#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CA6	765	broad.mit.edu	37	1	9017331	9017331	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0916-01	TCGA-13-0916-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:9017331G>C	ENST00000377443.2	+	3	399	c.395G>C	c.(394-396)aGa>aCa	p.R132T	CA6_ENST00000476083.1_Intron|CA6_ENST00000377436.3_Missense_Mutation_p.R132T|CA6_ENST00000377442.2_Missense_Mutation_p.R72T	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	132					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.R132T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	GACGGGATCAGACATGTGATC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	70.0	73.0					1																	9017331		2203	4300	6503	8939918	SO:0001583	missense	765			M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.395G>C	1.37:g.9017331G>C	ENSP00000366662:p.Arg132Thr	Somatic		x	x	x	8939918	E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Missense_Mutation	SNP	ENST00000377443.2	37	CCDS30578.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890681	0.72524	.	.	ENSG00000131686	ENST00000549778;ENST00000377443;ENST00000377436;ENST00000377442	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	4.95	4.95	0.65309	Carbonic anhydrase, alpha-class, conserved site (1);Carbonic anhydrase, alpha-class, catalytic domain (4);	0.048119	0.85682	D	0.000000	T	0.81293	0.4792	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.82849	-0.0254	10	0.62326	D	0.03	.	14.4235	0.67200	0.0:0.0:1.0:0.0	.	72;132	E7EMQ1;P23280	.;CAH6_HUMAN	T	100;132;132;72	ENSP00000447108:R100T;ENSP00000366662:R132T;ENSP00000366654:R132T;ENSP00000366661:R72T	ENSP00000366654:R132T	R	+	2	0	CA6	8939918	0.982000	0.34865	0.014000	0.15608	0.110000	0.19582	7.751000	0.85126	2.660000	0.90430	0.650000	0.86243	AGA		0.512	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000004911.1			Missense_Mutation
IGSF21	84966	broad.mit.edu	37	1	18692118	18692118	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:18692118C>A	ENST00000251296.1	+	6	1325	c.942C>A	c.(940-942)gaC>gaA	p.D314E		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	314						extracellular region (GO:0005576)		p.D314E(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CACAGATCGACAACGAGGCCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											107.0	86.0	93.0					1																	18692118		2203	4300	6503	18564705	SO:0001583	missense	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.942C>A	1.37:g.18692118C>A	ENSP00000251296:p.Asp314Glu	Unknown		x	x	x	18564705	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	SNP	17	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.23|16.23	3.065327|3.065327	0.55432|0.55432	.|.	.|.	ENSG00000117154|ENSG00000117154	ENST00000251296|ENST00000412684	T|.	0.25579|.	1.79|.	4.1|4.1	4.1|4.1	0.47936|0.47936	Immunoglobulin-like fold (1);|.	0.156356|.	0.64402|.	D|.	0.000020|.	T|T	0.54727|0.54727	0.1876|0.1876	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	B|.	0.24618|.	0.107|.	B|.	0.15870|.	0.014|.	T|T	0.51466|0.51466	-0.8702|-0.8702	10|5	0.16420|.	T|.	0.52|.	-7.1739|-7.1739	15.3842|15.3842	0.74684|0.74684	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	314|.	Q96ID5|.	IGS21_HUMAN|.	E|K	314|267	ENSP00000251296:D314E|.	ENSP00000251296:D314E|.	D|Q	+|+	3|1	2|0	IGSF21|IGSF21	18564705|18564705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.200000|4.200000	0.58433|0.58433	2.280000|2.280000	0.76307|0.76307	0.561000|0.561000	0.74099|0.74099	GAC|CAA		0.632	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880		Missense_Mutation
COL16A1	1307	broad.mit.edu	37	1	32163561	32163561	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:32163561C>A	ENST00000373672.3	-	6	1119	c.603G>T	c.(601-603)agG>agT	p.R201S	COL16A1_ENST00000271069.6_Missense_Mutation_p.R201S|COL16A1_ENST00000373668.3_Missense_Mutation_p.R201S	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	201	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)	p.R201S(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGCCCACAGGCCTCATGGGTC	0.622																																					Colon(143;498 1786 21362 25193 36625)											1	Substitution - Missense(1)	ovary(1)	1											36.0	41.0	39.0					1																	32163561		2016	4183	6199	31936148	SO:0001583	missense	1307			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.603G>T	1.37:g.32163561C>A	ENSP00000362776:p.Arg201Ser	Unknown		x	x	x	31936148	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	6.222	0.409080	0.11812	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	T;T;T	0.72051	-0.62;-0.62;-0.62	5.14	3.15	0.36227	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.941157	0.08913	N	0.875589	T	0.43964	0.1271	N	0.03608	-0.345	0.09310	N	1	P;B;B	0.41188	0.741;0.002;0.003	B;B;B	0.36289	0.221;0.004;0.009	T	0.30327	-0.9982	10	0.54805	T	0.06	.	5.1068	0.14789	0.1268:0.566:0.2236:0.0836	.	201;201;201	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	S	201	ENSP00000362776:R201S;ENSP00000271069:R201S;ENSP00000362772:R201S	ENSP00000271069:R201S	R	-	3	2	COL16A1	31936148	0.000000	0.05858	0.054000	0.19295	0.096000	0.18686	-0.097000	0.11042	1.310000	0.45006	0.561000	0.74099	AGG		0.622	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856		Missense_Mutation
FOXJ3	22887	broad.mit.edu	37	1	42693625	42693625	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:42693625C>A	ENST00000372572.1	-	7	768	c.457G>T	c.(457-459)Gca>Tca	p.A153S	FOXJ3_ENST00000372573.1_Missense_Mutation_p.A153S|FOXJ3_ENST00000361346.1_Missense_Mutation_p.A153S|FOXJ3_ENST00000361776.1_Missense_Mutation_p.A153S|FOXJ3_ENST00000545068.1_Missense_Mutation_p.A153S	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	153					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A153S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTGTCTATTGCCCAGTAGGAC	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											84.0	76.0	78.0					1																	42693625		2203	4300	6503	42466212	SO:0001583	missense	22887			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.457G>T	1.37:g.42693625C>A	ENSP00000361653:p.Ala153Ser	Unknown		x	x	x	42466212	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	ENST00000372572.1	37	CCDS30689.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138290	0.56936	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	D;D;D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75;-3.75;-3.75	5.68	4.78	0.61160	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.058247	0.64402	D	0.000004	D	0.92270	0.7548	L	0.33245	0.995	0.80722	D	1	P;P	0.46142	0.737;0.873	B;B	0.43658	0.234;0.426	D	0.91262	0.5037	10	0.41790	T	0.15	.	12.4168	0.55498	0.0:0.9185:0.0:0.0815	.	153;153	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	S	153	ENSP00000361654:A153S;ENSP00000361653:A153S;ENSP00000354620:A153S;ENSP00000354449:A153S;ENSP00000439044:A153S;ENSP00000393408:A153S	ENSP00000354620:A153S	A	-	1	0	FOXJ3	42466212	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.184000	0.72008	1.399000	0.46721	-0.136000	0.14681	GCA		0.378	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947		Missense_Mutation
C8A	731	broad.mit.edu	37	1	57340626	57340626	+	Missense_Mutation	SNP	G	G	A	rs369702409	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:57340626G>A	ENST00000361249.3	+	3	272	c.176G>A	c.(175-177)cGa>cAa	p.R59Q		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	59	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.R59Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						GTTTAGTACCGACACCGGAGC	0.458													G|||	12	0.00239617	0.0	0.0	5008	,	,		20285	0.0		0.0	False		,,,				2504	0.0123															1	Substitution - Missense(1)	ovary(1)	1											66.0	65.0	65.0					1																	57340626		2203	4300	6503	57113214	SO:0001583	missense	731			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.176G>A	1.37:g.57340626G>A	ENSP00000354458:p.Arg59Gln	Unknown		x	x	x	57113214	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012882	0.93346	.	.	ENSG00000157131	ENST00000361249	T	0.48522	0.81	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.79799	0.4508	H	0.96691	3.865	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	D	0.86171	0.1600	10	0.87932	D	0	-12.767	17.5773	0.87953	0.0:0.0:1.0:0.0	.	59	P07357	CO8A_HUMAN	Q	59	ENSP00000354458:R59Q	ENSP00000354458:R59Q	R	+	2	0	C8A	57113214	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.906000	0.56340	2.820000	0.97059	0.650000	0.86243	CGA		0.458	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562		Missense_Mutation
MAGI3	260425	broad.mit.edu	37	1	114201761	114201761	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:114201761C>G	ENST00000307546.9	+	16	2764	c.2689C>G	c.(2689-2691)Ctg>Gtg	p.L897V	MAGI3_ENST00000369615.1_Missense_Mutation_p.L897V|MAGI3_ENST00000369617.4_Missense_Mutation_p.L922V|MAGI3_ENST00000369611.4_Missense_Mutation_p.L897V	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	922	Interaction with LPAR2 and GRIN2B.|PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)	p.L897V(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGTGGAAAACTGAAAGTTGG	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	139.0	141.0					1																	114201761		2203	4300	6503	114003284	SO:0001583	missense	260425			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2689C>G	1.37:g.114201761C>G	ENSP00000304604:p.Leu897Val	Somatic		x	x	x	114003284	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	37	CCDS44196.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694091	0.68386	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	6.17	4.31	0.51392	.	0.000000	0.64402	D	0.000001	T	0.51312	0.1667	L	0.52823	1.66	0.58432	D	0.999999	P;B;D	0.55800	0.76;0.341;0.973	P;B;D	0.65987	0.704;0.441;0.94	T	0.57653	-0.7774	10	0.87932	D	0	-16.2086	12.9426	0.58354	0.0:0.8699:0.0:0.1301	.	897;897;922	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	V	922;897;897;897	ENSP00000358630:L922V;ENSP00000304604:L897V;ENSP00000358628:L897V;ENSP00000358624:L897V	ENSP00000304604:L897V	L	+	1	2	MAGI3	114003284	0.987000	0.35691	0.791000	0.31998	0.982000	0.71751	1.417000	0.34770	0.940000	0.37473	0.655000	0.94253	CTG		0.413	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900		Missense_Mutation
TDRKH	11022	broad.mit.edu	37	1	151755434	151755434	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:151755434C>A	ENST00000368822.1	-	2	698	c.65G>T	c.(64-66)gGg>gTg	p.G22V	TDRKH_ENST00000368827.6_Missense_Mutation_p.G22V|TDRKH_ENST00000458431.2_Missense_Mutation_p.G22V|TDRKH_ENST00000368824.3_Missense_Mutation_p.G22V|TDRKH_ENST00000440583.2_5'UTR|TDRKH_ENST00000368823.1_Missense_Mutation_p.G22V|TDRKH_ENST00000368825.3_Missense_Mutation_p.G22V|TDRKH_ENST00000484421.1_5'UTR			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	22					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)	p.G22V(1)		breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GGCTGGGATCCCAAGGCCCAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											108.0	111.0	110.0					1																	151755434		1859	4091	5950	150022058	SO:0001583	missense	11022			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.65G>T	1.37:g.151755434C>A	ENSP00000357812:p.Gly22Val	Unknown		x	x	x	150022058	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	ENST00000368822.1	37	CCDS41394.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	19.91	3.915045	0.72983	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000526378	T;T;T;T;T;T;T	0.58652	1.49;1.0;1.49;1.51;1.49;1.49;0.32	5.36	4.43	0.53597	.	0.171432	0.51477	D	0.000086	T	0.46034	0.1372	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.999	P;D;D	0.91635	0.861;0.999;0.96	T	0.56902	-0.7902	10	0.87932	D	0	-18.5438	10.2625	0.43436	0.0:0.9084:0.0:0.0916	.	22;22;22	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	V	22	ENSP00000357819:G22V;ENSP00000357817:G22V;ENSP00000357815:G22V;ENSP00000357813:G22V;ENSP00000357812:G22V;ENSP00000395718:G22V;ENSP00000431557:G22V	ENSP00000357812:G22V	G	-	2	0	TDRKH	150022058	1.000000	0.71417	0.911000	0.35937	0.771000	0.43674	3.464000	0.53057	2.814000	0.96858	0.650000	0.86243	GGG		0.463	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000036648.2	NM_006862		Missense_Mutation
POGK	57645	broad.mit.edu	37	1	166819349	166819349	+	Nonsense_Mutation	SNP	C	C	A	rs150936983		TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:166819349C>A	ENST00000367875.1	+	5	1893	c.1533C>A	c.(1531-1533)taC>taA	p.Y511*	POGK_ENST00000537173.1_Nonsense_Mutation_p.Y393*|POGK_ENST00000367876.4_Nonsense_Mutation_p.Y511*|POGK_ENST00000536514.1_Nonsense_Mutation_p.Y426*			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	511	DDE.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Y511*(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						tcgtggtctacaagccactga	0.567																																					GBM(76;192 1530 30153 48742)											1	Substitution - Nonsense(1)	ovary(1)	1											37.0	31.0	33.0					1																	166819349		2202	4300	6502	165085973	SO:0001587	stop_gained	57645			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.1533C>A	1.37:g.166819349C>A	ENSP00000356849:p.Tyr511*	Unknown		x	x	x	165085973	Q5TIJ1|Q8TE07	Nonsense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.545293	0.96488	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	.	.	.	5.49	2.35	0.29111	.	0.000000	0.42548	D	0.000695	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.7929	3.0423	0.06142	0.1997:0.5315:0.0:0.2688	.	.	.	.	X	393;426;511;511	.	.	Y	+	3	2	POGK	165085973	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	0.681000	0.25320	0.834000	0.34852	-0.145000	0.13849	TAC		0.567	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542		Nonsense_Mutation
