP3_ENST00000507879.1_Nonsense_Mutation_p.R285*|TNIP3_ENST00000454328.1_Nonsense_Mutation_p.R215*	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3									p.R215*(1)		NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						CGATCCGATCGTTCCTTTTTG	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	4											193.0	187.0	189.0					4																	122068296		2203	4300	6503	122287746	SO:0001587	stop_gained	79931			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.874C>T	4.37:g.122068296G>A	ENSP00000426613:p.Arg292*	Unknown		x	x	x	122287746		Nonsense_Mutation	SNP	ENST00000509841.1	37	CCDS58926.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	37	6.256847	0.97417	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	.	.	.	5.4	2.33	0.28932	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.629	13.3008	0.60324	0.0:0.0:0.3006:0.6994	.	.	.	.	X	215;215;285;292	.	ENSP00000057513:R215X	R	-	1	2	TNIP3	122287746	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	2.618000	0.46393	0.626000	0.30322	0.563000	0.77884	CGA		0.373	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364000.4	NM_024873		Nonsense_Mutation
FHDC1	85462	broad.mit.edu	37	4	153875436	153875436	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:153875436C>G	ENST00000511601.1	+	4	816	c.628C>G	c.(628-630)Cga>Gga	p.R210G	FHDC1_ENST00000260008.3_Missense_Mutation_p.R210G			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	210	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.							p.R210G(1)	ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					AGAGACCTTGCGAGAATTTCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											107.0	112.0	110.0					4																	153875436		2203	4300	6503	154094886	SO:0001583	missense	85462			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.628C>G	4.37:g.153875436C>G	ENSP00000427567:p.Arg210Gly	Unknown		x	x	x	154094886		Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602315	0.46423	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.62788	-0.0;-0.0	5.86	4.11	0.48088	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.297635	0.33457	N	0.004898	T	0.64360	0.2591	M	0.83223	2.63	0.29340	N	0.866077	P	0.41214	0.742	B	0.39094	0.29	T	0.66333	-0.5950	10	0.72032	D	0.01	.	11.1007	0.48172	0.1291:0.8045:0.0:0.0664	.	210	Q9C0D6	FHDC1_HUMAN	G	210	ENSP00000427567:R210G;ENSP00000260008:R210G	ENSP00000260008:R210G	R	+	1	2	FHDC1	154094886	1.000000	0.71417	0.705000	0.30386	0.670000	0.39368	2.200000	0.42724	0.804000	0.34136	0.650000	0.86243	CGA		0.363	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393		Missense_Mutation
CPE	1363	broad.mit.edu	37	4	166405679	166405679	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr4:166405679C>A	ENST00000402744.4	+	5	1176	c.896C>A	c.(895-897)cCa>cAa	p.P299Q		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	299					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)	p.P299Q(1)		endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AATCGGCCACCATGTCGCAAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	4											315.0	301.0	306.0					4																	166405679		2203	4300	6503	166625129	SO:0001583	missense	1363			X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.896C>A	4.37:g.166405679C>A	ENSP00000386104:p.Pro299Gln	Unknown		x	x	x	166625129	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	37	CCDS3810.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898139	0.52227	.	.	ENSG00000109472	ENST00000402744;ENST00000261510	T	0.20738	2.05	5.67	5.67	0.87782	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.45478	0.1344	M	0.64567	1.98	0.80722	D	1	D	0.65815	0.995	D	0.65773	0.938	T	0.12941	-1.0528	10	0.49607	T	0.09	-10.7722	20.1284	0.97992	0.0:1.0:0.0:0.0	.	299	P16870	CBPE_HUMAN	Q	299;263	ENSP00000386104:P299Q	ENSP00000261510:P263Q	P	+	2	0	CPE	166625129	1.000000	0.71417	0.207000	0.23584	0.057000	0.15508	7.228000	0.78079	2.829000	0.97493	0.650000	0.86243	CCA		0.537	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873		Missense_Mutation
SEMA5A	9037	broad.mit.edu	37	5	9224934	9224934	+	Silent	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr5:9224934C>T	ENST00000382496.5	-	8	1163	c.498G>A	c.(496-498)caG>caA	p.Q166Q		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	166	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.Q166Q(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TGGAATTGTGCTGGGGACTGT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	5											96.0	86.0	90.0					5																	9224934		2203	4300	6503	9277934	SO:0001819	synonymous_variant	9037			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.498G>A	5.37:g.9224934C>T		Unknown		x	x	x	9277934	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	8.429	0.848167	0.17034	.	.	ENSG00000112902	ENST00000514923	.	.	.	5.04	3.96	0.45880	.	.	.	.	.	T	0.58552	0.2130	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55444	-0.8140	4	.	.	.	.	9.2872	0.37764	0.0:0.8843:0.0:0.1157	.	.	.	.	T	114	.	.	A	-	1	0	SEMA5A	9277934	0.998000	0.40836	1.000000	0.80357	0.915000	0.54546	0.570000	0.23653	2.351000	0.79841	0.637000	0.83480	GCA		0.552	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			Silent
DNAH5	1767	broad.mit.edu	37	5	13769114	13769114	+	Silent	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr5:13769114C>A	ENST00000265104.4	-	58	9956	c.9852G>T	c.(9850-9852)ctG>ctT	p.L3284L	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3284	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L3284L(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTGCTGCTTCCAGTTTTTCTT	0.468									Kartagener syndrome																																							1	Substitution - coding silent(1)	ovary(1)	5											229.0	216.0	221.0					5																	13769114		2203	4300	6503	13822114	SO:0001819	synonymous_variant	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9852G>T	5.37:g.13769114C>A		Unknown		x	x	x	13822114	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	21	Broad																																																																																				0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Silent
