#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACAD10	80724	hgsc.bcm.edu	37	12	112193479	112193479	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr12:112193479C>T	ENST00000313698.4	+	20	3124	c.2969C>T	c.(2968-2970)gCc>gTc	p.A990V	RP11-162P23.2_ENST00000546840.2_Missense_Mutation_p.P12S|ACAD10_ENST00000455480.2_Missense_Mutation_p.A1021V	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	990						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.A990V(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						CAGGCTGCAGCCTTGGATATA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											116.0	118.0	117.0					12																	112193479		2203	4300	6503	110677862	SO:0001583	missense	80724			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2969C>T	12.37:g.112193479C>T	ENSP00000325137:p.Ala990Val	Somatic		Capture	SOLID	Phase_IV	110677862	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762751	0.69763	.	.	ENSG00000111271	ENST00000455480;ENST00000313698;ENST00000512792;ENST00000546899	D;D	0.96011	-3.88;-3.88	4.98	4.98	0.66077	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.502070	0.19052	N	0.124001	D	0.96213	0.8765	M	0.62209	1.925	0.80722	D	1	B;P	0.38473	0.36;0.633	B;P	0.49421	0.239;0.61	D	0.96056	0.9035	10	0.52906	T	0.07	.	17.1614	0.86804	0.0:1.0:0.0:0.0	.	1021;990	G3XAJ0;Q6JQN1	.;ACD10_HUMAN	V	1021;990;145;10	ENSP00000389813:A1021V;ENSP00000325137:A990V	ENSP00000325137:A990V	A	+	2	0	ACAD10	110677862	0.996000	0.38824	0.933000	0.37362	0.953000	0.61014	3.598000	0.54038	2.571000	0.86741	0.561000	0.74099	GCC		0.542	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		Missense_Mutation
ACTR1A	10121	hgsc.bcm.edu	37	10	104240898	104240898	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr10:104240898G>C	ENST00000369905.4	-	10	1082	c.1019C>G	c.(1018-1020)aCg>aGg	p.T340R	ACTR1A_ENST00000446605.2_Missense_Mutation_p.T293R|ACTR1A_ENST00000470322.1_5'UTR|ACTR1A_ENST00000545684.1_Missense_Mutation_p.T266R|RP11-18I14.11_ENST00000608017.1_RNA|ACTR1A_ENST00000487599.1_Missense_Mutation_p.H319Q	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	340					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)	p.T340R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CCCAATCCACGTGGAATACAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											127.0	126.0	127.0					10																	104240898		2203	4300	6503	104230888	SO:0001583	missense	10121			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.1019C>G	10.37:g.104240898G>C	ENSP00000358921:p.Thr340Arg	Somatic		Capture	SOLID	Phase_IV	104230888	B2R6B0|P42024	Missense_Mutation	SNP	ENST00000369905.4	37	CCDS7536.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	32	5.157417	0.94686	.	.	ENSG00000138107	ENST00000369905;ENST00000545684;ENST00000446605	D;D;D	0.94966	-3.57;-3.57;-3.57	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.98369	0.9458	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99053	1.0828	10	0.87932	D	0	.	19.9335	0.97129	0.0:0.0:1.0:0.0	.	340	P61163	ACTZ_HUMAN	R	340;266;293	ENSP00000358921:T340R;ENSP00000438890:T266R;ENSP00000406028:T293R	ENSP00000358921:T340R	T	-	2	0	ACTR1A	104230888	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.256000	0.95535	2.722000	0.93159	0.462000	0.41574	ACG		0.502	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050053.1			Missense_Mutation
ACVR1C	130399	hgsc.bcm.edu	37	2	158390527	158390527	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:158390527C>T	ENST00000243349.8	-	9	1745	c.1385G>A	c.(1384-1386)cGt>cAt	p.R462H	ACVR1C_ENST00000335450.7_Missense_Mutation_p.R382H|ACVR1C_ENST00000409680.3_Missense_Mutation_p.R412H|ACVR1C_ENST00000348328.5_Missense_Mutation_p.R305H	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.R462H(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CCAACACTCACGCATTATTCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	89.0	87.0					2																	158390527		2203	4300	6503	158098773	SO:0001583	missense	130399			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1385G>A	2.37:g.158390527C>T	ENSP00000243349:p.Arg462His	Somatic		Capture	SOLID	Phase_IV	158098773		Missense_Mutation	SNP	ENST00000243349.8	37	CCDS2205.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	34	5.360834	0.95877	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.133611	0.30911	N	0.008625	T	0.80854	0.4703	M	0.82517	2.595	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.987	D;P;P	0.65684	0.937;0.815;0.86	T	0.83353	-0.0002	10	0.72032	D	0.01	.	18.9895	0.92786	0.0:1.0:0.0:0.0	.	305;382;462	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	H	462;412;305;382	ENSP00000243349:R462H;ENSP00000387168:R412H;ENSP00000335139:R305H;ENSP00000335178:R382H	ENSP00000243349:R462H	R	-	2	0	ACVR1C	158098773	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	7.736000	0.84948	2.574000	0.86865	0.591000	0.81541	CGT		0.413	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		Missense_Mutation
ANKRD55	79722	hgsc.bcm.edu	37	5	55455707	55455707	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr5:55455707G>T	ENST00000341048.4	-	6	587	c.436C>A	c.(436-438)Ctg>Atg	p.L146M	ANKRD55_ENST00000513241.2_Missense_Mutation_p.L117M|ANKRD55_ENST00000505970.2_5'UTR|ANKRD55_ENST00000504958.2_Missense_Mutation_p.L146M	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	146										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TGTTGCAACAGGACCGTGAGG	0.448																																																0			5											128.0	114.0	119.0					5																	55455707		2203	4300	6503	55491464	SO:0001583	missense	79722			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.436C>A	5.37:g.55455707G>T	ENSP00000342295:p.Leu146Met	Somatic		Capture	SOLID	Phase_IV	55491464	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023613	0.54683	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958;ENST00000513241;ENST00000519586	T;T;T	0.66995	1.33;-0.24;-0.24	5.33	4.34	0.51931	.	0.000000	0.64402	D	0.000004	T	0.82213	0.4988	M	0.88775	2.98	0.40530	D	0.98092	D	0.76494	0.999	D	0.87578	0.998	D	0.84093	0.0391	10	0.87932	D	0	.	8.8775	0.35354	0.1202:0.0:0.8798:0.0	.	146	B3KVT8	.	M	146;146;146;117;146	ENSP00000342295:L146M;ENSP00000424230:L146M;ENSP00000423507:L117M	ENSP00000342295:L146M	L	-	1	2	ANKRD55	55491464	1.000000	0.71417	0.995000	0.50966	0.583000	0.36354	2.418000	0.44662	1.108000	0.41662	0.650000	0.86243	CTG		0.448	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669		Missense_Mutation
ARFGAP1	55738	hgsc.bcm.edu	37	20	61907467	61907467	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr20:61907467A>G	ENST00000370283.4	+	3	225	c.85A>G	c.(85-87)Aat>Gat	p.N29D	ARFGAP1_ENST00000519604.1_Intron|ARFGAP1_ENST00000353546.3_Missense_Mutation_p.N29D|ARFGAP1_ENST00000547204.1_Intron|ARFGAP1_ENST00000519273.2_5'UTR|ARFGAP1_ENST00000370275.4_Missense_Mutation_p.N29D	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	29	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					TGGCGCGTTCAATCCTCAGTG	0.622																																																0			20											149.0	136.0	140.0					20																	61907467		2203	4300	6503	61377912	SO:0001583	missense	55738			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.85A>G	20.37:g.61907467A>G	ENSP00000359306:p.Asn29Asp	Somatic		Capture	SOLID	Phase_IV	61377912	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	ENST00000370283.4	37	CCDS13515.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712433	0.89112	.	.	ENSG00000101199	ENST00000370283;ENST00000523114;ENST00000370275;ENST00000353546;ENST00000522403;ENST00000550188	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	4.68	4.68	0.58851	.	0.094539	0.64402	D	0.000001	T	0.60444	0.2269	L	0.60957	1.885	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.85130	0.997;0.994;0.989	T	0.64364	-0.6425	10	0.72032	D	0.01	-9.1718	14.4157	0.67148	1.0:0.0:0.0:0.0	.	29;29;29	B7ZBI2;Q8N6T3;Q8N6T3-2	.;ARFG1_HUMAN;.	D	29	ENSP00000359306:N29D;ENSP00000428355:N29D;ENSP00000359298:N29D;ENSP00000314615:N29D;ENSP00000430929:N29D;ENSP00000449515:N29D	ENSP00000314615:N29D	N	+	1	0	ARFGAP1	61377912	1.000000	0.71417	0.972000	0.41901	0.930000	0.56654	9.016000	0.93645	1.872000	0.54250	0.379000	0.24179	AAT		0.622	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209		Missense_Mutation
ARMCX2	9823	hgsc.bcm.edu	37	X	100911501	100911501	+	Silent	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chrX:100911501G>C	ENST00000328766.5	-	5	1527	c.1074C>G	c.(1072-1074)acC>acG	p.T358T	ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Silent_p.T358T|ARMCX2_ENST00000356824.4_Silent_p.T358T	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	358						integral component of membrane (GO:0016021)		p.T358T(2)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						CTCTGCGCTGGGTCTCGGGCT	0.572																																																2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	X											72.0	63.0	66.0					X																	100911501		2203	4300	6503	100798157	SO:0001819	synonymous_variant	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1074C>G	X.37:g.100911501G>C		Somatic		Capture	SOLID	Phase_IV	100798157	O60267|Q5H9D9	Silent	SNP	ENST00000328766.5	37	CCDS14490.1	SNP	43	Baylor																																																																																				0.572	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		Silent
ASTL	431705	hgsc.bcm.edu	37	2	96801092	96801094	+	In_Frame_Del	DEL	GCC	GCC	-	rs373382016		TCGA-13-0919-01	TCGA-13-0919-10	GCC	GCC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:96801092_96801094delGCC	ENST00000342380.2	-	3	238_240	c.239_241delGGC	c.(238-243)cggccg>ccg	p.R80del		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)									p.R80delR(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GCACTCACCGGCCGGATGATGTC	0.606																																																1	Deletion - In frame(1)	ovary(1)	2																																								96164821	SO:0001651	inframe_deletion	431705			AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.239_241delGGC	2.37:g.96801092_96801094delGCC	ENSP00000343674:p.Arg80del	Somatic		Capture	SOLID	Phase_IV	96164819		In_Frame_Del	DEL	ENST00000342380.2	37	CCDS33249.1	DEL	42	Baylor																																																																																				0.606	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1			In_Frame_Del
ATP2A3	489	hgsc.bcm.edu	37	17	3831274	3831274	+	Intron	SNP	C	C	G	rs138187501		TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:3831274C>G	ENST00000352011.3	-	21	3123				ATP2A3_ENST00000397039.1_Splice_Site|ATP2A3_ENST00000309890.7_Intron|ATP2A3_ENST00000359983.3_Splice_Site|ATP2A3_ENST00000397041.3_Intron|ATP2A3_ENST00000397035.3_Intron|ATP2A3_ENST00000397043.3_Intron			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous						blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CCGGAGCTCACCCCTGCTTCC	0.632																																					GBM(32;29 774 15719 37967)											1	Unknown(1)	ovary(1)	17											103.0	91.0	95.0					17																	3831274		2203	4300	6503	3778023	SO:0001627	intron_variant	489				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.3068+259G>C	17.37:g.3831274C>G		Somatic		Capture	SOLID	Phase_IV	3778023	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Splice_Site_SNP	SNP	ENST00000352011.3	37	CCDS11041.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	2.108	-0.404542	0.04832	.	.	ENSG00000074370	ENST00000397039;ENST00000359983	.	.	.	3.89	-3.72	0.04411	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.4203	0.04447	0.143:0.246:0.4217:0.1893	.	.	.	.	.	-1	.	.	.	-	.	.	ATP2A3	3778023	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	-0.179000	0.09768	-0.646000	0.05452	-0.339000	0.08088	.		0.632	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953		Splice_Site_SNP
BIK	638	hgsc.bcm.edu	37	22	43520091	43520091	+	Silent	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr22:43520091C>G	ENST00000216115.2	+	2	126	c.63C>G	c.(61-63)ctC>ctG	p.L21L		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	21					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				ATGAGCAGCTCCTGGAACCCC	0.527																																																0			22											112.0	114.0	113.0					22																	43520091		2203	4300	6503	41850035	SO:0001819	synonymous_variant	638			U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.63C>G	22.37:g.43520091C>G		Somatic		Capture	SOLID	Phase_IV	41850035	Q16582|Q6FH93	Silent	SNP	ENST00000216115.2	37	CCDS14044.1	SNP	30	Baylor																																																																																				0.527	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319676.1	NM_001197		Silent
LAMTOR1	55004	hgsc.bcm.edu	37	11	71809888	71809888	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr11:71809888A>T	ENST00000278671.5	-	3	367	c.205T>A	c.(205-207)Tct>Act	p.S69T	LRTOMT_ENST00000307198.7_Intron|LAMTOR1_ENST00000539797.1_5'UTR|LRTOMT_ENST00000419228.1_Intron|LAMTOR1_ENST00000535107.1_Missense_Mutation_p.S69T|LAMTOR1_ENST00000538404.1_Missense_Mutation_p.S69T|LAMTOR1_ENST00000545249.1_Missense_Mutation_p.S69T|LRTOMT_ENST00000439209.1_Intron|LRTOMT_ENST00000435085.1_Intron	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1	69				S -> P (in Ref. 2; CAG33528). {ECO:0000305}.	cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						TCTGCAGCAGACACATCAATG	0.567																																																0			11											85.0	56.0	66.0					11																	71809888		2010	3829	5839	71487536	SO:0001583	missense	55004			AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869	ENST00000278671.5:c.205T>A	11.37:g.71809888A>T	ENSP00000278671:p.Ser69Thr	Somatic		Capture	SOLID	Phase_IV	71487536	Q8WZ09|Q9NWT0	Missense_Mutation	SNP	ENST00000278671.5	37	CCDS8209.1	SNP	10	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.102961|5.102961	0.94245|0.94245	.|.	.|.	ENSG00000149357|ENSG00000149357	ENST00000544594|ENST00000545249;ENST00000535107;ENST00000278671;ENST00000538404	.|T;T;T;T	.|0.45668	.|0.89;0.89;0.89;0.89	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.47248	.|0.1435	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	.|P	.|0.42518	.|0.782	.|B	.|0.40375	.|0.327	.|T	.|0.53408	.|-0.8443	.|10	0.56958|0.62326	D|D	0.05|0.03	.|.	15.8237|15.8237	0.78678|0.78678	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|69	.|Q6IAA8	.|LTOR1_HUMAN	X|T	55|69	.|ENSP00000440738:S69T;ENSP00000445170:S69T;ENSP00000278671:S69T;ENSP00000439011:S69T	ENSP00000439482:C50X|ENSP00000278671:S69T	C|S	-|-	3|1	2|0	LAMTOR1|LAMTOR1	71487536|71487536	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.823000|0.823000	0.46562|0.46562	6.875000|6.875000	0.75551|0.75551	2.224000|2.224000	0.72417|0.72417	0.533000|0.533000	0.62120|0.62120	TGT|TCT		0.567	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396733.1	NM_017907		Missense_Mutation
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493549	77493549	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr14:77493549G>A	ENST00000238647.3	-	1	1485	c.587C>T	c.(586-588)cCa>cTa	p.P196L		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	196	Gly/Pro-rich.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.P196L(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAAGCCGTTTGGGCCCCCCAG	0.687																																																1	Substitution - Missense(1)	ovary(1)	14											31.0	30.0	30.0					14																	77493549		2200	4299	6499	76563302	SO:0001583	missense	64207			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.587C>T	14.37:g.77493549G>A	ENSP00000238647:p.Pro196Leu	Somatic		Capture	SOLID	Phase_IV	76563302	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	37	CCDS9854.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076233	0.36662	.	.	ENSG00000119669	ENST00000238647	T	0.65178	-0.14	3.66	2.76	0.32466	.	0.000000	0.56097	U	0.000029	T	0.45196	0.1330	L	0.38175	1.15	0.44852	D	0.99786	B	0.06786	0.001	B	0.04013	0.001	T	0.19582	-1.0301	10	0.17369	T	0.5	0.0421	7.2918	0.26370	0.2101:0.0:0.7899:0.0	.	196	Q9H1B7	I2BPL_HUMAN	L	196	ENSP00000238647:P196L	ENSP00000238647:P196L	P	-	2	0	IRF2BPL	76563302	1.000000	0.71417	0.983000	0.44433	0.935000	0.57460	3.137000	0.50562	0.742000	0.32697	0.298000	0.19748	CCA		0.687	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496		Missense_Mutation
