#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
HTT	3064	genome.wustl.edu	37	4	3176802	3176802	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:3176802C>G	ENST00000355072.5	+	33	4520	c.4375C>G	c.(4375-4377)Cgg>Ggg	p.R1459G		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1459					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGTTCAGTTACGGGTTAATTA	0.378																																																0			4											168.0	151.0	156.0					4																	3176802		1850	4115	5965	3146600	SO:0001583	missense	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4375C>G	4.37:g.3176802C>G	ENSP00000347184:p.Arg1459Gly	Somatic		Capture	Illumina GAIIx	4	3146600	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830511	0.71258	.	.	ENSG00000197386	ENST00000355072	T	0.06294	3.32	5.44	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.15998	0.0385	L	0.36672	1.1	0.58432	D	0.999994	D	0.71674	0.998	D	0.79108	0.992	T	0.00485	-1.1711	10	0.51188	T	0.08	.	14.5532	0.68081	0.2508:0.7492:0.0:0.0	.	1459	P42858	HD_HUMAN	G	1459	ENSP00000347184:R1459G	ENSP00000347184:R1459G	R	+	1	2	HTT	3146600	0.702000	0.27816	0.979000	0.43373	0.998000	0.95712	1.358000	0.34102	2.706000	0.92434	0.650000	0.86243	CGG		0.378	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		Missense_Mutation
RGS12	6002	genome.wustl.edu	37	4	3319414	3319414	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:3319414C>G	ENST00000344733.5	+	2	2421	c.1517C>G	c.(1516-1518)tCt>tGt	p.S506C	RGS12_ENST00000382788.3_Missense_Mutation_p.S506C|RGS12_ENST00000543385.1_Missense_Mutation_p.S506C|RGS12_ENST00000336727.3_Missense_Mutation_p.S506C	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	506					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.S506C(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGGCCAGCCTCTCCTGTGGAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	4											43.0	45.0	44.0					4																	3319414		2203	4300	6503	3289212	SO:0001583	missense	6002			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1517C>G	4.37:g.3319414C>G	ENSP00000339381:p.Ser506Cys	Somatic		Capture	Illumina GAIIx	4	3289212	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	CCDS3366.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	6.111	0.388672	0.11581	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.34859	1.34;1.36;1.41;1.41	3.92	1.03	0.20045	.	0.760191	0.12354	N	0.476249	T	0.37652	0.1011	L	0.53249	1.67	0.20196	N	0.999924	P;D;P	0.57257	0.896;0.979;0.937	B;P;P	0.49708	0.415;0.613;0.62	T	0.18178	-1.0345	10	0.48119	T	0.1	-0.2985	6.2016	0.20579	0.0:0.6678:0.1529:0.1794	.	506;506;506	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	C	506	ENSP00000440566:S506C;ENSP00000339381:S506C;ENSP00000338509:S506C;ENSP00000372238:S506C	ENSP00000338509:S506C	S	+	2	0	RGS12	3289212	0.003000	0.15002	0.000000	0.03702	0.021000	0.10359	1.717000	0.37991	-0.022000	0.13986	0.491000	0.48974	TCT		0.642	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926		Missense_Mutation
ZBTB49	166793	genome.wustl.edu	37	4	4304434	4304434	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:4304434G>C	ENST00000337872.4	+	3	992	c.871G>C	c.(871-873)Gac>Cac	p.D291H	ZBTB49_ENST00000538529.1_5'UTR|ZBTB49_ENST00000355834.3_Missense_Mutation_p.D291H	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D291H(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CCCTGAGTCAGACGCCACATG	0.512																																																1	Substitution - Missense(1)	ovary(1)	4											76.0	77.0	77.0					4																	4304434		2203	4300	6503	4355335	SO:0001583	missense	166793			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.871G>C	4.37:g.4304434G>C	ENSP00000338807:p.Asp291His	Somatic		Capture	Illumina GAIIx	4	4355335	Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	CCDS3375.1	SNP	33	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.25|15.25	2.777070|2.777070	0.49786|0.49786	.|.	.|.	ENSG00000168826|ENSG00000168826	ENST00000355834;ENST00000337872|ENST00000504302	T;T|.	0.14391|.	2.51;2.85|.	5.05|5.05	2.3|2.3	0.28687|0.28687	.|.	0.395731|.	0.24162|.	N|.	0.040967|.	T|T	0.46964|0.46964	0.1420|0.1420	M|M	0.71581|0.71581	2.175|2.175	0.22819|0.22819	N|N	0.998697|0.998697	D|.	0.67145|.	0.996|.	P|.	0.59703|.	0.862|.	T|T	0.35574|0.35574	-0.9783|-0.9783	10|5	0.48119|.	T|.	0.1|.	.|.	6.8229|6.8229	0.23866|0.23866	0.0696:0.1283:0.6689:0.1332|0.0696:0.1283:0.6689:0.1332	.|.	291|.	Q6ZSB9|.	ZBT49_HUMAN|.	H|H	291|27	ENSP00000348091:D291H;ENSP00000338807:D291H|.	ENSP00000338807:D291H|.	D|Q	+|+	1|3	0|2	ZBTB49|ZBTB49	4355335|4355335	0.964000|0.964000	0.33143|0.33143	0.000000|0.000000	0.03702|0.03702	0.025000|0.025000	0.11179|0.11179	2.691000|2.691000	0.47010|0.47010	0.364000|0.364000	0.24374|0.24374	0.591000|0.591000	0.81541|0.81541	GAC|CAG		0.512	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206688.3	NM_145291		Missense_Mutation
RNF216	54476	genome.wustl.edu	37	7	5780945	5780945	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:5780945A>C	ENST00000425013.2	-	4	756	c.532T>G	c.(532-534)Ttc>Gtc	p.F178V	RNF216_ENST00000389902.3_Missense_Mutation_p.F235V	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	178					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.F235V(1)	FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		AGAGACTGGAAGTAAGGATGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	7											109.0	110.0	110.0					7																	5780945		2203	4300	6503	5747471	SO:0001583	missense	54476			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.532T>G	7.37:g.5780945A>C	ENSP00000404602:p.Phe178Val	Somatic		Capture	Illumina GAIIx	4	5747471	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	16.82	3.229180	0.58777	.	.	ENSG00000011275	ENST00000425013;ENST00000389902	T;T	0.50277	0.8;0.75	5.97	3.59	0.41128	.	0.487236	0.21164	N	0.079105	T	0.44871	0.1314	L	0.59436	1.845	0.29462	N	0.8577	B;B	0.21147	0.034;0.052	B;B	0.29862	0.053;0.108	T	0.48281	-0.9049	10	0.66056	D	0.02	-1.1361	8.0028	0.30308	0.7509:0.0:0.2491:0.0	.	178;235	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	V	178;235	ENSP00000404602:F178V;ENSP00000374552:F235V	ENSP00000374550:F178V	F	-	1	0	RNF216	5747471	0.982000	0.34865	0.841000	0.33234	0.940000	0.58332	1.707000	0.37888	0.498000	0.27948	-0.441000	0.05720	TTC		0.498	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7579389	7579389	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:7579389G>A	ENST00000269305.4	-	4	487	c.298C>T	c.(298-300)Cag>Tag	p.Q100*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q100*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q100*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q100*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q100*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q100*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	100	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		Q -> R (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q100*(12)|p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.V73fs*9(1)|p.W91fs*13(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TAGGTTTTCTGGGAAGGGACA	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Substitution - Nonsense(12)|Deletion - Frameshift(10)|Whole gene deletion(8)	upper_aerodigestive_tract(6)|lung(4)|ovary(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|adrenal_gland(2)|central_nervous_system(2)|skin(2)|stomach(1)|breast(1)|liver(1)	17											50.0	52.0	51.0					17																	7579389		2203	4300	6503	7520114	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.298C>T	17.37:g.7579389G>A	ENSP00000269305:p.Gln100*	Somatic		Capture	Illumina GAIIx	4	7520114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710371	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.75	3.76	0.43208	.	0.315497	0.32386	N	0.006178	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-9.4011	8.082	0.30750	0.0:0.1753:0.6433:0.1814	.	.	.	.	X	100	.	ENSP00000269305:Q100X	Q	-	1	0	TP53	7520114	0.357000	0.24938	0.127000	0.21898	0.611000	0.37282	3.263000	0.51546	1.327000	0.45338	0.655000	0.94253	CAG		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
DNAH2	146754	genome.wustl.edu	37	17	7662788	7662788	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:7662788G>A	ENST00000572933.1	+	16	3957	c.2497G>A	c.(2497-2499)Gag>Aag	p.E833K	DNAH2_ENST00000389173.2_Missense_Mutation_p.E833K			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	833	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E833K(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCGCATGATGGAGGATGCCCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	17											112.0	98.0	103.0					17																	7662788		2203	4300	6503	7603513	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.2497G>A	17.37:g.7662788G>A	ENSP00000458355:p.Glu833Lys	Somatic		Capture	Illumina GAIIx	4	7603513	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446917	0.84101	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.23147	1.92	5.38	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	M	0.81497	2.545	0.80722	D	1	D	0.55605	0.972	P	0.58391	0.838	T	0.30504	-0.9976	10	0.20046	T	0.44	.	12.4405	0.55621	0.0829:0.0:0.9171:0.0	.	833	Q9P225	DYH2_HUMAN	K	833	ENSP00000373825:E833K	ENSP00000353818:E833K	E	+	1	0	DNAH2	7603513	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.462000	0.73526	2.524000	0.85096	0.491000	0.48974	GAG		0.522	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		Missense_Mutation
TRMT44	152992	genome.wustl.edu	37	4	8465818	8465818	+	Splice_Site	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:8465818G>T	ENST00000389737.4	+	7	1310	c.1310G>T	c.(1309-1311)aGg>aTg	p.R437M	TRMT44_ENST00000513449.2_Splice_Site_p.R196M	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	437					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R45M(1)									ATTGCAGCCAGGTGAGAAGTA	0.463																																																1	Substitution - Missense(1)	ovary(1)	4											140.0	125.0	130.0					4																	8465818		2203	4300	6503	8516718	SO:0001630	splice_region_variant	152992			AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1310+1G>T	4.37:g.8465818G>T		Somatic		Capture	Illumina GAIIx	4	8516718	Q8NA95	Missense_Mutation	SNP	ENST00000389737.4	37	CCDS3402.2	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	23.9	4.470296	0.84533	.	.	ENSG00000155275	ENST00000513449;ENST00000389737;ENST00000285635	T;T	0.51071	0.72;0.72	4.18	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.72128	0.3422	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.83275	0.936;0.996	T	0.78563	-0.2156	10	0.72032	D	0.01	-34.0466	17.1324	0.86729	0.0:0.0:1.0:0.0	.	437;196	Q8IYL2;Q8IYL2-2	TRM44_HUMAN;.	M	196;437;45	ENSP00000424643:R196M;ENSP00000374387:R437M	ENSP00000285635:R45M	R	+	2	0	METTL19	8516718	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	8.201000	0.89735	2.350000	0.79820	0.558000	0.71614	AGG		0.463	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	Missense_Mutation	Missense_Mutation
UBE4B	10277	genome.wustl.edu	37	1	10238758	10238758	+	Silent	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:10238758G>C	ENST00000253251.8	+	25	4034	c.3195G>C	c.(3193-3195)ggG>ggC	p.G1065G	UBE4B_ENST00000343090.6_Silent_p.G1194G|UBE4B_ENST00000377157.3_Silent_p.G949G					ubiquitination factor E4B									p.G1065G(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GGAAGGCAGGGATCAAATCCA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	1											73.0	70.0	71.0					1																	10238758		2203	4300	6503	10161345	SO:0001819	synonymous_variant	10277			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.3195G>C	1.37:g.10238758G>C		Somatic		Capture	Illumina GAIIx	4	10161345		Silent	SNP	ENST00000253251.8	37	CCDS110.1	SNP	41	WashU																																																																																				0.453	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048		Silent
LRP6	4040	genome.wustl.edu	37	12	12274064	12274064	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr12:12274064G>T	ENST00000261349.4	-	23	4914	c.4838C>A	c.(4837-4839)tCc>tAc	p.S1613Y	LRP6_ENST00000543091.1_Missense_Mutation_p.S1568Y|BCL2L14_ENST00000396369.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1613					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S1613Y(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CCCTCCTCAGGAGGAGTCTGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	12											72.0	61.0	65.0					12																	12274064		2203	4300	6503	12165331	SO:0001583	missense	4040			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4838C>A	12.37:g.12274064G>T	ENSP00000261349:p.Ser1613Tyr	Somatic		Capture	Illumina GAIIx	4	12165331	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455944	0.84209	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.95272	-3.42;-3.66	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000011	D	0.96383	0.8820	L	0.46157	1.445	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.80764	0.994;0.986	D	0.96515	0.9381	10	0.87932	D	0	.	20.1576	0.98120	0.0:0.0:1.0:0.0	.	1568;1613	F5H7J9;O75581	.;LRP6_HUMAN	Y	1613;1568	ENSP00000261349:S1613Y;ENSP00000442472:S1568Y	ENSP00000261349:S1613Y	S	-	2	0	LRP6	12165331	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.773000	0.95371	0.650000	0.86243	TCC		0.517	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1			Missense_Mutation
AC005863.1	0	genome.wustl.edu	37	17	14683193	14683193	+	lincRNA	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:14683193A>T	ENST00000379640.1	-	0	327																		p.C98*(1)									TTACGAGTTCACAGCCAAGTA	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	17											84.0	86.0	85.0					17																	14683193		2203	4300	6503	14623918																																		17.37:g.14683193A>T		Somatic		Capture	Illumina GAIIx	4	14623918		Nonsense_Mutation	SNP	ENST00000379640.1	37		SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270266	0.59540	.	.	ENSG00000205325	ENST00000379640	.	.	.	3.95	-0.178	0.13303	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.8719	0.09041	0.4203:0.1969:0.0:0.3828	.	.	.	.	X	98	.	ENSP00000368961:C98X	C	-	3	2	AC005863.1	14623918	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.041000	0.12084	0.133000	0.18654	-0.336000	0.08194	TGT		0.463	AC005863.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000130001.1			Nonsense_Mutation
ARHGEF19	128272	genome.wustl.edu	37	1	16525128	16525128	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:16525128T>G	ENST00000270747.3	-	16	2499	c.2363A>C	c.(2362-2364)aAg>aCg	p.K788T	ARHGEF19_ENST00000478117.1_5'UTR|ARHGEF19-AS1_ENST00000457809.1_RNA	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	788					regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K788T(1)		cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		TGTGACTCGCTTATTCTCCCG	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	79.0	79.0					1																	16525128		2203	4300	6503	16397715	SO:0001583	missense	128272			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.2363A>C	1.37:g.16525128T>G	ENSP00000270747:p.Lys788Thr	Somatic		Capture	Illumina GAIIx	4	16397715	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	ENST00000270747.3	37	CCDS170.1	SNP	56	WashU	.	.	.	.	.	.	.	.	.	.	T	10.95	1.494980	0.26774	.	.	ENSG00000142632	ENST00000270747;ENST00000421561	T;T	0.70282	-0.47;1.47	5.37	4.24	0.50183	.	0.451574	0.20874	N	0.084120	T	0.48892	0.1525	N	0.19112	0.55	0.21967	N	0.999442	P	0.37330	0.59	B	0.34301	0.179	T	0.33317	-0.9873	10	0.22706	T	0.39	.	6.7554	0.23510	0.0:0.1407:0.0:0.8593	.	788	Q8IW93	ARHGJ_HUMAN	T	788;488	ENSP00000270747:K788T;ENSP00000396001:K488T	ENSP00000270747:K788T	K	-	2	0	ARHGEF19	16397715	1.000000	0.71417	0.995000	0.50966	0.538000	0.34931	2.816000	0.48026	2.053000	0.61076	0.533000	0.62120	AAG		0.642	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213		Missense_Mutation
BNC2	54796	genome.wustl.edu	37	9	16437047	16437047	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr9:16437047G>C	ENST00000380672.4	-	6	1202	c.1145C>G	c.(1144-1146)cCc>cGc	p.P382R	BNC2_ENST00000380666.2_Missense_Mutation_p.P382R|BNC2_ENST00000545497.1_Missense_Mutation_p.P287R|BNC2_ENST00000380667.2_Missense_Mutation_p.P315R	NM_017637.5	NP_060107.3			basonuclin 2									p.P382R(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		ATTTCTATTGGGTGTTTGATC	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											115.0	118.0	117.0					9																	16437047		2203	4300	6503	16427047	SO:0001583	missense	54796			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1145C>G	9.37:g.16437047G>C	ENSP00000370047:p.Pro382Arg	Somatic		Capture	Illumina GAIIx	4	16427047		Missense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863603	0.32884	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.31769	1.48;1.5;1.51;1.51;1.48	5.96	5.96	0.96718	.	0.096199	0.64402	D	0.000001	T	0.33731	0.0873	L	0.29908	0.895	0.52501	D	0.99995	B;B;P;B;P;B;B;P;B	0.37015	0.002;0.232;0.571;0.058;0.571;0.232;0.435;0.578;0.435	B;B;B;B;B;B;B;B;B	0.42798	0.009;0.104;0.398;0.019;0.21;0.104;0.104;0.224;0.104	T	0.02625	-1.1132	10	0.45353	T	0.12	-17.2342	20.4082	0.99013	0.0:0.0:1.0:0.0	.	287;315;382;208;382;339;382;287;147	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	R	382;339;315;287;208;382;382	ENSP00000370047:P382R;ENSP00000408370:P339R;ENSP00000370042:P315R;ENSP00000444640:P287R;ENSP00000370041:P382R	ENSP00000370041:P382R	P	-	2	0	BNC2	16427047	1.000000	0.71417	0.996000	0.52242	0.655000	0.38815	9.734000	0.98822	2.814000	0.96858	0.655000	0.94253	CCC		0.483	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637		Missense_Mutation