TNN	63923	broad.mit.edu	37	1	175097258	175097258	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:175097258G>A	ENST00000239462.4	+	14	3249	c.3136G>A	c.(3136-3138)Ggt>Agt	p.G1046S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1046	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)		p.G1046S(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TGCCTTTAAGGGTGGTCGCCG	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	80.0	85.0					1																	175097258		2203	4300	6503	173363881	SO:0001583	missense	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3136G>A	1.37:g.175097258G>A	ENSP00000239462:p.Gly1046Ser	Somatic		x	x	x	173363881	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562852	0.86335	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.60548	0.18	5.78	5.78	0.91487	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80099	0.4561	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81265	-0.1011	10	0.56958	D	0.05	.	19.6093	0.95599	0.0:0.0:1.0:0.0	.	1046	Q9UQP3	TENN_HUMAN	S	1046;869	ENSP00000239462:G1046S	ENSP00000239462:G1046S	G	+	1	0	TNN	173363881	1.000000	0.71417	0.994000	0.49952	0.367000	0.29736	7.371000	0.79600	2.740000	0.93945	0.313000	0.20887	GGT		0.552	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		Missense_Mutation
CRB1	23418	broad.mit.edu	37	1	197390742	197390742	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:197390742C>G	ENST00000367400.3	+	6	1919	c.1784C>G	c.(1783-1785)gCt>gGt	p.A595G	CRB1_ENST00000367399.2_Missense_Mutation_p.A483G|CRB1_ENST00000544212.1_Missense_Mutation_p.A76G|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.A526G|CRB1_ENST00000543483.1_Intron|CRB1_ENST00000538660.1_Missense_Mutation_p.A595G	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	595	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A595G(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATCGCGAAAGCTCCTACTCCA	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	113.0	115.0					1																	197390742		2203	4300	6503	195657365	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1784C>G	1.37:g.197390742C>G	ENSP00000356370:p.Ala595Gly	Unknown		x	x	x	195657365	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	9.834	1.189268	0.21954	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367401	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	5.39	2.51	0.30379	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.77130	0.4085	L	0.56769	1.78	0.09310	N	1	D;P;P;B;P	0.54964	0.969;0.644;0.887;0.386;0.846	P;B;B;B;B	0.52481	0.7;0.307;0.335;0.178;0.41	T	0.65014	-0.6271	9	0.02654	T	1	.	5.8379	0.18617	0.0:0.634:0.1383:0.2277	.	595;526;483;244;595	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	G	526;595;595;483;76;244	ENSP00000438786:A526G;ENSP00000438091:A595G;ENSP00000356370:A595G;ENSP00000356369:A483G;ENSP00000444556:A76G	ENSP00000356369:A483G	A	+	2	0	CRB1	195657365	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.552000	0.23376	0.268000	0.21939	0.557000	0.71058	GCT		0.463	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		Missense_Mutation
PROX1	5629	broad.mit.edu	37	1	214170701	214170701	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:214170701T>A	ENST00000366958.4	+	2	1431	c.823T>A	c.(823-825)Tct>Act	p.S275T	PROX1_ENST00000261454.4_Missense_Mutation_p.S275T|PROX1_ENST00000498508.2_Missense_Mutation_p.S275T|PROX1_ENST00000435016.1_Missense_Mutation_p.S275T	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	275					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.S275T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TGGTAACCTGTCTGAAGACAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	64.0	64.0					1																	214170701		2203	4300	6503	212237324	SO:0001583	missense	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.823T>A	1.37:g.214170701T>A	ENSP00000355925:p.Ser275Thr	Somatic		x	x	x	212237324	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	15.18	2.757098	0.49468	.	.	ENSG00000117707	ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.51574	0.72;0.7;0.72;0.72	5.93	5.93	0.95920	.	0.058374	0.85682	D	0.000000	T	0.59004	0.2162	L	0.33485	1.01	0.58432	D	0.999999	D	0.63046	0.992	D	0.76071	0.987	T	0.57985	-0.7716	10	0.42905	T	0.14	-3.6659	16.3766	0.83401	0.0:0.0:0.0:1.0	.	275	Q92786	PROX1_HUMAN	T	275	ENSP00000420283:S275T;ENSP00000355925:S275T;ENSP00000400694:S275T;ENSP00000261454:S275T	ENSP00000261454:S275T	S	+	1	0	PROX1	212237324	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.841000	0.86834	2.263000	0.75096	0.533000	0.62120	TCT		0.512	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763		Missense_Mutation
OR2T6	254879	broad.mit.edu	37	1	248551173	248551173	+	Silent	SNP	C	C	T	rs151042656	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr1:248551173C>T	ENST00000355728.2	+	1	264	c.264C>T	c.(262-264)ggC>ggT	p.G88G		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G88G(2)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCTCATGGGCGAGGGGACCA	0.527													c|||	3	0.000599042	0.0023	0.0	5008	,	,		18684	0.0		0.0	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|lung(1)	1						C		11,4395	17.9+/-39.9	0,11,2192	153.0	134.0	140.0		264	-2.5	0.0	1	dbSNP_134	140	0,8600		0,0,4300	no	coding-synonymous	OR2T6	NM_001005471.1		0,11,6492	TT,TC,CC		0.0,0.2497,0.0846		88/309	248551173	11,12995	2203	4300	6503	246617796	SO:0001819	synonymous_variant	254879			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.264C>T	1.37:g.248551173C>T		Unknown		x	x	x	246617796	A6NE36	Silent	SNP	ENST00000355728.2	37	CCDS31114.1	SNP	27	Broad																																																																																				0.527	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471		Silent
FRMD4A	55691	broad.mit.edu	37	10	13803657	13803657	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr10:13803657C>A	ENST00000357447.2	-	8	822	c.454G>T	c.(454-456)Gat>Tat	p.D152Y	FRMD4A_ENST00000342409.2_Missense_Mutation_p.D168Y|FRMD4A_ENST00000378503.1_Missense_Mutation_p.D152Y|FRMD4A_ENST00000358621.4_Missense_Mutation_p.D137Y	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	152	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.D152Y(2)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						CTAGAAAAATCTCCCTTTGCC	0.333																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	10											105.0	108.0	107.0					10																	13803657		2203	4300	6503	13843663	SO:0001583	missense	55691			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.454G>T	10.37:g.13803657C>A	ENSP00000350032:p.Asp152Tyr	Unknown		x	x	x	13843663	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618733	0.66787	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	4.98	4.98	0.66077	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	T	0.69735	0.3144	M	0.90595	3.13	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.79108	0.985;0.971;0.992	T	0.76745	-0.2846	10	0.87932	D	0	-15.1188	14.1261	0.65222	0.0:1.0:0.0:0.0	.	168;185;152	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	Y	137;152;152;185;168	ENSP00000351438:D137Y;ENSP00000350032:D152Y;ENSP00000367764:D152Y;ENSP00000264546:D185Y;ENSP00000344237:D168Y	ENSP00000264546:D185Y	D	-	1	0	FRMD4A	13843663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.333000	0.59285	2.438000	0.82558	0.655000	0.94253	GAT		0.333	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027		Missense_Mutation
HTR7	3363	broad.mit.edu	37	10	92509273	92509273	+	Silent	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr10:92509273G>A	ENST00000336152.3	-	2	644	c.618C>T	c.(616-618)gtC>gtT	p.V206V	HTR7_ENST00000371721.3_Silent_p.V206V|HTR7_ENST00000371719.2_Silent_p.V206V|HTR7_ENST00000277874.6_Silent_p.V206V	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	206					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.V206V(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	AGAGAAGCCAGACGGAGAGAA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	10											125.0	128.0	127.0					10																	92509273		2203	4300	6503	92499253	SO:0001819	synonymous_variant	3363			BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.618C>T	10.37:g.92509273G>A		Unknown		x	x	x	92499253	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Silent	SNP	ENST00000336152.3	37	CCDS7408.1	SNP	33	Broad																																																																																				0.493	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872		Silent
NOLC1	9221	broad.mit.edu	37	10	103919250	103919250	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr10:103919250C>T	ENST00000605788.1	+	7	1019	c.784C>T	c.(784-786)Cgg>Tgg	p.R262W	NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Missense_Mutation_p.R272W|NOLC1_ENST00000488254.2_Missense_Mutation_p.R263W	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	262	11 X 12 AA approximate repeats of an acidic serine cluster.|Interacts with RPA194.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)	p.R262R(1)|p.R262W(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CACCCCTACCCGGAAGAGTTC	0.473																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|kidney(1)	10											109.0	119.0	116.0					10																	103919250		2203	4300	6503	103909240	SO:0001583	missense	9221			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.784C>T	10.37:g.103919250C>T	ENSP00000474710:p.Arg262Trp	Unknown		x	x	x	103909240	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	37	CCDS7530.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020326	0.35606	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.31769	1.48	5.97	5.97	0.96955	.	0.279043	0.31566	N	0.007426	T	0.17492	0.0420	N	0.14661	0.345	0.09310	N	1	D;D;D	0.57257	0.979;0.979;0.964	B;B;B	0.39152	0.292;0.292;0.153	T	0.24190	-1.0167	10	0.87932	D	0	-6.1694	10.4528	0.44533	0.1352:0.6191:0.2457:0.0	.	263;272;262	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	W	272;262	ENSP00000385410:R272W	ENSP00000359024:R262W	R	+	1	2	NOLC1	103909240	0.002000	0.14202	0.354000	0.25760	0.283000	0.27025	1.233000	0.32648	2.836000	0.97738	0.655000	0.94253	CGG		0.473	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741		Missense_Mutation
SOX6	55553	broad.mit.edu	37	11	15994567	15994567	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr11:15994567T>C	ENST00000352083.6	-	16	2352	c.2275A>G	c.(2275-2277)Aca>Gca	p.T759A	SOX6_ENST00000528429.1_Missense_Mutation_p.T759A|SOX6_ENST00000396356.3_Missense_Mutation_p.T739A|SOX6_ENST00000528252.1_Missense_Mutation_p.T732A|SOX6_ENST00000316399.6_Missense_Mutation_p.T739A|SOX6_ENST00000527619.1_Missense_Mutation_p.T735A			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	759					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.T739A(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						CAGTCAGATGTCATCTGAGGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											121.0	117.0	119.0					11																	15994567		2200	4294	6494	15951143	SO:0001583	missense	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.2275A>G	11.37:g.15994567T>C	ENSP00000339876:p.Thr759Ala	Unknown		x	x	x	15951143	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	10.32	1.317540	0.23908	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02	5.85	3.5	0.40072	.	0.087270	0.85682	N	0.000000	T	0.31358	0.0794	L	0.45581	1.43	0.58432	D	0.999998	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.15484	0.013;0.002;0.002	T	0.07578	-1.0765	10	0.12103	T	0.63	.	8.8766	0.35350	0.0:0.0656:0.1276:0.8068	.	739;759;735	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	A	739;759;739;732;735;759	ENSP00000324948:T739A;ENSP00000339876:T759A;ENSP00000379644:T739A;ENSP00000432134:T732A;ENSP00000434455:T735A;ENSP00000433233:T759A	ENSP00000324948:T739A	T	-	1	0	SOX6	15951143	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.876000	0.63079	0.461000	0.27071	0.533000	0.62120	ACA		0.532	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326		Missense_Mutation
CAPN1	823	broad.mit.edu	37	11	64950667	64950667	+	Splice_Site	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr11:64950667G>A	ENST00000527323.1	+	2	576	c.336G>A	c.(334-336)ctG>ctA	p.L112L	CAPN1_ENST00000527469.1_3'UTR|CAPN1_ENST00000533129.1_Splice_Site_p.L112L|AP003068.23_ENST00000526623.1_5'Flank|CAPN1_ENST00000533820.1_Splice_Site_p.L112L|CAPN1_ENST00000524773.1_Splice_Site_p.L112L|CAPN1_ENST00000279247.6_Splice_Site_p.L112L			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	112	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.L112L(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		AGGGAGCACTGGGTAGGCCCC	0.612																																																1	Substitution - coding silent(1)	ovary(1)	11											121.0	134.0	130.0					11																	64950667		1950	4179	6129	64707243	SO:0001630	splice_region_variant	823			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.337+1G>A	11.37:g.64950667G>A		Unknown		x	x	x	64707243	Q2TTR0|Q6DHV4	Silent	SNP	ENST00000527323.1	37	CCDS44644.1	SNP	47	Broad																																																																																				0.612	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		Silent	Silent