CCDC178	374864	hgsc.bcm.edu	37	18	30847180	30847180	+	Missense_Mutation	SNP	C	C	T	rs58448816	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr18:30847180C>T	ENST00000383096.3	-	13	1440	c.1258G>A	c.(1258-1260)Gat>Aat	p.D420N	CCDC178_ENST00000300227.8_Missense_Mutation_p.D420N|CCDC178_ENST00000402325.1_Missense_Mutation_p.D420N|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.D420N|CCDC178_ENST00000583930.1_Missense_Mutation_p.D420N|CCDC178_ENST00000579947.1_Missense_Mutation_p.D420N|CCDC178_ENST00000406524.2_Missense_Mutation_p.D420N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	420			D -> N (in dbSNP:rs58448816).														GCATAAAAATCATTAACTGCT	0.313													T|||	436	0.0870607	0.1498	0.0432	5008	,	,		15037	0.1171		0.0378	False		,,,				2504	0.0532															0			18						T	ASN/ASP,ASN/ASP	550,3854	770.4+/-413.7	32,486,1684	68.0	71.0	70.0		1258,1258	-2.5	0.0	18	dbSNP_129	70	329,8261	799.4+/-407.4	3,323,3969	yes	missense,missense	C18orf34	NM_001105528.1,NM_198995.2	23,23	35,809,5653	TT,TC,CC		3.83,12.4886,6.7647	benign,benign	420/868,420/830	30847180	879,12115	2202	4295	6497	29101178	SO:0001583	missense	374864			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1258G>A	18.37:g.30847180C>T	ENSP00000372576:p.Asp420Asn	Somatic		Capture	SOLID	Phase_IV	29101178	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	SNP	29	Baylor	175	0.08012820512820513	64	0.13008130081300814	13	0.03591160220994475	75	0.13111888111888112	23	0.030343007915567283	T	5.312	0.242887	0.10077	0.124886	0.0383	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	3.93	-2.48	0.06423	.	.	.	.	.	T	0.00144	0.0004	N	0.04508	-0.205	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.001	T	0.37291	-0.9712	8	0.07644	T	0.81	-0.825	10.0604	0.42270	0.0:0.4735:0.0:0.5265	rs58448816	420;420;420;420	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	N	420	ENSP00000385591:D420N;ENSP00000372576:D420N;ENSP00000300227:D420N;ENSP00000385867:D420N;ENSP00000385234:D420N	ENSP00000300227:D420N	D	-	1	0	C18orf34	29101178	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.956000	0.01522	-0.844000	0.04184	-2.401000	0.00224	GAT		0.313	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995		Missense_Mutation
SSUH2	51066	hgsc.bcm.edu	37	3	8672591	8672591	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr3:8672591C>A	ENST00000317371.4	-	13	1584	c.359G>T	c.(358-360)aGa>aTa	p.R120I	SSUH2_ENST00000415132.1_Missense_Mutation_p.R120I|SSUH2_ENST00000341795.3_Missense_Mutation_p.R120I|SSUH2_ENST00000544814.1_Missense_Mutation_p.R142I			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	120						cytoplasm (GO:0005737)		p.R120I(1)									GGAGGCGCCTCTTTGCGGCCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											76.0	72.0	74.0					3																	8672591		2203	4300	6503	8647591	SO:0001583	missense	51066			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.359G>T	3.37:g.8672591C>A	ENSP00000324551:p.Arg120Ile	Somatic		Capture	SOLID	Phase_IV	8647591	A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	ENST00000317371.4	37	CCDS2568.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571911	0.65765	.	.	ENSG00000125046	ENST00000341795;ENST00000317371;ENST00000415132;ENST00000544814;ENST00000427408	T;T;T;T;T	0.46819	0.87;0.87;0.86;0.88;0.89	5.72	2.57	0.30868	.	0.236285	0.43747	D	0.000528	T	0.45776	0.1359	M	0.64997	1.995	0.41493	D	0.988237	D;P	0.53151	0.958;0.911	P;P	0.47981	0.563;0.483	T	0.39663	-0.9603	10	0.45353	T	0.12	-13.114	5.5711	0.17198	0.0:0.6227:0.0:0.3773	.	142;120	F5H2S5;Q9Y2M2	.;CC032_HUMAN	I	120;120;120;142;142	ENSP00000339150:R120I;ENSP00000324551:R120I;ENSP00000410757:R120I;ENSP00000439378:R142I;ENSP00000401289:R142I	ENSP00000324551:R120I	R	-	2	0	C3orf32	8647591	1.000000	0.71417	0.481000	0.27354	0.977000	0.68977	2.352000	0.44080	0.767000	0.33267	0.591000	0.81541	AGA		0.527	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931		Missense_Mutation
CASS4	57091	hgsc.bcm.edu	37	20	55012466	55012466	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr20:55012466G>A	ENST00000360314.3	+	3	508	c.283G>A	c.(283-285)Gag>Aag	p.E95K	CASS4_ENST00000434344.1_Missense_Mutation_p.E95K|CASS4_ENST00000371336.3_Missense_Mutation_p.E95K	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	95					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TGCCAGCTCAGAGGAGACCTA	0.662																																																0			20											33.0	37.0	36.0					20																	55012466		2203	4300	6503	54445873	SO:0001583	missense	57091			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.283G>A	20.37:g.55012466G>A	ENSP00000353462:p.Glu95Lys	Somatic		Capture	SOLID	Phase_IV	54445873	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018633	0.54576	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.20200	2.59;2.59;2.09	5.57	-0.0864	0.13681	.	0.396976	0.27730	N	0.018087	T	0.12433	0.0302	N	0.21448	0.665	0.09310	N	0.999997	B;B;B;B	0.17667	0.001;0.023;0.001;0.0	B;B;B;B	0.14023	0.002;0.007;0.01;0.003	T	0.31081	-0.9956	10	0.12430	T	0.62	-9.4147	14.4492	0.67372	0.0727:0.6872:0.2401:0.0	.	95;95;95;95	B4DII4;Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;.;CASS4_HUMAN	K	95	ENSP00000353462:E95K;ENSP00000360387:E95K;ENSP00000410027:E95K	ENSP00000353462:E95K	E	+	1	0	CASS4	54445873	0.026000	0.19158	0.013000	0.15412	0.390000	0.30446	0.762000	0.26503	0.041000	0.15688	-0.122000	0.15005	GAG		0.662	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		Missense_Mutation
CDC27	996	hgsc.bcm.edu	37	17	45216162	45216162	+	Missense_Mutation	SNP	A	A	C	rs111227623		TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:45216162A>C	ENST00000066544.3	-	13	1740	c.1647T>G	c.(1645-1647)gaT>gaG	p.D549E	CDC27_ENST00000531206.1_Missense_Mutation_p.D555E|CDC27_ENST00000446365.2_Missense_Mutation_p.D488E|CDC27_ENST00000527547.1_Missense_Mutation_p.D548E	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	549					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.D549E(4)|p.D555E(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AAAGAGCAACATCTTTTTGAA	0.348																																																6	Substitution - Missense(6)	large_intestine(4)|ovary(1)|lung(1)	17											46.0	51.0	49.0					17																	45216162		2202	4299	6501	42571161	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1647T>G	17.37:g.45216162A>C	ENSP00000066544:p.Asp549Glu	Somatic		Capture	SOLID	Phase_IV	42571161	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	6.981	0.550975	0.13374	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65364	-0.14;-0.15;0.15;-0.12	5.57	-0.476	0.12100	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	N	0.01473	-0.845	0.48040	D	0.999577	B;B;B;B	0.27192	0.052;0.171;0.171;0.052	B;B;B;B	0.27715	0.021;0.082;0.082;0.021	T	0.36261	-0.9755	10	0.02654	T	1	-6.7614	9.4643	0.38802	0.6029:0.0:0.3971:0.0	.	488;548;555;549	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	E	549;555;488;548	ENSP00000066544:D549E;ENSP00000434614:D555E;ENSP00000392802:D488E;ENSP00000437339:D548E	ENSP00000066544:D549E	D	-	3	2	CDC27	42571161	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	1.462000	0.35266	-0.146000	0.11274	-0.256000	0.11100	GAT		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2			Missense_Mutation
CELA3A	10136	hgsc.bcm.edu	37	1	22333880	22333880	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:22333880C>A	ENST00000290122.3	+	6	533	c.514C>A	c.(514-516)Cca>Aca	p.P172T		NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	172	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TGGGCCACTCCCAGACAAGCT	0.607																																																0			1											42.0	45.0	44.0					1																	22333880		2197	4300	6497	22206467	SO:0001583	missense	10136			D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.514C>A	1.37:g.22333880C>A	ENSP00000290122:p.Pro172Thr	Somatic		Capture	SOLID	Phase_IV	22206467	B1AQ53|Q9BRW4	Missense_Mutation	SNP	ENST00000290122.3	37	CCDS220.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.13	3.034554	0.54896	.	.	ENSG00000142789	ENST00000290122	D	0.89270	-2.49	3.59	2.67	0.31697	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.86130	0.5859	N	0.16743	0.435	0.24927	N	0.991946	D	0.58970	0.984	P	0.57152	0.814	T	0.76772	-0.2836	9	0.87932	D	0	-7.96	8.6288	0.33906	0.0:0.8835:0.0:0.1165	.	172	P09093	CEL3A_HUMAN	T	172	ENSP00000290122:P172T	ENSP00000290122:P172T	P	+	1	0	CELA3A	22206467	0.009000	0.17119	0.012000	0.15200	0.787000	0.44495	0.208000	0.17415	0.708000	0.31955	0.400000	0.26472	CCA		0.607	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	NM_005747		Missense_Mutation
CLCN2	1181	hgsc.bcm.edu	37	3	184070929	184070929	+	Missense_Mutation	SNP	T	T	A	rs138530764		TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr3:184070929T>A	ENST00000265593.4	-	18	2206	c.2035A>T	c.(2035-2037)Aca>Tca	p.T679S	CLCN2_ENST00000457512.1_Missense_Mutation_p.T679S|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000434054.2_Missense_Mutation_p.T635S|CLCN2_ENST00000344937.7_Missense_Mutation_p.T662S|CLCN2_ENST00000475279.1_5'Flank	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	679					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)	p.T679S(1)		breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	GAGTCTTCTGTGTTCACCTGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	101.0	96.0					3																	184070929		2203	4300	6503	185553623	SO:0001583	missense	1181			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.2035A>T	3.37:g.184070929T>A	ENSP00000265593:p.Thr679Ser	Somatic		Capture	SOLID	Phase_IV	185553623	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	t	13.37	2.217197	0.39201	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.84730	-1.84;-1.79;-1.89;-1.86	5.58	-1.79	0.07932	.	0.547257	0.20898	N	0.083687	T	0.73768	0.3629	L	0.52364	1.645	0.80722	D	1	B;B;B;B;B	0.15930	0.009;0.009;0.015;0.009;0.009	B;B;B;B;B	0.20184	0.012;0.012;0.028;0.012;0.012	T	0.53865	-0.8378	10	0.19147	T	0.46	0.0012	3.5791	0.07945	0.2515:0.2466:0.0:0.5019	.	635;679;662;679;635	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	S	679;662;635;679	ENSP00000265593:T679S;ENSP00000345056:T662S;ENSP00000400425:T635S;ENSP00000391928:T679S	ENSP00000265593:T679S	T	-	1	0	CLCN2	185553623	0.994000	0.37717	0.976000	0.42696	0.906000	0.53458	0.423000	0.21313	-0.174000	0.10743	0.379000	0.24179	ACA		0.592	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1			Missense_Mutation
CNTNAP1	8506	hgsc.bcm.edu	37	17	40837237	40837237	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:40837237G>T	ENST00000264638.4	+	5	731	c.514G>T	c.(514-516)Gcc>Tcc	p.A172S	CCR10_ENST00000591765.1_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	172					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TTGCGCAGAGGCCGACATACT	0.627																																																0			17											73.0	72.0	72.0					17																	40837237		2203	4300	6503	38090763	SO:0001583	missense	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.514G>T	17.37:g.40837237G>T	ENSP00000264638:p.Ala172Ser	Somatic		Capture	SOLID	Phase_IV	38090763		Missense_Mutation	SNP	ENST00000264638.4	37	CCDS11436.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.922	-0.017886	0.07681	.	.	ENSG00000108797	ENST00000264638	T	0.78126	-1.15	5.26	1.79	0.24919	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.590112	0.17185	N	0.183743	T	0.41419	0.1158	N	0.01048	-1.04	0.23430	N	0.997692	B	0.02656	0.0	B	0.04013	0.001	T	0.41627	-0.9498	10	0.02654	T	1	.	7.8661	0.29539	0.0:0.0771:0.4417:0.4812	.	172	P78357	CNTP1_HUMAN	S	172	ENSP00000264638:A172S	ENSP00000264638:A172S	A	+	1	0	CNTNAP1	38090763	1.000000	0.71417	0.995000	0.50966	0.829000	0.46940	1.419000	0.34793	0.287000	0.22375	-0.364000	0.07487	GCC		0.627	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632		Missense_Mutation
CPT1B	1375	hgsc.bcm.edu	37	22	51012845	51012845	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr22:51012845delT	ENST00000360719.2	-	9	1026	c.889delA	c.(889-891)atgfs	p.M297fs	CPT1B_ENST00000434492.2_Frame_Shift_Del_p.M94fs|CPT1B_ENST00000440709.1_Frame_Shift_Del_p.M297fs|CPT1B_ENST00000395650.2_Frame_Shift_Del_p.M297fs|CPT1B_ENST00000312108.7_Frame_Shift_Del_p.M297fs|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000405237.3_Frame_Shift_Del_p.M297fs|CPT1B_ENST00000457250.1_Frame_Shift_Del_p.M263fs	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	297					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.M297fs*5(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CCCAGTGCCATCACCTGAGGG	0.582																																					Esophageal Squamous(170;988 1933 25577 30295 48163)											1	Deletion - Frameshift(1)	ovary(1)	22											180.0	116.0	138.0					22																	51012845		2203	4300	6503	49359711	SO:0001589	frameshift_variant	1375			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.889delA	22.37:g.51012845delT	ENSP00000353945:p.Met297fs	Somatic		Capture	SOLID	Phase_IV	49359711	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Frame_Shift_Del	DEL	ENST00000360719.2	37	CCDS14098.1	DEL	50	Baylor																																																																																				0.582	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246		Frame_Shift_Del
CREG2	200407	hgsc.bcm.edu	37	2	101967422	101967422	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:101967422C>T	ENST00000324768.5	-	4	973	c.836G>A	c.(835-837)aGg>aAg	p.R279K		NM_153836.3	NP_722578.1	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	279						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	FMN binding (GO:0010181)|oxidoreductase activity (GO:0016491)	p.R279K(2)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						ATATTCCTCCCTTGAAATACT	0.423																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	2											135.0	128.0	130.0					2																	101967422		2203	4300	6503	101333854	SO:0001583	missense	200407			AB046109	CCDS2052.1	2q12.1	2007-08-01			ENSG00000175874	ENSG00000175874			14272	protein-coding gene	gene with protein product						12408961	Standard	NM_153836		Approved		uc002tba.2	Q8IUH2	OTTHUMG00000130692	ENST00000324768.5:c.836G>A	2.37:g.101967422C>T	ENSP00000315203:p.Arg279Lys	Somatic		Capture	SOLID	Phase_IV	101333854	Q86X03|Q8N540|Q8N9E3	Missense_Mutation	SNP	ENST00000324768.5	37	CCDS2052.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	5.885	0.347378	0.11126	.	.	ENSG00000175874	ENST00000324768	T	0.41400	1.0	5.88	-3.61	0.04556	FMN-binding split barrel-related (1);FMN-binding split barrel (1);	0.953190	0.08868	N	0.881936	T	0.16557	0.0398	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30707	-0.9969	10	0.02654	T	1	.	2.2666	0.04080	0.1109:0.3084:0.1761:0.4046	.	279	Q8IUH2	CREG2_HUMAN	K	279	ENSP00000315203:R279K	ENSP00000315203:R279K	R	-	2	0	CREG2	101333854	0.037000	0.19845	0.016000	0.15963	0.274000	0.26718	0.164000	0.16542	-0.646000	0.05452	-1.814000	0.00607	AGG		0.423	CREG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253188.2	NM_153836		Missense_Mutation
CTSF	8722	hgsc.bcm.edu	37	11	66333351	66333352	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-13-0919-01	TCGA-13-0919-10	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr11:66333351_66333352delCT	ENST00000310325.5	-	7	1023_1024	c.914_915delAG	c.(913-915)gagfs	p.E305fs	ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA|CTSF_ENST00000533168.1_5'Flank	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	305				E -> K (in Ref. 5; AAF13146). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)	p.E305fs*15(1)		endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						ACCACTGGCCCTCCACATTGCC	0.624																																																1	Deletion - Frameshift(1)	ovary(1)	11																																								66089928	SO:0001589	frameshift_variant	8722			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.914_915delAG	11.37:g.66333351_66333352delCT	ENSP00000310832:p.Glu305fs	Somatic		Capture	SOLID	Phase_IV	66089927	B2R964|O95240|Q9NSU4|Q9UKQ5	Frame_Shift_Del	DEL	ENST00000310325.5	37	CCDS8144.1	DEL	24	Baylor																																																																																				0.624	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393047.1	NM_003793		Frame_Shift_Del