PRPS1L1	221823	genome.wustl.edu	37	7	18067234	18067234	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:18067234T>C	ENST00000506618.2	-	1	252	c.172A>G	c.(172-174)Agt>Ggt	p.S58G		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	58					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.S58G(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CCACAACCACTCTGAACGATG	0.483																																																1	Substitution - Missense(1)	ovary(1)	7											372.0	360.0	364.0					7																	18067234		2203	4300	6503	18033759	SO:0001583	missense	221823			M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.172A>G	7.37:g.18067234T>C	ENSP00000424595:p.Ser58Gly	Somatic		Capture	Illumina GAIIx	4	18033759	Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	CCDS47552.1	SNP	54	WashU	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597017	0.66332	.	.	ENSG00000229937	ENST00000506618	D	0.92699	-3.09	4.4	3.24	0.37175	.	.	.	.	.	D	0.95265	0.8464	M	0.89214	3.015	.	.	.	P	0.48911	0.917	P	0.59357	0.856	D	0.96293	0.9215	8	0.87932	D	0	.	8.336	0.32215	0.0:0.0956:0.0:0.9044	.	58	P21108	PRPS3_HUMAN	G	58	ENSP00000424595:S58G	ENSP00000424595:S58G	S	-	1	0	PRPS1L1	18033759	1.000000	0.71417	0.993000	0.49108	0.809000	0.45718	5.559000	0.67326	0.827000	0.34685	0.528000	0.53228	AGT		0.483	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		Missense_Mutation
BEND2	139105	genome.wustl.edu	37	X	18234734	18234734	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:18234734C>T	ENST00000380033.4	-	2	277	c.145G>A	c.(145-147)Gtc>Atc	p.V49I	BEND2_ENST00000380030.3_Missense_Mutation_p.V49I	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	49								p.V49I(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						TCTGCTGTGACATAAGTGGAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											269.0	207.0	228.0					X																	18234734		2203	4300	6503	18144655	SO:0001583	missense	139105			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.145G>A	X.37:g.18234734C>T	ENSP00000369372:p.Val49Ile	Somatic		Capture	Illumina GAIIx	4	18144655	E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	37	CCDS14184.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	0.195	-1.049796	0.01981	.	.	ENSG00000177324	ENST00000380033;ENST00000380030	T;T	0.26810	1.76;1.71	2.94	-2.95	0.05564	.	.	.	.	.	T	0.11067	0.0270	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.30090	-0.9990	9	0.29301	T	0.29	.	8.0695	0.30680	0.0:0.3816:0.0:0.6184	.	49;49	E9PFY2;Q8NDZ0	.;BEND2_HUMAN	I	49	ENSP00000369372:V49I;ENSP00000369369:V49I	ENSP00000369369:V49I	V	-	1	0	BEND2	18144655	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.285000	0.08410	-0.944000	0.03686	-0.434000	0.05882	GTC		0.423	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346		Missense_Mutation
CDKAL1	54901	genome.wustl.edu	37	6	20846328	20846328	+	Missense_Mutation	SNP	T	T	A	rs112984088		TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:20846328T>A	ENST00000378610.1	+	7	671	c.661T>A	c.(661-663)Tgc>Agc	p.C221S	CDKAL1_ENST00000378624.4_Missense_Mutation_p.C151S|CDKAL1_ENST00000274695.4_Missense_Mutation_p.C221S			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	221					maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)	p.C221S(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			TTGTACCTACTGCAAAACTAA	0.338																																																1	Substitution - Missense(1)	ovary(1)	6											75.0	76.0	75.0					6																	20846328		2203	4300	6503	20954307	SO:0001583	missense	54901			AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.661T>A	6.37:g.20846328T>A	ENSP00000367873:p.Cys221Ser	Somatic		Capture	Illumina GAIIx	4	20954307	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	37	CCDS4546.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	28.3	4.911048	0.92178	.	.	ENSG00000145996	ENST00000274695;ENST00000378624;ENST00000378610	D;D;D	0.99807	-6.85;-6.85;-6.85	5.81	5.81	0.92471	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Methylthiotransferase, conserved site (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	H	0.99325	4.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95984	0.8980	10	0.87932	D	0	.	16.1616	0.81721	0.0:0.0:0.0:1.0	.	151;221	Q5VV42-2;Q5VV42	.;CDKAL_HUMAN	S	221;151;221	ENSP00000274695:C221S;ENSP00000367889:C151S;ENSP00000367873:C221S	ENSP00000274695:C221S	C	+	1	0	CDKAL1	20954307	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.528000	0.81941	2.218000	0.71995	0.377000	0.23210	TGC		0.338	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774		Missense_Mutation
MYH7	4625	genome.wustl.edu	37	14	23887512	23887512	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr14:23887512C>T	ENST00000355349.3	-	30	4238	c.4076G>A	c.(4075-4077)cGc>cAc	p.R1359H	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1359				RV -> GD (in Ref. 14; CAA27381). {ECO:0000305}.	adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R1359H(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGAAAGGACGCGCTGCAGCTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	14											72.0	66.0	68.0					14																	23887512		2203	4300	6503	22957352	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4076G>A	14.37:g.23887512C>T	ENSP00000347507:p.Arg1359His	Somatic		Capture	Illumina GAIIx	4	22957352	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579211	0.86645	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.81579	-1.51	4.83	4.83	0.62350	Myosin tail (1);	.	.	.	.	D	0.92234	0.7537	M	0.93978	3.48	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.94200	0.7449	9	0.87932	D	0	.	18.1069	0.89523	0.0:1.0:0.0:0.0	.	1359	P12883	MYH7_HUMAN	H	1359;1364	ENSP00000347507:R1359H	ENSP00000347507:R1359H	R	-	2	0	MYH7	22957352	1.000000	0.71417	0.972000	0.41901	0.447000	0.32167	7.375000	0.79646	2.520000	0.84964	0.655000	0.94253	CGC		0.647	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		Missense_Mutation
PALB2	79728	genome.wustl.edu	37	16	23646320	23646320	+	Missense_Mutation	SNP	C	C	A	rs587781560		TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:23646320C>A	ENST00000261584.4	-	4	1699	c.1547G>T	c.(1546-1548)aGa>aTa	p.R516I		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	516	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		GGCTGATTTTCTTTTTCCTGT	0.473			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0			16											162.0	154.0	157.0					16																	23646320		2197	4300	6497	23553821	SO:0001583	missense	79728				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1547G>T	16.37:g.23646320C>A	ENSP00000261584:p.Arg516Ile	Somatic		Capture	Illumina GAIIx	4	23553821	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	37	CCDS32406.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301340	0.60195	.	.	ENSG00000083093	ENST00000261584	T	0.25085	1.82	5.67	4.72	0.59763	.	0.082642	0.52532	D	0.000069	T	0.47985	0.1475	M	0.72118	2.19	0.45867	D	0.998729	D	0.69078	0.997	D	0.68039	0.955	T	0.51926	-0.8643	10	0.87932	D	0	-16.0834	13.0574	0.58988	0.0:0.8388:0.1612:0.0	.	516	Q86YC2	PALB2_HUMAN	I	516	ENSP00000261584:R516I	ENSP00000261584:R516I	R	-	2	0	PALB2	23553821	0.957000	0.32711	0.978000	0.43139	0.380000	0.30137	0.927000	0.28818	1.521000	0.48983	0.655000	0.94253	AGA		0.473	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675		Missense_Mutation
TDP2	51567	genome.wustl.edu	37	6	24666798	24666798	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:24666798G>T	ENST00000378198.4	-	2	377	c.207C>A	c.(205-207)agC>agA	p.S69R	TDP2_ENST00000545995.1_Missense_Mutation_p.S99R|ACOT13_ENST00000230048.4_5'Flank|TDP2_ENST00000341060.3_5'UTR|ACOT13_ENST00000537591.1_5'Flank			O95551	TYDP2_HUMAN	tyrosyl-DNA phosphodiesterase 2	69					cell surface receptor signaling pathway (GO:0007166)|double-strand break repair (GO:0006302)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|PML body (GO:0016605)	5'-tyrosyl-DNA phosphodiesterase activity (GO:0070260)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)|tyrosyl-RNA phosphodiesterase activity (GO:0036317)	p.S69R(1)		kidney(2)|large_intestine(1)|lung(5)|ovary(1)	9						GTTCCAAGGCGCTCTCCTCCA	0.567								Direct reversal of damage																																								1	Substitution - Missense(1)	ovary(1)	6											152.0	157.0	155.0					6																	24666798		2203	4300	6503	24774777	SO:0001583	missense	51567			AJ269473	CCDS4557.1	6p22.3-p22.1	2010-05-07	2010-05-07	2010-05-07	ENSG00000111802	ENSG00000111802	3.1.4.-		17768	protein-coding gene	gene with protein product		605764	"""TRAF and TNF receptor associated protein"""	TTRAP		11478795	Standard	NM_016614		Approved		uc003nej.3	O95551	OTTHUMG00000014360	ENST00000378198.4:c.207C>A	6.37:g.24666798G>T	ENSP00000367440:p.Ser69Arg	Somatic		Capture	Illumina GAIIx	4	24774777	B4DKL8|B4DQ95|Q2TBE2|Q5JYM0|Q7Z6U5|Q9NUK5|Q9NYY9	Missense_Mutation	SNP	ENST00000378198.4	37	CCDS4557.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911659	0.52439	.	.	ENSG00000111802	ENST00000378198;ENST00000545995	T;T	0.22945	1.95;1.93	4.24	2.34	0.29019	.	0.926970	0.09321	N	0.818183	T	0.06781	0.0173	L	0.44542	1.39	0.19300	N	0.999978	B;B	0.14438	0.01;0.006	B;B	0.12156	0.007;0.003	T	0.37641	-0.9697	10	0.18276	T	0.48	-14.0259	5.1666	0.15088	0.1092:0.0:0.6891:0.2018	.	99;69	O95551-2;O95551	.;TYDP2_HUMAN	R	69;99	ENSP00000367440:S69R;ENSP00000437637:S99R	ENSP00000367440:S69R	S	-	3	2	TDP2	24774777	0.000000	0.05858	0.641000	0.29422	0.814000	0.46013	-0.036000	0.12185	0.988000	0.38734	0.655000	0.94253	AGC		0.567	TDP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000040012.1			Missense_Mutation
ANAPC4	29945	genome.wustl.edu	37	4	25417157	25417157	+	Silent	SNP	A	A	G			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:25417157A>G	ENST00000315368.3	+	26	2038	c.1896A>G	c.(1894-1896)agA>agG	p.R632R	ANAPC4_ENST00000510092.1_Silent_p.R633R	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	632					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.R632R(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				AAAAAGTCAGAAGAAGGTAAG	0.348																																																1	Substitution - coding silent(1)	ovary(1)	4											106.0	107.0	107.0					4																	25417157		2203	4300	6503	25026255	SO:0001819	synonymous_variant	29945			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.1896A>G	4.37:g.25417157A>G		Somatic		Capture	Illumina GAIIx	4	25026255	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Silent	SNP	ENST00000315368.3	37	CCDS3434.1	SNP	9	WashU																																																																																				0.348	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214986.1	NM_013367		Silent
NFE2L3	9603	genome.wustl.edu	37	7	26224213	26224213	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:26224213G>T	ENST00000056233.3	+	4	1154	c.895G>T	c.(895-897)Gca>Tca	p.A299S		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	299					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.A299S(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GAATTCTTCAGCACATTATCA	0.418																																																1	Substitution - Missense(1)	ovary(1)	7											135.0	129.0	131.0					7																	26224213		2203	4300	6503	26190738	SO:0001583	missense	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.895G>T	7.37:g.26224213G>T	ENSP00000056233:p.Ala299Ser	Somatic		Capture	Illumina GAIIx	4	26190738	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	ENST00000056233.3	37	CCDS5396.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213393	0.39102	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.32023	1.47	4.96	-1.73	0.08081	.	4.018370	0.00166	N	0.000007	T	0.22437	0.0541	L	0.34521	1.04	0.09310	N	1	B	0.19706	0.038	B	0.11329	0.006	T	0.13255	-1.0516	10	0.27785	T	0.31	-0.0205	5.5836	0.17262	0.4902:0.0:0.3254:0.1844	.	299	Q9Y4A8	NF2L3_HUMAN	S	299;5	ENSP00000056233:A299S	ENSP00000056233:A299S	A	+	1	0	NFE2L3	26190738	0.002000	0.14202	0.001000	0.08648	0.581000	0.36288	-0.196000	0.09532	-0.017000	0.14103	0.460000	0.39030	GCA		0.418	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1			Missense_Mutation
MAPRE3	22924	genome.wustl.edu	37	2	27245110	27245110	+	Silent	SNP	A	A	G			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:27245110A>G	ENST00000233121.2	+	2	222	c.24A>G	c.(22-24)acA>acG	p.T8T	MAPRE3_ENST00000491354.1_3'UTR|MAPRE3_ENST00000402218.1_Silent_p.T8T|MAPRE3_ENST00000405074.3_Silent_p.T8T			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	8					mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)	p.T8T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTACTCCACATCTGTGACCA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	2											185.0	174.0	178.0					2																	27245110		2203	4300	6503	27098614	SO:0001819	synonymous_variant	22924			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.24A>G	2.37:g.27245110A>G		Somatic		Capture	Illumina GAIIx	4	27098614	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	CCDS1731.1	SNP	8	WashU																																																																																				0.498	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326		Silent
DSG1	1828	genome.wustl.edu	37	18	28914029	28914029	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr18:28914029T>A	ENST00000257192.4	+	8	1081	c.869T>A	c.(868-870)aTt>aAt	p.I290N		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	290	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)	p.I290N(1)		NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TTGCTCGAGATTAGAGTAATT	0.323																																																1	Substitution - Missense(1)	ovary(1)	18											77.0	84.0	81.0					18																	28914029		2203	4294	6497	27168027	SO:0001583	missense	1828			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.869T>A	18.37:g.28914029T>A	ENSP00000257192:p.Ile290Asn	Somatic		Capture	Illumina GAIIx	4	27168027	B7Z845	Missense_Mutation	SNP	ENST00000257192.4	37	CCDS11896.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	15.64	2.893624	0.52121	.	.	ENSG00000134760	ENST00000257192	T	0.54866	0.55	5.79	5.79	0.91817	Cadherin (4);Cadherin-like (1);	0.592105	0.16666	N	0.204561	T	0.77322	0.4113	M	0.88570	2.965	0.80722	D	1	D	0.56746	0.977	D	0.69479	0.964	T	0.81011	-0.1126	10	0.87932	D	0	.	16.1343	0.81471	0.0:0.0:0.0:1.0	.	290	Q02413	DSG1_HUMAN	N	290	ENSP00000257192:I290N	ENSP00000257192:I290N	I	+	2	0	DSG1	27168027	0.983000	0.35010	0.267000	0.24556	0.113000	0.19764	6.439000	0.73430	2.209000	0.71365	0.533000	0.62120	ATT		0.323	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254947.1	NM_001942		Missense_Mutation
CHRNA2	1135	genome.wustl.edu	37	8	27327391	27327391	+	Missense_Mutation	SNP	G	G	A	rs142375828		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:27327391G>A	ENST00000520933.2	-	2	334	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	CHRNA2_ENST00000240132.2_Missense_Mutation_p.R61W|CHRNA2_ENST00000407991.1_Missense_Mutation_p.R61W			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	61					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)	p.R61W(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	TTGAAGAGCCGGTCCTCAGTC	0.637																																																1	Substitution - Missense(1)	ovary(1)	8						G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	71.0	73.0	72.0		181	4.8	1.0	8	dbSNP_134	72	0,8600		0,0,4300	yes	missense	CHRNA2	NM_000742.3	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	61/530	27327391	2,13004	2203	4300	6503	27383308	SO:0001583	missense	1135			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.181C>T	8.37:g.27327391G>A	ENSP00000429616:p.Arg61Trp	Somatic		Capture	Illumina GAIIx	4	27383308	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	ENST00000520933.2	37	CCDS6059.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281343	0.80692	4.54E-4	0.0	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132;ENST00000524096;ENST00000518712	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	4.77	4.77	0.60923	Neurotransmitter-gated ion-channel ligand-binding (3);	0.505114	0.24554	N	0.037524	D	0.85383	0.5684	H	0.96398	3.815	0.45930	D	0.998769	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89675	0.3886	10	0.87932	D	0	.	15.6641	0.77213	0.0:0.0:1.0:0.0	.	61;61	B4DK19;Q15822	.;ACHA2_HUMAN	W	61	ENSP00000385026:R61W;ENSP00000429616:R61W;ENSP00000240132:R61W;ENSP00000430422:R61W;ENSP00000430856:R61W	ENSP00000240132:R61W	R	-	1	2	CHRNA2	27383308	0.816000	0.29132	1.000000	0.80357	0.797000	0.45037	2.671000	0.46842	2.653000	0.90120	0.561000	0.74099	CGG		0.637	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4			Missense_Mutation
DCAF8L1	139425	genome.wustl.edu	37	X	27998266	27998266	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:27998266C>T	ENST00000441525.1	-	1	1300	c.1186G>A	c.(1186-1188)Gtt>Att	p.V396I		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	396								p.V396I(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CTGTACACAACGCAGGTGATG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											99.0	90.0	93.0					X																	27998266		2202	4300	6502	27908187	SO:0001583	missense	139425				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1186G>A	X.37:g.27998266C>T	ENSP00000405222:p.Val396Ile	Somatic		Capture	Illumina GAIIx	4	27908187	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	6.989	0.552634	0.13374	.	.	ENSG00000226372	ENST00000441525	D	0.82081	-1.57	1.08	-2.17	0.07059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.177207	0.36932	N	0.002336	T	0.67562	0.2906	L	0.34521	1.04	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.45948	-0.9226	10	0.37606	T	0.19	-2.0265	4.8121	0.13349	0.0:0.3808:0.4094:0.2098	.	396	A6NGE4	DC8L1_HUMAN	I	396	ENSP00000405222:V396I	ENSP00000405222:V396I	V	-	1	0	DCAF8L1	27908187	1.000000	0.71417	0.024000	0.17045	0.129000	0.20672	1.329000	0.33770	-2.073000	0.00878	-1.079000	0.02226	GTT		0.418	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		Missense_Mutation