DNAH5	1767	broad.mit.edu	37	5	13769233	13769233	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr5:13769233C>T	ENST00000265104.4	-	58	9837	c.9733G>A	c.(9733-9735)Gtg>Atg	p.V3245M	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3245	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V3245M(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCATTGTCACTTCTTTTAAG	0.408									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											219.0	218.0	219.0					5																	13769233		2203	4300	6503	13822233	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9733G>A	5.37:g.13769233C>T	ENSP00000265104:p.Val3245Met	Unknown		x	x	x	13822233	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966581	0.92855	.	.	ENSG00000039139	ENST00000265104	T	0.80566	-1.39	5.76	5.76	0.90799	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.93831	0.8027	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95022	0.8161	10	0.87932	D	0	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	3245	Q8TE73	DYH5_HUMAN	M	3245	ENSP00000265104:V3245M	ENSP00000265104:V3245M	V	-	1	0	DNAH5	13822233	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.639000	0.83342	2.882000	0.98803	0.655000	0.94253	GTG		0.408	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
JAKMIP2	9832	broad.mit.edu	37	5	147051268	147051268	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr5:147051268C>G	ENST00000265272.5	-	2	569	c.102G>C	c.(100-102)caG>caC	p.Q34H	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.Q34H|JAKMIP2_ENST00000333010.6_Intron	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	34						Golgi apparatus (GO:0005794)		p.Q34H(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTCTATCTGAATGTCTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											166.0	136.0	146.0					5																	147051268		2203	4300	6503	147031461	SO:0001583	missense	9832			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.102G>C	5.37:g.147051268C>G	ENSP00000265272:p.Gln34His	Unknown		x	x	x	147031461	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701930	0.68501	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000539401	T;T	0.36699	1.24;1.24	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.54191	0.1843	M	0.73962	2.25	0.80722	D	1	D;D;D	0.60575	0.988;0.988;0.988	D;D;D	0.72338	0.977;0.977;0.977	T	0.57516	-0.7798	10	0.72032	D	0.01	.	6.4753	0.22033	0.0:0.7654:0.0:0.2346	.	34;34;34	Q96AA8-3;G5E9Y0;Q96AA8	.;.;JKIP2_HUMAN	H	34	ENSP00000421398:Q34H;ENSP00000265272:Q34H	ENSP00000265272:Q34H	Q	-	3	2	JAKMIP2	147031461	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.880000	0.48530	2.483000	0.83821	0.555000	0.69702	CAG		0.542	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		Missense_Mutation
USP49	25862	broad.mit.edu	37	6	41771619	41771619	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:41771619G>A	ENST00000394253.3	-	4	1815	c.1486C>T	c.(1486-1488)Ctc>Ttc	p.L496F	USP49_ENST00000373009.3_Missense_Mutation_p.L496F|USP49_ENST00000297229.2_Missense_Mutation_p.L496F|USP49_ENST00000373006.1_Missense_Mutation_p.L496F|USP49_ENST00000373010.1_Missense_Mutation_p.L496F			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	496	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.L496F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATCTCAGTGAGCAAGCACTCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											120.0	115.0	117.0					6																	41771619		2203	4300	6503	41879597	SO:0001583	missense	25862			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1486C>T	6.37:g.41771619G>A	ENSP00000377797:p.Leu496Phe	Unknown		x	x	x	41879597	Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	ENST00000394253.3	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539674	0.85917	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;T;T	0.10192	3.54;3.54;3.54;2.9;2.9	5.66	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.29684	0.0741	M	0.86864	2.845	0.58432	D	0.999999	D	0.71674	0.998	D	0.74674	0.984	T	0.36648	-0.9739	10	0.87932	D	0	-12.9935	16.4713	0.84112	0.0:0.1314:0.8686:0.0	.	496	Q70CQ1-2	.	F	496	ENSP00000377797:L496F;ENSP00000362101:L496F;ENSP00000362100:L496F;ENSP00000362097:L496F;ENSP00000297229:L496F	ENSP00000297229:L496F	L	-	1	0	USP49	41879597	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	1.484000	0.48361	0.655000	0.94253	CTC		0.507	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561		Missense_Mutation
SUPT3H	8464	broad.mit.edu	37	6	44971495	44971495	+	Silent	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:44971495T>C	ENST00000371459.1	-	6	564	c.399A>G	c.(397-399)agA>agG	p.R133R	SUPT3H_ENST00000371461.2_Silent_p.R144R|SUPT3H_ENST00000306867.5_Silent_p.R133R|SUPT3H_ENST00000371460.1_Silent_p.R144R	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	215					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)	p.R144R(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						CAATCTTTTGTCTTTTGTTCG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	6											152.0	134.0	140.0					6																	44971495		2202	4299	6501	45079473	SO:0001819	synonymous_variant	8464			AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.399A>G	6.37:g.44971495T>C		Unknown		x	x	x	45079473	A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Silent	SNP	ENST00000371459.1	37	CCDS34465.1	SNP	58	Broad																																																																																				0.343	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106911.2	NM_181356		Silent
GRIK2	2898	broad.mit.edu	37	6	102266271	102266271	+	Silent	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:102266271C>G	ENST00000421544.1	+	9	1720	c.1230C>G	c.(1228-1230)ggC>ggG	p.G410G	GRIK2_ENST00000318991.6_Silent_p.G410G|GRIK2_ENST00000369134.4_Silent_p.G361G|GRIK2_ENST00000413795.1_Silent_p.G410G|GRIK2_ENST00000369138.1_Silent_p.G410G|GRIK2_ENST00000369137.3_Silent_p.G410G	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	410					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.G410G(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CAGCCAGTGGCCTGAATATGA	0.398																																																2	Substitution - coding silent(2)	ovary(2)	6											173.0	154.0	161.0					6																	102266271		2203	4300	6503	102372964	SO:0001819	synonymous_variant	2898				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1230C>G	6.37:g.102266271C>G		Unknown		x	x	x	102372964	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	ENST00000421544.1	37	CCDS5048.1	SNP	26	Broad																																																																																				0.398	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			Silent