DLL4	54567	hgsc.bcm.edu	37	15	41228906	41228906	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr15:41228906T>G	ENST00000249749.5	+	9	1997	c.1721T>G	c.(1720-1722)tTc>tGc	p.F574C		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	574					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TTGTCGGACTTCCAGAAGGAC	0.582																																																0			15											54.0	60.0	58.0					15																	41228906		2075	4226	6301	39016198	SO:0001583	missense	54567			AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.1721T>G	15.37:g.41228906T>G	ENSP00000249749:p.Phe574Cys	Somatic		Capture	SOLID	Phase_IV	39016198	Q3KP23|Q9NQT9	Missense_Mutation	SNP	ENST00000249749.5	37	CCDS45232.1	SNP	62	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.98	2.992401	0.54041	.	.	ENSG00000128917	ENST00000249749	D	0.87029	-2.2	6.06	6.06	0.98353	.	0.190731	0.56097	D	0.000021	T	0.78566	0.4303	N	0.15975	0.35	0.38821	D	0.955641	B	0.19583	0.037	B	0.15052	0.012	T	0.74343	-0.3696	10	0.32370	T	0.25	.	16.6127	0.84892	0.0:0.0:0.0:1.0	.	574	Q9NR61	DLL4_HUMAN	C	574	ENSP00000249749:F574C	ENSP00000249749:F574C	F	+	2	0	DLL4	39016198	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.941000	0.56607	2.322000	0.78497	0.528000	0.53228	TTC		0.582	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1			Missense_Mutation
DNAJC10	54431	hgsc.bcm.edu	37	2	183605072	183605072	+	Missense_Mutation	SNP	A	A	G	rs548642310		TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:183605072A>G	ENST00000264065.7	+	12	1449	c.1034A>G	c.(1033-1035)cAt>cGt	p.H345R		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	345	Trxb 1.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GAAGTAATACATAATCTTCCA	0.269													A|||	1	0.000199681	0.0	0.0	5008	,	,		15746	0.001		0.0	False		,,,				2504	0.0				Pancreas(56;860 1183 25669 35822 48585)											0			2											35.0	39.0	37.0					2																	183605072		2194	4262	6456	183313317	SO:0001583	missense	54431				CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1034A>G	2.37:g.183605072A>G	ENSP00000264065:p.His345Arg	Somatic		Capture	SOLID	Phase_IV	183313317	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	ENST00000264065.7	37	CCDS33345.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.42	1.344641	0.24426	.	.	ENSG00000077232	ENST00000264065;ENST00000392392	T	0.36699	1.24	5.22	4.07	0.47477	Thioredoxin-like fold (1);	0.717906	0.14178	N	0.336228	T	0.29588	0.0738	L	0.40543	1.245	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.12837	0.004;0.008	T	0.03587	-1.1022	10	0.25751	T	0.34	.	10.8992	0.47040	0.9257:0.0:0.0743:0.0	.	299;345	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	R	345;299	ENSP00000264065:H345R	ENSP00000264065:H345R	H	+	2	0	DNAJC10	183313317	0.999000	0.42202	0.920000	0.36463	0.928000	0.56348	2.742000	0.47434	0.931000	0.37242	0.528000	0.53228	CAT		0.269	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334418.2	NM_018981		Missense_Mutation
DUOX1	53905	hgsc.bcm.edu	37	15	45426426	45426426	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr15:45426426C>G	ENST00000321429.4	+	5	633	c.226C>G	c.(226-228)Cga>Gga	p.R76G	DUOX1_ENST00000389037.3_Missense_Mutation_p.R76G	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	76	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.R76G(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GCCCAACCCCCGAGACCTTAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	15											41.0	45.0	44.0					15																	45426426		2198	4298	6496	43213718	SO:0001583	missense	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.226C>G	15.37:g.45426426C>G	ENSP00000317997:p.Arg76Gly	Somatic		Capture	SOLID	Phase_IV	43213718	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722126	0.48728	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.72505	-0.66;-0.66	5.01	3.08	0.35506	.	0.000000	0.85682	D	0.000000	D	0.87696	0.6242	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89395	0.3691	10	0.87932	D	0	-16.6459	11.334	0.49492	0.5088:0.4912:0.0:0.0	.	76	Q9NRD9	DUOX1_HUMAN	G	76	ENSP00000317997:R76G;ENSP00000373689:R76G	ENSP00000317997:R76G	R	+	1	2	DUOX1	43213718	0.986000	0.35501	0.963000	0.40424	0.356000	0.29392	2.480000	0.45206	0.771000	0.33359	-0.169000	0.13324	CGA		0.627	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		Missense_Mutation
EGFR	1956	hgsc.bcm.edu	37	7	55249017	55249017	+	Missense_Mutation	SNP	C	C	G	rs121913445|rs397517115		TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr7:55249017C>G	ENST00000275493.2	+	20	2492	c.2315C>G	c.(2314-2316)cCc>cGc	p.P772R	EGFR_ENST00000454757.2_Missense_Mutation_p.P719R|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.P727R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	772	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.N771_P772>SVDNR(1)|p.P772_H773insTHP(1)|p.P772R(1)|p.D770_P772>ASVDNR(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GTGGACAACCCCCACGTGTGC	0.647		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	4	Complex - insertion inframe(2)|Substitution - Missense(1)|Insertion - In frame(1)	lung(3)|ovary(1)	7											106.0	96.0	99.0					7																	55249017		2203	4300	6503	55216511	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2315C>G	7.37:g.55249017C>G	ENSP00000275493:p.Pro772Arg	Somatic		Capture	SOLID	Phase_IV	55216511	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.9	4.343769	0.82022	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.68025	-0.3;-0.3;-0.3	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74966	0.3786	L	0.28556	0.865	0.80722	D	1	P;D	0.89917	0.743;1.0	B;D	0.78314	0.173;0.991	T	0.76963	-0.2764	10	0.87932	D	0	.	18.7267	0.91716	0.0:1.0:0.0:0.0	.	727;772	Q504U8;P00533	.;EGFR_HUMAN	R	727;642;772;719	ENSP00000415559:P727R;ENSP00000275493:P772R;ENSP00000395243:P719R	ENSP00000275493:P772R	P	+	2	0	EGFR	55216511	1.000000	0.71417	0.945000	0.38365	0.990000	0.78478	7.788000	0.85771	2.760000	0.94817	0.655000	0.94253	CCC		0.647	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		Missense_Mutation
EVI2B	2124	hgsc.bcm.edu	37	17	29632368	29632368	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:29632368G>A	ENST00000330927.4	-	2	414	c.260C>T	c.(259-261)aCc>aTc	p.T87I	EVI2B_ENST00000544462.1_Missense_Mutation_p.T102I|CTD-2370N5.3_ENST00000578584.1_3'UTR|EVI2B_ENST00000577894.1_Missense_Mutation_p.T87I|NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	87						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)|p.T87I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		TTCAGAAGAGGTATAGACAGC	0.468																																																12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											381.0	310.0	334.0					17																	29632368		2203	4300	6503	26656494	SO:0001583	missense	2124				CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.260C>T	17.37:g.29632368G>A	ENSP00000333779:p.Thr87Ile	Somatic		Capture	SOLID	Phase_IV	26656494	B7Z4A7	Missense_Mutation	SNP	ENST00000330927.4	37	CCDS11266.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	7.550	0.662543	0.14645	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.46063	0.89;0.88	5.17	-7.96	0.01144	.	1.368430	0.05311	N	0.524717	T	0.23451	0.0567	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19811	-1.0294	10	0.18276	T	0.48	-9.6085	9.54	0.39246	0.6097:0.1065:0.2838:0.0	.	102;87	B7Z4A7;P34910	.;EVI2B_HUMAN	I	87;102	ENSP00000333779:T87I;ENSP00000439738:T102I	ENSP00000333779:T87I	T	-	2	0	EVI2B	26656494	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.147000	0.03188	-1.290000	0.02372	-2.069000	0.00389	ACC		0.468	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2	NM_006495		Missense_Mutation
FAM13C	220965	hgsc.bcm.edu	37	10	61112126	61112126	+	Silent	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr10:61112126C>G	ENST00000373868.2	-	3	315	c.228G>C	c.(226-228)gtG>gtC	p.V76V	FAM13C_ENST00000277705.6_Silent_p.V76V|FAM13C_ENST00000468840.2_5'UTR|FAM13C_ENST00000442566.3_Silent_p.V76V|FAM13C_ENST00000435852.2_Silent_p.V76V|FAM13C_ENST00000419214.2_Silent_p.V76V|FAM13C_ENST00000373867.3_5'UTR|FAM13C_ENST00000422313.2_Silent_p.V76V	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	76										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ATACGCTGTCCACCAGCACGG	0.592																																																0			10											62.0	62.0	62.0					10																	61112126		2203	4300	6503	60782132	SO:0001819	synonymous_variant	220965			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.228G>C	10.37:g.61112126C>G		Somatic		Capture	SOLID	Phase_IV	60782132	B7ZB77|Q5T631|Q6P2M3|Q99787	Silent	SNP	ENST00000373868.2	37	CCDS7255.1	SNP	21	Baylor																																																																																				0.592	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2			Silent
FBXO30	84085	hgsc.bcm.edu	37	6	146125581	146125581	+	Missense_Mutation	SNP	C	C	T	rs35721211	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:146125581C>T	ENST00000237281.4	-	2	2127	c.1961G>A	c.(1960-1962)cGt>cAt	p.R654H		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	654							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R654H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		GACCATGCCACGAGACTGAAG	0.443													C|||	5	0.000998403	0.0038	0.0	5008	,	,		20412	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	6						C	HIS/ARG	10,4396	16.8+/-37.8	0,10,2193	146.0	138.0	141.0		1961	5.0	1.0	6	dbSNP_126	141	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FBXO30	NM_032145.4	29	0,11,6492	TT,TC,CC		0.0116,0.227,0.0846	probably-damaging	654/746	146125581	11,12995	2203	4300	6503	146167274	SO:0001583	missense	84085			AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1961G>A	6.37:g.146125581C>T	ENSP00000237281:p.Arg654His	Somatic		Capture	SOLID	Phase_IV	146167274	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232538	0.58777	0.00227	1.16E-4	ENSG00000118496	ENST00000237281	T	0.60171	0.21	5.86	4.99	0.66335	F-box domain, cyclin-like (1);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.67841	0.2936	M	0.74647	2.275	0.54753	D	0.999988	D	0.71674	0.998	D	0.65874	0.939	T	0.74435	-0.3666	10	0.87932	D	0	-16.5277	14.9501	0.71067	0.0:0.9317:0.0:0.0683	rs35721211	654	Q8TB52	FBX30_HUMAN	H	654	ENSP00000237281:R654H	ENSP00000237281:R654H	R	-	2	0	FBXO30	146167274	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.083000	0.71326	1.490000	0.48466	-0.148000	0.13756	CGT		0.443	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2			Missense_Mutation
FCRL1	115350	hgsc.bcm.edu	37	1	157772278	157772278	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:157772278C>T	ENST00000368176.3	-	4	563	c.496G>A	c.(496-498)Gca>Aca	p.A166T	FCRL1_ENST00000358292.3_Missense_Mutation_p.A166T|FCRL1_ENST00000491942.1_Missense_Mutation_p.A166T|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	166	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A166T(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCATACTCTGCTGTCAGTGAA	0.498																																					GBM(54;482 1003 11223 30131 35730)											1	Substitution - Missense(1)	ovary(1)	1											119.0	97.0	105.0					1																	157772278		2203	4300	6503	156038902	SO:0001583	missense	115350			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.496G>A	1.37:g.157772278C>T	ENSP00000357158:p.Ala166Thr	Somatic		Capture	SOLID	Phase_IV	156038902	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075591	0.55646	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03860	3.78;3.78;3.78	5.42	4.49	0.54785	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000030	T	0.11623	0.0283	M	0.80422	2.495	0.09310	N	1	D;D;D	0.89917	0.966;1.0;1.0	P;D;D	0.97110	0.747;1.0;0.999	T	0.02144	-1.1206	10	0.72032	D	0.01	.	9.395	0.38397	0.0:0.9046:0.0:0.0954	.	166;166;166	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	T	166	ENSP00000351039:A166T;ENSP00000357158:A166T;ENSP00000418130:A166T	ENSP00000351039:A166T	A	-	1	0	FCRL1	156038902	0.012000	0.17670	0.079000	0.20413	0.599000	0.36880	0.876000	0.28092	2.698000	0.92095	0.655000	0.94253	GCA		0.498	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938		Missense_Mutation
FKBPL	63943	hgsc.bcm.edu	37	6	32096575	32096575	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:32096575T>A	ENST00000375156.3	-	2	1253	c.983A>T	c.(982-984)aAg>aTg	p.K328M	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	328					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										AATGACCACCTTCCCCAGTTC	0.532																																																0			6											150.0	159.0	156.0					6																	32096575		2203	4300	6503	32204553	SO:0001583	missense	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.983A>T	6.37:g.32096575T>A	ENSP00000364298:p.Lys328Met	Somatic		Capture	SOLID	Phase_IV	32204553	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	CCDS4738.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115287	0.56505	.	.	ENSG00000204315	ENST00000375156	T	0.74209	-0.82	5.75	1.79	0.24919	Tetratricopeptide-like helical (1);	0.633028	0.15298	N	0.269775	T	0.48370	0.1496	N	0.08118	0	0.34074	D	0.658845	D	0.63046	0.992	P	0.54401	0.751	T	0.50693	-0.8798	10	0.51188	T	0.08	-8.5591	7.4306	0.27126	0.0:0.405:0.0:0.595	.	328	Q9UIM3	FKBPL_HUMAN	M	328	ENSP00000364298:K328M	ENSP00000364298:K328M	K	-	2	0	FKBPL	32204553	0.167000	0.22975	0.997000	0.53966	0.892000	0.51952	0.126000	0.15769	0.354000	0.24105	0.459000	0.35465	AAG		0.532	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			Missense_Mutation
FKBPL	63943	hgsc.bcm.edu	37	6	32096839	32096839	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:32096839A>G	ENST00000375156.3	-	2	989	c.719T>C	c.(718-720)cTc>cCc	p.L240P	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	240					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										TAAAGTCAGGAGCAGCCGAAG	0.597																																																0			6											52.0	57.0	55.0					6																	32096839		2203	4300	6503	32204817	SO:0001583	missense	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.719T>C	6.37:g.32096839A>G	ENSP00000364298:p.Leu240Pro	Somatic		Capture	SOLID	Phase_IV	32204817	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	ENST00000375156.3	37	CCDS4738.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	20.8	4.052639	0.75960	.	.	ENSG00000204315	ENST00000375156	T	0.60171	0.21	5.51	5.51	0.81932	Tetratricopeptide-like helical (1);	0.415690	0.20052	N	0.100275	T	0.70002	0.3174	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74315	-0.3705	10	0.87932	D	0	-6.1621	13.6279	0.62178	1.0:0.0:0.0:0.0	.	240	Q9UIM3	FKBPL_HUMAN	P	240	ENSP00000364298:L240P	ENSP00000364298:L240P	L	-	2	0	FKBPL	32204817	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.223000	0.58587	2.317000	0.78254	0.459000	0.35465	CTC		0.597	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076221.2			Missense_Mutation
ARHGEF37	389337	hgsc.bcm.edu	37	5	149011739	149011739	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr5:149011739G>A	ENST00000333677.6	+	13	2176	c.2013G>A	c.(2011-2013)tgG>tgA	p.W671*		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	671						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.W671*(1)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						TGTGGGGCTGGAGTCTGCCCT	0.577																																																1	Substitution - Nonsense(1)	ovary(1)	5											64.0	66.0	65.0					5																	149011739		1907	4130	6037	148991932	SO:0001587	stop_gained	389337			BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.2013G>A	5.37:g.149011739G>A	ENSP00000328083:p.Trp671*	Somatic		Capture	SOLID	Phase_IV	148991932	Q6ZW51	Nonsense_Mutation	SNP	ENST00000333677.6	37	CCDS43385.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	36	5.868543	0.97043	.	.	ENSG00000183111	ENST00000333677	.	.	.	5.44	5.44	0.79542	.	0.146288	0.49305	D	0.000142	.	.	.	.	.	.	0.53005	D	0.999968	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.8126	0.88620	0.0:0.0:1.0:0.0	.	.	.	.	X	671	.	ENSP00000328083:W671X	W	+	3	0	ARHGEF37	148991932	1.000000	0.71417	0.997000	0.53966	0.299000	0.27559	7.475000	0.81041	2.545000	0.85829	0.655000	0.94253	TGG		0.577	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669		Nonsense_Mutation