SF3A1	10291	genome.wustl.edu	37	22	30742390	30742390	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr22:30742390T>A	ENST00000215793.8	-	3	458	c.304A>T	c.(304-306)Aag>Tag	p.K102*	SF3A1_ENST00000439242.1_Nonsense_Mutation_p.K102*	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	102					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.K102*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						TTCCCTTCCTTGAACTCGCTG	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	22											141.0	130.0	134.0					22																	30742390		2203	4300	6503	29072390	SO:0001587	stop_gained	10291			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.304A>T	22.37:g.30742390T>A	ENSP00000215793:p.Lys102*	Somatic		Capture	Illumina GAIIx	4	29072390	E9PAW1	Nonsense_Mutation	SNP	ENST00000215793.8	37	CCDS13875.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	37	6.442073	0.97568	.	.	ENSG00000099995	ENST00000439242;ENST00000215793	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.7965	15.7623	0.78096	0.0:0.0:0.0:1.0	.	.	.	.	X	102	.	ENSP00000215793:K102X	K	-	1	0	SF3A1	29072390	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.979000	0.70508	2.311000	0.77944	0.533000	0.62120	AAG		0.582	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		Nonsense_Mutation
OR2J1	442185	genome.wustl.edu	37	6	29069645	29069645	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:29069645A>T	ENST00000377171.3	+	1	1260	c.926A>T	c.(925-927)gAa>gTa	p.E309V				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E309V(1)		breast(1)|lung(6)	7						ATGGGGTGGGAATGGGGGATG	0.433																																																1	Substitution - Missense(1)	ovary(1)	6																																								29177624	SO:0001583	missense						6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.926A>T	6.37:g.29069645A>T	ENSP00000366376:p.Glu309Val	Somatic		Capture	Illumina GAIIx	4	29177624	A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	ENST00000377171.3	37		SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	8.258	0.810567	0.16537	.	.	ENSG00000204702	ENST00000377171	T	0.36340	1.26	2.56	1.34	0.21922	.	.	.	.	.	T	0.11879	0.0289	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29119	-1.0022	6	0.41790	T	0.15	.	3.0863	0.06279	0.6587:0.0:0.1322:0.2091	.	.	.	.	V	309	ENSP00000366376:E309V	ENSP00000366376:E309V	E	+	2	0	OR2J1	29177624	.	.	0.001000	0.08648	0.014000	0.08584	.	.	0.206000	0.20587	0.443000	0.29094	GAA		0.433	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076612.2	NG_004683		Missense_Mutation
OR2J3	442186	genome.wustl.edu	37	6	29079871	29079871	+	Missense_Mutation	SNP	C	C	A	rs201161327		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:29079871C>A	ENST00000377169.1	+	1	204	c.204C>A	c.(202-204)aaC>aaA	p.N68K		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TCCTTTCAAACCTCTCATTTC	0.468																																																0			6											242.0	253.0	250.0					6																	29079871		1340	2631	3971	29187850	SO:0001583	missense	442186				CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.204C>A	6.37:g.29079871C>A	ENSP00000366374:p.Asn68Lys	Germline		Capture	Illumina GAIIx	4	29187850	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	CCDS43433.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560291	0.27827	.	.	ENSG00000204701	ENST00000377169	T	0.12879	2.64	2.78	0.888	0.19206	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.25082	0.0609	M	0.91406	3.205	0.34720	D	0.728671	D	0.71674	0.998	D	0.64595	0.927	T	0.08743	-1.0707	9	0.87932	D	0	.	6.274	0.20971	0.0:0.5386:0.0:0.4614	.	68	O76001	OR2J3_HUMAN	K	68	ENSP00000366374:N68K	ENSP00000366374:N68K	N	+	3	2	OR2J3	29187850	0.031000	0.19500	0.995000	0.50966	0.163000	0.22366	0.178000	0.16820	0.485000	0.27652	0.436000	0.28706	AAC		0.468	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2			Missense_Mutation
SEZ6L2	26470	genome.wustl.edu	37	16	29909243	29909243	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:29909243A>T	ENST00000308713.5	-	2	669	c.142T>A	c.(142-144)Tct>Act	p.S48T	ASPHD1_ENST00000308748.5_5'Flank|SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000537485.1_Intron|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.S48T|ASPHD1_ENST00000483405.1_5'Flank|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.S48T	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	48	O-glycosylated at one site.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.S48T(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGGGCCTCAGAGGCCACCGTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	16											53.0	55.0	54.0					16																	29909243		2197	4300	6497	29816744	SO:0001583	missense	26470			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.142T>A	16.37:g.29909243A>T	ENSP00000312550:p.Ser48Thr	Somatic		Capture	Illumina GAIIx	4	29816744	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	SNP	11	WashU	.	.	.	.	.	.	.	.	.	.	A	10.87	1.472353	0.26423	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932	T;T;T	0.33654	1.4;1.4;1.4	4.96	-0.683	0.11335	.	0.431258	0.19803	N	0.105713	T	0.12178	0.0296	N	0.08118	0	0.36274	D	0.855332	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.0;0.001	T	0.20405	-1.0276	10	0.09590	T	0.72	.	2.9286	0.05792	0.4628:0.0:0.2236:0.3135	.	48;48;48;48;48	B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;SE6L2_HUMAN;.	T	48	ENSP00000310206:S48T;ENSP00000312550:S48T;ENSP00000319215:S48T	ENSP00000312550:S48T	S	-	1	0	SEZ6L2	29816744	0.999000	0.42202	0.873000	0.34254	0.887000	0.51463	0.542000	0.23222	-0.092000	0.12417	0.379000	0.24179	TCT		0.627	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410		Missense_Mutation
TRIM39	56658	genome.wustl.edu	37	6	30309785	30309785	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:30309785G>A	ENST00000396547.1	+	8	1466	c.1306G>A	c.(1306-1308)Ggg>Agg	p.G436R	TRIM39_ENST00000376659.5_Missense_Mutation_p.G406R|TRIM39_ENST00000396551.3_Missense_Mutation_p.G406R|TRIM39_ENST00000396548.1_Missense_Mutation_p.G406R|TRIM39_ENST00000376656.4_Missense_Mutation_p.G436R|TRIM39_ENST00000540416.1_Missense_Mutation_p.G406R|TRIM39-RPP21_ENST00000513556.1_Intron			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	436	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.G436R(1)		ovary(3)	3						GCTATGGAATGGGGACAAATA	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											66.0	62.0	63.0					6																	30309785		1511	2709	4220	30417764	SO:0001583	missense	56658			BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.1306G>A	6.37:g.30309785G>A	ENSP00000379796:p.Gly436Arg	Somatic		Capture	Illumina GAIIx	4	30417764	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	ENST00000396547.1	37	CCDS34377.1	SNP	47	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.68|19.68	3.872427|3.872427	0.72180|0.72180	.|.	.|.	ENSG00000204599|ENSG00000204599	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000396548;ENST00000376659;ENST00000396547|ENST00000449040	T;T;T;T;T;T|.	0.62364|.	0.03;0.03;0.03;0.03;0.03;0.03|.	5.78|5.78	5.78|5.78	0.91487|0.91487	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);|.	0.081067|.	0.52532|.	D|.	0.000065|.	T|T	0.59514|0.59514	0.2199|0.2199	L|L	0.50333|0.50333	1.59|1.59	0.41368|0.41368	D|D	0.987472|0.987472	D;B|.	0.54207|.	0.965;0.025|.	P;B|.	0.51777|.	0.679;0.052|.	T|T	0.53892|0.53892	-0.8374|-0.8374	10|6	0.56958|0.25106	D|T	0.05|0.35	.|.	17.5141|17.5141	0.87768|0.87768	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	436;406|.	Q9HCM9;Q9HCM9-2|.	TRI39_HUMAN;.|.	R|I	406;436;436;406;406;406;436|394	ENSP00000379800:G406R;ENSP00000365844:G436R;ENSP00000439400:G406R;ENSP00000379797:G406R;ENSP00000365847:G406R;ENSP00000379796:G436R|.	ENSP00000365844:G436R|ENSP00000406562:M394I	G|M	+|+	1|3	0|0	TRIM39|TRIM39	30417764|30417764	0.992000|0.992000	0.36948|0.36948	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	3.029000|3.029000	0.49712|0.49712	2.730000|2.730000	0.93505|0.93505	0.655000|0.655000	0.94253|0.94253	GGG|ATG		0.577	TRIM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076086.2	NM_172016		Missense_Mutation
ATAT1	79969	genome.wustl.edu	37	6	30610562	30610562	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:30610562G>C	ENST00000376485.4	+	10	772	c.742G>C	c.(742-744)Gag>Cag	p.E248Q	ATAT1_ENST00000319027.5_Missense_Mutation_p.E225Q|ATAT1_ENST00000318999.7_Missense_Mutation_p.E225Q|ATAT1_ENST00000376478.2_Missense_Mutation_p.E225Q|ATAT1_ENST00000329992.8_Missense_Mutation_p.E248Q|ATAT1_ENST00000376483.4_Missense_Mutation_p.E248Q|ATAT1_ENST00000330083.5_Missense_Mutation_p.E236Q|ATAT1_ENST00000468713.1_Intron					alpha tubulin acetyltransferase 1									p.E248Q(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	9						GGTAGCTGTGGAGCCTCCTTG	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											28.0	31.0	30.0					6																	30610562		2201	4300	6501	30718541	SO:0001583	missense	79969			AK023220	CCDS4683.2, CCDS54978.1, CCDS59002.1	6p21.32	2014-06-17	2010-10-11	2010-10-11	ENSG00000137343	ENSG00000137343	2.3.1.108		21186	protein-coding gene	gene with protein product	"""alpha-tubulin N-acetyltransferase"""	615556	"""chromosome 6 open reading frame 134"""	C6orf134		20829795	Standard	NM_024909		Approved	FLJ13158, Em:AB023049.7, MEC17	uc003nqv.3	Q5SQI0	OTTHUMG00000031219	ENST00000376485.4:c.742G>C	6.37:g.30610562G>C	ENSP00000365668:p.Glu248Gln	Somatic		Capture	Illumina GAIIx	4	30718541		Missense_Mutation	SNP	ENST00000376485.4	37		SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	g	20.2	3.942878	0.73672	.	.	ENSG00000137343	ENST00000318999;ENST00000376485;ENST00000376478;ENST00000319027;ENST00000376483;ENST00000329992;ENST00000330083	.	.	.	5.01	5.01	0.66863	.	0.344010	0.28724	N	0.014355	T	0.60274	0.2256	L	0.51422	1.61	0.37120	D	0.900786	P;P;P;P;D;D	0.89917	0.944;0.808;0.82;0.916;0.974;1.0	P;P;P;P;P;D	0.85130	0.482;0.528;0.533;0.584;0.719;0.997	T	0.54596	-0.8270	9	0.18276	T	0.48	-16.5214	15.3524	0.74399	0.0:0.0:1.0:0.0	.	213;225;236;248;225;248	B7Z4Q7;Q5SQI0-3;Q5SQI0-2;Q5SQI0;Q5SQI0-6;Q5SQI0-4	.;.;.;ATAT_HUMAN;.;.	Q	225;248;225;225;248;248;236	.	ENSP00000324222:E225Q	E	+	1	0	ATAT1	30718541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.845000	0.62853	2.599000	0.87857	0.493000	0.49557	GAG		0.562	ATAT1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076449.2	NM_024909		Missense_Mutation
GALNT14	79623	genome.wustl.edu	37	2	31215801	31215801	+	Missense_Mutation	SNP	G	G	A	rs145668909	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:31215801G>A	ENST00000349752.5	-	2	841	c.202C>T	c.(202-204)Cgc>Tgc	p.R68C	GALNT14_ENST00000324589.5_Intron|AC009305.1_ENST00000449780.1_RNA|GALNT14_ENST00000406653.1_Missense_Mutation_p.R48C|GALNT14_ENST00000356174.3_Missense_Mutation_p.R68C|GALNT14_ENST00000420311.2_Missense_Mutation_p.R33C	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	68					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TCACCAACGCGCCACTTTTTG	0.572																																																0			2						G	CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	100.0	87.0	92.0		202	4.8	1.0	2	dbSNP_134	92	0,8600		0,0,4300	no	missense	GALNT14	NM_024572.2	180	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	68/553	31215801	3,13003	2203	4300	6503	31069305	SO:0001583	missense	79623			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.202C>T	2.37:g.31215801G>A	ENSP00000288988:p.Arg68Cys	Somatic		Capture	Illumina GAIIx	4	31069305	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249193	0.80024	6.81E-4	0.0	ENSG00000158089	ENST00000349752;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T	0.64803	0.37;0.37;0.13;0.37;-0.12	4.8	4.8	0.61643	.	.	.	.	.	T	0.68449	0.3002	L	0.45352	1.415	0.58432	D	0.999998	D;D;D;P;D	0.76494	0.998;0.997;0.999;0.952;0.998	D;P;P;B;P	0.63113	0.911;0.817;0.862;0.418;0.507	T	0.70773	-0.4781	9	0.87932	D	0	.	11.0235	0.47732	0.0:0.0:0.6808:0.3192	.	33;33;68;68;48	F5H263;B7Z5C5;Q96FL9-2;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	C	68;48;68;33;68	ENSP00000288988:R68C;ENSP00000385435:R48C;ENSP00000348497:R68C;ENSP00000415514:R33C;ENSP00000406399:R68C	ENSP00000288988:R68C	R	-	1	0	GALNT14	31069305	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.746000	0.68681	2.479000	0.83701	0.555000	0.69702	CGC		0.572	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		Missense_Mutation
C16orf58	64755	genome.wustl.edu	37	16	31505097	31505097	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:31505097C>T	ENST00000327237.2	-	8	824	c.785G>A	c.(784-786)gGa>gAa	p.G262E	C16orf58_ENST00000430477.2_Missense_Mutation_p.G120E|C16orf58_ENST00000567994.1_Missense_Mutation_p.G217E|C16orf58_ENST00000570164.1_Missense_Mutation_p.G260E			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	262						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G262E(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						GAAGAAACATCCAAGGCTGAA	0.627																																																1	Substitution - Missense(1)	ovary(1)	16											95.0	87.0	90.0					16																	31505097		2197	4300	6497	31412598	SO:0001583	missense	64755			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.785G>A	16.37:g.31505097C>T	ENSP00000317579:p.Gly262Glu	Somatic		Capture	Illumina GAIIx	4	31412598	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	ENST00000327237.2	37	CCDS10715.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	6.103	0.387277	0.11581	.	.	ENSG00000140688	ENST00000327237;ENST00000452223;ENST00000430477	T;T	0.41758	0.99;0.99	5.39	4.41	0.53225	.	0.543263	0.21267	N	0.077386	T	0.27663	0.0680	N	0.25485	0.75	0.09310	N	1	B;B	0.14438	0.007;0.01	B;B	0.19666	0.026;0.026	T	0.11108	-1.0601	10	0.13853	T	0.58	-24.7475	10.6402	0.45588	0.0:0.7485:0.2515:0.0	.	120;262	B4DJP2;Q96GQ5	.;CP058_HUMAN	E	262;216;120	ENSP00000317579:G262E;ENSP00000398074:G120E	ENSP00000317579:G262E	G	-	2	0	C16orf58	31412598	0.000000	0.05858	0.278000	0.24718	0.929000	0.56500	1.035000	0.30216	2.517000	0.84864	0.563000	0.77884	GGA		0.627	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744		Missense_Mutation
PGAP3	93210	genome.wustl.edu	37	17	37829112	37829112	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:37829112C>T	ENST00000300658.4	-	8	999	c.907G>A	c.(907-909)Gaa>Aaa	p.E303K	PGAP3_ENST00000378011.4_Missense_Mutation_p.E252K|PGAP3_ENST00000579146.1_Missense_Mutation_p.G147E|PGAP3_ENST00000429199.2_Missense_Mutation_p.E282K	NM_033419.3	NP_219487.3	Q96FM1	PGAP3_HUMAN	post-GPI attachment to proteins 3	303					GPI anchor biosynthetic process (GO:0006506)|GPI anchor metabolic process (GO:0006505)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12						CTGTCATCTTCCAGAAAGCTG	0.597																																																0			17											89.0	69.0	75.0					17																	37829112		2203	4300	6503	35082638	SO:0001583	missense	93210			AB088396	CCDS32641.1	17q21.2	2009-06-02	2009-06-02	2009-06-02		ENSG00000161395			23719	protein-coding gene	gene with protein product	"""post-GPI attachment to proteins 3"""	611801	"""per1-like domain containing 1"""	PERLD1		15010812, 17021251, 17314402	Standard	NM_001291728		Approved	MGC9753, CAB2, PP1498, PER1	uc002hsj.3	Q96FM1		ENST00000300658.4:c.907G>A	17.37:g.37829112C>T	ENSP00000300658:p.Glu303Lys	Somatic		Capture	Illumina GAIIx	4	35082638	B4DGK7|Q86Z03|Q8NBJ8	Missense_Mutation	SNP	ENST00000300658.4	37	CCDS32641.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	5.328	0.245890	0.10077	.	.	ENSG00000161395	ENST00000300658;ENST00000378011;ENST00000309862;ENST00000429199	.	.	.	5.33	0.363	0.16118	.	0.461817	0.25786	N	0.028312	T	0.18383	0.0441	N	0.04297	-0.235	0.33550	D	0.596065	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.002;0.004;0.003	T	0.41070	-0.9529	9	0.02654	T	1	-1.5031	9.7319	0.40366	0.0:0.499:0.0:0.501	.	282;252;303	B4DGK7;Q96FM1-2;Q96FM1	.;.;PGAP3_HUMAN	K	303;252;247;282	.	ENSP00000300658:E303K	E	-	1	0	PGAP3	35082638	0.947000	0.32204	1.000000	0.80357	0.978000	0.69477	0.395000	0.20850	0.200000	0.20447	-0.258000	0.10820	GAA		0.597	PGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444825.2	NM_033419		Missense_Mutation
G6PC	2538	genome.wustl.edu	37	17	41063279	41063279	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:41063279G>A	ENST00000253801.2	+	5	989	c.910G>A	c.(910-912)Gtc>Atc	p.V304I	G6PC_ENST00000592383.1_3'UTR|G6PC_ENST00000585489.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	304					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.V304I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGCCTCCCTCGTCCTCCTGCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	17											144.0	137.0	140.0					17																	41063279		2203	4300	6503	38316805	SO:0001583	missense	2538			U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.910G>A	17.37:g.41063279G>A	ENSP00000253801:p.Val304Ile	Somatic		Capture	Illumina GAIIx	4	38316805	A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	37	CCDS11446.1	SNP	40	WashU	.	.	.	.	.	.	.	.	.	.	G	5.746	0.322133	0.10900	.	.	ENSG00000131482	ENST00000253801	T	0.75938	-0.98	5.07	-3.34	0.04943	.	0.573150	0.17666	N	0.166137	T	0.42562	0.1208	N	0.08118	0	0.37938	D	0.932213	B	0.02656	0.0	B	0.01281	0.0	T	0.04386	-1.0955	10	0.20519	T	0.43	.	2.8103	0.05440	0.5042:0.1024:0.2207:0.1727	.	304	P35575	G6PC_HUMAN	I	304	ENSP00000253801:V304I	ENSP00000253801:V304I	V	+	1	0	G6PC	38316805	0.001000	0.12720	0.123000	0.21794	0.966000	0.64601	-1.271000	0.02828	-0.449000	0.07117	0.637000	0.83480	GTC		0.577	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151		Missense_Mutation