SAMD3	154075	broad.mit.edu	37	6	130476163	130476163	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:130476163G>A	ENST00000368134.2	-	11	1438	c.830C>T	c.(829-831)gCt>gTt	p.A277V	SAMD3_ENST00000437477.2_Missense_Mutation_p.A277V|SAMD3_ENST00000439090.2_Missense_Mutation_p.A277V|SAMD3_ENST00000457563.2_Missense_Mutation_p.A301V	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	277								p.A277V(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		AAAACAAACAGCTTCTTCCTG	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											100.0	93.0	95.0					6																	130476163		2203	4300	6503	130517856	SO:0001583	missense	154075			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.830C>T	6.37:g.130476163G>A	ENSP00000357116:p.Ala277Val	Unknown		x	x	x	130517856	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	CCDS34539.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786038	0.31593	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477	T;T;T;T	0.45276	0.91;0.9;0.91;0.91	5.41	-3.69	0.04450	.	1.479880	0.03799	N	0.264152	T	0.12008	0.0292	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22661	-1.0210	10	0.48119	T	0.1	.	1.0818	0.01644	0.2889:0.2063:0.3544:0.1504	.	277	Q8N6K7	SAMD3_HUMAN	V	277;301;277;277	ENSP00000357116:A277V;ENSP00000402092:A301V;ENSP00000403565:A277V;ENSP00000391163:A277V	ENSP00000357116:A277V	A	-	2	0	SAMD3	130517856	0.001000	0.12720	0.051000	0.19133	0.913000	0.54294	0.000000	0.12993	-0.420000	0.07427	0.563000	0.77884	GCT		0.353	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552		Missense_Mutation
IYD	389434	broad.mit.edu	37	6	150690326	150690326	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:150690326C>A	ENST00000344419.3	+	1	299	c.159C>A	c.(157-159)gaC>gaA	p.D53E	IYD_ENST00000392256.2_Missense_Mutation_p.D53E|IYD_ENST00000425615.3_5'Flank|IYD_ENST00000392255.3_Missense_Mutation_p.D53E|IYD_ENST00000229447.5_Missense_Mutation_p.D53E|IYD_ENST00000500320.3_Missense_Mutation_p.D53E	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	53					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)	p.D53E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		ACAGCAGTGACCTGCACCAAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											63.0	62.0	62.0					6																	150690326		2203	4300	6503	150732019	SO:0001583	missense	389434			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.159C>A	6.37:g.150690326C>A	ENSP00000343763:p.Asp53Glu	Unknown		x	x	x	150732019	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	37	CCDS5227.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	4.387	0.071437	0.08436	.	.	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320	D;T;D;D;D	0.86097	-2.07;-0.35;-1.96;-2.0;-2.03	5.14	-8.26	0.01021	.	0.486110	0.22047	N	0.065376	T	0.39279	0.1072	N	0.22421	0.69	0.28104	N	0.931299	B;B;B	0.17038	0.007;0.02;0.002	B;B;B	0.21151	0.002;0.033;0.005	T	0.53711	-0.8400	10	0.08381	T	0.77	-9.5621	3.4875	0.07625	0.1016:0.1327:0.2888:0.4768	.	53;53;53	C9JFW2;Q6PHW0-3;Q6PHW0	.;.;IYD1_HUMAN	E	53	ENSP00000229447:D53E;ENSP00000343763:D53E;ENSP00000376085:D53E;ENSP00000376084:D53E;ENSP00000441276:D53E	ENSP00000229447:D53E	D	+	3	2	IYD	150732019	0.000000	0.05858	0.000000	0.03702	0.508000	0.34012	-1.907000	0.01589	-1.375000	0.02129	-0.300000	0.09419	GAC		0.502	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	NM_203395		Missense_Mutation
KIF25	3834	broad.mit.edu	37	6	168430274	168430274	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr6:168430274G>T	ENST00000443060.2	+	3	400	c.9G>T	c.(7-9)tgG>tgT	p.W3C	KIF25_ENST00000354419.2_Missense_Mutation_p.W3C|KIF25_ENST00000351261.3_Missense_Mutation_p.W3C			Q9UIL4	KIF25_HUMAN	kinesin family member 25	3					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.W3C(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AGATGACATGGACCTCAGGTC	0.617																																																1	Substitution - Missense(1)	ovary(1)	6											125.0	118.0	120.0					6																	168430274		2203	4300	6503	168173123	SO:0001583	missense	3834			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.9G>T	6.37:g.168430274G>T	ENSP00000388878:p.Trp3Cys	Unknown		x	x	x	168173123	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	g	0.307	-0.970285	0.02232	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.73258	-0.73;-0.73;0.07	0.598	-0.648	0.11464	.	0.000000	0.46758	U	0.000269	T	0.14743	0.0356	N	0.08118	0	0.09310	N	1	P;P	0.37525	0.553;0.598	B;B	0.28011	0.085;0.022	T	0.43988	-0.9357	8	.	.	.	.	.	.	.	.	3;3	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	C	3	ENSP00000388878:W3C;ENSP00000346401:W3C;ENSP00000252688:W3C	.	W	+	3	0	KIF25	168173123	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.811000	0.04500	-1.214000	0.02614	-1.478000	0.00992	TGG		0.617	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1			Missense_Mutation
DAGLB	221955	broad.mit.edu	37	7	6449759	6449759	+	Splice_Site	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:6449759A>G	ENST00000297056.6	-	14	1990		c.e14+1		DAGLB_ENST00000428902.2_Splice_Site|DAGLB_ENST00000436575.1_Splice_Site|DAGLB_ENST00000425398.2_Splice_Site	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta						arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CGCCGCACTCACCGCCCCGAG	0.672																																																1	Unknown(1)	ovary(1)	7											19.0	22.0	21.0					7																	6449759		2198	4298	6496	6416284	SO:0001630	splice_region_variant	221955			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1820+1T>C	7.37:g.6449759A>G		Unknown		x	x	x	6416284	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Splice_Site_SNP	SNP	ENST00000297056.6	37	CCDS5350.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	22.1	4.239701	0.79800	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000436575	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8538	0.78960	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DAGLB	6416284	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.004000	0.88535	2.141000	0.66446	0.528000	0.53228	.		0.672	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	Intron	Splice_Site_SNP