MROH5	389690	hgsc.bcm.edu	37	8	142477553	142477553	+	RNA	SNP	T	T	C	rs73713680	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr8:142477553T>C	ENST00000430863.1	-	0	2348					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		TCTCGGAGGCTGCCTGCACGC	0.667													C|||	809	0.161542	0.1944	0.1369	5008	,	,		15525	0.128		0.2097	False		,,,				2504	0.1196															0			8								685,3411		57,571,1420	32.0	37.0	36.0		2268	-0.8	0.0	8	dbSNP_130	36	1531,6843		142,1247,2798	no	coding-synonymous	FLJ43860	NM_207414.2		199,1818,4218	CC,CT,TT		18.2828,16.7236,17.7706		756/1319	142477553	2216,10254	2048	4187	6235	142546735			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142477553T>C		Somatic		Capture	SOLID	Phase_IV	142546735		Silent	SNP	ENST00000430863.1	37		SNP	55	Baylor																																																																																				0.667	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414		Silent
CMTR1	23070	hgsc.bcm.edu	37	6	37429339	37429339	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:37429339G>C	ENST00000373451.4	+	11	1274	c.1110G>C	c.(1108-1110)gaG>gaC	p.E370D	CMTR1_ENST00000493656.1_3'UTR	NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	370	RrmJ-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00945}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)	p.E370D(1)									TCTCGGTGGAGGGGCAGGAGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											110.0	105.0	107.0					6																	37429339		2203	4300	6503	37537317	SO:0001583	missense	23070			BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.1110G>C	6.37:g.37429339G>C	ENSP00000362550:p.Glu370Asp	Somatic		Capture	SOLID	Phase_IV	37537317	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	37	CCDS4835.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.90	3.913325	0.72983	.	.	ENSG00000137200	ENST00000373451;ENST00000455891;ENST00000373427	T;T	0.30714	1.52;1.52	5.64	1.76	0.24704	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.045481	0.85682	D	0.000000	T	0.15132	0.0365	L	0.46741	1.465	0.54753	D	0.999988	P;B	0.40578	0.722;0.078	B;B	0.43536	0.423;0.207	T	0.02610	-1.1134	10	0.48119	T	0.1	-28.7352	8.1473	0.31119	0.4118:0.0:0.5882:0.0	.	314;370	Q5T7F5;Q8N1G2	.;MTR1_HUMAN	D	370;314;314	ENSP00000362550:E370D;ENSP00000414233:E314D	ENSP00000362526:E314D	E	+	3	2	FTSJD2	37537317	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.377000	0.34317	0.026000	0.15269	0.591000	0.81541	GAG		0.512	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050		Missense_Mutation
GABRA1	2554	hgsc.bcm.edu	37	5	161300148	161300148	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr5:161300148G>A	ENST00000428797.2	+	6	636	c.281G>A	c.(280-282)cGt>cAt	p.R94H	GABRA1_ENST00000437025.2_Missense_Mutation_p.R94H|GABRA1_ENST00000023897.6_Missense_Mutation_p.R94H|GABRA1_ENST00000393943.4_Missense_Mutation_p.R94H|GABRA1_ENST00000444819.1_Missense_Mutation_p.R94H|GABRA1_ENST00000420560.1_Missense_Mutation_p.R94H	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	94					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R94H(2)|p.R94L(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	GTATTTTTCCGTCAAAGCTGG	0.373																																																3	Substitution - Missense(3)	urinary_tract(1)|ovary(1)|lung(1)	5											91.0	98.0	96.0					5																	161300148		2203	4300	6503	161232726	SO:0001583	missense	2554				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.281G>A	5.37:g.161300148G>A	ENSP00000393097:p.Arg94His	Somatic		Capture	SOLID	Phase_IV	161232726	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	35	5.525396	0.96431	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35;-1.35;-1.35	5.75	5.75	0.90469	Neurotransmitter-gated ion-channel ligand-binding (3);	0.107484	0.64402	D	0.000008	D	0.91133	0.7208	M	0.84585	2.705	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.91782	0.5436	10	0.87932	D	0	.	19.9462	0.97183	0.0:0.0:1.0:0.0	.	94	P14867	GBRA1_HUMAN	H	94	ENSP00000023897:R94H;ENSP00000393097:R94H;ENSP00000377517:R94H;ENSP00000415441:R94H;ENSP00000408041:R94H;ENSP00000414232:R94H;ENSP00000430435:R94H	ENSP00000023897:R94H	R	+	2	0	GABRA1	161232726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.717000	0.92951	0.585000	0.79938	CGT		0.373	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5		Missense_Mutation
LYPLA2	11313	hgsc.bcm.edu	37	1	24124642	24124642	+	IGR	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:24124642T>C	ENST00000374514.3	+	0	1810				GALE_ENST00000470383.1_5'Flank|GALE_ENST00000374497.3_Missense_Mutation_p.R106G	NM_007260.2	NP_009191.1	O95372	LYPA2_HUMAN	lysophospholipase II						fatty acid metabolic process (GO:0006631)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		AGGTTAACTCTGTAATAATCC	0.602																																																0			1											69.0	69.0	69.0					1																	24124642		2203	4300	6503	23997229	SO:0001628	intergenic_variant	2582			AF098668	CCDS241.1	1p36.11	2008-08-08			ENSG00000011009	ENSG00000011009	3.1.1.5		6738	protein-coding gene	gene with protein product							Standard	NM_007260		Approved	APT-2	uc001bht.3	O95372	OTTHUMG00000002961		1.37:g.24124642T>C		Somatic		Capture	SOLID	Phase_IV	23997229	Q7Z4Z2	Missense_Mutation	SNP	ENST00000374514.3	37	CCDS241.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.33	2.800224	0.50208	.	.	ENSG00000117308	ENST00000374498;ENST00000374497;ENST00000429356;ENST00000418277;ENST00000425913;ENST00000445705	D;D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32;-3.32	4.79	0.97	0.19692	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.276464	0.41194	D	0.000936	D	0.90714	0.7086	L	0.61218	1.895	0.44531	D	0.997484	B;B;B;B	0.15473	0.013;0.001;0.003;0.003	B;B;B;B	0.18561	0.013;0.002;0.022;0.022	D	0.84237	0.0470	10	0.48119	T	0.1	-2.9539	12.3704	0.55252	0.0:0.0:0.433:0.5669	.	32;42;106;106	B3KQ39;E9PH43;Q38G75;Q14376	.;.;.;GALE_HUMAN	G	42;106;42;42;106;106	ENSP00000363621:R106G;ENSP00000398585:R42G;ENSP00000414719:R42G;ENSP00000393359:R106G;ENSP00000398257:R106G	ENSP00000363621:R106G	R	-	1	2	GALE	23997229	0.993000	0.37304	0.997000	0.53966	0.997000	0.91878	1.377000	0.34317	-0.002000	0.14469	0.460000	0.39030	AGA		0.602	LYPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008245.1			Missense_Mutation
HSF5	124535	hgsc.bcm.edu	37	17	56540187	56540187	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:56540187A>T	ENST00000323777.3	-	4	1607	c.1498T>A	c.(1498-1500)Tca>Aca	p.S500T		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	500					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S500T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AATACTACTGAAGATGGAGAT	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											211.0	188.0	196.0					17																	56540187		2203	4300	6503	53895186	SO:0001583	missense	124535			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1498T>A	17.37:g.56540187A>T	ENSP00000313243:p.Ser500Thr	Somatic		Capture	SOLID	Phase_IV	53895186	Q08EH7|Q8N7V2	Missense_Mutation	SNP	ENST00000323777.3	37	CCDS32690.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	21.7	4.186373	0.78789	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.73047	-0.71	5.57	5.57	0.84162	.	0.000000	0.52532	D	0.000080	T	0.74207	0.3686	L	0.27053	0.805	0.34539	D	0.710102	D	0.58268	0.982	D	0.67548	0.952	T	0.82538	-0.0407	10	0.87932	D	0	.	13.1131	0.59285	1.0:0.0:0.0:0.0	.	500	Q4G112	HSF5_HUMAN	T	400;500	ENSP00000313243:S500T	ENSP00000313243:S500T	S	-	1	0	HSF5	53895186	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.290000	0.33319	2.127000	0.65507	0.528000	0.53228	TCA		0.438	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190		Missense_Mutation
IRS1	3667	hgsc.bcm.edu	37	2	227661263	227661263	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:227661263T>C	ENST00000305123.5	-	1	3212	c.2192A>G	c.(2191-2193)gAc>gGc	p.D731G	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	731					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.D731G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GTTCATGTAGTCACCTGTGCA	0.602											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											137.0	143.0	141.0					2																	227661263		2203	4300	6503	227369507	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2192A>G	2.37:g.227661263T>C	ENSP00000304895:p.Asp731Gly	Somatic	2321	Capture	SOLID	Phase_IV	227369507		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792742	0.50102	.	.	ENSG00000169047	ENST00000305123	T	0.69175	-0.38	4.85	4.85	0.62838	.	0.064020	0.64402	D	0.000016	T	0.61615	0.2361	L	0.56199	1.76	0.54753	D	0.999989	P	0.34562	0.457	B	0.32624	0.149	T	0.64097	-0.6487	10	0.44086	T	0.13	-29.5004	14.6033	0.68456	0.0:0.0:0.0:1.0	.	731	P35568	IRS1_HUMAN	G	731	ENSP00000304895:D731G	ENSP00000304895:D731G	D	-	2	0	IRS1	227369507	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.495000	0.81514	2.043000	0.60533	0.459000	0.35465	GAC		0.602	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Missense_Mutation
IRS1	3667	hgsc.bcm.edu	37	2	227661266	227661267	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-13-0919-01	TCGA-13-0919-10	CC	CC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:227661266_227661267delCC	ENST00000305123.5	-	1	3208_3209	c.2188_2189delGG	c.(2188-2190)ggtfs	p.G730fs	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	730					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.G730fs*1(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CATGTAGTCACCTGTGCAAGGT	0.599											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Deletion - Frameshift(1)	ovary(1)	2																																								227369511	SO:0001589	frameshift_variant	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2188_2189delGG	2.37:g.227661266_227661267delCC	ENSP00000304895:p.Gly730fs	Somatic	2321	Capture	SOLID	Phase_IV	227369510		Frame_Shift_Del	DEL	ENST00000305123.5	37	CCDS2463.1	DEL	18	Baylor																																																																																				0.599	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Frame_Shift_Del
IRS1	3667	hgsc.bcm.edu	37	2	227661481	227661481	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:227661481G>T	ENST00000305123.5	-	1	2994	c.1974C>A	c.(1972-1974)gaC>gaA	p.D658E	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	658					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		AGCCATTGGGGTCCACTCTCT	0.607											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											89.0	83.0	85.0					2																	227661481		2203	4300	6503	227369725	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1974C>A	2.37:g.227661481G>T	ENSP00000304895:p.Asp658Glu	Somatic	2321	Capture	SOLID	Phase_IV	227369725		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589049	0.28357	.	.	ENSG00000169047	ENST00000305123	T	0.58797	0.31	4.81	1.98	0.26296	.	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	L	0.43923	1.385	0.32068	N	0.594776	D	0.76494	0.999	P	0.61070	0.883	T	0.58411	-0.7641	10	0.09843	T	0.71	-23.5858	8.6855	0.34234	0.3018:0.0:0.6982:0.0	.	658	P35568	IRS1_HUMAN	E	658	ENSP00000304895:D658E	ENSP00000304895:D658E	D	-	3	2	IRS1	227369725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.013000	0.49582	0.636000	0.30508	0.561000	0.74099	GAC		0.607	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Missense_Mutation
IRS1	3667	hgsc.bcm.edu	37	2	227661486	227661486	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:227661486C>T	ENST00000305123.5	-	1	2989	c.1969G>A	c.(1969-1971)Gtg>Atg	p.V657M	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	657					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TTGGGGTCCACTCTCTGGGGA	0.607											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											91.0	84.0	86.0					2																	227661486		2202	4300	6502	227369730	SO:0001583	missense	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1969G>A	2.37:g.227661486C>T	ENSP00000304895:p.Val657Met	Somatic	2321	Capture	SOLID	Phase_IV	227369730		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456056	0.26161	.	.	ENSG00000169047	ENST00000305123	T	0.58060	0.36	4.81	3.94	0.45596	.	0.085770	0.46758	D	0.000276	T	0.40094	0.1103	L	0.34521	1.04	0.32185	N	0.579853	B	0.24483	0.104	B	0.18561	0.022	T	0.50083	-0.8869	10	0.48119	T	0.1	-12.1226	11.0699	0.47997	0.0:0.8455:0.0:0.1545	.	657	P35568	IRS1_HUMAN	M	657	ENSP00000304895:V657M	ENSP00000304895:V657M	V	-	1	0	IRS1	227369730	0.971000	0.33674	1.000000	0.80357	0.997000	0.91878	1.783000	0.38664	1.257000	0.44085	0.561000	0.74099	GTG		0.607	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544		Missense_Mutation
JAGN1	84522	hgsc.bcm.edu	37	3	9934740	9934740	+	Silent	SNP	G	G	A	rs572248666		TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr3:9934740G>A	ENST00000307768.4	+	2	400	c.231G>A	c.(229-231)ccG>ccA	p.P77P		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)									p.P77P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					GGGAATACCCGTATTTGCTGA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		21188	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	3											207.0	156.0	173.0					3																	9934740		2203	4300	6503	9909740	SO:0001819	synonymous_variant	84522			AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.231G>A	3.37:g.9934740G>A		Somatic		Capture	SOLID	Phase_IV	9909740		Silent	SNP	ENST00000307768.4	37	CCDS2588.1	SNP	40	Baylor																																																																																				0.517	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250335.1	NM_032492		Silent
KANK4	163782	hgsc.bcm.edu	37	1	62739951	62739951	+	Silent	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:62739951C>G	ENST00000371153.4	-	3	1203	c.825G>C	c.(823-825)gtG>gtC	p.V275V	KANK4_ENST00000354381.3_Intron|KANK4_ENST00000371150.1_5'Flank	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	275	Pro-rich.					cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						GGGTGAACAACACCTCTGCTT	0.542																																																0			1											46.0	41.0	42.0					1																	62739951		2203	4300	6503	62512539	SO:0001819	synonymous_variant	163782			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.825G>C	1.37:g.62739951C>G		Somatic		Capture	SOLID	Phase_IV	62512539	B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	ENST00000371153.4	37	CCDS620.1	SNP	17	Baylor																																																																																				0.542	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		Silent
KCNA1	3736	hgsc.bcm.edu	37	12	5021069	5021069	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr12:5021069G>A	ENST00000382545.3	+	2	1632	c.525G>A	c.(523-525)atG>atA	p.M175I	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	175					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.M175I(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TCTCCGTCATGGTCATCCTCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											91.0	89.0	89.0					12																	5021069		2203	4300	6503	4891330	SO:0001583	missense	3736			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.525G>A	12.37:g.5021069G>A	ENSP00000371985:p.Met175Ile	Somatic		Capture	SOLID	Phase_IV	4891330	A6NM83|Q3MIQ9	Missense_Mutation	SNP	ENST00000382545.3	37	CCDS8535.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010227	0.54361	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.67865	-0.29	4.71	4.71	0.59529	.	0.040366	0.85682	D	0.000000	T	0.62097	0.2400	L	0.45470	1.425	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.61048	-0.7141	10	0.56958	D	0.05	.	17.1898	0.86876	0.0:0.0:1.0:0.0	.	175	Q09470	KCNA1_HUMAN	I	175	ENSP00000371985:M175I	ENSP00000228858:M175I	M	+	3	0	KCNA1	4891330	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.531000	0.98054	2.606000	0.88127	0.655000	0.94253	ATG		0.622	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217		Missense_Mutation
KRT6A	3853	hgsc.bcm.edu	37	12	52882327	52882327	+	Silent	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr12:52882327G>A	ENST00000330722.6	-	7	1277	c.1209C>T	c.(1207-1209)gcC>gcT	p.A403A		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	403	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.A403A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTGCAGGTTGGCGCACTGGA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	12											67.0	62.0	64.0					12																	52882327		2203	4300	6503	51168594	SO:0001819	synonymous_variant	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1209C>T	12.37:g.52882327G>A		Somatic		Capture	SOLID	Phase_IV	51168594	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Silent	SNP	ENST00000330722.6	37	CCDS41786.1	SNP	47	Baylor																																																																																				0.567	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554		Silent