ENTHD1	150350	genome.wustl.edu	37	22	40283672	40283672	+	Silent	SNP	G	G	A	rs146928757	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr22:40283672G>A	ENST00000325157.6	-	2	331	c.81C>T	c.(79-81)aaC>aaT	p.N27N		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	27	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.							p.N27N(1)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					CCCAAGGGTCGTTAGAAGTTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	22						G		0,4406		0,0,2203	98.0	98.0	98.0		81	2.4	1.0	22	dbSNP_134	98	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	ENTHD1	NM_152512.3		0,5,6498	AA,AG,GG		0.0581,0.0,0.0384		27/608	40283672	5,13001	2203	4300	6503	38613618	SO:0001819	synonymous_variant	150350			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.81C>T	22.37:g.40283672G>A		Somatic		Capture	Illumina GAIIx	4	38613618	B0QYD5|Q5H9F7|Q96LK3	Silent	SNP	ENST00000325157.6	37	CCDS13998.1	SNP	40	WashU																																																																																				0.398	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512		Silent
DNAJB7	150353	genome.wustl.edu	37	22	41257669	41257669	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr22:41257669G>C	ENST00000307221.4	-	1	461	c.330C>G	c.(328-330)caC>caG	p.H110Q	XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000482652.1_3'UTR|XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000357137.4_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	110							chaperone binding (GO:0051087)	p.H110Q(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						CTTCAAAGAAGTGAAAAGAAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	22											81.0	86.0	84.0					22																	41257669		2203	4300	6503	39587615	SO:0001583	missense	150353			AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.330C>G	22.37:g.41257669G>C	ENSP00000307197:p.His110Gln	Somatic		Capture	Illumina GAIIx	4	39587615	Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	ENST00000307221.4	37	CCDS14008.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	11.00	1.510707	0.27036	.	.	ENSG00000172404	ENST00000307221	T	0.73575	-0.76	4.7	1.46	0.22682	.	2.012990	0.02534	N	0.093880	T	0.72914	0.3520	M	0.70595	2.14	0.80722	D	1	B	0.15141	0.012	B	0.19148	0.024	T	0.53464	-0.8435	10	0.29301	T	0.29	.	6.229	0.20724	0.6527:0.0:0.3473:0.0	.	110	Q7Z6W7	DNJB7_HUMAN	Q	110	ENSP00000307197:H110Q	ENSP00000307197:H110Q	H	-	3	2	DNAJB7	39587615	0.002000	0.14202	0.944000	0.38274	0.500000	0.33767	-0.199000	0.09491	0.348000	0.23949	0.591000	0.81541	CAC		0.388	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321765.1	NM_145174		Missense_Mutation
PRPH2	5961	genome.wustl.edu	37	6	42672306	42672306	+	Missense_Mutation	SNP	C	C	T	rs62645934|rs281865372		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:42672306C>T	ENST00000230381.5	-	2	864	c.625G>A	c.(625-627)Gtc>Atc	p.V209I		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	209					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.V209I(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			CTGAAAGGGACGCCGTCCACC	0.572																																																1	Substitution - Missense(1)	ovary(1)	6	GRCh37	CD972426	PRPH2	D							155.0	118.0	130.0					6																	42672306		2203	4300	6503	42780284	SO:0001583	missense	5961				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.625G>A	6.37:g.42672306C>T	ENSP00000230381:p.Val209Ile	Somatic		Capture	Illumina GAIIx	4	42780284	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	32	5.146706	0.94603	.	.	ENSG00000112619	ENST00000230381	D	0.87650	-2.28	5.1	5.1	0.69264	Tetraspanin, EC2 domain (1);Peripherin/rom-1, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.92388	0.7584	M	0.75150	2.29	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92488	0.5998	10	0.54805	T	0.06	.	18.5136	0.90926	0.0:1.0:0.0:0.0	.	209	P23942	PRPH2_HUMAN	I	209	ENSP00000230381:V209I	ENSP00000230381:V209I	V	-	1	0	PRPH2	42780284	1.000000	0.71417	0.902000	0.35471	0.704000	0.40688	7.764000	0.85297	2.383000	0.81215	0.655000	0.94253	GTC		0.572	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322		Missense_Mutation
ABCC10	89845	genome.wustl.edu	37	6	43416922	43416922	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:43416922G>T	ENST00000372530.4	+	20	4398	c.4183G>T	c.(4183-4185)Gct>Tct	p.A1395S	ABCC10_ENST00000244533.3_Missense_Mutation_p.A1367S	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1395	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A1367S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TTTGGCCAGGGCTCTCCTCAC	0.592																																																1	Substitution - Missense(1)	ovary(1)	6											89.0	88.0	88.0					6																	43416922		2203	4300	6503	43524900	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.4183G>T	6.37:g.43416922G>T	ENSP00000361608:p.Ala1395Ser	Somatic		Capture	Illumina GAIIx	4	43524900	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	33	5.266146	0.95399	.	.	ENSG00000124574	ENST00000372530;ENST00000244533;ENST00000443394	D;D	0.93366	-3.21;-3.21	5.46	5.46	0.80206	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96153	0.8746	M	0.71871	2.18	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.979;0.998	D	0.95809	0.8840	10	0.56958	D	0.05	-2.7181	19.3082	0.94173	0.0:0.0:1.0:0.0	.	1367;1395	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	S	1395;1367;151	ENSP00000361608:A1395S;ENSP00000244533:A1367S	ENSP00000244533:A1367S	A	+	1	0	ABCC10	43524900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.588000	0.87417	0.585000	0.79938	GCT		0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		Missense_Mutation
RYR1	6261	genome.wustl.edu	37	19	39051935	39051935	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0920-01	TCGA-13-0920-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr19:39051935T>G	ENST00000359596.3	+	90	12465	c.12465T>G	c.(12463-12465)caT>caG	p.H4155Q	RYR1_ENST00000360985.3_Missense_Mutation_p.H4150Q|RYR1_ENST00000355481.4_Missense_Mutation_p.H4150Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4155					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ATGTGCCGCATGACCCTCGCC	0.632																																																0			19											114.0	86.0	95.0					19																	39051935		2203	4300	6503	43743775	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12465T>G	19.37:g.39051935T>G	ENSP00000352608:p.His4155Gln	Somatic		Capture	Illumina GAIIx	4	43743775	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	SNP	51	WashU	.	.	.	.	.	.	.	.	.	.	T	10.28	1.305482	0.23736	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95035	-3.59;-3.59;-3.59	3.67	2.1	0.27182	.	0.073877	0.51477	U	0.000082	D	0.94755	0.8307	M	0.86502	2.82	0.35582	D	0.806406	P;P;P	0.48016	0.904;0.904;0.845	P;P;B	0.48227	0.571;0.571;0.368	D	0.94393	0.7616	10	0.87932	D	0	.	6.7454	0.23458	0.0:0.6055:0.0:0.3945	.	4150;4150;4155	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	Q	4155;4150;4150	ENSP00000352608:H4155Q;ENSP00000347667:H4150Q;ENSP00000354254:H4150Q	ENSP00000347667:H4150Q	H	+	3	2	RYR1	43743775	0.582000	0.26749	0.998000	0.56505	0.934000	0.57294	-0.211000	0.09332	0.514000	0.28300	0.248000	0.18094	CAT		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			Missense_Mutation
SLC35B2	347734	genome.wustl.edu	37	6	44224594	44224594	+	Silent	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:44224594C>T	ENST00000393812.3	-	2	176	c.33G>A	c.(31-33)ctG>ctA	p.L11L	SLC35B2_ENST00000393810.1_Silent_p.L11L|SLC35B2_ENST00000537814.1_Intron|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000538577.1_5'UTR|SLC35B2_ENST00000495706.1_Intron	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	11					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)	p.L11L(1)		breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGAACGCAGCCAGCACCACCA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	6											63.0	68.0	66.0					6																	44224594		2203	4300	6503	44332572	SO:0001819	synonymous_variant	347734			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.33G>A	6.37:g.44224594C>T		Somatic		Capture	Illumina GAIIx	4	44332572	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Silent	SNP	ENST00000393812.3	37	CCDS34462.1	SNP	21	WashU																																																																																				0.612	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2			Silent
GABRG1	2565	genome.wustl.edu	37	4	46060357	46060357	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:46060357C>A	ENST00000295452.4	-	7	960	c.793G>T	c.(793-795)Gac>Tac	p.D265Y		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	265					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.D265Y(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGCTCAGGTCAAAAAAAATT	0.294																																																1	Substitution - Missense(1)	lung(1)	4											97.0	100.0	99.0					4																	46060357		2203	4300	6503	45755114	SO:0001583	missense	2565			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.793G>T	4.37:g.46060357C>A	ENSP00000295452:p.Asp265Tyr	Germline		Capture	Illumina GAIIx	4	45755114	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	37	CCDS3470.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003067	0.74932	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.79247	-1.25	5.82	4.96	0.65561	Neurotransmitter-gated ion-channel ligand-binding (3);	0.149032	0.64402	D	0.000017	T	0.81522	0.4840	L	0.31664	0.95	0.51767	D	0.999934	P	0.50272	0.933	D	0.65140	0.932	D	0.83496	0.0072	10	0.62326	D	0.03	.	15.8646	0.79055	0.0:0.8641:0.1359:0.0	.	265	Q8N1C3	GBRG1_HUMAN	Y	265	ENSP00000295452:D265Y	ENSP00000295452:D265Y	D	-	1	0	GABRG1	45755114	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.798000	0.55522	1.439000	0.47511	0.644000	0.83932	GAC		0.294	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536		Missense_Mutation
GYLTL1B	120071	genome.wustl.edu	37	11	45948276	45948276	+	Silent	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:45948276G>A	ENST00000531526.1	+	10	1290	c.1179G>A	c.(1177-1179)ctG>ctA	p.L393L	GYLTL1B_ENST00000401752.1_Silent_p.L393L|GYLTL1B_ENST00000389968.3_Silent_p.L120L|GYLTL1B_ENST00000536139.1_Silent_p.L362L|GYLTL1B_ENST00000529052.1_Silent_p.L362L|GYLTL1B_ENST00000325468.5_Silent_p.L393L	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	393					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L393L(1)		breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		AGCAGGCCCTGGCACAACTGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	11											78.0	76.0	77.0					11																	45948276		2203	4299	6502	45904852	SO:0001819	synonymous_variant	120071				CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.1179G>A	11.37:g.45948276G>A		Somatic		Capture	Illumina GAIIx	4	45904852	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Silent	SNP	ENST00000531526.1	37	CCDS31473.1	SNP	47	WashU																																																																																				0.617	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312		Silent
RTP3	83597	genome.wustl.edu	37	3	46542220	46542220	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr3:46542220C>A	ENST00000296142.3	+	2	1102	c.530C>A	c.(529-531)cCa>cAa	p.P177Q		NM_031440.1	NP_113628.1	Q9BQQ7	RTP3_HUMAN	receptor (chemosensory) transporter protein 3	177					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P177Q(1)		endometrium(1)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TCTCAGACCCCAAGAGTACAC	0.522																																																1	Substitution - Missense(1)	ovary(1)	3											77.0	76.0	77.0					3																	46542220		2203	4300	6503	46517224	SO:0001583	missense	83597			AJ312776	CCDS2740.1	3p21.3	2014-02-20	2006-11-21	2006-02-07	ENSG00000163825	ENSG00000163825		"""Receptor transporter proteins"""	15572	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 3"""	607181	"""transmembrane protein 7"", ""receptor transporter protein 3"""	TMEM7		16271481, 15550249, 16720576	Standard	NM_031440		Approved	LTM1, Z3CXXC3	uc003cps.1	Q9BQQ7	OTTHUMG00000133483	ENST00000296142.3:c.530C>A	3.37:g.46542220C>A	ENSP00000296142:p.Pro177Gln	Somatic		Capture	Illumina GAIIx	4	46517224	A2RRP6	Missense_Mutation	SNP	ENST00000296142.3	37	CCDS2740.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102260	0.37145	.	.	ENSG00000163825	ENST00000296142	T	0.20069	2.1	2.32	1.43	0.22495	.	1.354520	0.05314	N	0.525302	T	0.30070	0.0753	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	D	0.66716	0.946	T	0.30504	-0.9976	10	0.66056	D	0.02	-9.8694	7.0102	0.24857	0.0:0.8502:0.0:0.1498	.	177	Q9BQQ7	RTP3_HUMAN	Q	177	ENSP00000296142:P177Q	ENSP00000296142:P177Q	P	+	2	0	RTP3	46517224	0.005000	0.15991	0.008000	0.14137	0.047000	0.14425	1.171000	0.31896	0.537000	0.28751	0.462000	0.41574	CCA		0.522	RTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257379.2	NM_031440		Missense_Mutation
TFAP2D	83741	genome.wustl.edu	37	6	50740458	50740458	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:50740458A>T	ENST00000008391.3	+	8	1468	c.1240A>T	c.(1240-1242)Act>Tct	p.T414S		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.T414S(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					AAAACACACTACTCACAAGAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											66.0	65.0	65.0					6																	50740458		2203	4300	6503	50848417	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1240A>T	6.37:g.50740458A>T	ENSP00000008391:p.Thr414Ser	Somatic		Capture	Illumina GAIIx	4	50848417		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	SNP	14	WashU	.	.	.	.	.	.	.	.	.	.	A	1.456	-0.563756	0.03939	.	.	ENSG00000008197	ENST00000008391	D	0.96992	-4.2	5.31	0.131	0.14755	.	0.629162	0.16681	N	0.203945	T	0.77405	0.4125	N	0.08118	0	0.27990	N	0.935684	B	0.02656	0.0	B	0.09377	0.004	T	0.70575	-0.4834	10	0.29301	T	0.29	0.2228	3.7917	0.08722	0.3667:0.0:0.3417:0.2915	.	414	Q7Z6R9	AP2D_HUMAN	S	414	ENSP00000008391:T414S	ENSP00000008391:T414S	T	+	1	0	TFAP2D	50848417	0.718000	0.27976	0.974000	0.42286	0.660000	0.38997	1.054000	0.30455	0.013000	0.14918	-0.456000	0.05471	ACT		0.507	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238		Missense_Mutation
PKHD1	5314	genome.wustl.edu	37	6	51890438	51890438	+	Silent	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:51890438C>A	ENST00000371117.3	-	32	4445	c.4170G>T	c.(4168-4170)cgG>cgT	p.R1390R	PKHD1_ENST00000340994.4_Silent_p.R1390R	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1390	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R1390R(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGGCCATTATCCGAGGCATCA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	6											84.0	79.0	81.0					6																	51890438		2203	4300	6503	51998397	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4170G>T	6.37:g.51890438C>A		Somatic		Capture	Illumina GAIIx	4	51998397	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	30	WashU																																																																																				0.512	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Silent
FTO	79068	genome.wustl.edu	37	16	53860389	53860389	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:53860389G>T	ENST00000471389.1	+	3	959	c.737G>T	c.(736-738)aGt>aTt	p.S246I	FTO_ENST00000394647.3_Intron	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	246	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)			endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GCAGTGTACAGTTATAGCTGT	0.458																																																0			16											70.0	69.0	69.0					16																	53860389		2198	4300	6498	52417890	SO:0001583	missense	79068			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.737G>T	16.37:g.53860389G>T	ENSP00000418823:p.Ser246Ile	Somatic		Capture	Illumina GAIIx	4	52417890	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	ENST00000471389.1	37	CCDS32448.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558153	0.65538	.	.	ENSG00000140718	ENST00000471389	T	0.78364	-1.17	5.44	-2.76	0.05896	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	0.275088	0.51477	D	0.000090	T	0.76557	0.4004	L	0.59436	1.845	0.80722	D	1	P	0.46512	0.879	P	0.50231	0.635	T	0.74904	-0.3505	10	0.87932	D	0	-19.5227	11.1684	0.48556	0.5554:0.0:0.4446:0.0	.	246	Q9C0B1	FTO_HUMAN	I	246	ENSP00000418823:S246I	ENSP00000418823:S246I	S	+	2	0	FTO	52417890	1.000000	0.71417	0.692000	0.30179	0.992000	0.81027	0.830000	0.27462	-0.840000	0.04206	-0.136000	0.14681	AGT		0.458	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432		Missense_Mutation
ITGA5	3678	genome.wustl.edu	37	12	54795449	54795449	+	Splice_Site	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr12:54795449G>C	ENST00000293379.4	-	23	2568	c.2307C>G	c.(2305-2307)agC>agG	p.S769R	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	769					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)	p.S769R(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TGAGATTCTTGCTGTGGGATG	0.607																																																1	Substitution - Missense(1)	ovary(1)	12											153.0	125.0	134.0					12																	54795449		2203	4300	6503	53081716	SO:0001630	splice_region_variant	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2307-1C>G	12.37:g.54795449G>C		Somatic		Capture	Illumina GAIIx	4	53081716	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	SNP	46	WashU	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845866	0.71603	.	.	ENSG00000161638	ENST00000293379	T	0.62639	0.01	4.92	2.67	0.31697	Integrin alpha-2 (1);	0.039496	0.85682	D	0.000000	T	0.76205	0.3955	M	0.84433	2.695	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.76168	-0.3058	10	0.87932	D	0	.	5.4062	0.16323	0.2891:0.0:0.7109:0.0	.	769	P08648	ITA5_HUMAN	R	769	ENSP00000293379:S769R	ENSP00000293379:S769R	S	-	3	2	ITGA5	53081716	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.466000	0.35310	1.189000	0.43028	0.563000	0.77884	AGC		0.607	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		Missense_Mutation	Missense_Mutation