HECW1	23072	broad.mit.edu	37	7	43495970	43495970	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:43495970C>G	ENST00000395891.2	+	13	3180	c.2575C>G	c.(2575-2577)Cgt>Ggt	p.R859G	HECW1_ENST00000453890.1_Missense_Mutation_p.R825G	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	859	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R838G(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CACCTGGCAGCGTCCGACGGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	7											60.0	61.0	61.0					7																	43495970		1962	4146	6108	43462495	SO:0001583	missense	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2575C>G	7.37:g.43495970C>G	ENSP00000379228:p.Arg859Gly	Somatic		x	x	x	43462495	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426253	0.83667	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.84298	-1.83;-1.83	6.06	5.16	0.70880	WW/Rsp5/WWP (6);	0.000000	0.85682	D	0.000000	D	0.93523	0.7933	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.982	D	0.94629	0.7820	10	0.72032	D	0.01	.	16.6144	0.84903	0.1311:0.8689:0.0:0.0	.	825;859	B4DH42;Q76N89	.;HECW1_HUMAN	G	859;825;859	ENSP00000379228:R859G;ENSP00000407774:R825G	ENSP00000265522:R859G	R	+	1	0	HECW1	43462495	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	3.097000	0.50251	1.524000	0.49035	0.655000	0.94253	CGT		0.557	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052		Missense_Mutation
BUD31	8896	broad.mit.edu	37	7	99008722	99008722	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:99008722A>G	ENST00000403633.2	+	3	536	c.7A>G	c.(7-9)Aaa>Gaa	p.K3E	BUD31_ENST00000456893.1_Missense_Mutation_p.K3E|BUD31_ENST00000222969.5_Missense_Mutation_p.K3E|snoU13_ENST00000458831.1_RNA|PDAP1_ENST00000350498.3_5'Flank			P41223	BUD31_HUMAN	BUD31 homolog (S. cerevisiae)	3					regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K3E(1)		autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	4	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GAAAATGCCTAAAGTCAAAAG	0.448																																																1	Substitution - Missense(1)	ovary(1)	7											50.0	57.0	55.0					7																	99008722		2203	4300	6503	98846658	SO:0001583	missense	8896			BC022821	CCDS5663.1	7q22.1	2012-06-07	2007-01-12	2006-03-16	ENSG00000106245	ENSG00000106245			29629	protein-coding gene	gene with protein product	"""G10 maternal transcript homolog (Xenopus laevis)"", ""functional spliceosome-associated protein 17"""	603477	"""BUD31 homolog (yeast)"""			7841202	Standard	NM_003910		Approved	YCR063W, EDG-2, EDG2, G10, fSAP17, Cwc14	uc003uqg.4	P41223	OTTHUMG00000154602	ENST00000403633.2:c.7A>G	7.37:g.99008722A>G	ENSP00000386023:p.Lys3Glu	Unknown		x	x	x	98846658	A4D274|B7Z4S9|D6W5S6|Q6IB53|Q9UDV1	Missense_Mutation	SNP	ENST00000403633.2	37	CCDS5663.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	34	5.308516	0.95629	.	.	ENSG00000106245	ENST00000403633;ENST00000222969;ENST00000456893	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.80824	0.4697	M	0.88775	2.98	0.80722	D	1	D;P	0.59357	0.985;0.846	P;P	0.62435	0.902;0.79	D	0.84752	0.0757	9	0.66056	D	0.02	-26.8115	15.5153	0.75818	1.0:0.0:0.0:0.0	.	3;3	B7Z4S9;P41223	.;BUD31_HUMAN	E	3	.	ENSP00000222969:K3E	K	+	1	0	BUD31	98846658	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.636000	0.91010	2.063000	0.61619	0.533000	0.62120	AAA		0.448	BUD31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336275.1	NM_003910		Missense_Mutation
MUC17	140453	broad.mit.edu	37	7	100682335	100682335	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:100682335G>A	ENST00000306151.4	+	3	7702	c.7638G>A	c.(7636-7638)gtG>gtA	p.V2546V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2546	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.V2546V(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAGTCCTGTGGTCACTTCTA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	7											246.0	250.0	249.0					7																	100682335		2203	4300	6503	100469055	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7638G>A	7.37:g.100682335G>A		Unknown		x	x	x	100469055	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	47	Broad																																																																																				0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
COL26A1	136227	broad.mit.edu	37	7	101006394	101006394	+	RNA	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:101006394C>T	ENST00000397927.3	+	0	294				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.F27F(1)									TCTATCCCTTCTCGGCCGCAG	0.746																																																1	Substitution - coding silent(1)	ovary(1)	7											4.0	6.0	5.0					7																	101006394		1904	4049	5953	100793114			136227			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101006394C>T		Unknown		x	x	x	100793114	Q32M90	Silent	SNP	ENST00000397927.3	37		SNP	32	Broad																																																																																				0.746	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457		Silent
RELN	5649	broad.mit.edu	37	7	103124237	103124237	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:103124237G>C	ENST00000428762.1	-	62	10203	c.10044C>G	c.(10042-10044)gaC>gaG	p.D3348E	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.D3348E|RELN_ENST00000343529.5_Missense_Mutation_p.D3348E|RELN_ENST00000473945.1_5'UTR|RN7SKP86_ENST00000410454.1_RNA	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3348					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.D3348E(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGCCACTCAGGTCACTGTTGC	0.483																																					NSCLC(146;835 1944 15585 22231 52158)											1	Substitution - Missense(1)	ovary(1)	7											141.0	127.0	132.0					7																	103124237		2203	4300	6503	102911473	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.10044C>G	7.37:g.103124237G>C	ENSP00000392423:p.Asp3348Glu	Unknown		x	x	x	102911473	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905572	0.52333	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.21543	2.0;2.0;2.0	5.73	4.74	0.60224	.	0.178406	0.49916	D	0.000122	T	0.10380	0.0254	N	0.08118	0	0.26587	N	0.973261	B;B	0.14012	0.003;0.009	B;B	0.22601	0.037;0.04	T	0.09662	-1.0664	10	0.41790	T	0.15	.	6.89	0.24224	0.1954:0.0:0.8046:0.0	.	3348;3348	P78509-2;P78509	.;RELN_HUMAN	E	3348;3348;3348;865;3348	ENSP00000392423:D3348E;ENSP00000345694:D3348E;ENSP00000388446:D3348E	ENSP00000345694:D3348E	D	-	3	2	RELN	102911473	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.823000	0.39062	2.704000	0.92352	0.655000	0.94253	GAC		0.483	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		Missense_Mutation