TENM4	26011	broad.mit.edu	37	11	78383367	78383367	+	Missense_Mutation	SNP	T	T	A	rs368814082		TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr11:78383367T>A	ENST00000278550.7	-	31	5966	c.5504A>T	c.(5503-5505)aAc>aTc	p.N1835I		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1835					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.N1835I(1)									GAGATTTCGGTTGTGAACCTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	11											78.0	76.0	77.0					11																	78383367		1911	4133	6044	78061015	SO:0001583	missense	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5504A>T	11.37:g.78383367T>A	ENSP00000278550:p.Asn1835Ile	Unknown		x	x	x	78061015	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181893	0.78677	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.90324	-2.65;0.81	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	L	0.42245	1.32	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	D	0.92240	0.5800	9	.	.	.	.	16.0399	0.80667	0.0:0.0:0.0:1.0	.	1835	Q6N022	TEN4_HUMAN	I	1835;299	ENSP00000278550:N1835I;ENSP00000431711:N299I	.	N	-	2	0	ODZ4	78061015	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.015000	0.64035	2.371000	0.80710	0.533000	0.62120	AAC		0.498	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2			Missense_Mutation
GUCY1A2	2977	broad.mit.edu	37	11	106647285	106647285	+	Silent	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr11:106647285G>A	ENST00000526355.2	-	6	2184	c.1716C>T	c.(1714-1716)taC>taT	p.Y572Y	GUCY1A2_ENST00000347596.2_Silent_p.Y593Y|GUCY1A2_ENST00000282249.2_Silent_p.Y572Y	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	572	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)	p.Y572Y(1)		breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTGCAACACAGTAGGCATCAC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	11											109.0	105.0	106.0					11																	106647285		2201	4298	6499	106152495	SO:0001819	synonymous_variant	2977			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1716C>T	11.37:g.106647285G>A		Somatic		x	x	x	106152495	A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	37	CCDS8335.1	SNP	36	Broad																																																																																				0.443	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			Silent
CD163	9332	broad.mit.edu	37	12	7637853	7637853	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:7637853C>T	ENST00000359156.4	-	11	2820	c.2618G>A	c.(2617-2619)gGg>gAg	p.G873E	CD163_ENST00000396620.3_Missense_Mutation_p.G906E|CD163_ENST00000432237.2_Missense_Mutation_p.G873E|CD163_ENST00000539632.1_5'UTR|CD163_ENST00000541972.1_Missense_Mutation_p.G861E	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	873	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.G873E(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GTTGATTTTCCCTTTGTCTGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	12											134.0	122.0	126.0					12																	7637853		2203	4300	6503	7529120	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2618G>A	12.37:g.7637853C>T	ENSP00000352071:p.Gly873Glu	Somatic		x	x	x	7529120	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598036	0.66332	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.54	5.54	0.83059	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.64402	D	0.000015	T	0.53932	0.1827	M	0.66439	2.03	0.43203	D	0.995059	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.99;1.0	T	0.50783	-0.8787	10	0.51188	T	0.08	.	15.3446	0.74327	0.0:1.0:0.0:0.0	.	906;873;873	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	E	873;861;906;873	ENSP00000352071:G873E;ENSP00000444071:G861E;ENSP00000379863:G906E;ENSP00000403885:G873E	ENSP00000352071:G873E	G	-	2	0	CD163	7529120	0.010000	0.17322	0.187000	0.23214	0.005000	0.04900	1.862000	0.39448	2.776000	0.95493	0.650000	0.86243	GGG		0.517	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		Missense_Mutation
PDZRN4	29951	broad.mit.edu	37	12	41946499	41946499	+	Silent	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:41946499C>A	ENST00000402685.2	+	6	1253	c.1245C>A	c.(1243-1245)ggC>ggA	p.G415G	PDZRN4_ENST00000298919.7_Silent_p.G155G|PDZRN4_ENST00000539469.2_Silent_p.G157G	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	415	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G157G(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGAAGCTGGGCCTGACAGTCT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	12											161.0	143.0	149.0					12																	41946499		2203	4300	6503	40232766	SO:0001819	synonymous_variant	29951			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1245C>A	12.37:g.41946499C>A		Somatic		x	x	x	40232766	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	ENST00000402685.2	37	CCDS53777.1	SNP	26	Broad																																																																																				0.473	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377		Silent
GALNT6	11226	broad.mit.edu	37	12	51773357	51773357	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0916-01	TCGA-13-0916-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:51773357T>C	ENST00000543196.2	-	2	414	c.209A>G	c.(208-210)aAg>aGg	p.K70R	GALNT6_ENST00000603203.1_5'Flank|GALNT6_ENST00000356317.3_Missense_Mutation_p.K70R			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	70					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K70R(1)		endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GATTTGGAGCTTGGGCATTGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											88.0	91.0	90.0					12																	51773357		2203	4300	6503	50059624	SO:0001583	missense	11226			Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.209A>G	12.37:g.51773357T>C	ENSP00000444171:p.Lys70Arg	Somatic		x	x	x	50059624	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	18.50	3.638306	0.67130	.	.	ENSG00000139629	ENST00000543196;ENST00000356317;ENST00000546163	T;T	0.29397	1.57;1.57	4.52	2.18	0.27775	.	0.491885	0.23552	N	0.046947	T	0.35393	0.0930	M	0.62723	1.935	0.30922	N	0.72794	P	0.49696	0.927	P	0.49361	0.608	T	0.34477	-0.9827	10	0.36615	T	0.2	.	8.7489	0.34602	0.0:0.1625:0.0:0.8375	.	70	Q8NCL4	GALT6_HUMAN	R	70;70;51	ENSP00000444171:K70R;ENSP00000348668:K70R	ENSP00000348668:K70R	K	-	2	0	GALNT6	50059624	0.638000	0.27225	1.000000	0.80357	0.990000	0.78478	2.081000	0.41596	0.492000	0.27815	-0.250000	0.11733	AAG		0.562	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210		Missense_Mutation
KRT72	140807	broad.mit.edu	37	12	52984693	52984693	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:52984693G>T	ENST00000537672.2	-	6	1026	c.1016C>A	c.(1015-1017)aCc>aAc	p.T339N	KRT72_ENST00000354310.4_Intron|KRT72_ENST00000398066.3_Missense_Mutation_p.T151N|KRT72_ENST00000293745.2_Missense_Mutation_p.T339N	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	339	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.T339N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		TTCAGCCTTGGTGAGCTTGAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	98.0	101.0					12																	52984693		2203	4300	6503	51270960	SO:0001583	missense	140807			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1016C>A	12.37:g.52984693G>T	ENSP00000441160:p.Thr339Asn	Unknown		x	x	x	51270960	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817332	0.50633	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000398066	T;T;T	0.77750	-1.12;-1.12;-1.12	5.14	5.14	0.70334	Filament (1);	0.124234	0.35838	N	0.002950	D	0.90854	0.7127	M	0.91140	3.18	0.36744	D	0.882374	D	0.76494	0.999	D	0.77004	0.989	D	0.93842	0.7137	10	0.87932	D	0	.	19.5038	0.95106	0.0:0.0:1.0:0.0	.	339	Q14CN4	K2C72_HUMAN	N	339;339;151	ENSP00000441160:T339N;ENSP00000293745:T339N;ENSP00000446151:T151N	ENSP00000293745:T339N	T	-	2	0	KRT72	51270960	0.961000	0.32948	1.000000	0.80357	0.086000	0.17979	1.198000	0.32223	2.791000	0.96007	0.655000	0.94253	ACC		0.507	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747		Missense_Mutation
C12orf50	160419	broad.mit.edu	37	12	88391944	88391944	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:88391944G>A	ENST00000298699.2	-	4	337	c.157C>T	c.(157-159)Cag>Tag	p.Q53*	C12orf50_ENST00000550553.1_Nonsense_Mutation_p.Q53*	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	53								p.Q53*(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						ATTCCTTCCTGAATTTCTTTC	0.368																																																1	Substitution - Nonsense(1)	ovary(1)	12											114.0	109.0	110.0					12																	88391944		2203	4300	6503	86916075	SO:0001587	stop_gained	160419			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.157C>T	12.37:g.88391944G>A	ENSP00000298699:p.Gln53*	Unknown		x	x	x	86916075	Q6P674	Nonsense_Mutation	SNP	ENST00000298699.2	37	CCDS9031.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.537277	0.96460	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944;ENST00000551163	.	.	.	5.81	5.81	0.92471	.	0.098604	0.45126	D	0.000387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.2244	0.59907	0.0:0.1594:0.8406:0.0	.	.	.	.	X	53;53;107;53	.	ENSP00000298699:Q53X	Q	-	1	0	C12orf50	86916075	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.945000	0.49043	2.759000	0.94783	0.591000	0.81541	CAG		0.368	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406328.1	NM_152589		Nonsense_Mutation
PXN	5829	broad.mit.edu	37	12	120650286	120650286	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:120650286G>T	ENST00000228307.7	-	12	1748	c.1607C>A	c.(1606-1608)tCt>tAt	p.S536Y	PXN_ENST00000458477.2_Missense_Mutation_p.S369Y|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000267257.7_Missense_Mutation_p.S550Y|PXN-AS1_ENST00000542314.1_RNA|PXN-AS1_ENST00000539446.1_RNA|PXN_ENST00000397506.3_Missense_Mutation_p.S348Y|PXN-AS1_ENST00000535200.1_RNA|PXN-AS1_ENST00000542265.1_RNA|PXN_ENST00000536957.1_Missense_Mutation_p.S534Y|PXN-AS1_ENST00000538804.1_RNA|PXN_ENST00000424649.2_Missense_Mutation_p.S502Y	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	536	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.S502Y(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGCAGCCAGAACACAGCGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											44.0	56.0	52.0					12																	120650286		2081	4201	6282	119134669	SO:0001583	missense	5829			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.1607C>A	12.37:g.120650286G>T	ENSP00000228307:p.Ser536Tyr	Somatic		x	x	x	119134669	B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	ENST00000228307.7	37	CCDS44997.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568053	0.45798	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000397506;ENST00000331257;ENST00000541856	D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	5.6	4.71	0.59529	Zinc finger, LIM-type (5);	.	.	.	.	D	0.82481	0.5046	N	0.25825	0.765	0.80722	D	1	P;P;B;P	0.37423	0.539;0.539;0.113;0.594	B;B;B;B	0.40982	0.234;0.234;0.115;0.345	T	0.80874	-0.1187	9	0.33940	T	0.23	.	16.5574	0.84490	0.0:0.1306:0.8694:0.0	.	502;550;348;536	P49023-2;P49023-3;E7EMK8;P49023	.;.;.;PAXI_HUMAN	Y	369;536;502;534;550;348;164;261	ENSP00000395536:S369Y;ENSP00000228307:S536Y;ENSP00000391283:S502Y;ENSP00000443887:S534Y;ENSP00000267257:S550Y;ENSP00000380643:S348Y	ENSP00000228307:S536Y	S	-	2	0	PXN	119134669	1.000000	0.71417	0.928000	0.36995	0.237000	0.25408	6.704000	0.74639	1.364000	0.46038	0.551000	0.68910	TCT		0.622	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402679.4	NM_002859		Missense_Mutation
DNAH10	196385	broad.mit.edu	37	12	124395163	124395163	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr12:124395163G>A	ENST00000409039.3	+	58	9749	c.9724G>A	c.(9724-9726)Gaa>Aaa	p.E3242K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3242	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E1834K(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAAATTTGTTGAAGCTGTAAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											99.0	102.0	101.0					12																	124395163		1928	4129	6057	122961116	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9724G>A	12.37:g.124395163G>A	ENSP00000386770:p.Glu3242Lys	Unknown		x	x	x	122961116	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	6.592	0.477543	0.12521	.	.	ENSG00000197653	ENST00000409039	T	0.74002	-0.8	4.96	4.96	0.65561	Dynein heavy chain, coiled coil stalk (1);	0.118380	0.56097	D	0.000031	T	0.59595	0.2205	N	0.19112	0.55	0.80722	D	1	B	0.18310	0.027	B	0.22152	0.038	T	0.57046	-0.7878	10	0.05833	T	0.94	.	18.2022	0.89842	0.0:0.0:1.0:0.0	.	3242	Q8IVF4	DYH10_HUMAN	K	3242	ENSP00000386770:E3242K	ENSP00000386770:E3242K	E	+	1	0	DNAH10	122961116	1.000000	0.71417	0.521000	0.27850	0.195000	0.23768	9.537000	0.98070	2.303000	0.77524	0.655000	0.94253	GAA		0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			Missense_Mutation
FRY	10129	broad.mit.edu	37	13	32835801	32835801	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr13:32835801G>T	ENST00000380250.3	+	52	7961	c.7465G>T	c.(7465-7467)Gac>Tac	p.D2489Y		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2489						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.D2489Y(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACGTTCTCTGGACAGCCTGGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	13											85.0	89.0	88.0					13																	32835801		2005	4178	6183	31733801	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.7465G>T	13.37:g.32835801G>T	ENSP00000369600:p.Asp2489Tyr	Somatic		x	x	x	31733801	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929259	0.92389	.	.	ENSG00000073910	ENST00000380250;ENST00000380235	T	0.25749	1.78	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.52741	0.1753	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	T	0.51212	-0.8734	10	0.66056	D	0.02	.	19.7964	0.96487	0.0:0.0:1.0:0.0	.	270;2489	Q8NB82;Q5TBA9	.;FRY_HUMAN	Y	2489;133	ENSP00000369600:D2489Y	ENSP00000369567:D133Y	D	+	1	0	FRY	31733801	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.702000	0.92279	0.655000	0.94253	GAC		0.488	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		Missense_Mutation