CASS4	57091	genome.wustl.edu	37	20	55026992	55026992	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr20:55026992A>T	ENST00000360314.3	+	6	985	c.760A>T	c.(760-762)Agc>Tgc	p.S254C	CASS4_ENST00000434344.1_Intron|CASS4_ENST00000371336.3_Missense_Mutation_p.S254C	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	254					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.S254C(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						AGGAAAGGCCAGCGTCAGAAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	20											68.0	67.0	67.0					20																	55026992		2203	4300	6503	54460399	SO:0001583	missense	57091			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.760A>T	20.37:g.55026992A>T	ENSP00000353462:p.Ser254Cys	Somatic		Capture	Illumina GAIIx	4	54460399	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095217	0.56075	.	.	ENSG00000087589	ENST00000360314;ENST00000371336	T;T	0.14144	2.53;2.53	5.23	-4.9	0.03094	.	1.787360	0.02916	N	0.137378	T	0.14227	0.0344	N	0.14661	0.345	0.09310	N	1	D;D;D	0.63046	0.985;0.992;0.973	P;P;P	0.53360	0.527;0.724;0.533	T	0.34925	-0.9809	10	0.56958	D	0.05	1.1541	10.636	0.45565	0.2198:0.1214:0.6587:0.0	.	200;254;254	B4DII4;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	C	254	ENSP00000353462:S254C;ENSP00000360387:S254C	ENSP00000353462:S254C	S	+	1	0	CASS4	54460399	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.336000	0.07863	-0.882000	0.03987	0.460000	0.39030	AGC		0.502	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356		Missense_Mutation
OR5I1	10798	genome.wustl.edu	37	11	55703700	55703700	+	Silent	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:55703700G>A	ENST00000301532.3	-	1	176	c.177C>T	c.(175-177)acC>acT	p.T59T		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	59					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T59T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AATACATGGGGGTTTGAAGGT	0.388																																																1	Substitution - coding silent(1)	ovary(1)	11											63.0	63.0	63.0					11																	55703700		2199	4296	6495	55460276	SO:0001819	synonymous_variant	10798			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.177C>T	11.37:g.55703700G>A		Somatic		Capture	Illumina GAIIx	4	55460276	Q6IEU4	Silent	SNP	ENST00000301532.3	37	CCDS7949.1	SNP	43	WashU																																																																																				0.388	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637		Silent
OR10AG1	282770	genome.wustl.edu	37	11	55735358	55735358	+	Silent	SNP	C	C	T	rs556408380		TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:55735358C>T	ENST00000312345.2	-	1	632	c.582G>A	c.(580-582)gcG>gcA	p.A194A		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A194A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TAAACACCACCGCTACTACAT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	11											86.0	85.0	85.0					11																	55735358		2201	4296	6497	55491934	SO:0001819	synonymous_variant	282770			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.582G>A	11.37:g.55735358C>T		Somatic		Capture	Illumina GAIIx	4	55491934	B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	CCDS31514.1	SNP	23	WashU																																																																																				0.383	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		Silent
NAB2	4665	genome.wustl.edu	37	12	57485519	57485519	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr12:57485519G>A	ENST00000300131.3	+	2	1073	c.695G>A	c.(694-696)gGt>gAt	p.G232D	NAB2_ENST00000342556.6_Missense_Mutation_p.G232D|NAB2_ENST00000357680.4_Missense_Mutation_p.G232D|NAB2_ENST00000554718.1_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	232					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.G232D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GGGACTGGGGGTGGTCCAGAC	0.672																																																1	Substitution - Missense(1)	ovary(1)	12											53.0	61.0	58.0					12																	57485519		2203	4300	6503	55771786	SO:0001583	missense	4665			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.695G>A	12.37:g.57485519G>A	ENSP00000300131:p.Gly232Asp	Somatic		Capture	Illumina GAIIx	4	55771786	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	CCDS8930.1	SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278922	0.23307	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.26	3.35	0.38373	NAB co-repressor, domain (1);	0.096080	0.46758	D	0.000280	T	0.36386	0.0965	L	0.34521	1.04	0.35663	D	0.812676	B	0.21905	0.062	B	0.21151	0.033	T	0.32587	-0.9901	9	0.14252	T	0.57	-0.4771	9.1974	0.37237	0.0:0.0:0.7833:0.2167	.	232	Q15742	NAB2_HUMAN	D	232	.	ENSP00000300131:G232D	G	+	2	0	NAB2	55771786	0.949000	0.32298	0.697000	0.30258	0.373000	0.29922	-0.518000	0.06267	0.971000	0.38288	0.462000	0.41574	GGT		0.672	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967		Missense_Mutation
CLOCK	9575	genome.wustl.edu	37	4	56310050	56310050	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:56310050T>A	ENST00000309964.4	-	19	1956	c.1706A>T	c.(1705-1707)cAa>cTa	p.Q569L	CLOCK_ENST00000381322.1_Missense_Mutation_p.Q569L|CLOCK_ENST00000513440.1_Missense_Mutation_p.Q569L	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	569	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.|Interaction with SIRT1. {ECO:0000250|UniProtKB:O08785}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.Q569L(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AGGATTTGATTGTTGCAAAAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	4											54.0	51.0	52.0					4																	56310050		2203	4300	6503	56004807	SO:0001583	missense	9575			AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1706A>T	4.37:g.56310050T>A	ENSP00000308741:p.Gln569Leu	Somatic		Capture	Illumina GAIIx	4	56004807	A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	CCDS3500.1	SNP	63	WashU	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420581	0.42918	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.05447	3.44;3.44;3.44	5.77	5.77	0.91146	.	0.314059	0.39407	N	0.001377	T	0.12263	0.0298	M	0.79123	2.44	0.51767	D	0.999939	P	0.41748	0.761	B	0.37267	0.245	T	0.01140	-1.1439	10	0.72032	D	0.01	.	16.3948	0.83586	0.0:0.0:0.0:1.0	.	569	O15516	CLOCK_HUMAN	L	569	ENSP00000308741:Q569L;ENSP00000370723:Q569L;ENSP00000426983:Q569L	ENSP00000308741:Q569L	Q	-	2	0	CLOCK	56004807	1.000000	0.71417	0.996000	0.52242	0.166000	0.22503	6.175000	0.71949	2.326000	0.78906	0.533000	0.62120	CAA		0.313	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898		Missense_Mutation
INTS2	57508	genome.wustl.edu	37	17	59947159	59947159	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:59947159C>A	ENST00000444766.3	-	21	3068	c.2993G>T	c.(2992-2994)tGt>tTt	p.C998F	INTS2_ENST00000251334.6_Missense_Mutation_p.C990F	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	998					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)		p.C998F(1)		NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CAAGAGACAACAGATAAGGCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	17											236.0	231.0	232.0					17																	59947159		1935	4140	6075	57301941	SO:0001583	missense	57508			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2993G>T	17.37:g.59947159C>A	ENSP00000414237:p.Cys998Phe	Somatic		Capture	Illumina GAIIx	4	57301941	Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	CCDS45750.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084364	0.76642	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.62498	0.02	5.22	5.22	0.72569	.	0.045792	0.85682	D	0.000000	T	0.67618	0.2912	M	0.74647	2.275	0.80722	D	1	P	0.50528	0.936	P	0.44990	0.466	T	0.71297	-0.4635	9	.	.	.	-8.557	17.7739	0.88501	0.0:1.0:0.0:0.0	.	998	Q9H0H0	INT2_HUMAN	F	998;997	ENSP00000414237:C998F	.	C	-	2	0	INTS2	57301941	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.463000	0.80869	2.440000	0.82611	0.650000	0.86243	TGT		0.403	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		Missense_Mutation
CDH8	1006	genome.wustl.edu	37	16	62055265	62055265	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:62055265G>T	ENST00000577390.1	-	2	997	c.43C>A	c.(43-45)Cca>Aca	p.P15T	CDH8_ENST00000299345.6_Missense_Mutation_p.P15T|CDH8_ENST00000584337.1_Missense_Mutation_p.P15T|CDH8_ENST00000577730.1_Missense_Mutation_p.P15T	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	15					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.P15T(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATTATTAATGGAGTCCAGAGA	0.418																																																1	Substitution - Missense(1)	ovary(1)	16											66.0	69.0	68.0					16																	62055265		2203	4300	6503	60612766	SO:0001583	missense	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.43C>A	16.37:g.62055265G>T	ENSP00000462701:p.Pro15Thr	Somatic		Capture	Illumina GAIIx	4	60612766	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	17.51	3.407942	0.62399	.	.	ENSG00000150394	ENST00000299345	T	0.54071	0.59	6.17	6.17	0.99709	.	0.171574	0.52532	D	0.000061	T	0.48466	0.1501	L	0.51422	1.61	0.38690	D	0.952738	B	0.34103	0.437	B	0.27380	0.079	T	0.43972	-0.9358	10	0.22706	T	0.39	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	15	P55286	CADH8_HUMAN	T	15	ENSP00000299345:P15T	ENSP00000299345:P15T	P	-	1	0	CDH8	60612766	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.469000	0.66749	2.941000	0.99782	0.655000	0.94253	CCA		0.418	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		Missense_Mutation
YTHDF1	54915	genome.wustl.edu	37	20	61834694	61834694	+	Missense_Mutation	SNP	C	C	T	rs374927858		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr20:61834694C>T	ENST00000370339.3	-	4	939	c.598G>A	c.(598-600)Gtc>Atc	p.V200I	YTHDF1_ENST00000370334.4_Intron|YTHDF1_ENST00000370333.4_Missense_Mutation_p.V150I	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	200							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.V200I(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						ACCGTCTTGACGGCGGAGGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	20						C	ILE/VAL	0,4406		0,0,2203	43.0	39.0	40.0		598	5.2	0.9	20		40	1,8599	1.2+/-3.3	0,1,4299	no	missense	YTHDF1	NM_017798.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	200/560	61834694	1,13005	2203	4300	6503	61305139	SO:0001583	missense	54915			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.598G>A	20.37:g.61834694C>T	ENSP00000359364:p.Val200Ile	Somatic		Capture	Illumina GAIIx	4	61305139	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	CCDS13511.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000205	0.54147	0.0	1.16E-4	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.50813	0.73;0.73	5.15	5.15	0.70609	.	0.110164	0.64402	D	0.000009	T	0.32585	0.0834	N	0.08118	0	0.80722	D	1	D	0.61697	0.99	P	0.44772	0.46	T	0.13656	-1.0501	10	0.18710	T	0.47	-19.7646	18.6283	0.91349	0.0:1.0:0.0:0.0	.	200	Q9BYJ9	YTHD1_HUMAN	I	200;150	ENSP00000359364:V200I;ENSP00000359358:V150I	ENSP00000359358:V150I	V	-	1	0	YTHDF1	61305139	1.000000	0.71417	0.937000	0.37676	0.221000	0.24807	5.949000	0.70257	2.400000	0.81607	0.491000	0.48974	GTC		0.607	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798		Missense_Mutation
ZSCAN5B	342933	genome.wustl.edu	37	19	56704059	56704059	+	Silent	SNP	A	A	G			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr19:56704059A>G	ENST00000586855.2	-	2	676	c.363T>C	c.(361-363)aaT>aaC	p.N121N	ZSCAN5B_ENST00000358992.3_Silent_p.N121N			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	121	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.N121N(1)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GTCTTCTGTTATTTCGTAGCA	0.527																																																1	Substitution - coding silent(1)	ovary(1)	19											55.0	60.0	58.0					19																	56704059		2203	4298	6501	61395871	SO:0001819	synonymous_variant	342933				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.363T>C	19.37:g.56704059A>G		Somatic		Capture	Illumina GAIIx	4	61395871		Silent	SNP	ENST00000586855.2	37	CCDS46203.1	SNP	16	WashU																																																																																				0.527	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456		Silent
AHNAK	79026	genome.wustl.edu	37	11	62285127	62285127	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:62285127A>C	ENST00000378024.4	-	5	17036	c.16762T>G	c.(16762-16764)Ttg>Gtg	p.L5588V	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5588	Gly-rich.				protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.L5588V(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTAACACTCAAATGCCCTTCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											146.0	161.0	156.0					11																	62285127		2202	4299	6501	62041703	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.16762T>G	11.37:g.62285127A>C	ENSP00000367263:p.Leu5588Val	Somatic		Capture	Illumina GAIIx	4	62041703	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.764286	0.00005	.	.	ENSG00000124942	ENST00000378024	T	0.01933	4.55	4.57	-9.15	0.00698	.	0.663225	0.12877	N	0.431764	T	0.00845	0.0028	N	0.05414	-0.055	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.44097	-0.9350	10	0.02654	T	1	.	5.6908	0.17829	0.1415:0.5203:0.2121:0.126	.	5588	Q09666	AHNK_HUMAN	V	5588	ENSP00000367263:L5588V	ENSP00000367263:L5588V	L	-	1	2	AHNAK	62041703	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	-6.395000	0.00068	-4.988000	0.00025	-1.774000	0.00658	TTG		0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
PTPRG	5793	genome.wustl.edu	37	3	62248479	62248479	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr3:62248479C>A	ENST00000474889.1	+	17	2943	c.2566C>A	c.(2566-2568)Cag>Aag	p.Q856K	PTPRG-AS1_ENST00000462497.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.Q827K|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000469148.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	856	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q856K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CTAGGAAGTCCAGCGCTGTAC	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											106.0	97.0	100.0					3																	62248479		2203	4300	6503	62223519	SO:0001583	missense	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2566C>A	3.37:g.62248479C>A	ENSP00000418112:p.Gln856Lys	Somatic		Capture	Illumina GAIIx	4	62223519	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964629	0.74131	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.11385	2.78;2.78	5.87	5.87	0.94306	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.16342	0.0393	L	0.56340	1.77	0.80722	D	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.08055	0.0;0.001;0.003	T	0.02132	-1.1208	10	0.72032	D	0.01	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	102;827;856	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	K	856;827	ENSP00000418112:Q856K;ENSP00000295874:Q827K	ENSP00000295874:Q827K	Q	+	1	0	PTPRG	62223519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	CAG		0.373	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841		Missense_Mutation
SF3B2	10992	genome.wustl.edu	37	11	65829174	65829174	+	Silent	SNP	A	A	G	rs373128677	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:65829174A>G	ENST00000322535.6	+	15	1846	c.1797A>G	c.(1795-1797)acA>acG	p.T599T	SF3B2_ENST00000528302.1_Silent_p.T582T	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	599					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.T599T(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AGTTCGAGACACGACTGAAGG	0.498													A|||	23	0.00459265	0.0	0.0	5008	,	,		21429	0.0		0.0	False		,,,				2504	0.0235															1	Substitution - coding silent(1)	ovary(1)	11											124.0	120.0	122.0					11																	65829174		2201	4295	6496	65585750	SO:0001819	synonymous_variant	10992			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1797A>G	11.37:g.65829174A>G		Somatic		Capture	Illumina GAIIx	4	65585750	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	CCDS31612.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	8.049	0.765479	0.15914	.	.	ENSG00000087365	ENST00000530981	.	.	.	5.63	-11.3	0.00108	.	.	.	.	.	T	0.33904	0.0879	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43925	-0.9361	4	.	.	.	-21.166	3.6098	0.08055	0.1166:0.2151:0.4317:0.2367	.	.	.	.	R	20	.	.	H	+	2	0	SF3B2	65585750	0.003000	0.15002	0.184000	0.23157	0.950000	0.60333	-1.340000	0.02650	-2.787000	0.00358	-0.924000	0.02725	CAC		0.498	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2			Silent
EPHA5	2044	genome.wustl.edu	37	4	66242742	66242742	+	Silent	SNP	G	G	A	rs200675919		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:66242742G>A	ENST00000273854.3	-	9	2430	c.1830C>T	c.(1828-1830)tgC>tgT	p.C610C	EPHA5_ENST00000354839.4_Intron|EPHA5_ENST00000511294.1_Silent_p.C611C|EPHA5_ENST00000432638.2_Silent_p.C447C	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	610					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.C610C(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GGGCAACAGCGCACAGGGAAG	0.473										TSP Lung(17;0.13)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		15086	0.0		0.0	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|endometrium(1)	4											99.0	80.0	87.0					4																	66242742		2203	4300	6503	65925337	SO:0001819	synonymous_variant	2044			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1830C>T	4.37:g.66242742G>A		Somatic		Capture	Illumina GAIIx	4	65925337	Q7Z3F2	Silent	SNP	ENST00000273854.3	37	CCDS3513.1	SNP	38	WashU																																																																																				0.473	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439		Silent