KCND2	3751	broad.mit.edu	37	7	119915388	119915388	+	Silent	SNP	G	G	T	rs141583673		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr7:119915388G>T	ENST00000331113.4	+	1	1667	c.702G>T	c.(700-702)acG>acT	p.T234T		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	234					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.T234T(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCTTGGACACGGCCTGCGTCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	7											151.0	127.0	135.0					7																	119915388		2203	4300	6503	119702624	SO:0001819	synonymous_variant	3751			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.702G>T	7.37:g.119915388G>T		Unknown		x	x	x	119702624	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	CCDS5776.1	SNP	39	Broad																																																																																				0.537	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		Silent
SGK223	157285	broad.mit.edu	37	8	8197043	8197043	+	Silent	SNP	G	G	A	rs56187292		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr8:8197043G>A	ENST00000520004.1	-	4	2529	c.2265C>T	c.(2263-2265)acC>acT	p.T755T	SGK223_ENST00000330777.4_Silent_p.T755T			Q86YV5	SG223_HUMAN		757							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.T757T(1)|p.T755T(1)									CCGTGGAGCCGGTGGTGAAGC	0.532																																					GBM(34;731 755 10259 33573 33867)											2	Substitution - coding silent(2)	ovary(2)	8											72.0	84.0	80.0					8																	8197043		2092	4206	6298	8234453	SO:0001819	synonymous_variant	157285																														ENST00000520004.1:c.2265C>T	8.37:g.8197043G>A		Unknown		x	x	x	8234453	Q8N3N5	Silent	SNP	ENST00000520004.1	37	CCDS43706.1	SNP	39	Broad																																																																																				0.532	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1			Silent
KAT6A	7994	broad.mit.edu	37	8	41832337	41832337	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr8:41832337T>C	ENST00000396930.3	-	9	1910	c.1367A>G	c.(1366-1368)aAt>aGt	p.N456S	KAT6A_ENST00000485568.1_Missense_Mutation_p.N456S|KAT6A_ENST00000406337.1_Missense_Mutation_p.N456S|KAT6A_ENST00000265713.2_Missense_Mutation_p.N456S	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	456	Interaction with PML.|Interaction with RUNX1-1.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.N456S(1)									GCCATCCTGATTGTCTACATA	0.348																																																1	Substitution - Missense(1)	ovary(1)	8											85.0	80.0	82.0					8																	41832337		2203	4300	6503	41951494	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1367A>G	8.37:g.41832337T>C	ENSP00000380136:p.Asn456Ser	Somatic		x	x	x	41951494	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009031	0.54361	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000485568	T;T;T;D	0.83419	0.29;0.29;0.29;-1.72	5.68	5.68	0.88126	.	0.268590	0.37261	N	0.002177	D	0.88108	0.6348	L	0.53249	1.67	0.54753	D	0.99998	D;D	0.69078	0.993;0.997	D;D	0.75020	0.956;0.985	D	0.85411	0.1137	10	0.21014	T	0.42	-16.7418	15.9723	0.80031	0.0:0.0:0.0:1.0	.	456;456	A5PLL3;Q92794	.;KAT6A_HUMAN	S	456	ENSP00000265713:N456S;ENSP00000385888:N456S;ENSP00000380136:N456S;ENSP00000430606:N456S	ENSP00000265713:N456S	N	-	2	0	KAT6A	41951494	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.367000	0.79558	2.169000	0.68431	0.529000	0.55759	AAT		0.348	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766		Missense_Mutation
CNBD1	168975	broad.mit.edu	37	8	88365998	88365998	+	Silent	SNP	A	A	G			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr8:88365998A>G	ENST00000518476.1	+	10	1338	c.1287A>G	c.(1285-1287)gaA>gaG	p.E429E		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	429								p.E429E(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						CAATCATTGAAGATAAGGACC	0.308																																																1	Substitution - coding silent(1)	ovary(1)	8											85.0	82.0	83.0					8																	88365998		1832	4077	5909	88435114	SO:0001819	synonymous_variant	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1287A>G	8.37:g.88365998A>G		Unknown		x	x	x	88435114		Silent	SNP	ENST00000518476.1	37	CCDS55259.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	0.641	-0.813300	0.02798	.	.	ENSG00000176571	ENST00000523299;ENST00000521593	.	.	.	4.98	2.44	0.29823	.	.	.	.	.	T	0.46073	0.1374	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32241	-0.9914	4	.	.	.	-18.8154	3.3259	0.07067	0.6299:0.0:0.1134:0.2567	.	.	.	.	R	121;66	.	.	K	+	2	0	CNBD1	88435114	0.984000	0.35163	0.959000	0.39883	0.180000	0.23129	-0.044000	0.12023	0.763000	0.33175	0.454000	0.30748	AAG		0.308	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538		Silent
BAI1	575	broad.mit.edu	37	8	143624769	143624769	+	Silent	SNP	G	G	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr8:143624769G>T	ENST00000517894.1	+	29	5313	c.4419G>T	c.(4417-4419)cgG>cgT	p.R1473R	BAI1_ENST00000323289.5_Silent_p.R1473R			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1473	Necessary for interaction with MAGI1.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1473R(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCAGCGGCGGAAGTCGCGGT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	8											70.0	87.0	81.0					8																	143624769		2034	4172	6206	143621771	SO:0001819	synonymous_variant	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.4419G>T	8.37:g.143624769G>T		Unknown		x	x	x	143621771		Silent	SNP	ENST00000517894.1	37		SNP	41	Broad																																																																																				0.622	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702		Silent
FANCG	2189	broad.mit.edu	37	9	35076001	35076001	+	Silent	SNP	G	G	A			TCGA-13-0904-01	TCGA-13-0904-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr9:35076001G>A	ENST00000378643.3	-	9	1592	c.1101C>T	c.(1099-1101)taC>taT	p.Y367Y	FANCG_ENST00000476212.1_Intron|VCP_ENST00000358901.6_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	367					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)	p.Y367Y(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GCAGGTCCAAGTAATGCTCTG	0.562			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	1	Substitution - coding silent(1)	ovary(1)	9											131.0	129.0	130.0					9																	35076001		2203	4300	6503	35066001	SO:0001819	synonymous_variant	2189			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.1101C>T	9.37:g.35076001G>A		Somatic		x	x	x	35066001		Silent	SNP	ENST00000378643.3	37	CCDS6574.1	SNP	36	Broad																																																																																				0.562	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629		Silent