SCEL	8796	broad.mit.edu	37	13	78177254	78177254	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr13:78177254C>T	ENST00000349847.3	+	18	1165	c.1081C>T	c.(1081-1083)Cat>Tat	p.H361Y	SCEL-AS1_ENST00000457528.2_RNA|SCEL_ENST00000469982.1_Intron|SCEL_ENST00000535157.1_Missense_Mutation_p.H339Y|SCEL-AS1_ENST00000456280.2_RNA|SCEL_ENST00000377246.3_Missense_Mutation_p.H341Y	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	361	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)	p.H361Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TCCCAAAGGACATGAAAATAC	0.269																																																1	Substitution - Missense(1)	ovary(1)	13											54.0	60.0	58.0					13																	78177254		2202	4299	6501	77075255	SO:0001583	missense	8796			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.1081C>T	13.37:g.78177254C>T	ENSP00000302579:p.His361Tyr	Unknown		x	x	x	77075255	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	37	CCDS9459.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	9.353	1.065943	0.20067	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.21932	1.98;1.98;1.98	4.51	-1.68	0.08212	.	0.919810	0.08912	N	0.875754	T	0.09202	0.0227	N	0.19112	0.55	0.09310	N	1	B;B;B	0.30146	0.027;0.225;0.27	B;B;B	0.28305	0.036;0.065;0.088	T	0.32214	-0.9915	10	0.02654	T	1	-0.753	5.9575	0.19281	0.276:0.5858:0.1382:0.0	.	339;341;361	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	Y	339;341;361	ENSP00000437895:H339Y;ENSP00000366454:H341Y;ENSP00000302579:H361Y	ENSP00000302579:H361Y	H	+	1	0	SCEL	77075255	0.000000	0.05858	0.273000	0.24645	0.121000	0.20230	0.054000	0.14205	-0.097000	0.12307	-0.264000	0.10439	CAT		0.269	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777		Missense_Mutation
TRIP11	9321	broad.mit.edu	37	14	92439176	92439176	+	Silent	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr14:92439176T>A	ENST00000267622.4	-	20	5977	c.5604A>T	c.(5602-5604)ctA>ctT	p.L1868L		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1868					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.L1868L(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		ATTCTGTTTCTAGAAATTTAA	0.313			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - coding silent(1)	ovary(1)	14											120.0	137.0	131.0					14																	92439176		2203	4298	6501	91508929	SO:0001819	synonymous_variant	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.5604A>T	14.37:g.92439176T>A		Somatic		x	x	x	91508929	B2RUT2|O14689|O15154|O95949	Silent	SNP	ENST00000267622.4	37	CCDS9899.1	SNP	53	Broad	.	.	.	.	.	.	.	.	.	.	T	9.251	1.040847	0.19669	.	.	ENSG00000100815	ENST00000554357	.	.	.	5.9	-5.96	0.02234	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8659	0.63588	0.1117:0.6341:0.0:0.2542	.	.	.	.	X	1584	.	.	R	-	1	2	TRIP11	91508929	0.002000	0.14202	0.890000	0.34922	0.975000	0.68041	-1.738000	0.01842	-1.013000	0.03383	-0.917000	0.02746	AGA		0.313	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			Silent
FRMD5	84978	broad.mit.edu	37	15	44166269	44166269	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr15:44166269C>T	ENST00000417257.1	-	14	1703	c.1527G>A	c.(1525-1527)atG>atA	p.M509I	FRMD5_ENST00000402883.1_Intron|FRMD5_ENST00000484674.1_Intron	NM_032892.3	NP_116281.2	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5	509						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)		p.M509I(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		AGAGGAGTCCCATGGTCACAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	15											144.0	115.0	124.0					15																	44166269		2198	4298	6496	41953561	SO:0001583	missense	84978			BC007796	CCDS10107.2, CCDS73715.1, CCDS73716.1	15q15.3	2005-08-09			ENSG00000171877	ENSG00000171877			28214	protein-coding gene	gene with protein product							Standard	XM_005254729		Approved	MGC14161	uc001ztl.3	Q7Z6J6	OTTHUMG00000060475	ENST00000417257.1:c.1527G>A	15.37:g.44166269C>T	ENSP00000403067:p.Met509Ile	Unknown		x	x	x	41953561	Q8NBG4	Missense_Mutation	SNP	ENST00000417257.1	37	CCDS10107.2	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	1.253	-0.618054	0.03663	.	.	ENSG00000171877	ENST00000417257	D	0.82433	-1.61	5.81	5.81	0.92471	.	0.228496	0.48767	D	0.000165	T	0.59211	0.2177	N	0.03324	-0.35	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.58825	-0.7568	10	0.02654	T	1	.	10.1145	0.42583	0.1517:0.7018:0.1465:0.0	.	494;509	Q7Z6J6-2;Q7Z6J6	.;FRMD5_HUMAN	I	509	ENSP00000403067:M509I	ENSP00000403067:M509I	M	-	3	0	FRMD5	41953561	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.694000	0.25512	2.738000	0.93877	0.655000	0.94253	ATG		0.547	FRMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133879.1	NM_032892		Missense_Mutation
UNC13C	440279	broad.mit.edu	37	15	54838962	54838962	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr15:54838962G>C	ENST00000260323.11	+	26	5739	c.5739G>C	c.(5737-5739)aaG>aaC	p.K1913N	UNC13C_ENST00000537900.1_Missense_Mutation_p.K1911N|UNC13C_ENST00000545554.1_Missense_Mutation_p.K1913N	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1913	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.K1913N(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGTCCTAAAGCGAGTTTTAA	0.279																																																1	Substitution - Missense(1)	ovary(1)	15											39.0	34.0	35.0					15																	54838962		1755	4022	5777	52626254	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5739G>C	15.37:g.54838962G>C	ENSP00000260323:p.Lys1913Asn	Unknown		x	x	x	52626254	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975569	0.34848	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.20200	2.09;2.09;2.09	5.59	3.66	0.41972	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.42810	0.1219	M	0.81682	2.555	0.44098	D	0.996868	D	0.89917	1.0	D	0.87578	0.998	T	0.20672	-1.0268	10	0.42905	T	0.14	.	6.6996	0.23217	0.4028:0.0:0.5972:0.0	.	1913	Q8NB66	UN13C_HUMAN	N	1913;1913;1911	ENSP00000260323:K1913N;ENSP00000438156:K1913N;ENSP00000442569:K1911N	ENSP00000260323:K1913N	K	+	3	2	UNC13C	52626254	0.998000	0.40836	0.980000	0.43619	0.129000	0.20672	0.618000	0.24373	0.649000	0.30751	0.561000	0.74099	AAG		0.279	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166		Missense_Mutation
RRN3	54700	broad.mit.edu	37	16	15168715	15168715	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr16:15168715C>T	ENST00000198767.6	-	11	945	c.862G>A	c.(862-864)Gaa>Aaa	p.E288K	PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000429751.2_Missense_Mutation_p.E258K|RRN3_ENST00000563559.1_Missense_Mutation_p.E288K|RRN3_ENST00000327307.7_Missense_Mutation_p.E255K|RRN3_ENST00000540462.1_Missense_Mutation_p.E106K	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	288					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.E288K(1)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						TCTTCATCTTCATCCTTTGAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	16											98.0	72.0	81.0					16																	15168715		2197	4300	6497	15076216	SO:0001583	missense	54700			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.862G>A	16.37:g.15168715C>T	ENSP00000198767:p.Glu288Lys	Somatic		x	x	x	15076216	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	.	21.3	4.124249	0.77436	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.58524	0.2128	M	0.72118	2.19	0.80722	D	1	P;D;D	0.58268	0.663;0.96;0.982	B;P;P	0.60415	0.242;0.745;0.874	T	0.52419	-0.8578	10	0.08179	T	0.78	.	19.0094	0.92867	0.0:1.0:0.0:0.0	.	258;189;288	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	K	288;258;255;106	ENSP00000198767:E288K;ENSP00000402027:E258K;ENSP00000318484:E255K;ENSP00000437963:E106K	ENSP00000198767:E288K	E	-	1	0	RRN3	15076216	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.951000	0.75983	2.735000	0.93741	0.561000	0.74099	GAA		0.388	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	17	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Unknown		x	x	x	7518988	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
ASIC2	40	broad.mit.edu	37	17	31352992	31352992	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr17:31352992G>T	ENST00000359872.6	-	5	1755	c.994C>A	c.(994-996)Cct>Act	p.P332T	ASIC2_ENST00000225823.2_Missense_Mutation_p.P383T|ASIC2_ENST00000448983.1_5'UTR	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	332					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.P383T(1)								Amiloride(DB00594)	GTACAAAAAGGGGCATCCCCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											99.0	77.0	84.0					17																	31352992		2203	4300	6503	28377105	SO:0001583	missense	40			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.994C>A	17.37:g.31352992G>T	ENSP00000352934:p.Pro332Thr	Unknown		x	x	x	28377105	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506258	0.26949	.	.	ENSG00000108684	ENST00000225823;ENST00000359872;ENST00000448983	T;T	0.69040	-0.37;-0.37	5.12	5.12	0.69794	.	0.057343	0.64402	D	0.000001	T	0.57489	0.2057	L	0.31578	0.945	0.52501	D	0.999956	B;B	0.20988	0.05;0.033	B;B	0.26693	0.068;0.072	T	0.44390	-0.9331	10	0.24483	T	0.36	-0.5128	16.4308	0.83841	0.0:0.0:1.0:0.0	.	332;383	Q16515;E9PBX2	ACCN1_HUMAN;.	T	383;332;138	ENSP00000225823:P383T;ENSP00000352934:P332T	ENSP00000225823:P383T	P	-	1	0	ACCN1	28377105	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.987000	0.49378	0.655000	0.30866	0.555000	0.69702	CCT		0.562	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094		Missense_Mutation
DSC1	1823	broad.mit.edu	37	18	28734801	28734801	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr18:28734801T>C	ENST00000257198.5	-	5	824	c.563A>G	c.(562-564)gAg>gGg	p.E188G	DSC1_ENST00000257197.3_Missense_Mutation_p.E188G|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	188	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E188G(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			AGTGTCTTTCTCTATGTAAAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	18											81.0	79.0	80.0					18																	28734801		2203	4300	6503	26988799	SO:0001583	missense	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.563A>G	18.37:g.28734801T>C	ENSP00000257198:p.Glu188Gly	Unknown		x	x	x	26988799	Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	37	CCDS11894.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	16.56	3.157173	0.57259	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.61040	0.14;0.14	5.51	5.51	0.81932	Cadherin (5);Cadherin-like (1);	0.732533	0.12007	N	0.508243	T	0.64962	0.2646	M	0.83483	2.645	0.48632	D	0.999684	P;P	0.36683	0.565;0.565	B;B	0.37015	0.239;0.239	T	0.67745	-0.5591	10	0.59425	D	0.04	.	14.5948	0.68397	0.0:0.0:0.0:1.0	.	188;188	Q08554;Q9HB00	DSC1_HUMAN;.	G	188	ENSP00000257197:E188G;ENSP00000257198:E188G	ENSP00000257197:E188G	E	-	2	0	DSC1	26988799	1.000000	0.71417	0.987000	0.45799	0.648000	0.38561	4.861000	0.62969	2.100000	0.63781	0.455000	0.32223	GAG		0.368	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421		Missense_Mutation
KLHL14	57565	broad.mit.edu	37	18	30260447	30260447	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr18:30260447G>A	ENST00000359358.4	-	6	1792	c.1354C>T	c.(1354-1356)Cgc>Tgc	p.R452C		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	452						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.R452C(2)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GACACATAGCGCCATTCATTC	0.468																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	18											131.0	126.0	128.0					18																	30260447		2203	4300	6503	28514445	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1354C>T	18.37:g.30260447G>A	ENSP00000352314:p.Arg452Cys	Unknown		x	x	x	28514445	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	ENST00000359358.4	37	CCDS32813.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678853	0.68042	.	.	ENSG00000197705	ENST00000359358	T	0.79454	-1.27	5.58	5.58	0.84498	Galactose oxidase, beta-propeller (1);	0.143817	0.64402	D	0.000005	T	0.80675	0.4668	L	0.47190	1.495	0.80722	D	1	D	0.60575	0.988	P	0.51266	0.664	T	0.80982	-0.1139	10	0.52906	T	0.07	.	19.922	0.97089	0.0:0.0:1.0:0.0	.	452	Q9P2G3	KLH14_HUMAN	C	452	ENSP00000352314:R452C	ENSP00000352314:R452C	R	-	1	0	KLHL14	28514445	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.793000	0.69060	2.780000	0.95670	0.655000	0.94253	CGC		0.468	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1			Missense_Mutation
ALPK2	115701	broad.mit.edu	37	18	56203991	56203991	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr18:56203991G>C	ENST00000361673.3	-	5	3641	c.3428C>G	c.(3427-3429)tCc>tGc	p.S1143C	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1143						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S504C(1)|p.S1143C(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						ACCCTGCTGGGACAGGCTCTG	0.512																																																2	Substitution - Missense(2)	ovary(2)	18											117.0	124.0	122.0					18																	56203991		2203	4300	6503	54354971	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3428C>G	18.37:g.56203991G>C	ENSP00000354991:p.Ser1143Cys	Unknown		x	x	x	54354971	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	CCDS11966.2	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	10.26	1.299806	0.23650	.	.	ENSG00000198796	ENST00000361673	T	0.48522	0.81	5.21	1.14	0.20703	.	2.578920	0.01056	N	0.004540	T	0.37156	0.0993	L	0.34521	1.04	0.09310	N	1	B;B	0.18166	0.026;0.002	B;B	0.17979	0.02;0.002	T	0.30179	-0.9987	10	0.87932	D	0	-0.0745	1.9709	0.03406	0.1583:0.1624:0.5125:0.1668	.	1138;1143	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	C	1143	ENSP00000354991:S1143C	ENSP00000354991:S1143C	S	-	2	0	ALPK2	54354971	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.222000	0.09190	0.203000	0.20529	0.655000	0.94253	TCC		0.512	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		Missense_Mutation