CSPP1	79848	genome.wustl.edu	37	8	68007879	68007879	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:68007879G>T	ENST00000262210.5	+	6	893	c.862G>T	c.(862-864)Gat>Tat	p.D288Y	CSPP1_ENST00000412460.1_5'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	323					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.D288Y(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ACCAGACCAAGATCCTGAAGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	8											64.0	60.0	61.0					8																	68007879		1841	4084	5925	68170433	SO:0001583	missense	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.862G>T	8.37:g.68007879G>T	ENSP00000262210:p.Asp288Tyr	Somatic		Capture	Illumina GAIIx	4	68170433	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	CCDS43744.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300473	0.40694	.	.	ENSG00000104218	ENST00000262210;ENST00000389042	T	0.76839	-1.05	5.87	4.99	0.66335	.	0.247806	0.17983	U	0.155470	T	0.75554	0.3865	L	0.53249	1.67	0.80722	D	1	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.12837	0.004;0.008;0.008	T	0.71185	-0.4667	10	0.51188	T	0.08	-17.4369	16.5304	0.84355	0.0:0.0:0.8682:0.1318	.	288;323;323	Q1MSJ5-1;Q1MSJ5;F8W7C3	.;CSPP1_HUMAN;.	Y	288;323	ENSP00000262210:D288Y	ENSP00000262210:D288Y	D	+	1	0	CSPP1	68170433	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	4.808000	0.62583	1.481000	0.48307	-0.158000	0.13435	GAT		0.368	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		Missense_Mutation
C8orf34	116328	genome.wustl.edu	37	8	69351737	69351737	+	Silent	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:69351737T>C	ENST00000539993.1	+	2	622	c.73T>C	c.(73-75)Tta>Cta	p.L25L	C8orf34_ENST00000349492.3_3'UTR|C8orf34_ENST00000518698.1_Silent_p.L111L|C8orf34_ENST00000348340.2_Silent_p.L25L|C8orf34_ENST00000523686.1_Silent_p.L25L|C8orf34_ENST00000337103.4_5'UTR			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	25								p.L25L(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			CCTTCAGGAATTAATGACCAA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	8											67.0	65.0	66.0					8																	69351737		2203	4300	6503	69514291	SO:0001819	synonymous_variant	116328			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.73T>C	8.37:g.69351737T>C		Somatic		Capture	Illumina GAIIx	4	69514291	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Silent	SNP	ENST00000539993.1	37		SNP	52	WashU																																																																																				0.378	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_052958		Silent
KIF19	124602	genome.wustl.edu	37	17	72347060	72347060	+	Intron	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:72347060G>C	ENST00000389916.4	+	12	1725				AC103809.2_ENST00000599136.1_Intron	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19						ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CAGGGTTTGGGGGGACAAGGA	0.647																																																0			17											72.0	78.0	76.0					17																	72347060		2203	4300	6503	69858655	SO:0001627	intron_variant	124602			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1587+16G>C	17.37:g.72347060G>C		Somatic		Capture	Illumina GAIIx	4	69858655	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	SNP	43	WashU																																																																																				0.647	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		Missense_Mutation
HTN3	3347	genome.wustl.edu	37	4	70896494	70896494	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:70896494A>T	ENST00000530128.1	+	2	112	c.37A>T	c.(37-39)Atg>Ttg	p.M13L	HTN3_ENST00000381057.3_Missense_Mutation_p.M13L|HTN3_ENST00000526767.1_Missense_Mutation_p.M13L			P15516	HIS3_HUMAN	histatin 3	13					biomineral tissue development (GO:0031214)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.M13L(1)		breast(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	8						CTTGGCTCTCATGCTTTCCAT	0.328																																																1	Substitution - Missense(1)	ovary(1)	4											124.0	119.0	121.0					4																	70896494		2203	4299	6502	70931083	SO:0001583	missense	3347				CCDS33999.1	4q13	2008-08-29							5284	protein-coding gene	gene with protein product		142702					Standard	NM_000200		Approved	HIS2	uc003hew.2	P15516		ENST00000530128.1:c.37A>T	4.37:g.70896494A>T	ENSP00000432561:p.Met13Leu	Somatic		Capture	Illumina GAIIx	4	70931083	Q16243|Q502Z1	Missense_Mutation	SNP	ENST00000530128.1	37	CCDS33999.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	2.220	-0.378651	0.05000	.	.	ENSG00000205649	ENST00000526767;ENST00000530128;ENST00000381057	T;T;T	0.61859	0.44;0.44;0.07	2.62	-3.7	0.04437	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.31724	-0.9933	8	0.87932	D	0	.	3.3137	0.07026	0.4246:0.0:0.3817:0.1936	.	13	P15516	HIS3_HUMAN	L	13	ENSP00000437158:M13L;ENSP00000432561:M13L;ENSP00000370445:M13L	ENSP00000370445:M13L	M	+	1	0	HTN3	70931083	0.000000	0.05858	0.017000	0.16124	0.029000	0.11900	-0.712000	0.05013	-0.766000	0.04639	-1.486000	0.00981	ATG		0.328	HTN3-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387375.1	NM_000200		Missense_Mutation
CYP1A1	1543	genome.wustl.edu	37	15	75012850	75012850	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr15:75012850G>T	ENST00000379727.3	-	7	1717	c.1519C>A	c.(1519-1521)Caa>Aaa	p.Q507K	CYP1A1_ENST00000395048.2_Missense_Mutation_p.Q507K|CYP1A1_ENST00000567032.1_Missense_Mutation_p.Q507K|CYP1A1_ENST00000395049.4_Missense_Mutation_p.Q478K			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	507					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)	p.Q507K(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	AGCTGCATTTGGAAGTGCTCA	0.587									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																							1	Substitution - Missense(1)	ovary(1)	15											103.0	93.0	96.0					15																	75012850		2197	4296	6493	72799903	SO:0001583	missense	1543	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.1519C>A	15.37:g.75012850G>T	ENSP00000369050:p.Gln507Lys	Somatic		Capture	Illumina GAIIx	4	72799903	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866806	0.51588	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.69561	-0.41;-0.41;-0.27	5.65	5.65	0.86999	.	0.435408	0.25744	N	0.028590	T	0.81113	0.4755	M	0.77313	2.365	0.34197	D	0.672789	D;D	0.69078	0.997;0.995	D;D	0.83275	0.996;0.986	D	0.84831	0.0802	10	0.36615	T	0.2	.	14.5482	0.68047	0.0:0.0:0.8537:0.1463	.	478;507	E7EMT5;P04798	.;CP1A1_HUMAN	K	507;507;478;479	ENSP00000369050:Q507K;ENSP00000378488:Q507K;ENSP00000378489:Q478K	ENSP00000268062:Q479K	Q	-	1	0	CYP1A1	72799903	1.000000	0.71417	0.980000	0.43619	0.294000	0.27393	3.793000	0.55484	2.668000	0.90789	0.655000	0.94253	CAA		0.587	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499		Missense_Mutation
ALB	213	genome.wustl.edu	37	4	74276114	74276114	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:74276114C>A	ENST00000503124.1	+	4	458	c.251C>A	c.(250-252)gCt>gAt	p.A84D	ALB_ENST00000295897.4_Missense_Mutation_p.A234D|ALB_ENST00000401494.3_Missense_Mutation_p.A119D|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Missense_Mutation_p.A234D|ALB_ENST00000415165.2_Intron			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.A234D(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGAGAAAGAGCTTTCAAAGCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											75.0	80.0	79.0					4																	74276114		2203	4300	6503	74494978	SO:0001583	missense	213			V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.251C>A	4.37:g.74276114C>A	ENSP00000421027:p.Ala84Asp	Somatic		Capture	Illumina GAIIx	4	74494978	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	37		SNP	28	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.31|18.31	3.595599|3.595599	0.66219|0.66219	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T|.	0.72835|.	-0.69;-0.69;-0.69;-0.69|.	5.65|5.65	3.89|3.89	0.44902|0.44902	Serum albumin-like (1);Serum albumin, N-terminal (3);|.	0.207613|.	0.42172|.	D|.	0.000741|.	T|T	0.73806|0.73806	0.3634|0.3634	M|M	0.86028|0.86028	2.79|2.79	0.40492|0.40492	D|D	0.98055|0.98055	D;D;D;P|.	0.60575|.	0.988;0.977;0.972;0.951|.	P;P;P;P|.	0.58013|.	0.831;0.724;0.821;0.724|.	T|T	0.76055|0.76055	-0.3099|-0.3099	10|5	0.87932|.	D|.	0|.	-10.2682|-10.2682	8.2723|8.2723	0.31851|0.31851	0.0:0.7582:0.1561:0.0857|0.0:0.7582:0.1561:0.0857	.|.	119;84;234;234|.	B7WNR0;D6RHD5;A6NBZ8;P02768|.	.;.;.;ALBU_HUMAN|.	D|R	234;84;234;119;243|78	ENSP00000295897:A234D;ENSP00000421027:A84D;ENSP00000422784:A234D;ENSP00000384695:A119D|.	ENSP00000295897:A234D|.	A|S	+|+	2|3	0|2	ALB|ALB	74494978|74494978	0.829000|0.829000	0.29322|0.29322	0.994000|0.994000	0.49952|0.49952	0.845000|0.845000	0.48019|0.48019	1.071000|1.071000	0.30666|0.30666	1.364000|1.364000	0.46038|0.46038	0.555000|0.555000	0.69702|0.69702	GCT|AGC		0.363	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477		Missense_Mutation
EIF4A3	9775	genome.wustl.edu	37	17	78109893	78109893	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr17:78109893C>G	ENST00000269349.3	-	11	1350	c.1129G>C	c.(1129-1131)Gcc>Ccc	p.A377P		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	377	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)	p.A377P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			AAGTTAATGGCCACACCCTTC	0.393																																																1	Substitution - Missense(1)	ovary(1)	17											124.0	115.0	118.0					17																	78109893		2203	4300	6503	75724488	SO:0001583	missense	9775			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.1129G>C	17.37:g.78109893C>G	ENSP00000269349:p.Ala377Pro	Somatic		Capture	Illumina GAIIx	4	75724488	Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	ENST00000269349.3	37	CCDS11767.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053629	0.55218	.	.	ENSG00000141543	ENST00000269349	T	0.06449	3.3	4.18	4.18	0.49190	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.33614	0.0869	H	0.95679	3.705	0.80722	D	1	D	0.71674	0.998	D	0.65773	0.938	T	0.51787	-0.8661	10	0.87932	D	0	-27.3079	14.0211	0.64555	0.0:1.0:0.0:0.0	.	377	P38919	IF4A3_HUMAN	P	377	ENSP00000269349:A377P	ENSP00000269349:A377P	A	-	1	0	EIF4A3	75724488	1.000000	0.71417	0.998000	0.56505	0.024000	0.10985	7.212000	0.77941	2.185000	0.69588	0.555000	0.69702	GCC		0.393	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1	NM_014740		Missense_Mutation
SLAIN1	122060	genome.wustl.edu	37	13	78318404	78318404	+	Intron	SNP	C	C	T	rs200914952	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr13:78318404C>T	ENST00000466548.1	+	4	726				SLAIN1_ENST00000488699.1_Intron|SLAIN1_ENST00000314070.5_Intron|SLAIN1_ENST00000465831.1_Intron|SLAIN1_ENST00000418532.1_Intron|SLAIN1_ENST00000267219.8_Intron|SLAIN1_ENST00000358679.3_Intron|SLAIN1_ENST00000351546.3_Intron	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1											breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		ACACACTTTTCCTTTGTGTTT	0.403													c|||	2	0.000399361	0.0	0.0	5008	,	,		19325	0.002		0.0	False		,,,				2504	0.0															0			13											82.0	76.0	78.0					13																	78318404		2203	4300	6503	77216405	SO:0001627	intron_variant	122060			AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.701-14C>T	13.37:g.78318404C>T		Somatic		Capture	Illumina GAIIx	4	77216405	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Silent	SNP	ENST00000466548.1	37		SNP	30	WashU																																																																																				0.403	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000355018.1	NM_144595		Silent
ZSCAN2	54993	genome.wustl.edu	37	15	85163858	85163858	+	Silent	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr15:85163858G>C	ENST00000448803.2	+	3	724	c.432G>C	c.(430-432)ggG>ggC	p.G144G	ZSCAN2_ENST00000541040.1_Silent_p.G144G|ZSCAN2_ENST00000327179.6_Silent_p.G143G|ZSCAN2_ENST00000485222.2_Silent_p.G144G|ZSCAN2_ENST00000538076.1_Silent_p.G144G|ZSCAN2_ENST00000546148.1_Silent_p.G144G|ZSCAN2_ENST00000358472.3_5'UTR	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	144					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G144G(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		GTGAAAATGGGGAGAACTGTA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	15											102.0	113.0	110.0					15																	85163858		2203	4299	6502	82964862	SO:0001819	synonymous_variant	54993			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.432G>C	15.37:g.85163858G>C		Somatic		Capture	Illumina GAIIx	4	82964862	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Silent	SNP	ENST00000448803.2	37	CCDS10329.2	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	8.918	0.960273	0.18507	.	.	ENSG00000176371	ENST00000540936	T	0.35421	1.31	4.68	2.63	0.31362	.	0.462768	0.20023	N	0.100864	T	0.45276	0.1334	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45160	-0.9280	7	0.87932	D	0	-18.0137	8.3087	0.32058	0.2145:0.0:0.7855:0.0	.	.	.	.	A	100	ENSP00000446041:G100A	ENSP00000446041:G100A	G	+	2	0	ZSCAN2	82964862	0.518000	0.26234	1.000000	0.80357	0.990000	0.78478	0.630000	0.24553	1.175000	0.42826	0.655000	0.94253	GGG		0.398	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396956.1	NM_017894		Silent
SCD5	79966	genome.wustl.edu	37	4	83626508	83626508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:83626508C>T	ENST00000319540.4	-	2	610	c.291G>A	c.(289-291)tgG>tgA	p.W97*	SCD5_ENST00000273908.4_Nonsense_Mutation_p.W97*|SCD5_ENST00000282709.4_Nonsense_Mutation_p.W97*	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	97					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.W97*(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				ACCTGTGGCTCCACAAGCGAT	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	4											67.0	61.0	63.0					4																	83626508		2203	4300	6503	83845532	SO:0001587	stop_gained	79966			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.291G>A	4.37:g.83626508C>T	ENSP00000316329:p.Trp97*	Somatic		Capture	Illumina GAIIx	4	83845532	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Nonsense_Mutation	SNP	ENST00000319540.4	37	CCDS34024.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	37	6.501386	0.97616	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	.	.	.	5.12	5.12	0.69794	.	0.111911	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2504	18.7141	0.91668	0.0:1.0:0.0:0.0	.	.	.	.	X	97	.	ENSP00000273908:W97X	W	-	3	0	SCD5	83845532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.446000	0.80609	2.826000	0.97356	0.491000	0.48974	TGG		0.582	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906		Nonsense_Mutation
ZNF711	7552	genome.wustl.edu	37	X	84526277	84526277	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:84526277C>A	ENST00000373165.3	+	9	2035	c.1729C>A	c.(1729-1731)Ctt>Att	p.L577I	ZNF711_ENST00000542798.1_Missense_Mutation_p.L419I|ZNF711_ENST00000276123.3_Missense_Mutation_p.L577I|ZNF711_ENST00000360700.4_Missense_Mutation_p.L623I|ZNF711_ENST00000395402.1_Missense_Mutation_p.L585I	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	577				L -> P (in Ref. 3; BAG61766). {ECO:0000305}.	positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.L587I(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TGAGAGGGAGCTTCAACGCCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											80.0	63.0	69.0					X																	84526277		2201	4298	6499	84412933	SO:0001583	missense	7552			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1729C>A	X.37:g.84526277C>A	ENSP00000362260:p.Leu577Ile	Somatic		Capture	Illumina GAIIx	4	84412933	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	CCDS35344.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427979	0.43122	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	5.3	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.189536	0.25529	N	0.030048	T	0.45975	0.1369	M	0.90198	3.095	0.41683	D	0.989305	D;B	0.64830	0.994;0.018	P;B	0.54499	0.754;0.016	T	0.47086	-0.9144	10	0.72032	D	0.01	-2.2071	8.0858	0.30771	0.0:0.7242:0.1278:0.1481	.	623;577	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	I	585;577;577;623;419	ENSP00000378798:L585I;ENSP00000362260:L577I;ENSP00000276123:L577I;ENSP00000353922:L623I;ENSP00000442071:L419I	ENSP00000276123:L577I	L	+	1	0	ZNF711	84412933	1.000000	0.71417	0.946000	0.38457	0.989000	0.77384	4.946000	0.63576	0.111000	0.17947	0.513000	0.50165	CTT		0.408	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998		Missense_Mutation
IRF8	3394	genome.wustl.edu	37	16	85945260	85945260	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0920-01	TCGA-13-0920-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr16:85945260A>G	ENST00000268638.5	+	4	865	c.443A>G	c.(442-444)aAg>aGg	p.K148R	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	148					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.K148R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GAGCTGATCAAGGAGGTAAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	16											98.0	85.0	89.0					16																	85945260		2198	4300	6498	84502761	SO:0001583	missense	3394			M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.443A>G	16.37:g.85945260A>G	ENSP00000268638:p.Lys148Arg	Somatic		Capture	Illumina GAIIx	4	84502761	A0AV82	Missense_Mutation	SNP	ENST00000268638.5	37	CCDS10956.1	SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	12.42	1.932726	0.34096	.	.	ENSG00000140968	ENST00000268638	D	0.97089	-4.24	4.96	4.96	0.65561	.	0.386252	0.29126	N	0.013062	D	0.94391	0.8196	L	0.55481	1.735	0.80722	D	1	B	0.28998	0.23	B	0.26864	0.074	D	0.92454	0.5972	10	0.14656	T	0.56	-41.232	12.8725	0.57972	1.0:0.0:0.0:0.0	.	148	Q02556	IRF8_HUMAN	R	148	ENSP00000268638:K148R	ENSP00000268638:K148R	K	+	2	0	IRF8	84502761	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	4.908000	0.63307	1.867000	0.54127	0.459000	0.35465	AAG		0.557	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		Missense_Mutation