TLN1	7094	broad.mit.edu	37	9	35724624	35724624	+	Silent	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr9:35724624C>A	ENST00000314888.9	-	5	809	c.456G>T	c.(454-456)ctG>ctT	p.L152L	TLN1_ENST00000540444.1_Silent_p.L152L	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	152	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.L152L(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTTCATCTCGCAGCAATGTCT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	9											310.0	286.0	294.0					9																	35724624		2203	4300	6503	35714624	SO:0001819	synonymous_variant	7094			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.456G>T	9.37:g.35724624C>A		Somatic		x	x	x	35714624	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	ENST00000314888.9	37	CCDS35009.1	SNP	25	Broad																																																																																				0.408	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		Silent
TMEM2	23670	broad.mit.edu	37	9	74305103	74305103	+	Silent	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr9:74305103C>T	ENST00000377044.4	-	22	4295	c.3756G>A	c.(3754-3756)ccG>ccA	p.P1252P	TMEM2_ENST00000377066.5_Silent_p.P1189P|TMEM2_ENST00000396272.3_Silent_p.P245P	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1252					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.P1252P(1)		central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GAACGCTGCACGGATCCACAA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	9											125.0	103.0	111.0					9																	74305103		2203	4300	6503	73494923	SO:0001819	synonymous_variant	23670				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3756G>A	9.37:g.74305103C>T		Unknown		x	x	x	73494923	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Silent	SNP	ENST00000377044.4	37	CCDS6638.1	SNP	19	Broad																																																																																				0.468	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390		Silent
PRUNE2	158471	broad.mit.edu	37	9	79321991	79321991	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr9:79321991C>G	ENST00000376718.3	-	8	5322	c.5199G>C	c.(5197-5199)aaG>aaC	p.K1733N	PRUNE2_ENST00000428286.1_Missense_Mutation_p.K1374N	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1733					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.K1733N(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TATTTTCAGACTTAGGATCAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	9											160.0	130.0	139.0					9																	79321991		1568	3582	5150	78511811	SO:0001583	missense	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5199G>C	9.37:g.79321991C>G	ENSP00000365908:p.Lys1733Asn	Somatic		x	x	x	78511811	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	SNP	20	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.116|1.116	-0.656594|-0.656594	0.03480|0.03480	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.47528|.	0.84;0.84|.	5.91|5.91	-4.72|-4.72	0.03269|0.03269	.|.	0.892392|.	0.09628|.	N|.	0.776668|.	T|T	0.13072|0.13072	0.0317|0.0317	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.26018|0.26018	-1.0115|-1.0115	10|5	0.20519|.	T|.	0.43|.	-2.2955|-2.2955	3.6648|3.6648	0.08252|0.08252	0.1121:0.1578:0.4753:0.2549|0.1121:0.1578:0.4753:0.2549	.|.	1733|.	Q8WUY3|.	PRUN2_HUMAN|.	N|L	1733;1374;1732|1055	ENSP00000365908:K1733N;ENSP00000397425:K1374N|.	ENSP00000365908:K1733N|.	K|V	-|-	3|1	2|0	PRUNE2|PRUNE2	78511811|78511811	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.260000|0.260000	0.26232|0.26232	-1.325000|-1.325000	0.02687|0.02687	-0.708000|-0.708000	0.05015|0.05015	0.655000|0.655000	0.94253|0.94253	AAG|GTC		0.438	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818		Missense_Mutation
HDAC6	10013	broad.mit.edu	37	X	48664776	48664776	+	Splice_Site	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:48664776C>T	ENST00000334136.5	+	7	617	c.439C>T	c.(439-441)Cta>Tta	p.L147L	HDAC6_ENST00000469223.1_3'UTR|HDAC6_ENST00000376619.2_Splice_Site_p.L147L|HDAC6_ENST00000413163.2_Splice_Site_p.L92L|HDAC6_ENST00000444343.2_Splice_Site_p.L161L			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	147	Histone deacetylase 1.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.L147L(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TGTGTCTAGCCTAGAATATAT	0.502																																					Pancreas(112;205 1675 2305 8976 15959)											1	Substitution - coding silent(1)	ovary(1)	X											89.0	67.0	75.0					X																	48664776		2203	4300	6503	48549720	SO:0001630	splice_region_variant	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.438-1C>T	X.37:g.48664776C>T		Somatic		x	x	x	48549720	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1	SNP	24	Broad																																																																																				0.502	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	Silent	Silent
HDAC6	10013	broad.mit.edu	37	X	48674576	48674576	+	Silent	SNP	T	T	C			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:48674576T>C	ENST00000334136.5	+	18	1700	c.1522T>C	c.(1522-1524)Ttg>Ctg	p.L508L	HDAC6_ENST00000376619.2_Silent_p.L508L|HDAC6_ENST00000444343.2_Silent_p.L522L			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	508	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.L508L(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CCAGCGCATCTTGCGGATCAT	0.647																																					Pancreas(112;205 1675 2305 8976 15959)											1	Substitution - coding silent(1)	ovary(1)	X											96.0	77.0	84.0					X																	48674576		2203	4300	6503	48559520	SO:0001819	synonymous_variant	10013			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.1522T>C	X.37:g.48674576T>C		Unknown		x	x	x	48559520	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1	SNP	56	Broad																																																																																				0.647	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044		Silent