TIMM44	10469	broad.mit.edu	37	19	7997585	7997585	+	Missense_Mutation	SNP	C	C	T	rs201091980		TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr19:7997585C>T	ENST00000270538.3	-	9	1182	c.914G>A	c.(913-915)cGg>cAg	p.R305Q	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	305					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.R305Q(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CGGGTCCACCCGGAGGATCTC	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		16525	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											59.0	63.0	61.0					19																	7997585		2203	4300	6503	7903585	SO:0001583	missense	10469			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.914G>A	19.37:g.7997585C>T	ENSP00000270538:p.Arg305Gln	Unknown		x	x	x	7903585	A8K0R9|D6W664|Q8N193	Missense_Mutation	SNP	ENST00000270538.3	37	CCDS12192.1	SNP	23	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	19.71	3.878941	0.72294	.	.	ENSG00000104980	ENST00000270538	T	0.75821	-0.97	5.07	3.81	0.43845	.	0.049159	0.85682	D	0.000000	T	0.46502	0.1396	N	0.11560	0.145	0.42359	D	0.992407	B	0.32071	0.355	B	0.21546	0.035	T	0.44877	-0.9299	10	0.25106	T	0.35	-19.9042	5.2437	0.15485	0.0:0.75:0.0:0.25	.	305	O43615	TIM44_HUMAN	Q	305	ENSP00000270538:R305Q	ENSP00000270538:R305Q	R	-	2	0	TIMM44	7903585	0.965000	0.33210	0.984000	0.44739	0.968000	0.65278	2.368000	0.44222	2.529000	0.85273	0.561000	0.74099	CGG		0.652	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3			Missense_Mutation
ZNF266	10781	broad.mit.edu	37	19	9524703	9524703	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr19:9524703C>T	ENST00000592904.1	-	5	2974	c.898G>A	c.(898-900)Gaa>Aaa	p.E300K	ZNF266_ENST00000588933.1_Missense_Mutation_p.E300K|ZNF266_ENST00000590306.1_Missense_Mutation_p.E300K|ZNF266_ENST00000588221.1_Missense_Mutation_p.E300K|ZNF266_ENST00000592292.1_Missense_Mutation_p.E300K|ZNF266_ENST00000361451.2_Missense_Mutation_p.E300K|ZNF266_ENST00000361151.1_Missense_Mutation_p.E300K			Q14584	ZN266_HUMAN	zinc finger protein 266	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E300K(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						ATCCCACATTCCTTGCATTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	19											110.0	108.0	109.0					19																	9524703		2203	4300	6503	9385703	SO:0001583	missense	10781			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.898G>A	19.37:g.9524703C>T	ENSP00000466714:p.Glu300Lys	Unknown		x	x	x	9385703	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	CCDS12213.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.24	2.775855	0.49786	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07327	3.2;3.2	2.53	0.33	0.15929	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05456	0.0144	N	0.20530	0.585	0.09310	N	1	B	0.20671	0.047	B	0.17433	0.018	T	0.37888	-0.9686	9	0.54805	T	0.06	.	6.608	0.22735	0.0:0.7306:0.0:0.2694	.	300	Q14584	ZN266_HUMAN	K	300	ENSP00000354680:E300K;ENSP00000355047:E300K	ENSP00000355047:E300K	E	-	1	0	ZNF266	9385703	0.000000	0.05858	0.003000	0.11579	0.388000	0.30384	-0.258000	0.08733	0.160000	0.19432	0.555000	0.69702	GAA		0.383	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1			Missense_Mutation
OR7C2	26658	broad.mit.edu	37	19	15052699	15052699	+	Silent	SNP	G	G	A	rs377607402		TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr19:15052699G>A	ENST00000248072.3	+	1	399	c.399G>A	c.(397-399)acG>acA	p.T133T		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T133T(1)		large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					TGCACTACACGGTCATCATGA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	19						G		1,4405	826.1+/-416.6	0,1,2202	130.0	123.0	125.0		399	-8.4	0.0	19		125	0,8600		0,0,4300	no	coding-synonymous	OR7C2	NM_012377.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		133/320	15052699	1,13005	2203	4300	6503	14913699	SO:0001819	synonymous_variant	26658			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.399G>A	19.37:g.15052699G>A		Unknown		x	x	x	14913699	O43881|Q6IFP9	Silent	SNP	ENST00000248072.3	37	CCDS12320.1	SNP	39	Broad																																																																																				0.517	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			Silent
GPI	2821	broad.mit.edu	37	19	34887243	34887243	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr19:34887243C>G	ENST00000356487.5	+	13	1341	c.1100C>G	c.(1099-1101)tCt>tGt	p.S367C	GPI_ENST00000586425.1_Missense_Mutation_p.S367C|GPI_ENST00000415930.3_Missense_Mutation_p.S378C	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	367					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)	p.S367C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					ATCACCAAATCTGGAACCCGT	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	68.0	66.0					19																	34887243		2203	4300	6503	39579083	SO:0001583	missense	2821			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.1100C>G	19.37:g.34887243C>G	ENSP00000348877:p.Ser367Cys	Somatic		x	x	x	39579083	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	CCDS12437.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511329	0.64522	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	D;D	0.94092	-3.35;-3.35	5.46	4.36	0.52297	.	0.571221	0.18977	N	0.125969	D	0.94072	0.8100	M	0.64404	1.975	0.22858	N	0.998649	P;P;P;B	0.46512	0.547;0.879;0.814;0.196	P;P;P;B	0.51657	0.676;0.621;0.676;0.348	D	0.89015	0.3431	10	0.87932	D	0	-6.8411	13.5385	0.61659	0.2328:0.7672:0.0:0.0	.	339;378;340;367	B4DE36;B4DG39;B4DVJ0;P06744	.;.;.;G6PI_HUMAN	C	378;367	ENSP00000405573:S378C;ENSP00000348877:S367C	ENSP00000348877:S367C	S	+	2	0	GPI	39579083	0.947000	0.32204	0.950000	0.38849	0.901000	0.52897	3.370000	0.52372	2.566000	0.86566	0.555000	0.69702	TCT		0.498	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3			Missense_Mutation
ZNF615	284370	broad.mit.edu	37	19	52496396	52496396	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0916-01	TCGA-13-0916-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr19:52496396A>T	ENST00000602063.1	-	6	2282	c.1933T>A	c.(1933-1935)Ttt>Att	p.F645I	ZNF615_ENST00000598071.1_Missense_Mutation_p.F656I|ZNF615_ENST00000391795.3_Missense_Mutation_p.F650I|ZNF615_ENST00000594083.1_Missense_Mutation_p.F656I|ZNF615_ENST00000376716.5_Missense_Mutation_p.F645I			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	645					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F656I(1)|p.F645I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CCTGTGTGAAATCGCTGATGT	0.383																																																2	Substitution - Missense(2)	ovary(2)	19											166.0	164.0	165.0					19																	52496396		2203	4300	6503	57188208	SO:0001583	missense	284370			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1933T>A	19.37:g.52496396A>T	ENSP00000473089:p.Phe645Ile	Somatic		x	x	x	57188208	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	37	CCDS12846.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	1.056	-0.674268	0.03378	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.12672	2.66;2.66	3.32	-0.534	0.11883	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02119	0.0066	N	0.00289	-1.7	0.23023	N	0.998413	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.10450	0.005;0.003;0.003;0.005	T	0.44251	-0.9340	9	0.02654	T	1	.	3.9241	0.09256	0.3165:0.0:0.1208:0.5626	.	650;652;656;645	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	I	645;655;650;599	ENSP00000365906:F645I;ENSP00000375672:F650I	ENSP00000347019:F655I	F	-	1	0	ZNF615	57188208	0.001000	0.12720	0.373000	0.26003	0.967000	0.64934	0.537000	0.23144	0.037000	0.15575	0.533000	0.62120	TTT		0.383	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480		Missense_Mutation
OSR1	130497	broad.mit.edu	37	2	19552055	19552055	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr2:19552055G>T	ENST00000272223.2	-	3	1126	c.782C>A	c.(781-783)aCc>aAc	p.T261N	OSR1_ENST00000536433.1_Missense_Mutation_p.T261N	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	261					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T261N(1)		breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				GATCTTGGAGGTTTTGAGCTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											141.0	130.0	134.0					2																	19552055		2203	4300	6503	19415536	SO:0001583	missense	130497			BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.782C>A	2.37:g.19552055G>T	ENSP00000272223:p.Thr261Asn	Unknown		x	x	x	19415536	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	37	CCDS1694.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291220	0.40494	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	T;T	0.52983	0.64;0.64	5.01	3.01	0.34805	.	0.263399	0.43747	D	0.000537	T	0.28034	0.0691	N	0.16656	0.425	0.25857	N	0.983876	B	0.29508	0.246	B	0.27608	0.081	T	0.13818	-1.0495	9	.	.	.	-6.4553	10.6251	0.45502	0.0845:0.1391:0.7763:0.0	.	261	Q8TAX0	OSR1_HUMAN	N	261	ENSP00000272223:T261N;ENSP00000441801:T261N	.	T	-	2	0	OSR1	19415536	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.620000	0.61226	1.300000	0.44818	0.561000	0.74099	ACC		0.552	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260		Missense_Mutation
GALNT13	114805	broad.mit.edu	37	2	155252586	155252586	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr2:155252586C>A	ENST00000392825.3	+	10	1807	c.1240C>A	c.(1240-1242)Cta>Ata	p.L414I	GALNT13_ENST00000487047.1_3'UTR|GALNT13_ENST00000409237.1_Missense_Mutation_p.L414I	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	414					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.L414I(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						TTCTTGGTACCTAGAAAACAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											91.0	92.0	91.0					2																	155252586		2203	4300	6503	154960832	SO:0001583	missense	114805			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1240C>A	2.37:g.155252586C>A	ENSP00000376570:p.Leu414Ile	Somatic		x	x	x	154960832	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	SNP	24	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.67|19.67	3.871332|3.871332	0.72065|0.72065	.|.	.|.	ENSG00000144278|ENSG00000144278	ENST00000392825;ENST00000409237|ENST00000450838	D;D|.	0.83163|.	-1.69;-1.69|.	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.72851|0.72851	0.3512|0.3512	M|M	0.78223|0.78223	2.4|2.4	0.80722|0.80722	D|D	1|1	D;P;D;P|.	0.69078|.	0.984;0.936;0.997;0.936|.	D;D;D;D|.	0.72338|.	0.958;0.966;0.96;0.977|.	T|T	0.73920|0.73920	-0.3830|-0.3830	10|5	0.52906|.	T|.	0.07|.	.|.	10.8715|10.8715	0.46885|0.46885	0.0:0.9121:0.0:0.0879|0.0:0.9121:0.0:0.0879	.|.	414;414;414;414|.	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8|.	.;.;.;GLT13_HUMAN|.	I|H	414|32	ENSP00000376570:L414I;ENSP00000387239:L414I|.	ENSP00000376570:L414I|.	L|P	+|+	1|2	2|0	GALNT13|GALNT13	154960832|154960832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.470000|2.470000	0.45119|0.45119	2.492000|2.492000	0.84095|0.84095	0.650000|0.650000	0.86243|0.86243	CTA|CCT		0.353	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917		Missense_Mutation
ZNF804A	91752	broad.mit.edu	37	2	185800773	185800773	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr2:185800773C>A	ENST00000302277.6	+	4	1244	c.650C>A	c.(649-651)gCa>gAa	p.A217E		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	217							metal ion binding (GO:0046872)	p.A217E(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTTTCTTTTGCATTTCCAAAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	2											66.0	67.0	67.0					2																	185800773		2203	4300	6503	185509018	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.650C>A	2.37:g.185800773C>A	ENSP00000303252:p.Ala217Glu	Unknown		x	x	x	185509018	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628400	0.87560	.	.	ENSG00000170396	ENST00000302277	T	0.09073	3.02	5.32	5.32	0.75619	.	0.000000	0.53938	D	0.000043	T	0.27241	0.0668	L	0.56769	1.78	0.48696	D	0.999696	D	0.89917	1.0	D	0.77004	0.989	T	0.00458	-1.1727	10	0.87932	D	0	-15.9969	17.9814	0.89143	0.0:1.0:0.0:0.0	.	217	Q7Z570	Z804A_HUMAN	E	217	ENSP00000303252:A217E	ENSP00000303252:A217E	A	+	2	0	ZNF804A	185509018	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.202000	0.77856	2.490000	0.84030	0.467000	0.42956	GCA		0.428	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		Missense_Mutation