FLRT2	23768	genome.wustl.edu	37	14	86089685	86089685	+	Silent	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr14:86089685C>T	ENST00000330753.4	+	2	2594	c.1827C>T	c.(1825-1827)atC>atT	p.I609I	FLRT2_ENST00000554746.1_Silent_p.I609I	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	609					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.I609I(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GTTTTCAGATCGTCTCCTTAA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	14											126.0	134.0	131.0					14																	86089685		2203	4300	6503	85159438	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1827C>T	14.37:g.86089685C>T		Somatic		Capture	Illumina GAIIx	4	85159438	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1	SNP	31	WashU																																																																																				0.473	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			Silent
PTPN13	5783	genome.wustl.edu	37	4	87730941	87730941	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:87730941T>C	ENST00000411767.2	+	46	7166	c.7103T>C	c.(7102-7104)aTt>aCt	p.I2368T	PTPN13_ENST00000316707.6_Missense_Mutation_p.I2177T|PTPN13_ENST00000436978.1_Missense_Mutation_p.I2373T|PTPN13_ENST00000511467.1_Missense_Mutation_p.I2373T|PTPN13_ENST00000427191.2_Missense_Mutation_p.I2349T			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2368	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.I2373T(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GTGCGCCATATTTCTCATCTG	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											159.0	143.0	148.0					4																	87730941		1937	4151	6088	87949965	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.7103T>C	4.37:g.87730941T>C	ENSP00000407249:p.Ile2368Thr	Somatic		Capture	Illumina GAIIx	4	87949965	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	19.28	3.798119	0.70567	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	5.31	4.08	0.47627	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.247539	0.28241	N	0.016078	T	0.44393	0.1291	M	0.84585	2.705	0.41066	D	0.985417	P;P;D;D	0.54772	0.801;0.931;0.968;0.96	P;D;D;D	0.72338	0.869;0.962;0.977;0.962	T	0.51710	-0.8671	10	0.87932	D	0	.	12.4055	0.55436	0.0:0.0:0.14:0.86	.	2177;2349;2368;2373	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	T	2349;2373;2177;2368;2373;2317	ENSP00000408368:I2349T;ENSP00000394794:I2373T;ENSP00000322675:I2177T;ENSP00000407249:I2368T;ENSP00000426626:I2373T	ENSP00000322675:I2177T	I	+	2	0	PTPN13	87949965	1.000000	0.71417	0.862000	0.33874	0.983000	0.72400	5.720000	0.68470	2.003000	0.58678	0.533000	0.62120	ATT		0.378	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1			Missense_Mutation
CNNM4	26504	genome.wustl.edu	37	2	97427452	97427452	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:97427452G>T	ENST00000377075.2	+	1	814	c.716G>T	c.(715-717)gGc>gTc	p.G239V		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	239	DUF21.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.G239V(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						CGGCGCAAGGGCAACTACCTT	0.602																																																1	Substitution - Missense(1)	ovary(1)	2											128.0	119.0	122.0					2																	97427452		2203	4300	6503	96791179	SO:0001583	missense	26504			AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.716G>T	2.37:g.97427452G>T	ENSP00000366275:p.Gly239Val	Somatic		Capture	Illumina GAIIx	4	96791179	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Missense_Mutation	SNP	ENST00000377075.2	37	CCDS2024.2	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	g	23.8	4.455711	0.84209	.	.	ENSG00000158158	ENST00000377075	D	0.88124	-2.34	5.13	5.13	0.70059	Domain of unknown function DUF21 (1);	0.058067	0.64402	D	0.000002	D	0.95274	0.8467	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96469	0.9347	10	0.87932	D	0	-13.7803	17.363	0.87356	0.0:0.0:1.0:0.0	.	239	Q6P4Q7	CNNM4_HUMAN	V	239	ENSP00000366275:G239V	ENSP00000366275:G239V	G	+	2	0	CNNM4	96791179	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.820000	0.99359	2.385000	0.81259	0.651000	0.88453	GGC		0.602	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184		Missense_Mutation
CNGA3	1261	genome.wustl.edu	37	2	99013408	99013408	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:99013408C>A	ENST00000272602.2	+	7	1814	c.1775C>A	c.(1774-1776)cCc>cAc	p.P592H	CNGA3_ENST00000393504.1_Missense_Mutation_p.P592H|CNGA3_ENST00000436404.2_Missense_Mutation_p.P574H|CNGA3_ENST00000409937.1_Missense_Mutation_p.P596H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	592					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						ACCGAGTACCCCGAAGCCAAG	0.607																																																0			2											48.0	49.0	49.0					2																	99013408		2203	4300	6503	98379840	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1775C>A	2.37:g.99013408C>A	ENSP00000272602:p.Pro592His	Somatic		Capture	Illumina GAIIx	4	98379840	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819148	0.71028	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68	5.42	5.42	0.78866	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99327	0.9764	H	0.98446	4.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98556	1.0639	10	0.87932	D	0	.	18.154	0.89686	0.0:1.0:0.0:0.0	.	596;574;592	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	592;574;592;596	ENSP00000377140:P592H;ENSP00000410070:P574H;ENSP00000272602:P592H;ENSP00000386761:P596H	ENSP00000272602:P592H	P	+	2	0	CNGA3	98379840	1.000000	0.71417	0.958000	0.39756	0.723000	0.41478	7.320000	0.79064	2.826000	0.97356	0.563000	0.77884	CCC		0.607	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		Missense_Mutation
ZKSCAN1	7586	genome.wustl.edu	37	7	99627968	99627968	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:99627968C>G	ENST00000324306.6	+	5	1003	c.769C>G	c.(769-771)Cag>Gag	p.Q257E	ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.Q221E|ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.Q44E	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	257	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q257E(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGACAACAGGCAGGAGAATTA	0.502																																																1	Substitution - Missense(1)	ovary(1)	7											119.0	101.0	107.0					7																	99627968		2203	4300	6503	99465904	SO:0001583	missense	7586			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.769C>G	7.37:g.99627968C>G	ENSP00000323148:p.Gln257Glu	Somatic		Capture	Illumina GAIIx	4	99465904	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	CCDS34698.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866704	0.51588	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.01787	4.64;4.64;4.64	5.32	5.32	0.75619	Krueppel-associated box (4);	0.000000	0.51477	D	0.000083	T	0.05273	0.0140	M	0.66506	2.035	0.35131	D	0.767946	P	0.46784	0.884	P	0.51866	0.682	T	0.32268	-0.9913	10	0.34782	T	0.22	.	11.4239	0.49998	0.1798:0.8202:0.0:0.0	.	257	P17029	ZKSC1_HUMAN	E	257;221;44	ENSP00000323148:Q257E;ENSP00000409172:Q221E;ENSP00000443508:Q44E	ENSP00000323148:Q257E	Q	+	1	0	ZKSCAN1	99465904	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	1.096000	0.30976	2.767000	0.95098	0.655000	0.94253	CAG		0.502	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439		Missense_Mutation
SYTL4	94121	genome.wustl.edu	37	X	99942147	99942147	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:99942147C>G	ENST00000372989.1	-	13	1432	c.1101G>C	c.(1099-1101)gaG>gaC	p.E367D	SYTL4_ENST00000276141.6_Missense_Mutation_p.E367D|SYTL4_ENST00000454200.2_Missense_Mutation_p.E369D|SYTL4_ENST00000263033.5_Missense_Mutation_p.E367D|SYTL4_ENST00000455616.1_Missense_Mutation_p.E367D|SYTL4_ENST00000372981.1_3'UTR	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	367	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.E367D(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGGTTTGCTGCTCATACTTCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											108.0	85.0	93.0					X																	99942147		2203	4300	6503	99828803	SO:0001583	missense	94121				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1101G>C	X.37:g.99942147C>G	ENSP00000362080:p.Glu367Asp	Somatic		Capture	Illumina GAIIx	4	99828803	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	2.987	-0.208960	0.06140	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033	T;T;T;T;T	0.06768	3.26;3.26;3.26;3.26;3.26	5.98	0.924	0.19418	C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.239962	0.48767	N	0.000166	T	0.01800	0.0057	N	0.01048	-1.04	0.27471	N	0.952868	B	0.02656	0.0	B	0.01281	0.0	T	0.39941	-0.9589	9	.	.	.	-12.1872	1.4814	0.02437	0.2466:0.4282:0.1179:0.2073	.	367	Q96C24	SYTL4_HUMAN	D	367;367;369;367;367	ENSP00000362080:E367D;ENSP00000390252:E367D;ENSP00000403556:E369D;ENSP00000276141:E367D;ENSP00000263033:E367D	.	E	-	3	2	SYTL4	99828803	0.630000	0.27155	0.965000	0.40720	0.964000	0.63967	0.314000	0.19432	0.011000	0.14865	-0.197000	0.12766	GAG		0.507	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737		Missense_Mutation
ADH1A	124	genome.wustl.edu	37	4	100208014	100208014	+	Silent	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:100208014G>A	ENST00000209668.2	-	3	365	c.252C>T	c.(250-252)gtC>gtT	p.V84V	RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'UTR	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	84					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.V84V(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TACCTGGTTTGACTGTAGTCA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	4											223.0	204.0	210.0					4																	100208014		2203	4300	6503	100427037	SO:0001819	synonymous_variant	124			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.252C>T	4.37:g.100208014G>A		Somatic		Capture	Illumina GAIIx	4	100427037	A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	CCDS3648.1	SNP	45	WashU																																																																																				0.512	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667		Silent
SERPINE1	5054	genome.wustl.edu	37	7	100773786	100773786	+	Missense_Mutation	SNP	C	C	T	rs143027028		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:100773786C>T	ENST00000223095.4	+	3	513	c.356C>T	c.(355-357)gCg>gTg	p.A119V	SERPINE1_ENST00000445463.2_Missense_Mutation_p.A104V	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	119					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.A119V(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	ACCACAGACGCGATCTTCGTC	0.597													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18580	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7						C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	191.0	174.0	180.0		356,311	5.4	1.0	7	dbSNP_134	180	0,8600		0,0,4300	yes	missense,missense	SERPINE1	NM_000602.3,NM_001165413.1	64,64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	119/403,104/388	100773786	1,13005	2203	4300	6503	100560506	SO:0001583	missense	5054			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.356C>T	7.37:g.100773786C>T	ENSP00000223095:p.Ala119Val	Somatic		Capture	Illumina GAIIx	4	100560506	B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	CCDS5711.1	SNP	27	WashU	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	23.7	4.446365	0.84101	2.27E-4	0.0	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.84944	-1.92;-1.92	5.44	5.44	0.79542	Serpin domain (3);	0.124112	0.53938	D	0.000052	D	0.89663	0.6780	M	0.79614	2.46	0.39814	D	0.972749	D;D	0.89917	0.998;1.0	P;P	0.56514	0.585;0.8	D	0.90477	0.4457	10	0.51188	T	0.08	.	12.4802	0.55837	0.0:0.8317:0.1683:0.0	.	104;119	F8WD53;P05121	.;PAI1_HUMAN	V	119;104;104	ENSP00000223095:A119V;ENSP00000396766:A104V	ENSP00000223095:A119V	A	+	2	0	SERPINE1	100560506	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	2.215000	0.42862	2.553000	0.86117	0.561000	0.74099	GCG		0.597	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602		Missense_Mutation
ARMC10	83787	genome.wustl.edu	37	7	102738779	102738779	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:102738779C>T	ENST00000323716.3	+	7	1203	c.811C>T	c.(811-813)Cac>Tac	p.H271Y	ARMC10_ENST00000428183.2_Missense_Mutation_p.H212Y|ARMC10_ENST00000441711.2_Missense_Mutation_p.H236Y|ARMC10_ENST00000541300.1_Missense_Mutation_p.H153Y|ARMC10_ENST00000425331.1_Missense_Mutation_p.H212Y|ARMC10_ENST00000454559.1_Missense_Mutation_p.H177Y	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	271					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.H271Y(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TTATGACAGCCACGTAGCAAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	7											35.0	34.0	34.0					7																	102738779		2202	4299	6501	102526015	SO:0001583	missense	83787			AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.811C>T	7.37:g.102738779C>T	ENSP00000319412:p.His271Tyr	Somatic		Capture	Illumina GAIIx	4	102526015	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	37	CCDS5728.1	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	5.010	0.187567	0.09547	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153;ENST00000431642	T;T;T;T;T;T;T;T	0.48201	1.64;1.64;1.64;1.64;1.64;1.64;0.82;1.64	5.42	3.5	0.40072	Armadillo-like helical (1);Armadillo-type fold (1);	0.536654	0.21849	N	0.068201	T	0.47469	0.1447	L	0.46157	1.445	0.09310	N	1	B;P;P;D;P;P;P	0.59357	0.061;0.952;0.718;0.985;0.883;0.882;0.904	B;P;B;P;P;B;P	0.57620	0.038;0.453;0.251;0.824;0.767;0.43;0.558	T	0.32640	-0.9899	10	0.19590	T	0.45	-9.4756	5.4823	0.16731	0.1442:0.6331:0.1401:0.0825	.	212;153;177;199;212;236;271	B4DWJ8;F5GX65;Q8N2F6-4;C9J5N7;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;.;ARM10_HUMAN	Y	271;212;236;177;212;153;199;113	ENSP00000319412:H271Y;ENSP00000396654:H212Y;ENSP00000413619:H236Y;ENSP00000405612:H177Y;ENSP00000397969:H212Y;ENSP00000440463:H153Y;ENSP00000398201:H199Y;ENSP00000406840:H113Y	ENSP00000319412:H271Y	H	+	1	0	ARMC10	102526015	0.132000	0.22450	0.216000	0.23742	0.879000	0.50718	0.502000	0.22594	2.709000	0.92574	0.591000	0.81541	CAC		0.323	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905		Missense_Mutation
HCFC2	29915	genome.wustl.edu	37	12	104487252	104487252	+	Missense_Mutation	SNP	C	C	T	rs574023442		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr12:104487252C>T	ENST00000229330.4	+	10	1477	c.1373C>T	c.(1372-1374)aCg>aTg	p.T458M	HCFC2_ENST00000550335.1_3'UTR	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	458					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)	p.T458M(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						AAAGCACTGACGGATTCTAAT	0.338													c|||	1	0.000199681	0.0	0.0014	5008	,	,		15291	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(184;1814 2036 4771 6974 15702)											1	Substitution - Missense(1)	ovary(1)	12											97.0	90.0	93.0					12																	104487252		2203	4299	6502	103011382	SO:0001583	missense	29915			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1373C>T	12.37:g.104487252C>T	ENSP00000229330:p.Thr458Met	Somatic		Capture	Illumina GAIIx	4	103011382	B2R8Q5|C0H5X3	Missense_Mutation	SNP	ENST00000229330.4	37	CCDS9097.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	c	8.752	0.921577	0.17982	.	.	ENSG00000111727	ENST00000229330	T	0.01787	4.64	5.49	-4.58	0.03410	Fibronectin, type III (2);	1.368680	0.04334	N	0.352812	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.49163	-0.8968	10	0.44086	T	0.13	0.0781	8.2866	0.31932	0.0:0.2986:0.1172:0.5842	.	458	Q9Y5Z7	HCFC2_HUMAN	M	458	ENSP00000229330:T458M	ENSP00000229330:T458M	T	+	2	0	HCFC2	103011382	0.000000	0.05858	0.021000	0.16686	0.586000	0.36452	-1.103000	0.03329	-0.768000	0.04626	-0.876000	0.02978	ACG		0.338	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320		Missense_Mutation
GBF1	8729	genome.wustl.edu	37	10	104111614	104111614	+	Silent	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr10:104111614G>C	ENST00000369983.3	+	6	689	c.429G>C	c.(427-429)ctG>ctC	p.L143L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	143					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.L143L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		TACGGACTCTGCTGCTAACCC	0.468											OREG0020477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	10											172.0	144.0	153.0					10																	104111614		2203	4300	6503	104101604	SO:0001819	synonymous_variant	8729			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.429G>C	10.37:g.104111614G>C		Somatic	1379	Capture	Illumina GAIIx	4	104101604	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	37	CCDS7533.1	SNP	46	WashU																																																																																				0.468	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1			Silent
IGHG2	3501	genome.wustl.edu	37	14	106110421	106110421	+	RNA	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr14:106110421C>G	ENST00000390545.2	-	0	314							P01859	IGHG2_HUMAN	immunoglobulin heavy constant gamma 2 (G2m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										ACGGTGGGCACTCGACACAAC	0.607																																																0			14											144.0	142.0	142.0					14																	106110421		2093	4226	6319	105181466						J00230		14q32.33	2012-10-02			ENSG00000211893	ENSG00000211893		"""Immunoglobulins / IGH locus"""	5526	other	immunoglobulin gene		147110					Standard	NG_001019		Approved			P01859	OTTHUMG00000152482		14.37:g.106110421C>G		Somatic		Capture	Illumina GAIIx	4	105181466	A6NE66	Missense_Mutation	SNP	ENST00000390545.2	37		SNP	20	WashU																																																																																				0.607	IGHG2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IG_C_gene	OTTHUMT00000326391.1	NG_001019		Missense_Mutation