STARD8	9754	broad.mit.edu	37	X	67938364	67938364	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:67938364C>A	ENST00000252336.6	+	5	1740	c.1368C>A	c.(1366-1368)aaC>aaA	p.N456K	STARD8_ENST00000374597.3_Missense_Mutation_p.N456K|STARD8_ENST00000374599.3_Missense_Mutation_p.N536K	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	456					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.N456K(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GTAGTGGGAACTCCATGAATG	0.597																																																2	Substitution - Missense(2)	ovary(2)	X											50.0	40.0	44.0					X																	67938364		2203	4300	6503	67855089	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1368C>A	X.37:g.67938364C>A	ENSP00000252336:p.Asn456Lys	Somatic		x	x	x	67855089	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	CCDS14390.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395058	0.62066	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.07216	3.21;3.21;3.21	4.98	4.98	0.66077	.	0.344681	0.29145	N	0.013016	T	0.22166	0.0534	M	0.74881	2.28	0.48975	D	0.999731	D;P	0.56287	0.975;0.882	P;P	0.61201	0.885;0.601	T	0.01545	-1.1328	10	0.26408	T	0.33	.	10.0562	0.42246	0.2006:0.7994:0.0:0.0	.	536;456	Q92502-2;Q92502	.;STAR8_HUMAN	K	456;536;456	ENSP00000252336:N456K;ENSP00000363727:N536K;ENSP00000363725:N456K	ENSP00000252336:N456K	N	+	3	2	STARD8	67855089	0.059000	0.20769	0.762000	0.31397	0.965000	0.64279	0.120000	0.15647	2.056000	0.61249	0.600000	0.82982	AAC		0.597	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		Missense_Mutation
RLIM	51132	broad.mit.edu	37	X	73812800	73812800	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:73812800C>A	ENST00000332687.6	-	4	568	c.350G>T	c.(349-351)aGa>aTa	p.R117I	RLIM_ENST00000349225.2_Missense_Mutation_p.R117I	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	117					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R117I(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTGGTTTCCTCTTTGCCCACT	0.408																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)											1	Substitution - Missense(1)	ovary(1)	X											126.0	114.0	118.0					X																	73812800		2203	4300	6503	73729525	SO:0001583	missense	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.350G>T	X.37:g.73812800C>A	ENSP00000328059:p.Arg117Ile	Unknown		x	x	x	73729525	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	20.7	4.041800	0.75732	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.09538	2.97;2.97	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.30479	0.0766	L	0.52364	1.645	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.00107	-1.2052	10	0.46703	T	0.11	-7.8082	19.7362	0.96205	0.0:1.0:0.0:0.0	.	117	Q9NVW2	RNF12_HUMAN	I	117	ENSP00000328059:R117I;ENSP00000253571:R117I	ENSP00000328059:R117I	R	-	2	0	RLIM	73729525	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.618000	0.88619	0.600000	0.82982	AGA		0.408	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120		Missense_Mutation
TENM1	10178	broad.mit.edu	37	X	123517987	123517987	+	Missense_Mutation	SNP	G	G	A	rs372260419		TCGA-13-0904-01	TCGA-13-0904-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:123517987G>A	ENST00000371130.3	-	29	6836	c.6773C>T	c.(6772-6774)gCg>gTg	p.A2258V	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.A2265V	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2258					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.A2260V(1)									GGACTTACTCGCGACACGTCG	0.458																																																1	Substitution - Missense(1)	ovary(1)	X						G	VAL/ALA,VAL/ALA,VAL/ALA	1,3834		0,1,1631,571	99.0	95.0	96.0		6794,6791,6773	5.7	1.0	X		96	0,6728		0,0,2428,1872	no	missense,missense,missense	ODZ1	NM_001163278.1,NM_001163279.1,NM_014253.3	64,64,64	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	possibly-damaging,possibly-damaging,possibly-damaging	2265/2733,2264/2732,2258/2726	123517987	1,10562	2203	4300	6503	123345668	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6773C>T	X.37:g.123517987G>A	ENSP00000360171:p.Ala2258Val	Somatic		x	x	x	123345668	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249756	0.80024	2.61E-4	0.0	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86769	-2.17;-2.13	5.66	5.66	0.87406	.	0.051235	0.85682	D	0.000000	D	0.91489	0.7313	L	0.53561	1.675	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.997	D;P;P	0.63793	0.918;0.692;0.647	D	0.91220	0.5006	10	0.48119	T	0.1	.	18.6847	0.91559	0.0:0.0:1.0:0.0	.	2264;2265;2258	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	V	2258;2265	ENSP00000360171:A2258V;ENSP00000403954:A2265V	ENSP00000360171:A2258V	A	-	2	0	ODZ1	123345668	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.022000	0.88759	2.356000	0.79943	0.600000	0.82982	GCG		0.458	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		Missense_Mutation
GPR112	139378	broad.mit.edu	37	X	135427478	135427478	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0904-01	TCGA-13-0904-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chrX:135427478C>G	ENST00000394143.1	+	6	1904	c.1613C>G	c.(1612-1614)cCc>cGc	p.P538R	GPR112_ENST00000412101.1_Missense_Mutation_p.P333R|GPR112_ENST00000287534.4_Missense_Mutation_p.P475R|GPR112_ENST00000394141.1_Missense_Mutation_p.P333R|GPR112_ENST00000370652.1_Missense_Mutation_p.P538R	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	538					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P538R(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTCTCTTTACCCAGAGTGGAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											62.0	56.0	58.0					X																	135427478		2202	4300	6502	135255144	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1613C>G	X.37:g.135427478C>G	ENSP00000377699:p.Pro538Arg	Somatic		x	x	x	135255144	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	12.31	1.898769	0.33535	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.31769	1.51;1.51;1.48;1.6;1.48	3.42	2.54	0.30619	.	.	.	.	.	T	0.30008	0.0751	L	0.29908	0.895	0.09310	N	1	P;B;D	0.58970	0.527;0.235;0.984	B;B;P	0.52109	0.286;0.23;0.69	T	0.09271	-1.0682	9	0.87932	D	0	.	6.668	0.23052	0.0:0.851:0.0:0.149	.	