ANKRD44	91526	broad.mit.edu	37	2	197951416	197951416	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr2:197951416T>A	ENST00000328737.2	-	13	1305	c.1229A>T	c.(1228-1230)gAc>gTc	p.D410V	ANKRD44_ENST00000539527.1_Missense_Mutation_p.D363V|ANKRD44_ENST00000450567.1_Missense_Mutation_p.D410V|ANKRD44_ENST00000282272.8_Missense_Mutation_p.D427V|ANKRD44_ENST00000477852.1_5'UTR|ANKRD44_ENST00000409153.1_Missense_Mutation_p.D435V|ANKRD44_ENST00000337207.5_Missense_Mutation_p.D410V			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	435								p.D410V(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCCACACTTGTCCTTTTTATG	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											166.0	148.0	154.0					2																	197951416		2203	4300	6503	197659661	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1229A>T	2.37:g.197951416T>A	ENSP00000331516:p.Asp410Val	Unknown		x	x	x	197659661	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37		SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527164	0.85706	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000409153;ENST00000539527	T;T;T;T;T;T;T	0.77229	-0.5;-0.43;0.04;0.04;-0.43;-0.43;-1.08	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.91784	0.7401	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.94160	0.7413	10	0.72032	D	0.01	.	15.6414	0.77006	0.0:0.0:0.0:1.0	.	363;435;453	F5H682;Q8N8A2-3;Q8N8A2-2	.;.;.	V	250;427;410;410;410;435;363	ENSP00000403415:D250V;ENSP00000282272:D427V;ENSP00000331516:D410V;ENSP00000402420:D410V;ENSP00000338794:D410V;ENSP00000387141:D435V;ENSP00000437825:D363V	ENSP00000282272:D427V	D	-	2	0	ANKRD44	197659661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.312000	0.78968	2.279000	0.76181	0.533000	0.62120	GAC		0.383	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		Missense_Mutation
MAP2	4133	broad.mit.edu	37	2	210560575	210560575	+	Silent	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr2:210560575T>A	ENST00000360351.4	+	7	4187	c.3681T>A	c.(3679-3681)tcT>tcA	p.S1227S	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Silent_p.S1223S|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1227					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.S1227S(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CGATCGTATCTGAACCAGCAG	0.458																																					Pancreas(27;423 979 28787 29963)											1	Substitution - coding silent(1)	ovary(1)	2											62.0	66.0	65.0					2																	210560575		2203	4300	6503	210268820	SO:0001819	synonymous_variant	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3681T>A	2.37:g.210560575T>A		Somatic		x	x	x	210268820	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	55	Broad																																																																																				0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Silent
TGM6	343641	broad.mit.edu	37	20	2398128	2398128	+	Silent	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr20:2398128C>G	ENST00000202625.2	+	10	1648	c.1587C>G	c.(1585-1587)gtC>gtG	p.V529V	TGM6_ENST00000381423.1_Silent_p.V529V	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	529					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.V529V(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	GGGTGAGGGTCAACCTGAGCG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											31.0	30.0	30.0					20																	2398128		2203	4300	6503	2346128	SO:0001819	synonymous_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1587C>G	20.37:g.2398128C>G		Unknown		x	x	x	2346128	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	37	CCDS13025.1	SNP	29	Broad																																																																																				0.627	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994		Silent
PDZRN3	23024	broad.mit.edu	37	3	73434831	73434831	+	Missense_Mutation	SNP	C	C	G	rs563627189	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr3:73434831C>G	ENST00000263666.4	-	9	1738	c.1624G>C	c.(1624-1626)Gtg>Ctg	p.V542L	PDZRN3_ENST00000479530.1_Missense_Mutation_p.V259L|PDZRN3_ENST00000466780.1_Missense_Mutation_p.V199L|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000462146.2_Missense_Mutation_p.V199L|PDZRN3_ENST00000535920.1_Missense_Mutation_p.V264L	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	542					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V542L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGCTGCAGCACGCTAGCTGTG	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											192.0	144.0	160.0					3																	73434831		2203	4300	6503	73517521	SO:0001583	missense	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1624G>C	3.37:g.73434831C>G	ENSP00000263666:p.Val542Leu	Unknown		x	x	x	73517521	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	2.469	-0.322284	0.05350	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.09350	2.99;3.68;3.57;3.57;3.69;3.69	5.58	2.52	0.30459	.	0.607998	0.17490	N	0.172377	T	0.05868	0.0153	L	0.29908	0.895	0.29707	N	0.839731	B;B;B;B	0.23650	0.0;0.089;0.0;0.043	B;B;B;B	0.18263	0.004;0.021;0.002;0.015	T	0.40384	-0.9566	10	0.08179	T	0.78	.	4.3572	0.11185	0.0:0.4177:0.1622:0.42	.	264;259;259;542	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	L	542;264;199;199;259;542;240	ENSP00000263666:V542L;ENSP00000442026:V264L;ENSP00000418168:V199L;ENSP00000418484:V199L;ENSP00000418624:V259L;ENSP00000419250:V240L	ENSP00000263666:V542L	V	-	1	0	PDZRN3	73517521	0.999000	0.42202	0.106000	0.21319	0.485000	0.33311	0.674000	0.25218	0.185000	0.20105	0.655000	0.94253	GTG		0.557	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363		Missense_Mutation
WDFY3	23001	broad.mit.edu	37	4	85623611	85623611	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr4:85623611C>A	ENST00000295888.4	-	56	8898	c.8491G>T	c.(8491-8493)Gcc>Tcc	p.A2831S	WDFY3_ENST00000322366.6_Missense_Mutation_p.A2814S	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2831	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.A2831S(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GAATACCAGGCCTCGCGCACA	0.463																																																1	Substitution - Missense(1)	ovary(1)	4											69.0	73.0	72.0					4																	85623611		2203	4300	6503	85842635	SO:0001583	missense	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8491G>T	4.37:g.85623611C>A	ENSP00000295888:p.Ala2831Ser	Somatic		x	x	x	85842635	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157712	0.78114	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.63744	-0.06;-0.06;-0.06	5.86	5.01	0.66863	BEACH domain (4);	0.048585	0.85682	D	0.000000	T	0.70613	0.3244	L	0.41079	1.255	0.80722	D	1	D	0.60575	0.988	D	0.63381	0.914	T	0.71517	-0.4569	10	0.45353	T	0.12	.	17.119	0.86697	0.0:0.8734:0.1265:0.0	.	2831	Q8IZQ1	WDFY3_HUMAN	S	2814;2831;434	ENSP00000318466:A2814S;ENSP00000295888:A2831S;ENSP00000424987:A434S	ENSP00000295888:A2831S	A	-	1	0	WDFY3	85842635	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	7.814000	0.86154	1.471000	0.48121	-0.172000	0.13284	GCC		0.463	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		Missense_Mutation
FRG2	448831	broad.mit.edu	37	4	190948206	190948206	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr4:190948206T>A	ENST00000378763.1	-	1	206	c.154A>T	c.(154-156)Agt>Tgt	p.S52C	FRG2_ENST00000504750.1_Missense_Mutation_p.S52C	NM_001005217.1|NM_001199232.1	NP_001005217.1|NP_001186161.1	Q64ET8	FRG2_HUMAN	FSHD region gene 2	52						nucleus (GO:0005634)		p.S52C(1)		large_intestine(1)|lung(3)|ovary(2)|skin(1)	7		all_cancers(14;1.01e-50)|all_epithelial(14;6.7e-35)|all_lung(41;2.17e-14)|Lung NSC(41;4.95e-14)|Breast(6;3.4e-05)|Melanoma(20;0.000539)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|all_hematologic(60;0.0489)|Prostate(90;0.0513)		all cancers(3;3.83e-31)|Epithelial(3;1.36e-30)|OV - Ovarian serous cystadenocarcinoma(60;1.99e-15)|BRCA - Breast invasive adenocarcinoma(30;8.54e-06)|Lung(3;3.23e-05)|STAD - Stomach adenocarcinoma(60;8.24e-05)|LUSC - Lung squamous cell carcinoma(40;0.000184)|GBM - Glioblastoma multiforme(59;0.00831)|READ - Rectum adenocarcinoma(43;0.155)		TGCTTCTCACTGGAATGGGAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	4																																								191185200	SO:0001583	missense	448831				CCDS34123.1, CCDS68834.1	4q35.2	2014-09-04			ENSG00000205097	ENSG00000205097			19136	protein-coding gene	gene with protein product		609032				12176321, 15520407	Standard	NM_001005217		Approved	FRG2A		Q64ET8	OTTHUMG00000160339	ENST00000378763.1:c.154A>T	4.37:g.190948206T>A	ENSP00000368039:p.Ser52Cys	Unknown		x	x	x	191185200	B7ZMJ1|E7EN36	Missense_Mutation	SNP	ENST00000378763.1	37	CCDS34123.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	.	7.450	0.642512	0.14451	.	.	ENSG00000205097	ENST00000504750;ENST00000378763	T;T	0.36157	1.27;1.27	0.352	-0.703	0.11261	.	4.623660	0.00610	N	0.000403	T	0.39733	0.1089	N	0.14661	0.345	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.69824	0.966;0.966	T	0.19160	-1.0314	9	0.66056	D	0.02	2.5219	.	.	.	.	52;52	E7EN36;Q64ET8	.;FRG2_HUMAN	C	52	ENSP00000424015:S52C;ENSP00000368039:S52C	ENSP00000368039:S52C	S	-	1	0	FRG2	191185200	0.989000	0.36119	0.017000	0.16124	0.015000	0.08874	0.742000	0.26216	-0.810000	0.04375	-0.900000	0.02857	AGT		0.502	FRG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360294.1	NM_001005217		Missense_Mutation
C5orf42	65250	broad.mit.edu	37	5	37198855	37198855	+	Silent	SNP	T	T	A			TCGA-13-0916-01	TCGA-13-0916-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr5:37198855T>A	ENST00000508244.1	-	19	3714	c.3621A>T	c.(3619-3621)gtA>gtT	p.V1207V	C5orf42_ENST00000425232.2_Silent_p.V1207V|C5orf42_ENST00000274258.7_Silent_p.V88V			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1207						integral component of membrane (GO:0016021)		p.V88V(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACCACTGTGCTACAGGAAAAG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	5											94.0	96.0	95.0					5																	37198855		2203	4300	6503	37234612	SO:0001819	synonymous_variant	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3621A>T	5.37:g.37198855T>A		Somatic		x	x	x	37234612	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	37	CCDS34146.2	SNP	53	Broad																																																																																				0.403	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		Silent
PCDHB13	56123	broad.mit.edu	37	5	140594357	140594357	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr5:140594357C>T	ENST00000341948.4	+	1	849	c.662C>T	c.(661-663)cCg>cTg	p.P221L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	221	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P221L(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.532																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	104.0	102.0					5																	140594357		2203	4300	6503	140574541	SO:0001583	missense	56123			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.662C>T	5.37:g.140594357C>T	ENSP00000345491:p.Pro221Leu	Unknown		x	x	x	140574541	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	c	29.3	4.992937	0.93167	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.00792	5.69	3.51	2.6	0.31112	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.06554	0.0168	H	0.95982	3.75	0.46478	D	0.999069	D	0.65815	0.995	D	0.71870	0.975	T	0.01162	-1.1432	9	0.66056	D	0.02	.	11.0844	0.48078	0.0:0.9018:0.0:0.0982	.	221	Q9Y5F0	PCDBD_HUMAN	L	221	ENSP00000345491:P221L	ENSP00000345491:P221L	P	+	2	0	PCDHB13	140574541	0.999000	0.42202	0.006000	0.13384	0.808000	0.45660	4.915000	0.63355	0.548000	0.28955	0.306000	0.20318	CCG		0.532	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		Missense_Mutation
CDHR2	54825	broad.mit.edu	37	5	176003151	176003151	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr5:176003151G>A	ENST00000510636.1	+	12	1433	c.1159G>A	c.(1159-1161)Gat>Aat	p.D387N	CDHR2_ENST00000506348.1_Missense_Mutation_p.D387N|CDHR2_ENST00000261944.5_Missense_Mutation_p.D387N	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	387	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D387N(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CATCCCCATCGATGACCTCAC	0.657																																																1	Substitution - Missense(1)	ovary(1)	5											71.0	61.0	65.0					5																	176003151		2203	4300	6503	175935757	SO:0001583	missense	54825			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1159G>A	5.37:g.176003151G>A	ENSP00000424565:p.Asp387Asn	Unknown		x	x	x	175935757	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	1.387	-0.581838	0.03827	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.56611	0.45;0.45;0.45	4.54	2.59	0.31030	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.28995	0.0720	N	0.24115	0.695	0.09310	N	1	B	0.33494	0.414	B	0.26770	0.073	T	0.10753	-1.0616	9	0.12430	T	0.62	-7.5825	5.0119	0.14317	0.2026:0.0:0.6253:0.1721	.	387	Q9BYE9	CDHR2_HUMAN	N	387	ENSP00000424565:D387N;ENSP00000261944:D387N;ENSP00000421078:D387N	ENSP00000261944:D387N	D	+	1	0	CDHR2	175935757	0.007000	0.16637	0.011000	0.14972	0.019000	0.09904	1.325000	0.33724	1.139000	0.42245	0.549000	0.68633	GAT		0.657	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		Missense_Mutation
HIST1H4K	8362	broad.mit.edu	37	6	27799108	27799108	+	Silent	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:27799108C>T	ENST00000357549.2	-	1	197	c.198G>A	c.(196-198)gtG>gtA	p.V66V		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	66					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.V66V(2)		breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						CGTCCCGGATCACGTTCTCCA	0.667																																																2	Substitution - coding silent(2)	ovary(1)|breast(1)	6											15.0	17.0	17.0					6																	27799108		2195	4268	6463	27907087	SO:0001819	synonymous_variant	8362			X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.198G>A	6.37:g.27799108C>T		Unknown		x	x	x	27907087	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000357549.2	37	CCDS4631.1	SNP	29	Broad																																																																																				0.667	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040156.1	NM_003541		Silent