KRT9	3857	hgsc.bcm.edu	37	17	39726212	39726212	+	Missense_Mutation	SNP	G	G	A	rs200992045		TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:39726212G>A	ENST00000246662.4	-	3	846	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W	KRT9_ENST00000588431.1_Missense_Mutation_p.R28W	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	261	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.R261W(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				AGCACCTGCCGCAGGCCATTG	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20689	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	17											84.0	88.0	86.0					17																	39726212		2203	4300	6503	36979738	SO:0001583	missense	3857				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.781C>T	17.37:g.39726212G>A	ENSP00000246662:p.Arg261Trp	Somatic		Capture	SOLID	Phase_IV	36979738	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	SNP	38	Baylor	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	19.44	3.827459	0.71143	.	.	ENSG00000171403	ENST00000246662	D	0.92545	-3.06	4.96	-1.45	0.08828	Filament (1);	0.711463	0.10927	N	0.618793	D	0.95928	0.8674	M	0.92122	3.275	0.23144	N	0.998221	D	0.89917	1.0	D	0.65773	0.938	D	0.89249	0.3589	10	0.87932	D	0	.	9.884	0.41251	0.0659:0.0:0.4993:0.4348	.	261	P35527	K1C9_HUMAN	W	261	ENSP00000246662:R261W	ENSP00000246662:R261W	R	-	1	2	KRT9	36979738	0.024000	0.19004	0.581000	0.28614	0.983000	0.72400	0.999000	0.29757	0.091000	0.17302	0.491000	0.48974	CGG		0.527	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226		Missense_Mutation
LDLR	3949	hgsc.bcm.edu	37	19	11238730	11238730	+	Missense_Mutation	SNP	C	C	A	rs183255090	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:11238730C>A	ENST00000558518.1	+	16	2545	c.2358C>A	c.(2356-2358)agC>agA	p.S786R	LDLR_ENST00000455727.2_Missense_Mutation_p.S618R|LDLR_ENST00000557933.1_Missense_Mutation_p.S786R|LDLR_ENST00000535915.1_Missense_Mutation_p.S745R|LDLR_ENST00000560628.1_Intron|LDLR_ENST00000545707.1_Missense_Mutation_p.S608R|LDLR_ENST00000558013.1_Missense_Mutation_p.S786R	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	786					cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	AGCCCAGTAGCGTGAGGGCTC	0.617																																					GBM(18;201 575 7820 21545)											0			19											119.0	100.0	106.0					19																	11238730		2203	4300	6503	11099730	SO:0001583	missense	3949			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.2358C>A	19.37:g.11238730C>A	ENSP00000454071:p.Ser786Arg	Somatic		Capture	SOLID	Phase_IV	11099730	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	ENST00000558518.1	37	CCDS12254.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437139	0.25900	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000535915;ENST00000455727	D;D;D	0.90069	-2.61;-2.55;-2.59	4.88	-6.22	0.02058	Growth factor, receptor (1);	0.892392	0.09455	N	0.799905	T	0.82185	0.4982	L	0.61218	1.895	0.09310	N	1	B;B;B;B;B;B	0.18461	0.013;0.01;0.012;0.016;0.028;0.009	B;B;B;B;B;B	0.19946	0.011;0.007;0.007;0.018;0.027;0.027	T	0.66712	-0.5854	10	0.30854	T	0.27	.	5.0195	0.14354	0.2291:0.3001:0.0:0.4708	.	618;608;665;745;798;786	B4DR00;B4DJZ8;B4DII3;B4DTQ3;Q59FQ1;P01130	.;.;.;.;.;LDLR_HUMAN	R	786;608;745;618	ENSP00000437639:S608R;ENSP00000440520:S745R;ENSP00000397829:S618R	ENSP00000252444:S786R	S	+	3	2	LDLR	11099730	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.248000	0.02890	-0.617000	0.05664	-1.036000	0.02392	AGC		0.617	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2			Missense_Mutation
MLX	6945	hgsc.bcm.edu	37	17	40720868	40720868	+	Frame_Shift_Del	DEL	T	T	-			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:40720868delT	ENST00000246912.4	+	4	398	c.345delT	c.(343-345)agtfs	p.S115fs	MLX_ENST00000435881.2_Frame_Shift_Del_p.S61fs|MLX_ENST00000346833.4_Frame_Shift_Del_p.S31fs	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	115					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S115fs*94(1)		kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		ATGAGGACAGTGATTACCACC	0.597																																					GBM(121;657 1601 4665 24731 34640)											1	Deletion - Frameshift(1)	ovary(1)	17											36.0	31.0	33.0					17																	40720868		2203	4300	6503	37974394	SO:0001589	frameshift_variant	6945			AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.345delT	17.37:g.40720868delT	ENSP00000246912:p.Ser115fs	Somatic		Capture	SOLID	Phase_IV	37974394	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Frame_Shift_Del	DEL	ENST00000246912.4	37	CCDS11430.1	DEL	59	Baylor																																																																																				0.597	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450415.1	NM_170607		Frame_Shift_Del
MTL5	9633	hgsc.bcm.edu	37	11	68512557	68512557	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr11:68512557C>G	ENST00000255087.5	-	4	836	c.653G>C	c.(652-654)gGc>gCc	p.G218A	MTL5_ENST00000544963.1_Missense_Mutation_p.G218A|MTL5_ENST00000540869.1_Intron|MTL5_ENST00000443940.2_Missense_Mutation_p.G218A	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	218					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.G218A(1)		breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			CATTTGTGTGCCCCCTTTCAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	11											134.0	130.0	132.0					11																	68512557		2200	4293	6493	68269133	SO:0001583	missense	9633			U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.653G>C	11.37:g.68512557C>G	ENSP00000255087:p.Gly218Ala	Somatic		Capture	SOLID	Phase_IV	68269133	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	ENST00000255087.5	37	CCDS8184.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229141	0.79688	.	.	ENSG00000132749	ENST00000255087;ENST00000443940;ENST00000544963	T;T;T	0.70631	0.56;-0.5;0.08	5.35	5.35	0.76521	.	0.000000	0.52532	D	0.000063	T	0.77598	0.4154	L	0.34521	1.04	0.38303	D	0.943023	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79624	-0.1726	10	0.46703	T	0.11	-16.753	16.8394	0.85964	0.0:1.0:0.0:0.0	.	218;218	Q9Y4I5-3;Q9Y4I5	.;MTL5_HUMAN	A	218	ENSP00000255087:G218A;ENSP00000403086:G218A;ENSP00000440968:G218A	ENSP00000255087:G218A	G	-	2	0	MTL5	68269133	0.988000	0.35896	0.972000	0.41901	0.985000	0.73830	4.255000	0.58804	2.479000	0.83701	0.655000	0.94253	GGC		0.313	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923		Missense_Mutation
MYO7B	4648	hgsc.bcm.edu	37	2	128345993	128345993	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:128345993C>G	ENST00000409816.2	+	14	1749	c.1717C>G	c.(1717-1719)Ctg>Gtg	p.L573V	MYO7B_ENST00000389524.4_Missense_Mutation_p.L573V|MYO7B_ENST00000428314.1_Missense_Mutation_p.L573V			Q6PIF6	MYO7B_HUMAN	myosin VIIB	573	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCGAGACGTGCTGAGCACAGA	0.547																																																0			2											55.0	59.0	58.0					2																	128345993		1972	4150	6122	128062463	SO:0001583	missense	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1717C>G	2.37:g.128345993C>G	ENSP00000386461:p.Leu573Val	Somatic		Capture	SOLID	Phase_IV	128062463	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	c	11.41	1.630605	0.28978	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.89939	-2.59;-2.59;-2.59	5.1	3.31	0.37934	Myosin head, motor domain (2);	0.269718	0.30771	N	0.008908	D	0.84014	0.5379	L	0.46157	1.445	0.34359	D	0.6907	P	0.48162	0.906	P	0.45610	0.487	T	0.82481	-0.0436	10	0.05833	T	0.94	.	11.6118	0.51064	0.0:0.8538:0.0:0.1462	.	573	Q6PIF6	MYO7B_HUMAN	V	573	ENSP00000374175:L573V;ENSP00000415090:L573V;ENSP00000386461:L573V	ENSP00000374175:L573V	L	+	1	2	MYO7B	128062463	0.459000	0.25768	0.947000	0.38551	0.004000	0.04260	1.557000	0.36299	0.567000	0.29293	-1.003000	0.02500	CTG		0.547	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		Missense_Mutation
NBPF1	55672	hgsc.bcm.edu	37	1	16892256	16892256	+	Missense_Mutation	SNP	T	T	C	rs200425003		TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:16892256T>C	ENST00000430580.2	-	27	3823	c.2936A>G	c.(2935-2937)cAg>cGg	p.Q979R		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	979	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CAGTGAGTCCTGCAAGACTTC	0.478																																																0			1											24.0	19.0	21.0					1																	16892256		1491	2617	4108	16764843	SO:0001583	missense	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2936A>G	1.37:g.16892256T>C	ENSP00000474456:p.Gln979Arg	Somatic		Capture	SOLID	Phase_IV	16764843	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37		SNP	55	Baylor																																																																																				0.478	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940		Missense_Mutation
NGB	58157	hgsc.bcm.edu	37	14	77732927	77732927	+	Silent	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr14:77732927G>T	ENST00000298352.4	-	4	782	c.408C>A	c.(406-408)ctC>ctA	p.L136L	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	136	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		CGGCCCCGTAGAGTTGGCTCC	0.637																																																0			14											53.0	50.0	51.0					14																	77732927		2203	4300	6503	76802680	SO:0001819	synonymous_variant	58157			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.408C>A	14.37:g.77732927G>T		Somatic		Capture	SOLID	Phase_IV	76802680		Silent	SNP	ENST00000298352.4	37	CCDS9856.1	SNP	33	Baylor																																																																																				0.637	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1	NM_021257		Silent
NLGN4X	57502	hgsc.bcm.edu	37	X	5821716	5821716	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chrX:5821716T>C	ENST00000381095.3	-	5	1630	c.1003A>G	c.(1003-1005)Acc>Gcc	p.T335A	NLGN4X_ENST00000538097.1_Missense_Mutation_p.T335A|NLGN4X_ENST00000381093.2_Missense_Mutation_p.T355A|NLGN4X_ENST00000381092.1_Missense_Mutation_p.T335A|NLGN4X_ENST00000275857.6_Missense_Mutation_p.T335A	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	335					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.T335A(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						ATGTGGTAGGTGGCCGGGGTG	0.577																																																1	Substitution - Missense(1)	ovary(1)	X											182.0	125.0	144.0					X																	5821716		2203	4300	6503	5831716	SO:0001583	missense	57502			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1003A>G	X.37:g.5821716T>C	ENSP00000370485:p.Thr335Ala	Somatic		Capture	SOLID	Phase_IV	5831716	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.460	0.452973	0.12283	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	3.93	3.93	0.45458	Carboxylesterase, type B (1);	.	.	.	.	T	0.48624	0.1510	N	0.16708	0.43	0.33117	D	0.541359	B;B;B	0.28971	0.229;0.002;0.015	B;B;B	0.29440	0.102;0.014;0.026	T	0.55218	-0.8175	8	.	.	.	.	11.4714	0.50270	0.0:0.0:0.0:1.0	.	392;335;355	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	A	335;355;335;335;335	ENSP00000370485:T335A;ENSP00000370483:T355A;ENSP00000275857:T335A;ENSP00000370482:T335A;ENSP00000439203:T335A	.	T	-	1	0	NLGN4X	5831716	1.000000	0.71417	0.724000	0.30704	0.267000	0.26476	2.485000	0.45250	1.278000	0.44430	0.486000	0.48141	ACC		0.577	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		Missense_Mutation
NTRK3	4916	hgsc.bcm.edu	37	15	88576170	88576170	+	Silent	SNP	C	C	G	rs201918746		TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr15:88576170C>G	ENST00000360948.2	-	13	1664	c.1503G>C	c.(1501-1503)gtG>gtC	p.V501V	NTRK3_ENST00000542733.2_Silent_p.V403V|NTRK3_ENST00000357724.2_Silent_p.V493V|NTRK3_ENST00000394480.2_Silent_p.V501V|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000355254.2_Silent_p.V501V|NTRK3_ENST00000317501.3_Silent_p.V501V|NTRK3_ENST00000557856.1_Silent_p.V493V|NTRK3_ENST00000540489.2_Silent_p.V501V|NTRK3_ENST00000558676.1_Silent_p.V493V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	501					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V501V(1)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGCCAATGACCACAGTGTCGG	0.587			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	1	Substitution - coding silent(1)	ovary(1)	15											108.0	73.0	85.0					15																	88576170		2201	4299	6500	86377174	SO:0001819	synonymous_variant	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1503G>C	15.37:g.88576170C>G		Somatic		Capture	SOLID	Phase_IV	86377174	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1	SNP	21	Baylor																																																																																				0.587	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				Silent
OLFML2A	169611	hgsc.bcm.edu	37	9	127572687	127572687	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr9:127572687T>C	ENST00000373580.3	+	8	1955	c.1955T>C	c.(1954-1956)gTc>gCc	p.V652A	OLFML2A_ENST00000288815.5_Missense_Mutation_p.V438A	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	652	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CACTTCGTGGTCTGAGTGGAG	0.612																																																0			9											66.0	60.0	62.0					9																	127572687		2203	4300	6503	126612508	SO:0001583	missense	169611			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.1955T>C	9.37:g.127572687T>C	ENSP00000362682:p.Val652Ala	Somatic		Capture	SOLID	Phase_IV	126612508	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	37	CCDS6857.2	SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240971	0.39598	.	.	ENSG00000185585	ENST00000342100;ENST00000373580;ENST00000288815	D;D	0.90385	-2.61;-2.66	5.1	5.1	0.69264	Olfactomedin-like (2);	0.074057	0.53938	D	0.000048	D	0.90246	0.6950	L	0.27053	0.805	0.34946	D	0.75076	D;P	0.76494	0.999;0.873	D;P	0.69142	0.962;0.81	D	0.92272	0.5826	10	0.56958	D	0.05	.	8.4438	0.32830	0.0:0.0885:0.0:0.9115	.	438;652	Q68BL7-3;Q68BL7	.;OLM2A_HUMAN	A	344;652;438	ENSP00000362682:V652A;ENSP00000288815:V438A	ENSP00000288815:V438A	V	+	2	0	OLFML2A	126612508	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	1.963000	0.40452	1.921000	0.55644	0.379000	0.24179	GTC		0.612	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487		Missense_Mutation
OR11A1	26531	hgsc.bcm.edu	37	6	29394572	29394572	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:29394572T>A	ENST00000377149.1	-	5	1319	c.847A>T	c.(847-849)Acc>Tcc	p.T283S	OR11A1_ENST00000377148.1_Missense_Mutation_p.T283S|OR11A1_ENST00000377147.2_Missense_Mutation_p.T283S|OR5V1_ENST00000377154.1_Intron			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T283S(1)		cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						AAGAGAGGGGTGACCACAGTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	6											146.0	138.0	141.0					6																	29394572		1511	2709	4220	29502551	SO:0001583	missense	26531				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.847A>T	6.37:g.29394572T>A	ENSP00000366354:p.Thr283Ser	Somatic		Capture	SOLID	Phase_IV	29502551	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	37	CCDS34363.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	14.80	2.644788	0.47258	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.35605	1.3;1.3;1.3	3.34	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40554	N	0.001072	T	0.47340	0.1440	M	0.85777	2.775	0.29161	N	0.87778	D	0.89917	1.0	D	0.80764	0.994	T	0.42207	-0.9465	10	0.87932	D	0	-25.0926	7.9813	0.30185	0.0:0.0:0.2068:0.7932	.	283	Q9GZK7	O11A1_HUMAN	S	283	ENSP00000366353:T283S;ENSP00000366354:T283S;ENSP00000366352:T283S	ENSP00000366352:T283S	T	-	1	0	OR11A1	29502551	0.895000	0.30542	0.992000	0.48379	0.575000	0.36095	0.897000	0.28390	1.370000	0.46153	0.338000	0.21704	ACC		0.473	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1			Missense_Mutation