475;333;538	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	R	538;538;333;475;333	ENSP00000377699:P538R;ENSP00000359686:P538R;ENSP00000416526:P333R;ENSP00000287534:P475R;ENSP00000377697:P333R	ENSP00000287534:P475R	P	+	2	0	GPR112	135255144	0.001000	0.12720	0.001000	0.08648	0.053000	0.15095	0.075000	0.14686	0.567000	0.29293	0.411000	0.27672	CCC		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577102	7577102	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:7577102C>T	ENST00000269305.4	-	8	1025	c.836G>A	c.(835-837)gGg>gAg	p.G279E	TP53_ENST00000455263.2_Missense_Mutation_p.G279E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G279E|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.G279E|TP53_ENST00000420246.2_Missense_Mutation_p.G279E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	279	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G279E(32)|p.0?(8)|p.G279V(4)|p.?(2)|p.G279fs*65(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.G279fs*26(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTCTCTCCCAGGACAGGC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(36)|Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	upper_aerodigestive_tract(16)|urinary_tract(8)|oesophagus(7)|breast(5)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|skin(4)|large_intestine(3)|central_nervous_system(3)|ovary(2)|stomach(1)|lung(1)|liver(1)	17											75.0	65.0	68.0					17																	7577102		2203	4300	6503	7517827	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.836G>A	17.37:g.7577102C>T	ENSP00000269305:p.Gly279Glu	Unknown		Capture	Illumina GAIIx	Phase_I	7517827	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753775	0.89753	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99898	-7.61;-7.61;-7.61;-7.61;-7.61;-7.61	5.13	4.16	0.48862	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.991;0.999;1.0	D	0.96457	0.9338	10	0.87932	D	0	-22.6503	11.5187	0.50539	0.0:0.9131:0.0:0.0869	.	279;279;279;279	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	279;279;279;279;279;268;147	ENSP00000352610:G279E;ENSP00000269305:G279E;ENSP00000398846:G279E;ENSP00000391127:G279E;ENSP00000391478:G279E;ENSP00000425104:G147E	ENSP00000269305:G279E	G	-	2	0	TP53	7517827	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.862000	0.69560	1.390000	0.46547	0.462000	0.41574	GGG		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
KRT77	374454	broad.mit.edu	37	12	53086340	53086347	+	Frame_Shift_Del	DEL	AGGTCCTG	AGGTCCTG	-	rs150981240|rs111826357|rs200694410	byFrequency	TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr12:53086340_53086347delAGGTCCTG	ENST00000341809.3	-	7	1313_1320	c.1285_1292delCAGGACCT	c.(1285-1293)caggacctgfs	p.QDL429fs	KRT77_ENST00000537195.1_Frame_Shift_Del_p.QDL196fs|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	429	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.Q429fs*17(1)		NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GGCCTCCTCCAGGTCCTGCAGCTTCTGC	0.615																																																1	Deletion - Frameshift(1)	ovary(1)	12								18,4246		1,16,2115						3.4	0.1			42	205,8037		25,155,3941	no	frameshift	KRT77	NM_175078.2		26,171,6056	A1A1,A1R,RR		2.4873,0.4221,1.7831				223,12283				51372614	SO:0001589	frameshift_variant	374454			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1285_1292delCAGGACCT	12.37:g.53086340_53086347delAGGTCCTG	ENSP00000342710:p.Gln429fs	Unknown		Capture	Illumina GAIIx	Phase_I	51372607	Q7RTS8	Frame_Shift_Del	DEL	ENST00000341809.3	37	CCDS8837.1	DEL	7	Broad																																																																																				0.615	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078		Frame_Shift_Del
HNF1B	6928	broad.mit.edu	37	17	36070539	36070549	+	Frame_Shift_Del	DEL	TGGCCTGGGTC	TGGCCTGGGTC	-			TCGA-13-0904-01	TCGA-13-0904-10			-	-	TGGCCTGGGTC	TGGCCTGGGTC	Unknown	Valid	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr17:36070539_36070549delTGGCCTGGGTC	ENST00000225893.4	-	5	1529_1539	c.1168_1178delGACCCAGGCCA	c.(1168-1179)gacccaggccacfs	p.DPGH390fs	HNF1B_ENST00000561193.1_Frame_Shift_Del_p.DPGH364fs|HNF1B_ENST00000560016.1_Frame_Shift_Del_p.DPGH390fs|HNF1B_ENST00000427275.2_Frame_Shift_Del_p.DPGH364fs	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	390					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.D390fs*6(1)|p.S388fs*4(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			GAGGAGATTGTGGCCTGGGTCCAGGCTGGCT	0.502																																					Colon(71;102 1179 9001 27917 43397)											2	Deletion - Frameshift(2)	ovary(1)|liver(1)	17																																								33144662	SO:0001589	frameshift_variant	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.1168_1178delGACCCAGGCCA	17.37:g.36070539_36070549delTGGCCTGGGTC	ENSP00000225893:p.Asp390fs	Somatic		Capture	Illumina GAIIx	Phase_I	33144652	B4DKM3|E0YMJ9	Frame_Shift_Del	DEL	ENST00000225893.4	37	CCDS11324.1	DEL	59	Broad																																																																																				0.502	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256807.3	NM_000458		Frame_Shift_Del
PPP5C	5536	broad.mit.edu	37	19	46850392	46850393	+	Frame_Shift_Ins	INS	-	-	C	rs376984861		TCGA-13-0904-01	TCGA-13-0904-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0904-01	TCGA-13-0904-10	g.chr19:46850392_46850393insC	ENST00000012443.4	+	1	142_143	c.39_40insC	c.(40-42)cccfs	p.P14fs	PPP5C_ENST00000391919.1_5'UTR	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	14					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)	p.R16fs*7(1)		endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		AGTGTGCTGAGCCCCCCCGGGA	0.683											OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Insertion - Frameshift(1)	ovary(1)	19							,	13,4233		0,13,2110					,	0.6	1.0			24	15,8231		1,13,4109	no	frameshift,frameshift	PPP5C	NM_006247.3,NM_001204284.1	,	1,26,6219	A1A1,A1R,RR		0.1819,0.3062,0.2241	,	,		28,12464				51542233	SO:0001589	frameshift_variant	5536				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.46dupC	19.37:g.46850399_46850399dupC	ENSP00000012443:p.Pro14fs	Unknown	942	Capture	Illumina GAIIx	Phase_I	51542232	Q16722|Q53XV2	Frame_Shift_Ins	INS	ENST00000012443.4	37	CCDS12684.1	INS	34	Broad																																																																																				0.683	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247		Frame_Shift_Ins