MAS1L	116511	broad.mit.edu	37	6	29455289	29455289	+	Silent	SNP	A	A	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:29455289A>G	ENST00000377127.3	-	1	449	c.391T>C	c.(391-393)Tta>Cta	p.L131L		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	131					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L131L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						GTCACCTGTAAGAACCCCACT	0.507																																					NSCLC(153;755 1987 3859 11251 32945)											1	Substitution - coding silent(1)	ovary(1)	6											65.0	61.0	62.0					6																	29455289		2203	4300	6503	29563268	SO:0001819	synonymous_variant	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.391T>C	6.37:g.29455289A>G		Unknown		x	x	x	29563268	Q5SUN5	Silent	SNP	ENST00000377127.3	37	CCDS4661.1	SNP	3	Broad																																																																																				0.507	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967		Silent
MDC1	9656	broad.mit.edu	37	6	30671996	30671996	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0916-01	TCGA-13-0916-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:30671996G>C	ENST00000376406.3	-	10	5611	c.4964C>G	c.(4963-4965)cCa>cGa	p.P1655R	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Missense_Mutation_p.P1391R	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1655					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.P1655R(1)		breast(2)|kidney(1)|ovary(1)	4						AGAGGCTGCTGGTTCAACTGG	0.547								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	6											112.0	114.0	113.0					6																	30671996		2203	4300	6503	30779975	SO:0001583	missense	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4964C>G	6.37:g.30671996G>C	ENSP00000365588:p.Pro1655Arg	Somatic		x	x	x	30779975	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	37	CCDS34384.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	14.37	2.516175	0.44763	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.21361	2.01;2.01	3.46	-0.5	0.12012	.	0.821650	0.09962	N	0.733274	T	0.21227	0.0511	M	0.72894	2.215	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.972	T	0.05162	-1.0902	10	0.48119	T	0.1	0.0436	2.822	0.05474	0.3524:0.0:0.4459:0.2018	.	1391;1655	Q14676-2;Q14676	.;MDC1_HUMAN	R	1655;1391;1368;1221	ENSP00000365588:P1655R;ENSP00000365587:P1391R	ENSP00000365587:P1391R	P	-	2	0	MDC1	30779975	0.000000	0.05858	0.000000	0.03702	0.366000	0.29705	0.039000	0.13884	-0.122000	0.11766	0.449000	0.29647	CCA		0.547	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		Missense_Mutation
TNXB	7148	broad.mit.edu	37	6	32053728	32053728	+	Missense_Mutation	SNP	C	C	A	rs138850364	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:32053728C>A	ENST00000375244.3	-	7	3148	c.2947G>T	c.(2947-2949)Gcc>Tcc	p.A983S	TNXB_ENST00000375247.2_Missense_Mutation_p.A983S			P22105	TENX_HUMAN	tenascin XB	1070	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.A1070S(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCAGGCTGGGCGGTCCAGACC	0.687																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	58.0	54.0					6																	32053728		1329	2563	3892	32161706	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.2947G>T	6.37:g.32053728C>A	ENSP00000364393:p.Ala983Ser	Unknown		x	x	x	32161706	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051606	0.55218	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04758	3.56;3.56	3.89	2.99	0.34606	.	0.331049	0.21915	N	0.067244	T	0.03651	0.0104	L	0.34521	1.04	0.22500	N	0.999043	D	0.76494	0.999	D	0.80764	0.994	T	0.40997	-0.9533	10	0.16896	T	0.51	.	8.4092	0.32634	0.2336:0.7664:0.0:0.0	.	983	P22105-3	.	S	983	ENSP00000364393:A983S;ENSP00000364396:A983S	ENSP00000364393:A983S	A	-	1	0	TNXB	32161706	0.986000	0.35501	0.893000	0.35052	0.900000	0.52787	3.502000	0.53332	0.815000	0.34398	0.460000	0.39030	GCC		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		Missense_Mutation
SLC26A8	116369	broad.mit.edu	37	6	35987297	35987297	+	Splice_Site	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:35987297C>G	ENST00000490799.1	-	2	541	c.188G>C	c.(187-189)cGc>cCc	p.R63P	SLC26A8_ENST00000355574.2_Splice_Site_p.R63P|SLC26A8_ENST00000394602.2_Splice_Site_p.R63P	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8									p.R63P(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						ACACACGCACCGGCACTGGAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	6											201.0	151.0	168.0					6																	35987297		2203	4300	6503	36095275	SO:0001630	splice_region_variant	116369			AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.188+1G>C	6.37:g.35987297C>G		Unknown		x	x	x	36095275		Missense_Mutation	SNP	ENST00000490799.1	37	CCDS4813.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364300	0.61513	.	.	ENSG00000112053	ENST00000490799;ENST00000394602;ENST00000355574;ENST00000480663	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	4.79	3.0	0.34707	.	0.596683	0.14408	N	0.321455	T	0.16896	0.0406	L	0.32530	0.975	0.33883	D	0.636368	D;D	0.65815	0.995;0.985	P;P	0.59221	0.854;0.813	T	0.04961	-1.0915	9	.	.	.	.	7.2081	0.25919	0.0:0.7988:0.0:0.2012	.	63;63	Q96RN1;Q96RN1-2	S26A8_HUMAN;.	P	63;63;63;149	ENSP00000417638:R63P;ENSP00000378100:R63P;ENSP00000347778:R63P;ENSP00000420488:R149P	.	R	-	2	0	SLC26A8	36095275	0.986000	0.35501	0.975000	0.42487	0.752000	0.42762	0.717000	0.25851	0.736000	0.32559	0.650000	0.86243	CGC		0.517	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040325.2		Missense_Mutation	Missense_Mutation
TFAP2D	83741	broad.mit.edu	37	6	50718993	50718993	+	Silent	SNP	T	T	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:50718993T>C	ENST00000008391.3	+	7	1323	c.1095T>C	c.(1093-1095)acT>acC	p.T365T		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.T365T(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CCAGACCCACTCCAATTCTAG	0.368																																																1	Substitution - coding silent(1)	ovary(1)	6											108.0	99.0	102.0					6																	50718993		2203	4299	6502	50826952	SO:0001819	synonymous_variant	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1095T>C	6.37:g.50718993T>C		Unknown		x	x	x	50826952		Silent	SNP	ENST00000008391.3	37	CCDS4933.1	SNP	54	Broad																																																																																				0.368	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		Silent
GRIK2	2898	broad.mit.edu	37	6	102516286	102516286	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:102516286A>C	ENST00000421544.1	+	16	3117	c.2627A>C	c.(2626-2628)aAa>aCa	p.K876T	GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369137.3_Missense_Mutation_p.K800T|GRIK2_ENST00000369138.1_3'UTR|GRIK2_ENST00000369134.4_Missense_Mutation_p.K827T	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	876					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.K876T(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CGTCGGTTAAAACATAAGCCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	103.0	106.0					6																	102516286		2203	4300	6503	102622979	SO:0001583	missense	2898				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2627A>C	6.37:g.102516286A>C	ENSP00000397026:p.Lys876Thr	Unknown		x	x	x	102622979	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284552	0.80803	.	.	ENSG00000164418	ENST00000421544;ENST00000369137;ENST00000369134	T;T;T	0.12465	2.68;2.83;2.69	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.16342	0.0393	M	0.68593	2.085	0.52501	D	0.999953	P	0.49783	0.928	P	0.48982	0.597	T	0.00681	-1.1612	10	0.49607	T	0.09	.	16.1296	0.81418	1.0:0.0:0.0:0.0	.	876	Q13002	GRIK2_HUMAN	T	876;800;827	ENSP00000397026:K876T;ENSP00000358133:K800T;ENSP00000358130:K827T	ENSP00000358130:K827T	K	+	2	0	GRIK2	102622979	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.216000	0.71823	0.379000	0.24179	AAA		0.408	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			Missense_Mutation
TNFAIP3	7128	broad.mit.edu	37	6	138202410	138202410	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:138202410A>G	ENST00000237289.4	+	9	2393	c.2327A>G	c.(2326-2328)aAc>aGc	p.N776S		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	776	Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.N776S(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GCCAAGTGCAACGGCTACTGC	0.612			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(25)|ovary(1)	6											76.0	83.0	81.0					6																	138202410		2202	4298	6500	138244103	SO:0001583	missense	7128			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2327A>G	6.37:g.138202410A>G	ENSP00000237289:p.Asn776Ser	Unknown		x	x	x	138244103	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	13.01	2.110811	0.37242	.	.	ENSG00000118503	ENST00000237289	T	0.52526	0.66	5.67	2.0	0.26442	Zinc finger, A20-type (3);	0.251971	0.47455	N	0.000237	T	0.16300	0.0392	L	0.31926	0.97	0.35182	D	0.772551	B	0.06786	0.001	B	0.09377	0.004	T	0.03493	-1.1031	10	0.44086	T	0.13	-16.0584	7.848	0.29437	0.7552:0.0:0.2448:0.0	.	776	P21580	TNAP3_HUMAN	S	776	ENSP00000237289:N776S	ENSP00000237289:N776S	N	+	2	0	TNFAIP3	138244103	0.989000	0.36119	0.015000	0.15790	0.990000	0.78478	2.651000	0.46674	0.098000	0.17522	0.460000	0.39030	AAC		0.612	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			Missense_Mutation
KCTD7	154881	broad.mit.edu	37	7	66104165	66104165	+	Silent	SNP	G	G	C			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr7:66104165G>C	ENST00000275532.3	+	4	1000	c.816G>C	c.(814-816)gtG>gtC	p.V272V	KCTD7_ENST00000443322.1_Silent_p.V272V	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	272					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.V272V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						AGCACCTCGTGAACCACTACT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	7											90.0	72.0	78.0					7																	66104165		2203	4300	6503	65741600	SO:0001819	synonymous_variant	154881			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.816G>C	7.37:g.66104165G>C		Unknown		x	x	x	65741600	A4D2M4|Q8IVR0	Silent	SNP	ENST00000275532.3	37	CCDS5534.1	SNP	45	Broad																																																																																				0.582	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033		Silent
CACNA2D1	781	broad.mit.edu	37	7	81598283	81598283	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr7:81598283C>T	ENST00000356253.5	-	29	2606	c.2351G>A	c.(2350-2352)gGa>gAa	p.G784E	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.G772E|CACNA2D1_ENST00000535308.1_Intron			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	784					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G772E(2)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGCACCAGGTCCACTTTCtaa	0.284																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	7											73.0	78.0	76.0					7																	81598283		2203	4295	6498	81436219	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2351G>A	7.37:g.81598283C>T	ENSP00000348589:p.Gly784Glu	Unknown		x	x	x	81436219	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249383	0.39797	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.68903	-0.36;-0.36	5.07	5.07	0.68467	.	0.333148	0.34580	N	0.003860	T	0.53802	0.1819	L	0.31065	0.9	0.80722	D	1	B	0.31383	0.321	B	0.31946	0.138	T	0.50233	-0.8852	10	0.12430	T	0.62	-18.191	15.9532	0.79859	0.0:1.0:0.0:0.0	.	772	P54289-2	.	E	772;791;784	ENSP00000349320:G772E;ENSP00000348589:G784E	ENSP00000284088:G791E	G	-	2	0	CACNA2D1	81436219	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.662000	0.54510	2.518000	0.84900	0.484000	0.47621	GGA		0.284	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
NAT16	375607	broad.mit.edu	37	7	100815616	100815616	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr7:100815616G>T	ENST00000300303.2	-	4	1092	c.854C>A	c.(853-855)cCc>cAc	p.P285H	NAT16_ENST00000455377.1_Missense_Mutation_p.P285H	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)	285							N-acetyltransferase activity (GO:0008080)	p.P285H(1)									GTGCGGGATGGGGAAGGGGCG	0.711																																																1	Substitution - Missense(1)	ovary(1)	7											8.0	9.0	8.0					7																	100815616		2139	4198	6337	100602336	SO:0001583	missense	375607			AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.854C>A	7.37:g.100815616G>T	ENSP00000300303:p.Pro285His	Unknown		x	x	x	100602336	B3KRS2|Q8NDR1	Missense_Mutation	SNP	ENST00000300303.2	37	CCDS5713.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	10.87	1.471625	0.26423	.	.	ENSG00000167011	ENST00000300303;ENST00000455377	T;T	0.47528	0.84;0.84	3.59	-0.446	0.12238	.	0.522911	0.15359	N	0.266512	T	0.29223	0.0727	L	0.29908	0.895	0.09310	N	0.999993	B	0.14012	0.009	B	0.10450	0.005	T	0.15093	-1.0449	10	0.49607	T	0.09	.	4.1861	0.10398	0.2979:0.0:0.5401:0.162	.	285	Q8N8M0	CG052_HUMAN	H	285	ENSP00000300303:P285H;ENSP00000395125:P285H	ENSP00000300303:P285H	P	-	2	0	C7orf52	100602336	1.000000	0.71417	0.005000	0.12908	0.964000	0.63967	2.813000	0.48002	-0.091000	0.12440	0.456000	0.33151	CCC		0.711	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347465.1	NM_198571		Missense_Mutation