OR8B2	26595	hgsc.bcm.edu	37	11	124253129	124253129	+	Silent	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr11:124253129G>T	ENST00000375013.2	-	1	129	c.111C>A	c.(109-111)gtC>gtA	p.V37V		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V37V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CTACCATGGTGACAATGTAGA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	11											215.0	185.0	195.0					11																	124253129		2201	4299	6500	123758339	SO:0001819	synonymous_variant	26595			AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.111C>A	11.37:g.124253129G>T		Somatic		Capture	SOLID	Phase_IV	123758339	Q8NGH2	Silent	SNP	ENST00000375013.2	37	CCDS31708.1	SNP	45	Baylor																																																																																				0.418	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387290.1	NM_001005468		Silent
PCDHGB4	8641	hgsc.bcm.edu	37	5	140769843	140769843	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr5:140769843C>G	ENST00000519479.1	+	1	2392	c.2392C>G	c.(2392-2394)Cat>Gat	p.H798D	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	798					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTGACTTCCCATCAGGTGAG	0.353																																																0			5											124.0	123.0	124.0					5																	140769843		1853	4100	5953	140750027	SO:0001583	missense	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2392C>G	5.37:g.140769843C>G	ENSP00000428288:p.His798Asp	Somatic		Capture	SOLID	Phase_IV	140750027	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	37	CCDS54928.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	.	3.539	-0.094064	0.07053	.	.	ENSG00000253953	ENST00000519479	D	0.94457	-3.43	4.99	4.1	0.47936	.	.	.	.	.	D	0.85890	0.5802	N	0.08118	0	0.80722	D	1	B;B	0.24368	0.102;0.0	B;B	0.28139	0.086;0.001	T	0.80341	-0.1423	9	0.12766	T	0.61	.	11.015	0.47682	0.0:0.9098:0.0:0.0902	.	798;798	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	D	798	ENSP00000428288:H798D	ENSP00000428288:H798D	H	+	1	0	PCDHGB4	140750027	0.000000	0.05858	0.935000	0.37517	0.710000	0.40934	0.172000	0.16704	2.599000	0.87857	0.563000	0.77884	CAT		0.353	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		Missense_Mutation
PDE4C	5143	hgsc.bcm.edu	37	19	18321934	18321934	+	Silent	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:18321934G>A	ENST00000355502.3	-	19	2815	c.1944C>T	c.(1942-1944)ccC>ccT	p.P648P	PDE4C_ENST00000594465.3_Silent_p.P648P|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000447275.3_Silent_p.P542P|PDE4C_ENST00000598111.2_Silent_p.P363P|PDE4C_ENST00000597297.1_Silent_p.P418P|PDE4C_ENST00000539010.1_Silent_p.P417P|PDE4C_ENST00000262805.12_Silent_p.P616P|AC068499.10_ENST00000599416.2_RNA|PDE4C_ENST00000594617.3_Silent_p.P648P			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	648					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.P648P(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CGTCCCGCTCGGGGTTGGTGA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	19											127.0	109.0	115.0					19																	18321934		2203	4300	6503	18182934	SO:0001819	synonymous_variant	5143				CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1944C>T	19.37:g.18321934G>A		Somatic		Capture	SOLID	Phase_IV	18182934	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Silent	SNP	ENST00000355502.3	37	CCDS12373.1	SNP	39	Baylor																																																																																				0.582	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1			Silent
PNMA3	29944	hgsc.bcm.edu	37	X	152226780	152226780	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chrX:152226780C>A	ENST00000370264.4	+	1	1394	c.1368C>A	c.(1366-1368)agC>agA	p.S456R	PNMA3_ENST00000370265.4_Intron|PNMA3_ENST00000447306.1_Missense_Mutation_p.S456R			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	456					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					GGGACAAGAGCCATCCCAAGT	0.527																																																0			X											139.0	123.0	129.0					X																	152226780		2203	4300	6503	151977436	SO:0001583	missense	29944			AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.1368C>A	X.37:g.152226780C>A	ENSP00000359286:p.Ser456Arg	Somatic		Capture	SOLID	Phase_IV	151977436	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	CCDS35435.2	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	c	14.66	2.600862	0.46423	.	.	ENSG00000183837	ENST00000447306;ENST00000370264	T;T	0.21932	1.98;1.98	2.16	2.16	0.27623	.	.	.	.	.	T	0.14960	0.0361	L	0.50333	1.59	0.09310	N	0.999999	P	0.47484	0.896	B	0.32583	0.148	T	0.21280	-1.0250	9	0.87932	D	0	.	7.165	0.25685	0.0:1.0:0.0:0.0	.	456	Q9UL41	PNMA3_HUMAN	R	456	ENSP00000407642:S456R;ENSP00000359286:S456R	ENSP00000359286:S456R	S	+	3	2	PNMA3	151977436	0.191000	0.23288	0.235000	0.24058	0.372000	0.29890	1.995000	0.40767	1.378000	0.46305	0.464000	0.42555	AGC		0.527	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		Missense_Mutation
POLI	11201	hgsc.bcm.edu	37	18	51797772	51797772	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr18:51797772G>C	ENST00000579534.1	+	2	301	c.158G>C	c.(157-159)aGa>aCa	p.R53T	POLI_ENST00000579434.1_Intron|POLI_ENST00000406285.3_Missense_Mutation_p.R53T|POLI_ENST00000217800.5_5'UTR	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	53					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R28T(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		GCTTCATCCAGAGTCATAGTA	0.368								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	18											119.0	109.0	113.0					18																	51797772		2203	4300	6503	50051770	SO:0001583	missense	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.158G>C	18.37:g.51797772G>C	ENSP00000462664:p.Arg53Thr	Somatic		Capture	SOLID	Phase_IV	50051770	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368606	0.82463	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.35421	1.31	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.51024	0.1650	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	T	0.54523	-0.8281	10	0.87932	D	0	-24.5573	17.401	0.87459	0.0:0.0:1.0:0.0	.	52;53	B7Z780;Q9UNA4	.;POLI_HUMAN	T	53	ENSP00000385196:R53T	ENSP00000217800:R53T	R	+	2	0	POLI	50051770	1.000000	0.71417	0.987000	0.45799	0.903000	0.53119	6.071000	0.71229	2.382000	0.81193	0.563000	0.77884	AGA		0.368	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195		Missense_Mutation
PTN	5764	hgsc.bcm.edu	37	7	136939642	136939642	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr7:136939642C>T	ENST00000348225.2	-	2	506	c.79G>A	c.(79-81)Gtg>Atg	p.V27M	PTN_ENST00000393083.2_Missense_Mutation_p.V27M	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	27					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						GCAGTATCCACAGCTGCCAGT	0.443																																																0			7											80.0	78.0	78.0					7																	136939642		2203	4300	6503	136590182	SO:0001583	missense	5764			M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.79G>A	7.37:g.136939642C>T	ENSP00000341170:p.Val27Met	Somatic		Capture	SOLID	Phase_IV	136590182	Q5U0B0|Q6ICQ5|Q9UCC6	Missense_Mutation	SNP	ENST00000348225.2	37	CCDS5844.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969826	0.74246	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	5.36	5.36	0.76844	Midkine heparin-binding growth factor, N-terminal (1);	0.363651	0.32161	N	0.006493	T	0.54919	0.1888	N	0.08118	0	0.37480	D	0.915969	D;D	0.61697	0.99;0.972	D;P	0.72982	0.979;0.861	T	0.68021	-0.5519	9	0.72032	D	0.01	-14.2224	17.2654	0.87085	0.0:1.0:0.0:0.0	.	27;27	C9JR52;P21246	.;PTN_HUMAN	M	27	.	ENSP00000341170:V27M	V	-	1	0	PTN	136590182	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.191000	0.50981	2.487000	0.83934	0.650000	0.86243	GTG		0.443	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825		Missense_Mutation
PTPRS	5802	hgsc.bcm.edu	37	19	5222817	5222817	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:5222817T>C	ENST00000587303.1	-	17	3085	c.2986A>G	c.(2986-2988)Acg>Gcg	p.T996A	PTPRS_ENST00000372412.4_Missense_Mutation_p.T997A|PTPRS_ENST00000348075.2_Missense_Mutation_p.T974A|PTPRS_ENST00000588552.1_Intron|PTPRS_ENST00000262963.6_Missense_Mutation_p.T992A|PTPRS_ENST00000588012.1_Missense_Mutation_p.T974A|PTPRS_ENST00000353284.2_Intron|PTPRS_ENST00000357368.4_Missense_Mutation_p.T996A|PTPRS_ENST00000592099.1_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	996	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.		T -> M (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T996A(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CCCTGCAGCGTGAGCGCGTTC	0.736																																																1	Substitution - Missense(1)	ovary(1)	19											12.0	16.0	15.0					19																	5222817		2105	4088	6193	5173817	SO:0001583	missense	5802			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.2986A>G	19.37:g.5222817T>C	ENSP00000467537:p.Thr996Ala	Somatic		Capture	SOLID	Phase_IV	5173817	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.19	2.760814	0.49468	.	.	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	4.33	4.33	0.51752	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.275088	0.27881	U	0.017466	T	0.65903	0.2736	M	0.83603	2.65	0.80722	D	1	B;B	0.33448	0.373;0.412	B;B	0.40982	0.117;0.345	T	0.69506	-0.5127	10	0.46703	T	0.11	.	13.6454	0.62279	0.0:0.0:0.0:1.0	.	974;996	Q13332-6;Q13332	.;PTPRS_HUMAN	A	997;996;996;987;992;974	ENSP00000361489:T997A;ENSP00000349932:T996A;ENSP00000262963:T992A;ENSP00000269907:T974A	ENSP00000262963:T992A	T	-	1	0	PTPRS	5173817	1.000000	0.71417	1.000000	0.80357	0.631000	0.37964	4.944000	0.63561	1.829000	0.53265	0.455000	0.32223	ACG		0.736	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2			Missense_Mutation
RASAL1	8437	hgsc.bcm.edu	37	12	113544933	113544934	+	Frame_Shift_Ins	INS	-	-	A			TCGA-13-0919-01	TCGA-13-0919-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr12:113544933_113544934insA	ENST00000261729.5	-	16	1940_1941	c.1625_1626insT	c.(1624-1626)ctgfs	p.L542fs	RASAL1_ENST00000548055.1_Frame_Shift_Ins_p.L542fs|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_Frame_Shift_Ins_p.L542fs|RASAL1_ENST00000546530.1_Frame_Shift_Ins_p.L543fs			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	542					intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CCAGCCGGTCCAGGAAGTCTCT	0.604																																																0			12																																								112029317	SO:0001589	frameshift_variant	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1626dupT	12.37:g.113544934_113544934dupA	ENSP00000261729:p.Leu542fs	Somatic		Capture	SOLID	Phase_IV	112029316	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Frame_Shift_Ins	INS	ENST00000261729.5	37	CCDS9165.1	INS	21	Baylor																																																																																				0.604	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Frame_Shift_Ins
SCAF8	22828	hgsc.bcm.edu	37	6	155154016	155154016	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:155154016G>T	ENST00000367178.3	+	20	3879	c.3303G>T	c.(3301-3303)gaG>gaT	p.E1101D	TIAM2_ENST00000461783.3_5'UTR|SCAF8_ENST00000367186.4_Missense_Mutation_p.E1167D|SCAF8_ENST00000417268.1_Missense_Mutation_p.E1101D	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1101					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)	p.E1101D(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						ATTTTGATGAGAGAGAGCATC	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											51.0	57.0	55.0					6																	155154016		2203	4300	6503	155195708	SO:0001583	missense	22828			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3303G>T	6.37:g.155154016G>T	ENSP00000356146:p.Glu1101Asp	Somatic		Capture	SOLID	Phase_IV	155195708	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	CCDS5247.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358539	0.41801	.	.	ENSG00000213079;ENSG00000213079;ENSG00000213079;ENSG00000146426	ENST00000367178;ENST00000417268;ENST00000367186;ENST00000528928	T;T;T	0.59638	0.3;0.3;0.25	5.73	2.55	0.30701	.	0.142017	0.45361	U	0.000370	T	0.48732	0.1516	L	0.32530	0.975	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.72625	0.978;0.978;0.978	T	0.52003	-0.8633	10	0.52906	T	0.07	.	7.0648	0.25145	0.4495:0.0:0.5505:0.0	.	1146;1167;1101	B7Z876;B7Z888;Q9UPN6	.;.;SCAF8_HUMAN	D	1101;1101;1167;62	ENSP00000356146:E1101D;ENSP00000413098:E1101D;ENSP00000356154:E1167D	ENSP00000356146:E1101D	E	+	3	2	TIAM2;SCAF8	155195708	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.080000	0.30779	0.778000	0.33520	-0.150000	0.13652	GAG		0.463	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892		Missense_Mutation
RBM18	92400	hgsc.bcm.edu	37	9	125014167	125014167	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr9:125014167G>C	ENST00000417201.3	-	3	339	c.199C>G	c.(199-201)Cag>Gag	p.Q67E	RBM18_ENST00000483428.1_5'UTR	NM_033117.3	NP_149108.1	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	67	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7						CCTCGAGGCTGTCCCTCCAAA	0.413																																																0			9											84.0	88.0	86.0					9																	125014167		2203	4300	6503	124053988	SO:0001583	missense	92400			AK057676	CCDS6839.1	9q34.11	2013-02-12			ENSG00000119446	ENSG00000119446		"""RNA binding motif (RRM) containing"""	28413	protein-coding gene	gene with protein product						12477932	Standard	NM_033117		Approved	MGC2734	uc004bma.2	Q96H35	OTTHUMG00000020602	ENST00000417201.3:c.199C>G	9.37:g.125014167G>C	ENSP00000409315:p.Gln67Glu	Somatic		Capture	SOLID	Phase_IV	124053988	B3KQ89	Missense_Mutation	SNP	ENST00000417201.3	37	CCDS6839.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476374	0.44044	.	.	ENSG00000119446	ENST00000417201	T	0.16196	2.36	5.97	5.97	0.96955	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	N	0.21282	0.65	0.80722	D	1	D	0.53885	0.963	D	0.68621	0.959	T	0.02263	-1.1186	10	0.16420	T	0.52	-13.8331	19.4222	0.94726	0.0:0.0:1.0:0.0	.	67	Q96H35	RBM18_HUMAN	E	67	ENSP00000409315:Q67E	ENSP00000409315:Q67E	Q	-	1	0	RBM18	124053988	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.326000	0.96389	2.838000	0.97847	0.561000	0.74099	CAG		0.413	RBM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053928.2	NM_033117		Missense_Mutation
RC3H1	149041	hgsc.bcm.edu	37	1	173952739	173952739	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:173952739G>C	ENST00000367696.2	-	4	760	c.409C>G	c.(409-411)Ctt>Gtt	p.L137V	RC3H1_ENST00000367694.2_Missense_Mutation_p.L137V|RC3H1_ENST00000258349.4_Missense_Mutation_p.L137V			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	137					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						AGAGTCACAAGCTTCCTCTGC	0.453																																																0			1											128.0	118.0	122.0					1																	173952739		2203	4300	6503	172219362	SO:0001583	missense	149041			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.409C>G	1.37:g.173952739G>C	ENSP00000356669:p.Leu137Val	Somatic		Capture	SOLID	Phase_IV	172219362	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	37	CCDS30940.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020464	0.75275	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	D;D;D	0.95690	-3.78;-3.78;-3.78	5.29	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.97232	0.9095	M	0.75447	2.3	0.58432	D	0.999998	D;D;D;D	0.89917	0.997;0.997;0.998;1.0	D;D;D;D	0.83275	0.991;0.991;0.996;0.996	D	0.97084	0.9786	10	0.56958	D	0.05	-13.7455	14.8112	0.69996	0.0733:0.0:0.9267:0.0	.	137;137;137;137	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	V	137	ENSP00000356669:L137V;ENSP00000258349:L137V;ENSP00000356667:L137V	ENSP00000258349:L137V	L	-	1	0	RC3H1	172219362	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.972000	0.70448	2.630000	0.89119	0.557000	0.71058	CTT		0.453	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071		Missense_Mutation
RNF25	64320	hgsc.bcm.edu	37	2	219532686	219532686	+	Silent	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:219532686G>C	ENST00000295704.2	-	5	746	c.306C>G	c.(304-306)ggC>ggG	p.G102G		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	102	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCCACGTGGCCCAGCACCT	0.517																																																0			2											111.0	116.0	114.0					2																	219532686		2203	4300	6503	219240930	SO:0001819	synonymous_variant	64320				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.306C>G	2.37:g.219532686G>C		Somatic		Capture	SOLID	Phase_IV	219240930	A8K0D6|Q53HQ5|Q9H874	Silent	SNP	ENST00000295704.2	37	CCDS2420.1	SNP	42	Baylor																																																																																				0.517	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453		Silent
RRAS	6237	hgsc.bcm.edu	37	19	50140343	50140343	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:50140343G>C	ENST00000246792.3	-	2	300	c.198C>G	c.(196-198)taC>taG	p.Y66*		NM_006270.3	NP_006261.1	P10301	RRAS_HUMAN	related RAS viral (r-ras) oncogene homolog	66					axon guidance (GO:0007411)|negative regulation of cell migration (GO:0030336)|positive regulation of angiogenesis (GO:0045766)|Ras protein signal transduction (GO:0007265)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)	p.Y66*(1)		endometrium(1)|kidney(1)|lung(2)|ovary(2)	6				OV - Ovarian serous cystadenocarcinoma(262;0.00114)|GBM - Glioblastoma multiforme(134;0.0206)		AGATCTTCGTGTAGGAGTCCT	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	19											103.0	89.0	94.0					19																	50140343		2203	4300	6503	54832155	SO:0001587	stop_gained	6237				CCDS12774.1	19q13.33	2014-05-09				ENSG00000126458			10447	protein-coding gene	gene with protein product	"""Oncogene RRAS"""	165090				3098437	Standard	NM_006270		Approved		uc002pop.1	P10301		ENST00000246792.3:c.198C>G	19.37:g.50140343G>C	ENSP00000246792:p.Tyr66*	Somatic		Capture	SOLID	Phase_IV	54832155	Q6FH12	Nonsense_Mutation	SNP	ENST00000246792.3	37	CCDS12774.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681617	0.88542	.	.	ENSG00000126458	ENST00000246792	.	.	.	4.67	2.49	0.30216	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8091	0.29219	0.2909:0.0:0.7091:0.0	.	.	.	.	X	66	.	ENSP00000246792:Y66X	Y	-	3	2	RRAS	54832155	1.000000	0.71417	0.991000	0.47740	0.975000	0.68041	2.571000	0.45990	0.525000	0.28522	0.557000	0.71058	TAC		0.612	RRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465791.1	NM_006270		Nonsense_Mutation
SALL2	6297	hgsc.bcm.edu	37	14	21990979	21990979	+	Silent	SNP	C	C	T			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr14:21990979C>T	ENST00000327430.3	-	2	3177	c.2883G>A	c.(2881-2883)ctG>ctA	p.L961L	SALL2_ENST00000317492.5_Intron|SALL2_ENST00000538754.1_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Silent_p.L824L	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	961					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L961L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGTGGTGTGCCAGGAGCATAT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	14											66.0	63.0	64.0					14																	21990979		2203	4300	6503	21060819	SO:0001819	synonymous_variant	6297			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2883G>A	14.37:g.21990979C>T		Somatic		Capture	SOLID	Phase_IV	21060819	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	ENST00000327430.3	37	CCDS32045.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.939	-0.710050	0.03230	.	.	ENSG00000165821	ENST00000546363	.	.	.	5.18	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.0105	6.6381	0.22895	0.177:0.7309:0.0:0.0921	.	.	.	.	X	820	.	.	W	-	2	0	SALL2	21060819	1.000000	0.71417	0.993000	0.49108	0.449000	0.32228	1.364000	0.34171	1.165000	0.42670	0.462000	0.41574	TGG		0.577	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407		Silent
SAMD11	148398	hgsc.bcm.edu	37	1	874465	874466	+	Frame_Shift_Ins	INS	-	-	C			TCGA-13-0919-01	TCGA-13-0919-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:874465_874466insC	ENST00000342066.3	+	6	559_560	c.476_477insC	c.(475-480)agcgacfs	p.D160fs		NM_152486.2	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11	160					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)		p.D160fs*47(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CGTATCAGCAGCGACTGCTTTT	0.624																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								864329	SO:0001589	frameshift_variant	148398			BC024295	CCDS2.2	1p36.33	2013-01-10			ENSG00000187634	ENSG00000187634		"""Sterile alpha motif (SAM) domain containing"""	28706	protein-coding gene	gene with protein product						12477932	Standard	NM_152486		Approved	MGC45873	uc001abw.1	Q96NU1	OTTHUMG00000040719	ENST00000342066.3:c.477dupC	1.37:g.874466_874466dupC	ENSP00000342313:p.Asp160fs	Somatic		Capture	SOLID	Phase_IV	864328	A2AA76|I7FV78|I7FV81|I7G0Z6|Q5SV96|Q5SV99|Q5SVA0|Q8N195|Q8TB59	Frame_Shift_Ins	INS	ENST00000342066.3	37	CCDS2.2	INS	34	Baylor																																																																																				0.624	SAMD11-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276866.2	NM_152486		Frame_Shift_Ins
SCAMP4	113178	hgsc.bcm.edu	37	19	1917795	1917795	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:1917795T>A	ENST00000316097.8	+	3	377	c.110T>A	c.(109-111)gTg>gAg	p.V37E	SCAMP4_ENST00000409472.1_Missense_Mutation_p.V37E|SCAMP4_ENST00000414057.2_3'UTR	NM_079834.2	NP_524558.1	Q969E2	SCAM4_HUMAN	secretory carrier membrane protein 4	37					protein transport (GO:0015031)	integral component of membrane (GO:0016021)							Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGTCCTGGTGAAGAGGATC	0.622																																																0			19											56.0	63.0	61.0					19																	1917795		2051	4195	6246	1868795	SO:0001583	missense	113178			AK091166	CCDS45903.1	19p13.3	2013-02-21			ENSG00000227500	ENSG00000227500		"""Secretory carrier membrane proteins"""	30385	protein-coding gene	gene with protein product		613764					Standard	NM_079834		Approved	FLJ33847	uc002luj.4	Q969E2	OTTHUMG00000154590	ENST00000316097.8:c.110T>A	19.37:g.1917795T>A	ENSP00000316007:p.Val37Glu	Somatic		Capture	SOLID	Phase_IV	1868795	Q8N2N1|Q8NAV0	Missense_Mutation	SNP	ENST00000316097.8	37	CCDS45903.1	SNP	59	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	12.39|12.39	1.925008|1.925008	0.34002|0.34002	.|.	.|.	ENSG00000227500|ENSG00000227500	ENST00000316097;ENST00000409472;ENST00000411971|ENST00000414057	T;T|.	0.20881|.	2.04;2.04|.	4.3|4.3	3.28|3.28	0.37604|0.37604	.|.	.|.	.|.	.|.	.|.	T|.	0.72590|.	0.3479|.	M|M	0.86268|0.86268	2.805|2.805	0.58432|0.58432	D|D	0.999996|0.999996	P;P;B|.	0.49961|.	0.93;0.891;0.38|.	P;P;B|.	0.52424|.	0.669;0.698;0.283|.	T|.	0.70988|.	-0.4722|.	9|.	0.72032|.	D|.	0.01|.	-5.4115|-5.4115	6.8022|6.8022	0.23758|0.23758	0.0:0.1875:0.0:0.8125|0.0:0.1875:0.0:0.8125	.|.	37;37;37|.	Q969E2-2;Q969E2;F8WDW4|.	.;SCAM4_HUMAN;.|.	E|R	37;37;109|47	ENSP00000316007:V37E;ENSP00000386865:V37E|.	ENSP00000316007:V37E|.	V|X	+|+	2|1	0|0	SCAMP4|SCAMP4	1868795|1868795	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.002000|0.002000	0.02628|0.02628	2.323000|2.323000	0.43823|0.43823	0.618000|0.618000	0.30179|0.30179	-0.415000|-0.415000	0.06103|0.06103	GTG|TGA		0.622	SCAMP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336210.3	NM_079834		Missense_Mutation
SERPINB10	5273	hgsc.bcm.edu	37	18	61587044	61587044	+	Missense_Mutation	SNP	C	C	T	rs145764045	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr18:61587044C>T	ENST00000238508.3	+	5	454	c.395C>T	c.(394-396)aCa>aTa	p.T132I		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	132					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GACATGAAAACATATTTTGGT	0.338																																																0			18						C	ILE/THR	0,4406		0,0,2203	70.0	84.0	79.0		395	3.3	0.6	18	dbSNP_134	79	3,8595	3.0+/-9.4	0,3,4296	yes	missense	SERPINB10	NM_005024.1	89	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231		132/398	61587044	3,13001	2203	4299	6502	59738024	SO:0001583	missense	5273			U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.395C>T	18.37:g.61587044C>T	ENSP00000238508:p.Thr132Ile	Somatic		Capture	SOLID	Phase_IV	59738024	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	SNP	17	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004624	0.54254	0.0	3.49E-4	ENSG00000242550	ENST00000238508	D	0.84516	-1.86	5.33	3.35	0.38373	Serpin domain (3);	0.525914	0.21193	N	0.078617	D	0.83931	0.5361	M	0.68952	2.095	0.22001	N	0.999429	P	0.46784	0.884	P	0.47528	0.549	T	0.75941	-0.3140	10	0.59425	D	0.04	.	5.018	0.14347	0.3684:0.5161:0.0:0.1155	.	132	P48595	SPB10_HUMAN	I	132	ENSP00000238508:T132I	ENSP00000238508:T132I	T	+	2	0	SERPINB10	59738024	0.224000	0.23674	0.649000	0.29536	0.947000	0.59692	1.117000	0.31234	0.574000	0.29417	0.655000	0.94253	ACA		0.338	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024		Missense_Mutation
SF3B4	10262	hgsc.bcm.edu	37	1	149895759	149895760	+	Frame_Shift_Ins	INS	-	-	G			TCGA-13-0919-01	TCGA-13-0919-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:149895759_149895760insG	ENST00000271628.8	-	5	1644_1645	c.1060_1061insC	c.(1060-1062)cgafs	p.R354fs		NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	354					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R354fs*>72(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TGGAGGCCCTCGGGGGGGCATG	0.624																																																1	Insertion - Frameshift(1)	ovary(1)	1								15,4235		0,15,2110						5.0	1.0			16	15,8229		0,15,4107	no	frameshift	SF3B4	NM_005850.4		0,30,6217	A1A1,A1R,RR		0.182,0.3529,0.2401				30,12464				148162384	SO:0001589	frameshift_variant	10262			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.1061dupC	1.37:g.149895766_149895766dupG	ENSP00000271628:p.Arg354fs	Somatic		Capture	SOLID	Phase_IV	148162383	Q5SZ63	Frame_Shift_Ins	INS	ENST00000271628.8	37	CCDS941.1	INS	31	Baylor																																																																																				0.624	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850		Frame_Shift_Ins
SLC17A7	57030	hgsc.bcm.edu	37	19	49935787	49935787	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:49935787delA	ENST00000221485.3	-	9	1310	c.1139delT	c.(1138-1140)atgfs	p.M380fs	SLC17A7_ENST00000600601.1_Frame_Shift_Del_p.M313fs|SLC17A7_ENST00000543531.1_Frame_Shift_Del_p.M368fs	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	380					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)	p.M380fs*31(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		TCCGCAGTTCATCAACTTGCG	0.652																																																1	Deletion - Frameshift(1)	ovary(1)	19											17.0	19.0	19.0					19																	49935787		2201	4298	6499	54627599	SO:0001589	frameshift_variant	57030			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1139delT	19.37:g.49935787delA	ENSP00000221485:p.Met380fs	Somatic		Capture	SOLID	Phase_IV	54627599	B4DFR9|B4DG46|Q6PCD0	Frame_Shift_Del	DEL	ENST00000221485.3	37	CCDS12764.1	DEL	8	Baylor																																																																																				0.652	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2			Frame_Shift_Del
SLC4A4	8671	hgsc.bcm.edu	37	4	72412099	72412099	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr4:72412099G>A	ENST00000264485.5	+	19	2592	c.2475G>A	c.(2473-2475)tgG>tgA	p.W825*	SLC4A4_ENST00000425175.1_Nonsense_Mutation_p.W825*|SLC4A4_ENST00000340595.3_Nonsense_Mutation_p.W781*|SLC4A4_ENST00000351898.6_Intron	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	825					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.W781*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ATCTCTTTTGGGTGGCCATCC	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	4											269.0	218.0	235.0					4																	72412099		2203	4300	6503	72630963	SO:0001587	stop_gained	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2475G>A	4.37:g.72412099G>A	ENSP00000264485:p.Trp825*	Somatic		Capture	SOLID	Phase_IV	72630963	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Nonsense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	42	9.319782	0.99135	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	.	.	.	5.55	5.55	0.83447	.	0.053182	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	19.5157	0.95162	0.0:0.0:1.0:0.0	.	.	.	.	X	825;825;781	.	ENSP00000264485:W825X	W	+	3	0	SLC4A4	72630963	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.602000	0.87976	0.650000	0.86243	TGG		0.438	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759		Nonsense_Mutation
SNPH	9751	hgsc.bcm.edu	37	20	1285810	1285810	+	Silent	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr20:1285810G>A	ENST00000381873.3	+	6	833	c.597G>A	c.(595-597)gaG>gaA	p.E199E	SNPH_ENST00000381867.1_Silent_p.E243E	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	199					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.E199E(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCACTGGGGAGTCAGCCGGTG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	20											60.0	49.0	53.0					20																	1285810		2203	4300	6503	1233810	SO:0001819	synonymous_variant	9751				CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.597G>A	20.37:g.1285810G>A		Somatic		Capture	SOLID	Phase_IV	1233810	Q8IYI3	Silent	SNP	ENST00000381873.3	37	CCDS13012.1	SNP	36	Baylor																																																																																				0.632	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723		Silent
SNRNP200	23020	hgsc.bcm.edu	37	2	96951025	96951025	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:96951025C>G	ENST00000323853.5	-	30	4134	c.4057G>C	c.(4057-4059)Ggc>Cgc	p.G1353R	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1353	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.G1353R(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TTCCCGCTGCCCGTGGGGGCC	0.537																																																1	Substitution - Missense(1)	ovary(1)	2											79.0	78.0	79.0					2																	96951025		2203	4300	6503	96314752	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4057G>C	2.37:g.96951025C>G	ENSP00000317123:p.Gly1353Arg	Somatic		Capture	SOLID	Phase_IV	96314752	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.152188	0.94645	.	.	ENSG00000144028	ENST00000323853	T	0.79352	-1.26	5.79	5.79	0.91817	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92760	0.7698	H	0.97340	3.985	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.94770	0.7944	10	0.87932	D	0	-16.916	18.8028	0.92025	0.0:1.0:0.0:0.0	.	1353	O75643	U520_HUMAN	R	1353	ENSP00000317123:G1353R	ENSP00000317123:G1353R	G	-	1	0	SNRNP200	96314752	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.466000	0.80914	2.746000	0.94184	0.655000	0.94253	GGC		0.537	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014		Missense_Mutation
SPIN3	169981	hgsc.bcm.edu	37	X	57020662	57020662	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chrX:57020662delA	ENST00000374919.3	-	2	1041	c.719delT	c.(718-720)ttcfs	p.F240fs		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	240					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						AAATTTGATGAAGTACACAGA	0.398																																																0			X											82.0	77.0	79.0					X																	57020662		2196	4300	6496	57037387	SO:0001589	frameshift_variant	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.719delT	X.37:g.57020662delA	ENSP00000364054:p.Phe240fs	Somatic		Capture	SOLID	Phase_IV	57037387	B2RUW3|B7Z8W2|Q8N5D9	Frame_Shift_Del	DEL	ENST00000374919.3	37	CCDS43963.1	DEL	9	Baylor																																																																																				0.398	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056908.1	XM_093024		Frame_Shift_Del
SPTBN1	6711	hgsc.bcm.edu	37	2	54870202	54870202	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:54870202T>A	ENST00000356805.4	+	19	4222	c.3941T>A	c.(3940-3942)tTg>tAg	p.L1314*	SPTBN1_ENST00000333896.5_Nonsense_Mutation_p.L1301*	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1314					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.L1314*(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGTAAATGGTTGAAGCATCAA	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	2											109.0	108.0	108.0					2																	54870202		2203	4300	6503	54723706	SO:0001587	stop_gained	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3941T>A	2.37:g.54870202T>A	ENSP00000349259:p.Leu1314*	Somatic		Capture	SOLID	Phase_IV	54723706	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Nonsense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	SNP	63	Baylor	.	.	.	.	.	.	.	.	.	.	T	46	12.247378	0.99650	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	.	.	.	5.73	4.56	0.56223	.	0.072426	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2753	0.54730	0.1271:0.0:0.0:0.8729	.	.	.	.	X	1314;1301	.	ENSP00000334156:L1301X	L	+	2	0	SPTBN1	54723706	1.000000	0.71417	0.530000	0.27963	0.947000	0.59692	4.971000	0.63749	0.984000	0.38629	0.533000	0.62120	TTG		0.423	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			Nonsense_Mutation