SLC26A3	1811	broad.mit.edu	37	7	107423769	107423769	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr7:107423769C>G	ENST00000340010.5	-	9	1184	c.1000G>C	c.(1000-1002)Gag>Cag	p.E334Q	SLC26A3_ENST00000422236.2_Missense_Mutation_p.E299Q	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	334					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)	p.E334Q(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TGGAAAGTCTCCACGTCAGGT	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											78.0	78.0	78.0					7																	107423769		2203	4300	6503	107211005	SO:0001583	missense	1811			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1000G>C	7.37:g.107423769C>G	ENSP00000345873:p.Glu334Gln	Unknown		x	x	x	107211005		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	G	5.307	0.242035	0.10077	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.92805	-3.11;-3.11	5.28	-10.6	0.00265	Sulphate transporter (1);	2.159440	0.01305	N	0.010412	D	0.84070	0.5391	N	0.20685	0.6	0.09310	N	1	B;B	0.14805	0.004;0.011	B;B	0.15870	0.004;0.014	T	0.72833	-0.4173	10	0.29301	T	0.29	.	11.9673	0.53042	0.0496:0.4286:0.073:0.4488	.	299;334	G5E9U3;P40879	.;S26A3_HUMAN	Q	299;334	ENSP00000415817:E299Q;ENSP00000345873:E334Q	ENSP00000345873:E334Q	E	-	1	0	SLC26A3	107211005	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.951000	0.00327	-5.671000	0.00011	-6.464000	0.00000	GAG		0.413	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111		Missense_Mutation
PLXNA4	91584	broad.mit.edu	37	7	132193188	132193188	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr7:132193188C>A	ENST00000359827.3	-	2	1227	c.265G>T	c.(265-267)Gac>Tac	p.D89Y	PLXNA4_ENST00000423507.2_Missense_Mutation_p.D89Y|PLXNA4_ENST00000321063.4_Missense_Mutation_p.D89Y|PLXNA4_ENST00000378539.5_Missense_Mutation_p.D89Y			Q9HCM2	PLXA4_HUMAN	plexin A4	89	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.D89H(4)|p.D89Y(1)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TTGTCCTCGTCCGGCCCTGTC	0.552																																																5	Substitution - Missense(5)	lung(4)|ovary(1)	7											62.0	63.0	62.0					7																	132193188		2203	4300	6503	131843728	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.265G>T	7.37:g.132193188C>A	ENSP00000352882:p.Asp89Tyr	Unknown		x	x	x	131843728	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	13.16	2.154302	0.38021	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.42964	U	0.000639	T	0.20129	0.0484	L	0.44542	1.39	0.49213	D	0.999764	P;P;P	0.51537	0.799;0.946;0.917	P;P;P	0.56163	0.574;0.793;0.722	T	0.00143	-1.1995	10	0.46703	T	0.11	.	14.0472	0.64712	0.1509:0.8491:0.0:0.0	.	89;89;89	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	Y	89	ENSP00000323194:D89Y;ENSP00000352882:D89Y;ENSP00000392772:D89Y;ENSP00000367800:D89Y	ENSP00000323194:D89Y	D	-	1	0	PLXNA4	131843728	1.000000	0.71417	0.992000	0.48379	0.218000	0.24690	5.930000	0.70104	2.537000	0.85549	0.462000	0.41574	GAC		0.552	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		Missense_Mutation
GPR21	2844	broad.mit.edu	37	9	125797414	125797414	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr9:125797414A>G	ENST00000373642.1	+	1	609	c.569A>G	c.(568-570)tAc>tGc	p.Y190C	RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000373643.5_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	190					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.Y190C(1)		endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						ACCGACTCCTACTTCACCCTG	0.507																																																1	Substitution - Missense(1)	ovary(1)	9											151.0	134.0	140.0					9																	125797414		2203	4300	6503	124837235	SO:0001583	missense	2844			BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.569A>G	9.37:g.125797414A>G	ENSP00000362746:p.Tyr190Cys	Unknown		x	x	x	124837235	B2R8W9|Q6NXU2	Missense_Mutation	SNP	ENST00000373642.1	37	CCDS6849.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	10.46	1.356498	0.24598	.	.	ENSG00000188394	ENST00000373642;ENST00000412269	T	0.74315	-0.83	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.536026	0.17626	U	0.167554	T	0.81786	0.4896	L	0.58354	1.805	0.22479	N	0.999064	D	0.71674	0.998	D	0.63113	0.911	T	0.74532	-0.3634	10	0.66056	D	0.02	-13.2237	12.124	0.53907	0.8569:0.1431:0.0:0.0	.	190	Q99679	GPR21_HUMAN	C	190	ENSP00000362746:Y190C	ENSP00000362746:Y190C	Y	+	2	0	GPR21	124837235	0.964000	0.33143	0.997000	0.53966	0.798000	0.45092	2.294000	0.43567	2.075000	0.62263	0.383000	0.25322	TAC		0.507	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053965.1	NM_005294		Missense_Mutation
GDPD2	54857	broad.mit.edu	37	X	69646529	69646529	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chrX:69646529C>T	ENST00000374382.3	+	7	745	c.494C>T	c.(493-495)gCc>gTc	p.A165V	GDPD2_ENST00000536730.1_Missense_Mutation_p.A86V|GDPD2_ENST00000538649.1_Missense_Mutation_p.A86V|GDPD2_ENST00000472623.1_Intron|GDPD2_ENST00000453994.2_Missense_Mutation_p.A165V	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	165					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.A165V(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					ATTGGAGCAGCCGCTGGAATT	0.617																																																1	Substitution - Missense(1)	ovary(1)	X											44.0	37.0	39.0					X																	69646529		2203	4300	6503	69563254	SO:0001583	missense	54857			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.494C>T	X.37:g.69646529C>T	ENSP00000363503:p.Ala165Val	Unknown		x	x	x	69563254	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	2.899	-0.227948	0.06022	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.17691	2.26;2.84;2.84;2.84	4.92	2.37	0.29283	.	0.147691	0.45126	N	0.000381	T	0.03783	0.0107	N	0.00483	-1.445	0.30754	N	0.744779	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.34153	-0.9840	9	.	.	.	-3.8015	7.6687	0.28447	0.0:0.1818:0.0:0.8182	.	165;86;165	B4DVC9;B4DRH4;Q9HCC8	.;.;GDPD2_HUMAN	V	165;86;86;165	ENSP00000414019:A165V;ENSP00000445982:A86V;ENSP00000444601:A86V;ENSP00000363503:A165V	.	A	+	2	0	GDPD2	69563254	0.997000	0.39634	0.831000	0.32960	0.936000	0.57629	2.563000	0.45922	0.217000	0.20800	-0.354000	0.07668	GCC		0.617	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711		Missense_Mutation
SLC16A2	6567	broad.mit.edu	37	X	73751290	73751290	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chrX:73751290G>A	ENST00000587091.1	+	6	1699	c.1522G>A	c.(1522-1524)Gag>Aag	p.E508K	SLC16A2_ENST00000276033.5_Missense_Mutation_p.E582K	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	508					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)	p.E582K(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	GTTCAAGAAAGAGCAGAGAGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	92.0	97.0					X																	73751290		2203	4300	6503	73668015	SO:0001583	missense	6567				CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.1522G>A	X.37:g.73751290G>A	ENSP00000465734:p.Glu508Lys	Somatic		x	x	x	73668015	Q7Z797	Missense_Mutation	SNP	ENST00000587091.1	37	CCDS14426.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.12	1.841613	0.32513	.	.	ENSG00000147100	ENST00000276033	T	0.10477	2.87	5.3	4.39	0.52855	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.775103	0.12099	N	0.499630	T	0.08582	0.0213	L	0.38175	1.15	0.28989	N	0.888149	B	0.10296	0.003	B	0.14023	0.01	T	0.19614	-1.0300	10	0.19590	T	0.45	.	6.6736	0.23082	0.1899:0.2266:0.5835:0.0	.	508	P36021	MOT8_HUMAN	K	582	ENSP00000276033:E582K	ENSP00000276033:E582K	E	+	1	0	SLC16A2	73668015	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.444000	0.44890	2.210000	0.71456	0.529000	0.55759	GAG		0.547	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057266.3			Missense_Mutation
ESX1	80712	broad.mit.edu	37	X	103495039	103495039	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chrX:103495039G>A	ENST00000372588.4	-	4	1174	c.1091C>T	c.(1090-1092)gCg>gTg	p.A364V		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	364	15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)	p.A364V(1)		endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						TGGCAGAGGCGCCATGGGCGG	0.746																																					Pancreas(200;1705 2227 25194 28471 45274)											1	Substitution - Missense(1)	ovary(1)	X											10.0	10.0	10.0					X																	103495039		2184	4267	6451	103381695	SO:0001583	missense	80712			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.1091C>T	X.37:g.103495039G>A	ENSP00000361669:p.Ala364Val	Unknown		x	x	x	103381695	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	37	CCDS14516.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881645	0.33255	.	.	ENSG00000123576	ENST00000372588	T	0.75050	-0.9	2.33	0.133	0.14766	.	.	.	.	.	T	0.66992	0.2846	L	0.43152	1.355	0.09310	N	1	P	0.51147	0.942	P	0.46885	0.53	T	0.58002	-0.7713	9	0.87932	D	0	7.4327	5.0613	0.14559	0.1496:0.2099:0.6404:0.0	.	364	Q8N693	ESX1_HUMAN	V	364	ENSP00000361669:A364V	ENSP00000361669:A364V	A	-	2	0	ESX1	103381695	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.415000	0.02469	-0.225000	0.09913	0.292000	0.19580	GCG		0.746	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448		Missense_Mutation
SKIDA1	387640	broad.mit.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517															2	Insertion - In frame(2)	soft_tissue(2)	10								3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				21845473	SO:0001652	inframe_insertion	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup	Unknown		Capture	Illumina GAIIx	Phase_I	21845472	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	ENST00000449193.2	37	CCDS44363.1	INS	22	Broad																																																																																				0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371		In_Frame_Ins
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	T	-	rs11571510|rs557543525|rs202189171	byFrequency	TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr18:3452223delT	ENST00000330513.5	+	1	549	c.246delT	c.(244-246)cctfs	p.P85fs	TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000551541.1_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000405385.3_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	85					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P83fs*51(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													T|T|-|deletion	1280	0.255591	0.3419	0.2349	5008	,	,		10884	0.0109		0.4304	False		,,,				2504	0.226															1	Deletion - Frameshift(1)	large_intestine(1)	18											10.0	11.0	10.0					18																	3452223		2031	3818	5849	3442223	SO:0001589	frameshift_variant	7050			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.246delT	18.37:g.3452223delT	ENSP00000327959:p.Pro85fs	Unknown		Capture	Illumina GAIIx	Phase_I	3442223	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Del	DEL	ENST00000330513.5	37	CCDS11834.1	DEL	54	Broad																																																																																				0.766	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695		Frame_Shift_Del
CHDH	55349	broad.mit.edu	37	3	53852048	53852049	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-13-0916-01	TCGA-13-0916-10			-	CA	CA	CA	Unknown	Valid	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr3:53852048_53852049delCA	ENST00000315251.6	-	9	1977_1978	c.1540_1541delTG	c.(1540-1542)tgcfs	p.C514fs		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	514					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)	p.C514fs*3(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	CTTACAGGTGCACGAGGGGTGG	0.594																																																1	Deletion - Frameshift(1)	ovary(1)	3																																								53827089	SO:0001589	frameshift_variant	55349			AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1540_1541delTG	3.37:g.53852048_53852049delCA	ENSP00000319851:p.Cys514fs	Somatic		Capture	Illumina GAIIx	Phase_I	53827088	Q9NY17	Frame_Shift_Del	DEL	ENST00000315251.6	37	CCDS2873.1	DEL	25	Broad																																																																																				0.594	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397		Frame_Shift_Del
L3MBTL3	84456	broad.mit.edu	37	6	130460796	130460825	+	In_Frame_Del	DEL	CATTGTTAAAATTATGAGCATTAAACTGGG	CATTGTTAAAATTATGAGCATTAAACTGGG	-			TCGA-13-0916-01	TCGA-13-0916-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0916-01	TCGA-13-0916-10	g.chr6:130460796_130460825delCATTGTTAAAATTATGAGCATTAAACTGGG	ENST00000529410.1	+	25	2720_2749	c.2241_2270delCATTGTTAAAATTATGAGCATTAAACTGGG	c.(2239-2271)gacattgttaaaattatgagcattaaactgggc>gac	p.IVKIMSIKLG748del	L3MBTL3_ENST00000368139.2_In_Frame_Del_p.IVKIMSIKLG723del|L3MBTL3_ENST00000361794.2_In_Frame_Del_p.IVKIMSIKLG748del|L3MBTL3_ENST00000526019.1_In_Frame_Del_p.IVKIMSIKLG723del|L3MBTL3_ENST00000533560.1_In_Frame_Del_p.IVKIMSIKLG723del|RP11-73O6.3_ENST00000609978.1_RNA|RP11-73O6.3_ENST00000415964.1_RNA|RP11-73O6.3_ENST00000591297.1_RNA|L3MBTL3_ENST00000368136.2_In_Frame_Del_p.IVKIMSIKLG748del			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	748	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.I748_G757del(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CTCAAACAGACATTGTTAAAATTATGAGCATTAAACTGGGCCCTGCTCTC	0.357																																																1	Deletion - In frame(1)	ovary(1)	6																																								130502518	SO:0001651	inframe_deletion	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.2241_2270delCATTGTTAAAATTATGAGCATTAAACTGGG	6.37:g.130460796_130460825delCATTGTTAAAATTATGAGCATTAAACTGGG	ENSP00000431962:p.Ile748_Gly757del	Unknown		Capture	Illumina GAIIx	Phase_I	130502489	Q4VXE1|Q5VUM9|Q6P9B5	In_Frame_Del	DEL	ENST00000529410.1	37	CCDS34537.1	DEL	17	Broad																																																																																				0.357	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074		In_Frame_Del