STMN3	50861	hgsc.bcm.edu	37	20	62275198	62275198	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr20:62275198T>C	ENST00000370053.1	-	3	283	c.202A>G	c.(202-204)Agc>Ggc	p.S68G	STMN3_ENST00000540534.1_Missense_Mutation_p.S57G	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	68	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			AGCATAGGGCTCTCTGGGGAC	0.622																																																0			20											87.0	85.0	86.0					20																	62275198		2203	4300	6503	61745642	SO:0001583	missense	50861			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.202A>G	20.37:g.62275198T>C	ENSP00000359070:p.Ser68Gly	Somatic		Capture	SOLID	Phase_IV	61745642	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	ENST00000370053.1	37	CCDS13529.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.025	0.372963	0.11409	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	4.76	4.76	0.60689	.	0.067486	0.56097	U	0.000023	T	0.25044	0.0608	N	0.11255	0.115	0.30765	N	0.743666	B	0.32396	0.369	B	0.30782	0.12	T	0.18493	-1.0335	9	0.33141	T	0.24	-23.2378	14.2813	0.66213	0.0:0.0:0.0:1.0	.	68	Q9NZ72	STMN3_HUMAN	G	68;57	.	ENSP00000359070:S68G	S	-	1	0	STMN3	61745642	0.965000	0.33210	0.996000	0.52242	0.007000	0.05969	0.779000	0.26746	1.788000	0.52465	0.402000	0.26972	AGC		0.622	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080163.1	NM_015894		Missense_Mutation
GTF2A1L	11036	hgsc.bcm.edu	37	2	48848422	48848422	+	Silent	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr2:48848422G>A	ENST00000403751.3	+	3	277	c.240G>A	c.(238-240)tcG>tcA	p.S80S	GTF2A1L_ENST00000430487.2_Silent_p.S46S|STON1-GTF2A1L_ENST00000394754.1_Silent_p.S784S|STON1-GTF2A1L_ENST00000309827.2_Silent_p.S784S|STON1-GTF2A1L_ENST00000402114.2_Silent_p.S784S|STON1-GTF2A1L_ENST00000394751.3_Silent_p.S784S|STON1-GTF2A1L_ENST00000405008.1_Silent_p.S784S|GTF2A1L_ENST00000468326.1_3'UTR	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	80					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.S784S(1)		lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CATTGCAATCGTCAACAGGTT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	2											72.0	72.0	72.0					2																	48848422		2203	4300	6503	48701926	SO:0001819	synonymous_variant	286749			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.240G>A	2.37:g.48848422G>A		Somatic		Capture	SOLID	Phase_IV	48701926	B4DY14|Q53FD9|Q5D050	Silent	SNP	ENST00000403751.3	37	CCDS46281.1	SNP	40	Baylor																																																																																				0.383	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323852.4	NM_006872		Silent
STRADA	92335	hgsc.bcm.edu	37	17	61781806	61781806	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:61781806G>A	ENST00000336174.6	-	11	1107	c.995C>T	c.(994-996)cCc>cTc	p.P332L	STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000245865.5_3'UTR|STRADA_ENST00000579340.1_3'UTR|STRADA_ENST00000582137.1_Missense_Mutation_p.P303L|STRADA_ENST00000392950.4_Missense_Mutation_p.P295L|STRADA_ENST00000375840.4_Missense_Mutation_p.P274L|STRADA_ENST00000447001.3_Missense_Mutation_p.P288L|RP11-51F16.8_ENST00000580553.1_3'UTR	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	332	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GGAGGGCCGGGGGGTGCTGGT	0.642																																																0			17											32.0	33.0	32.0					17																	61781806		2202	4300	6502	59135538	SO:0001583	missense	92335			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.995C>T	17.37:g.61781806G>A	ENSP00000336655:p.Pro332Leu	Somatic		Capture	SOLID	Phase_IV	59135538	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	37	CCDS32703.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.013	0.983074	0.18889	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.56776	0.47;0.48;0.44;0.49	4.91	2.8	0.32819	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.517985	0.21296	N	0.076896	T	0.27524	0.0676	N	0.14661	0.345	0.32431	N	0.548056	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0	T	0.12630	-1.0540	10	0.32370	T	0.25	.	1.7342	0.02938	0.1844:0.2823:0.3833:0.15	.	303;288;274;295;295;332	B4DW17;B4DDE3;Q5JPI2;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;STRAA_HUMAN	L	332;274;288;295;294	ENSP00000336655:P332L;ENSP00000365000:P274L;ENSP00000398841:P288L;ENSP00000376677:P295L	ENSP00000245865:P294L	P	-	2	0	STRADA	59135538	0.934000	0.31675	0.998000	0.56505	0.791000	0.44710	0.807000	0.27140	1.263000	0.44181	0.491000	0.48974	CCC		0.642	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1			Missense_Mutation
SVEP1	79987	hgsc.bcm.edu	37	9	113308525	113308525	+	Silent	SNP	T	T	A	rs41305611	byFrequency	TCGA-13-0919-01	TCGA-13-0919-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr9:113308525T>A	ENST00000401783.2	-	3	1170	c.834A>T	c.(832-834)tcA>tcT	p.S278S	SVEP1_ENST00000374461.1_Silent_p.S255S|SVEP1_ENST00000302728.8_Silent_p.S278S|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Silent_p.S255S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	278					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CACAAAGATATGAGCAGTGGA	0.423													T|||	173	0.0345447	0.0182	0.0533	5008	,	,		20933	0.0		0.0835	False		,,,				2504	0.0286															0			9						T		131,3739		3,125,1807	78.0	72.0	74.0		834	-11.5	0.4	9	dbSNP_127	74	808,7462		50,708,3377	no	coding-synonymous	SVEP1	NM_153366.3		53,833,5184	AA,AT,TT		9.7703,3.385,7.7348		278/3572	113308525	939,11201	1935	4135	6070	112348346	SO:0001819	synonymous_variant	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.834A>T	9.37:g.113308525T>A		Somatic		Capture	SOLID	Phase_IV	112348346	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	51	Baylor																																																																																				0.423	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Silent
TOP2A	7153	hgsc.bcm.edu	37	17	38567939	38567939	+	Silent	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:38567939G>C	ENST00000423485.1	-	8	1079	c.921C>G	c.(919-921)ggC>ggG	p.G307G		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	307					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)	p.G307G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TTTGCTGAAAGCCTTTTTCAC	0.313																																																1	Substitution - coding silent(1)	ovary(1)	17											120.0	110.0	113.0					17																	38567939		1847	4089	5936	35821465	SO:0001819	synonymous_variant	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.921C>G	17.37:g.38567939G>C		Somatic		Capture	SOLID	Phase_IV	35821465	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	ENST00000423485.1	37	CCDS45672.1	SNP	34	Baylor																																																																																				0.313	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			Silent
TEX14	56155	hgsc.bcm.edu	37	17	56638929	56638929	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:56638929G>A	ENST00000240361.8	-	30	4332	c.4247C>T	c.(4246-4248)cCa>cTa	p.P1416L	TEX14_ENST00000349033.5_Missense_Mutation_p.P1370L|TEX14_ENST00000389934.3_Missense_Mutation_p.P1410L|TEX14_ENST00000584699.1_5'UTR			Q8IWB6	TEX14_HUMAN	testis expressed 14	1416					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)	p.P1370L(1)|p.P1416L(1)		breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCCTCAGGTGGCTGCAGCCA	0.498																																																2	Substitution - Missense(2)	ovary(2)	17											142.0	138.0	139.0					17																	56638929		2203	4300	6503	53993928	SO:0001583	missense	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.4247C>T	17.37:g.56638929G>A	ENSP00000240361:p.Pro1416Leu	Somatic		Capture	SOLID	Phase_IV	53993928	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	37	CCDS56042.1	SNP	47	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010829	0.35511	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.22945	1.93;1.93;1.93	5.09	-0.47	0.12131	.	0.778438	0.11564	N	0.551474	T	0.17365	0.0417	L	0.40543	1.245	0.29079	N	0.882807	B;B;B	0.13145	0.004;0.007;0.007	B;B;B	0.11329	0.003;0.006;0.006	T	0.21724	-1.0237	10	0.42905	T	0.14	0.4006	4.1484	0.10227	0.3354:0.0:0.5123:0.1523	.	1416;1370;1410	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	L	1416;1410;1370	ENSP00000240361:P1416L;ENSP00000374584:P1410L;ENSP00000268910:P1370L	ENSP00000240361:P1416L	P	-	2	0	TEX14	53993928	0.992000	0.36948	0.899000	0.35326	0.977000	0.68977	0.375000	0.20518	-0.162000	0.10964	0.655000	0.94253	CCA		0.498	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			Missense_Mutation
TOPBP1	11073	hgsc.bcm.edu	37	3	133358869	133358869	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr3:133358869C>G	ENST00000260810.5	-	13	2298	c.2167G>C	c.(2167-2169)Gag>Cag	p.E723Q		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	723	BRCT 5. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.E636Q(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						CTAGCAGTCTCCAACAGCCAA	0.368								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)											1	Substitution - Missense(1)	ovary(1)	3											88.0	83.0	84.0					3																	133358869		1860	4096	5956	134841559	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2167G>C	3.37:g.133358869C>G	ENSP00000260810:p.Glu723Gln	Somatic		Capture	SOLID	Phase_IV	134841559	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	CCDS46919.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914757	0.33815	.	.	ENSG00000163781	ENST00000260810	T	0.13307	2.6	5.59	2.59	0.31030	BRCT (4);	0.402206	0.29403	N	0.012259	T	0.12603	0.0306	L	0.38838	1.175	0.41767	D	0.989745	B	0.23591	0.088	B	0.21151	0.033	T	0.06552	-1.0820	10	0.21014	T	0.42	.	18.2539	0.90012	0.0:0.5622:0.4378:0.0	.	723	Q92547	TOPB1_HUMAN	Q	723	ENSP00000260810:E723Q	ENSP00000260810:E723Q	E	-	1	0	TOPBP1	134841559	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.317000	0.43770	0.693000	0.31634	0.650000	0.86243	GAG		0.368	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027		Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic		Capture	SOLID	Phase_IV	7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TYROBP	7305	hgsc.bcm.edu	37	19	36398142	36398142	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0919-01	TCGA-13-0919-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr19:36398142G>C	ENST00000262629.4	-	4	320	c.254C>G	c.(253-255)aCt>aGt	p.T85S	TYROBP_ENST00000544690.2_Missense_Mutation_p.T74S|TYROBP_ENST00000585901.2_Missense_Mutation_p.T116S|TYROBP_ENST00000424586.3_Missense_Mutation_p.T73S|TYROBP_ENST00000589517.1_Missense_Mutation_p.T84S	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	85	ITAM.				axon guidance (GO:0007411)|cellular defense response (GO:0006968)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|regulation of immune response (GO:0050776)|regulation of osteoclast development (GO:2001204)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(4)|skin(1)	8	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCGGTCTCAGTGATACGCTG	0.537																																																0			19											133.0	100.0	111.0					19																	36398142		2202	4300	6502	41089982	SO:0001583	missense	7305			AF019563	CCDS12482.1, CCDS46058.1, CCDS54255.1, CCDS59378.1	19q13.1	2014-09-17				ENSG00000011600			12449	protein-coding gene	gene with protein product	"""killer activating receptor associated protein"", ""DNAX-activation protein 12"""	604142		PLOSL		9490415, 10888890	Standard	NM_003332		Approved	DAP12, PLO-SL, KARAP	uc002ocm.3	O43914		ENST00000262629.4:c.254C>G	19.37:g.36398142G>C	ENSP00000262629:p.Thr85Ser	Somatic		Capture	SOLID	Phase_IV	41089982	A8K2X0|F5H389|Q6FGA5|Q9UMT3	Missense_Mutation	SNP	ENST00000262629.4	37	CCDS12482.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.117	-0.181431	0.06340	.	.	ENSG00000011600	ENST00000262629;ENST00000424586;ENST00000544690	D;D	0.85773	-2.03;-2.03	5.48	4.44	0.53790	.	0.752984	0.12008	N	0.508187	T	0.72399	0.3455	N	0.19112	0.55	0.09310	N	1	B;B	0.33171	0.4;0.4	B;B	0.30855	0.121;0.121	T	0.56372	-0.7990	10	0.09084	T	0.74	-9.0E-4	11.3485	0.49575	0.0:0.0:0.8062:0.1938	.	84;85	O43914-2;O43914	.;TYOBP_HUMAN	S	85;84;74	ENSP00000262629:T85S;ENSP00000445332:T74S	ENSP00000262629:T85S	T	-	2	0	TYROBP	41089982	0.022000	0.18835	0.033000	0.17914	0.256000	0.26092	2.279000	0.43435	1.280000	0.44463	0.585000	0.79938	ACT		0.537	TYROBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457397.1			Missense_Mutation
VPS13D	55187	hgsc.bcm.edu	37	1	12409403	12409403	+	Missense_Mutation	SNP	A	A	G	rs200878078		TCGA-13-0919-01	TCGA-13-0919-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr1:12409403A>G	ENST00000358136.3	+	46	9533	c.9403A>G	c.(9403-9405)Atg>Gtg	p.M3135V	VPS13D_ENST00000356315.4_Missense_Mutation_p.M3110V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GTGCCACTCTATGGACACAGA	0.403																																																0			1											85.0	88.0	87.0					1																	12409403		2203	4300	6503	12331990	SO:0001583	missense	55187			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.9403A>G	1.37:g.12409403A>G	ENSP00000350854:p.Met3135Val	Somatic		Capture	SOLID	Phase_IV	12331990		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782150	0.31502	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.51071	0.73;0.72	5.58	4.45	0.53987	.	0.129815	0.64402	N	0.000001	T	0.24547	0.0595	N	0.08118	0	0.80722	D	1	B;B	0.30973	0.302;0.028	B;B	0.22386	0.039;0.007	T	0.06110	-1.0845	10	0.24483	T	0.36	.	11.4634	0.50223	0.9296:0.0:0.0704:0.0	.	3110;3134	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	V	3110;3135	ENSP00000348666:M3110V;ENSP00000350854:M3135V	ENSP00000348666:M3110V	M	+	1	0	VPS13D	12331990	0.981000	0.34729	0.942000	0.38095	0.996000	0.88848	2.538000	0.45710	1.055000	0.40461	0.533000	0.62120	ATG		0.403	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		Missense_Mutation
ZBTB9	221504	hgsc.bcm.edu	37	6	33422977	33422977	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr6:33422977C>A	ENST00000395064.2	+	2	368	c.100C>A	c.(100-102)Ctg>Atg	p.L34M		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	34					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TAGCTCGTCTCTGCTGGAATC	0.582																																																0			6											99.0	100.0	100.0					6																	33422977		2203	4300	6503	33530955	SO:0001583	missense	221504			AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.100C>A	6.37:g.33422977C>A	ENSP00000378503:p.Leu34Met	Somatic		Capture	SOLID	Phase_IV	33530955	A2AB19	Missense_Mutation	SNP	ENST00000395064.2	37	CCDS4780.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908660	0.33721	.	.	ENSG00000213588	ENST00000395064	T	0.26957	1.7	4.97	2.18	0.27775	BTB/POZ fold (2);	0.351272	0.19120	U	0.122217	T	0.12050	0.0293	L	0.32530	0.975	0.18873	N	0.999983	D	0.54397	0.966	P	0.52159	0.691	T	0.06356	-1.0831	10	0.51188	T	0.08	.	6.5187	0.22262	0.0:0.6917:0.1501:0.1582	.	34	Q96C00	ZBTB9_HUMAN	M	34	ENSP00000378503:L34M	ENSP00000378503:L34M	L	+	1	2	ZBTB9	33530955	0.994000	0.37717	0.136000	0.22124	0.373000	0.29922	3.140000	0.50585	0.261000	0.21753	0.563000	0.77884	CTG		0.582	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735		Missense_Mutation
ZFHX3	463	hgsc.bcm.edu	37	16	72991600	72991600	+	Silent	SNP	C	C	G			TCGA-13-0919-01	TCGA-13-0919-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-13-0919-01	TCGA-13-0919-10	g.chr16:72991600C>G	ENST00000268489.5	-	2	3117	c.2445G>C	c.(2443-2445)gtG>gtC	p.V815V	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	815					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V815V(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGTTCCTGGCCACGTTGGTCT	0.552																																																1	Substitution - coding silent(1)	ovary(1)	16											207.0	174.0	185.0					16																	72991600		2198	4300	6498	71549101	SO:0001819	synonymous_variant	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2445G>C	16.37:g.72991600C>G		Somatic		Capture	SOLID	Phase_IV	71549101	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1	SNP	21	Baylor																																																																																				0.552	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		Silent