COL4A6	1288	genome.wustl.edu	37	X	107431887	107431887	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:107431887A>T	ENST00000372216.4	-	21	1550	c.1450T>A	c.(1450-1452)Tgt>Agt	p.C484S	COL4A6_ENST00000394872.2_Missense_Mutation_p.C484S|COL4A6_ENST00000334504.7_Missense_Mutation_p.C483S|COL4A6_ENST00000538570.1_Missense_Mutation_p.C483S|COL4A6_ENST00000545689.1_Missense_Mutation_p.C483S	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	484	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CCACCGTCACAAGCACAGAAA	0.493									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											0			X											38.0	39.0	39.0					X																	107431887		2203	4300	6503	107318543	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1450T>A	X.37:g.107431887A>T	ENSP00000361290:p.Cys484Ser	Somatic		Capture	Illumina GAIIx	4	107318543	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710854	0.30322	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13	4.12	4.12	0.48240	.	0.000000	0.41097	D	0.000958	D	0.93887	0.8044	M	0.65677	2.01	0.40942	D	0.984472	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.80764	0.994;0.994;0.987;0.994	D	0.91942	0.5564	10	0.07644	T	0.81	.	13.1131	0.59285	1.0:0.0:0.0:0.0	.	483;483;484;483	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	S	484;483;484;483;483;483	ENSP00000361290:C484S;ENSP00000334733:C483S;ENSP00000378340:C484S;ENSP00000443707:C483S;ENSP00000445236:C483S	ENSP00000334733:C483S	C	-	1	0	COL4A6	107318543	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	6.030000	0.70903	1.837000	0.53436	0.486000	0.48141	TGT		0.493	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			Missense_Mutation
DLAT	1737	genome.wustl.edu	37	11	111899569	111899569	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr11:111899569C>G	ENST00000280346.6	+	4	1219	c.560C>G	c.(559-561)cCt>cGt	p.P187R	DLAT_ENST00000537636.1_Intron|DLAT_ENST00000393051.1_Missense_Mutation_p.P187R	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase	187					cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)	p.P187R(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		TCAGCAGCACCTACCCCACAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											88.0	95.0	93.0					11																	111899569		2201	4297	6498	111404779	SO:0001583	missense	1737			Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.560C>G	11.37:g.111899569C>G	ENSP00000280346:p.Pro187Arg	Somatic		Capture	Illumina GAIIx	4	111404779	Q16783|Q53EP3	Missense_Mutation	SNP	ENST00000280346.6	37	CCDS8354.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420879	0.25639	.	.	ENSG00000150768	ENST00000280346;ENST00000534998;ENST00000393051	T;T	0.18502	2.21;2.25	5.02	5.02	0.67125	Single hybrid motif (1);	0.225652	0.46442	D	0.000300	T	0.19167	0.0460	L	0.36672	1.1	0.80722	D	1	P;B	0.46706	0.883;0.003	B;B	0.44044	0.439;0.004	T	0.00872	-1.1532	10	0.54805	T	0.06	-2.8829	16.7013	0.85349	0.0:1.0:0.0:0.0	.	187;187	E9PEJ4;P10515	.;ODP2_HUMAN	R	187;155;187	ENSP00000280346:P187R;ENSP00000376771:P187R	ENSP00000280346:P187R	P	+	2	0	DLAT	111404779	0.111000	0.22076	0.819000	0.32651	0.146000	0.21551	4.245000	0.58734	2.607000	0.88179	0.585000	0.79938	CCT		0.507	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258167.1	NM_001931		Missense_Mutation
HTR2C	3358	genome.wustl.edu	37	X	113965830	113965830	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:113965830T>A	ENST00000276198.1	+	4	891	c.163T>A	c.(163-165)Tgg>Agg	p.W55R	HTR2C_ENST00000371950.3_Missense_Mutation_p.W55R|HTR2C_ENST00000371951.1_Missense_Mutation_p.W55R	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	55					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.W55R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGTACAAAACTGGCCAGCACT	0.438																																																1	Substitution - Missense(1)	ovary(1)	X											165.0	141.0	149.0					X																	113965830		2203	4300	6503	113872086	SO:0001583	missense	3358				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.163T>A	X.37:g.113965830T>A	ENSP00000276198:p.Trp55Arg	Somatic		Capture	Illumina GAIIx	4	113872086	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	SNP	55	WashU	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174595	0.78452	.	.	ENSG00000147246	ENST00000276198;ENST00000371951;ENST00000371950	T;T;T	0.37752	2.16;2.16;1.18	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.989;0.999	T	0.33879	-0.9851	10	0.33940	T	0.23	.	12.1989	0.54313	0.0:0.0:0.0:1.0	.	55;55	B1AMW4;P28335	.;5HT2C_HUMAN	R	55	ENSP00000276198:W55R;ENSP00000361019:W55R;ENSP00000361018:W55R	ENSP00000276198:W55R	W	+	1	0	HTR2C	113872086	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	2.011000	0.59026	0.481000	0.45027	TGG		0.438	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		Missense_Mutation
PTPN4	5775	genome.wustl.edu	37	2	120567546	120567546	+	Silent	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:120567546T>A	ENST00000263708.2	+	2	888	c.117T>A	c.(115-117)acT>acA	p.T39T		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	39	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.T39T(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TGGATAACACTGTACAAGCTT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	2											134.0	122.0	126.0					2																	120567546		2203	4300	6503	120284016	SO:0001819	synonymous_variant	5775				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.117T>A	2.37:g.120567546T>A		Somatic		Capture	Illumina GAIIx	4	120284016	B2RBV8|Q9UDA7	Silent	SNP	ENST00000263708.2	37	CCDS2129.1	SNP	55	WashU																																																																																				0.373	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2			Silent
NOV	4856	genome.wustl.edu	37	8	120435162	120435162	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:120435162G>C	ENST00000259526.3	+	5	1091	c.864G>C	c.(862-864)aaG>aaC	p.K288N	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.K288N(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			ACACCTACAAGCCCAGGTTCT	0.512																																																1	Substitution - Missense(1)	ovary(1)	8											88.0	87.0	87.0					8																	120435162		2203	4300	6503	120504343	SO:0001583	missense	4856			X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.864G>C	8.37:g.120435162G>C	ENSP00000259526:p.Lys288Asn	Somatic		Capture	Illumina GAIIx	4	120504343		Missense_Mutation	SNP	ENST00000259526.3	37	CCDS6328.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192062	0.58017	.	.	ENSG00000136999	ENST00000259526	T	0.18016	2.24	5.85	4.06	0.47325	Cystine knot (1);Cystine knot, C-terminal (2);	0.045665	0.85682	D	0.000000	T	0.34629	0.0904	M	0.76328	2.33	0.44500	D	0.997446	D	0.58268	0.982	P	0.59825	0.864	T	0.07309	-1.0779	10	0.87932	D	0	-25.3212	9.0578	0.36416	0.2768:0.0:0.7232:0.0	.	288	P48745	NOV_HUMAN	N	288	ENSP00000259526:K288N	ENSP00000259526:K288N	K	+	3	2	NOV	120504343	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	1.779000	0.38624	0.812000	0.34326	0.650000	0.86243	AAG		0.512	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514		Missense_Mutation
TACC2	10579	genome.wustl.edu	37	10	123843238	123843238	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr10:123843238C>T	ENST00000369005.1	+	4	1563	c.1223C>T	c.(1222-1224)tCc>tTc	p.S408F	TACC2_ENST00000513429.1_Intron|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.S408F|TACC2_ENST00000515603.1_Missense_Mutation_p.S408F|TACC2_ENST00000453444.2_Missense_Mutation_p.S408F|TACC2_ENST00000334433.3_Missense_Mutation_p.S408F	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	408					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.S408F(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCTGAACCTTCCCTGCTCACT	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											64.0	64.0	64.0					10																	123843238		2203	4300	6503	123833228	SO:0001583	missense	10579			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1223C>T	10.37:g.123843238C>T	ENSP00000358001:p.Ser408Phe	Somatic		Capture	Illumina GAIIx	4	123833228	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986214	0.35036	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.03772	3.85;3.82;3.81;3.85;3.82	4.75	0.728	0.18260	.	0.578855	0.13233	N	0.403457	T	0.03477	0.0100	L	0.27053	0.805	0.09310	N	1	B;B;B	0.18310	0.027;0.027;0.01	B;B;B	0.13407	0.009;0.005;0.005	T	0.40869	-0.9540	10	0.87932	D	0	0.1246	3.7473	0.08552	0.0:0.5061:0.1856:0.3083	.	408;408;408	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	F	408;408;408;408;408;398	ENSP00000358001:S408F;ENSP00000424467:S408F;ENSP00000427618:S408F;ENSP00000334280:S408F;ENSP00000395048:S408F	ENSP00000334280:S408F	S	+	2	0	TACC2	123833228	0.005000	0.15991	0.001000	0.08648	0.024000	0.10985	0.273000	0.18662	0.080000	0.16959	0.561000	0.74099	TCC		0.567	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			Missense_Mutation
DHX32	55760	genome.wustl.edu	37	10	127526957	127526957	+	Splice_Site	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr10:127526957C>G	ENST00000284690.3	-	10	2372		c.e10-1		DHX32_ENST00000368721.1_Splice_Site|BCCIP_ENST00000299130.3_Intron|BCCIP_ENST00000429863.2_Intron|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000284688.6_Splice_Site	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32							mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CCCGAGCAATCTGAAAGGCAG	0.353																																																0			10											84.0	80.0	81.0					10																	127526957		2203	4300	6503	127516947	SO:0001630	splice_region_variant	55760				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1882-1G>C	10.37:g.127526957C>G		Somatic		Capture	Illumina GAIIx	4	127516947	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Splice_Site_SNP	SNP	ENST00000284690.3	37	CCDS7652.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865848	0.71949	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1793	0.86850	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DHX32	127516947	1.000000	0.71417	0.949000	0.38748	0.834000	0.47266	7.596000	0.82721	2.281000	0.76405	0.561000	0.74099	.		0.353	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180	Intron	Splice_Site_SNP
EXOC4	60412	genome.wustl.edu	37	7	132937874	132937874	+	Missense_Mutation	SNP	C	C	A	rs540463431		TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:132937874C>A	ENST00000253861.4	+	1	46	c.17C>A	c.(16-18)gCt>gAt	p.A6D	EXOC4_ENST00000539845.1_5'Flank|EXOC4_ENST00000393161.2_Missense_Mutation_p.A6D	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	6					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)	p.A6D(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GCAGAAGCAGCTGGTGGGAAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											79.0	81.0	80.0					7																	132937874		2203	4300	6503	132588414	SO:0001583	missense	60412			AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.17C>A	7.37:g.132937874C>A	ENSP00000253861:p.Ala6Asp	Somatic		Capture	Illumina GAIIx	4	132588414	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	37	CCDS5829.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032721	0.75504	.	.	ENSG00000131558	ENST00000253861;ENST00000393161	.	.	.	5.84	5.84	0.93424	.	0.134374	0.49916	D	0.000137	T	0.58906	0.2155	N	0.08118	0	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73708	0.981;0.981	T	0.62923	-0.6751	9	0.40728	T	0.16	.	17.7178	0.88342	0.0:1.0:0.0:0.0	.	6;6	Q96A65;Q8TAR2	EXOC4_HUMAN;.	D	6	.	ENSP00000253861:A6D	A	+	2	0	EXOC4	132588414	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.756000	0.47549	2.937000	0.99478	0.650000	0.86243	GCT		0.587	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807		Missense_Mutation
TG	7038	genome.wustl.edu	37	8	133920479	133920479	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:133920479A>T	ENST00000220616.4	+	18	3936	c.3896A>T	c.(3895-3897)cAg>cTg	p.Q1299L	TG_ENST00000377869.1_Missense_Mutation_p.Q1299L	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1299					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTTCAGCTCCAGCTCCCGCCG	0.577																																																0			8											60.0	56.0	57.0					8																	133920479		2203	4300	6503	133989661	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3896A>T	8.37:g.133920479A>T	ENSP00000220616:p.Gln1299Leu	Somatic		Capture	Illumina GAIIx	4	133989661	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	SNP	7	WashU	.	.	.	.	.	.	.	.	.	.	A	10.86	1.469329	0.26423	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	T;T	0.61510	0.1;0.1	5.47	-9.87	0.00470	.	1.272760	0.05313	N	0.525190	T	0.29423	0.0733	N	0.14661	0.345	0.22880	N	0.998615	B	0.02656	0.0	B	0.01281	0.0	T	0.08006	-1.0743	10	0.16420	T	0.52	.	5.8821	0.18862	0.2048:0.0:0.221:0.5742	.	1299	P01266	THYG_HUMAN	L	1299;105;1299	ENSP00000367100:Q1299L;ENSP00000220616:Q1299L	ENSP00000220616:Q1299L	Q	+	2	0	TG	133989661	0.003000	0.15002	0.854000	0.33618	0.985000	0.73830	-0.896000	0.04114	-1.586000	0.01632	0.528000	0.53228	CAG		0.577	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		Missense_Mutation
MATR3	9782	genome.wustl.edu	37	5	138643823	138643823	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr5:138643823C>G	ENST00000394805.3	+	2	1054	c.719C>G	c.(718-720)tCg>tGg	p.S240W	MATR3_ENST00000394800.2_Missense_Mutation_p.S240W|MATR3_ENST00000502499.1_Intron|MATR3_ENST00000502929.1_Missense_Mutation_p.S240W|MATR3_ENST00000504203.1_Intron|MATR3_ENST00000510056.1_Missense_Mutation_p.S240W|MATR3_ENST00000509990.1_Missense_Mutation_p.S240W|MATR3_ENST00000361059.2_Missense_Mutation_p.S240W|MATR3_ENST00000503811.1_Intron	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	240					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)	p.S240W(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GGTGAGACCTCGCATAACTAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											91.0	89.0	90.0					5																	138643823		2203	4300	6503	138671722	SO:0001583	missense	9782			M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.719C>G	5.37:g.138643823C>G	ENSP00000378284:p.Ser240Trp	Somatic		Capture	Illumina GAIIx	4	138671722	B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	37	CCDS4210.1	SNP	31	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.70|15.70	2.911710|2.911710	0.52439|0.52439	.|.	.|.	ENSG00000015479|ENSG00000015479	ENST00000515833|ENST00000509990;ENST00000361059;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000504045;ENST00000510056	.|T;T;T;T;T;T;T	.|0.80304	.|-0.95;-0.95;-0.97;-0.97;-0.95;-1.36;-0.95	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.052565	.|0.85682	.|D	.|0.000000	D|D	0.84188|0.84188	0.5417|0.5417	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.995;0.998	.|P;D;P	.|0.72625	.|0.892;0.978;0.892	D|D	0.86317|0.86317	0.1690|0.1690	5|10	.|0.87932	.|D	.|0	-2.481|-2.481	19.5239|19.5239	0.95196|0.95196	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|240;240;240	.|D6REM6;A8MXP9;P43243	.|.;.;MATR3_HUMAN	G|W	14|240	.|ENSP00000423533:S240W;ENSP00000354346:S240W;ENSP00000422319:S240W;ENSP00000378279:S240W;ENSP00000378284:S240W;ENSP00000423290:S240W;ENSP00000426743:S240W	.|ENSP00000354346:S240W	R|S	+|+	1|2	0|0	MATR3|MATR3	138671722|138671722	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.823000|6.823000	0.75282|0.75282	2.689000|2.689000	0.91719|0.91719	0.561000|0.561000	0.74099|0.74099	CGC|TCG		0.413	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834		Missense_Mutation
Unknown	0	genome.wustl.edu	37	7	0	0	+	IGR	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:0C>G								None (None upstream) : AC093627.7 (70971 downstream)																							NNNNNNNNNN	0.0																																																0			7																																								142180011	SO:0001628	intergenic_variant	5645																															7.37:g.0C>G		Somatic		Capture	Illumina GAIIx	4	142180011		Missense_Mutation	SNP		37		SNP	31	WashU																																																																																			0	0.000									Missense_Mutation
TRBV28	28559	genome.wustl.edu	37	7	142428757	142428757	+	RNA	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:142428757T>C	ENST00000390400.2	+	0	137									T cell receptor beta variable 28																		AGAAAGTTTTTCTGGAATGTG	0.438																																																0			7											47.0	47.0	47.0					7																	142428757		1843	4093	5936	142108338						U08314		7q34	2012-02-07			ENSG00000211753	ENSG00000211753		"""T cell receptors / TRB locus"""	12209	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TCRBV28S1, TCRBV3S1			OTTHUMG00000158900		7.37:g.142428757T>C		Somatic		Capture	Illumina GAIIx	4	142108338		Silent	SNP	ENST00000390400.2	37		SNP	62	WashU																																																																																				0.438	TRBV28-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000352512.1	NG_001333		Silent
HTR4	3360	genome.wustl.edu	37	5	147845468	147845468	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr5:147845468C>G	ENST00000314512.6	-	7	1260	c.1097G>C	c.(1096-1098)aGc>aCc	p.S366T	HTR4_ENST00000354217.2_Intron|HTR4_ENST00000521735.1_Missense_Mutation_p.S366T|HTR4_ENST00000521530.1_Intron	NM_199453.3	NP_955525.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	0					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	CAGGAGGAAGCTGGAGACAGG	0.438																																					GBM(120;370 1604 14007 17804 41573)											0			5											148.0	162.0	157.0					5																	147845468		2203	4300	6503	147825661	SO:0001583	missense	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000314512.6:c.1097G>C	5.37:g.147845468C>G	ENSP00000314906:p.Ser366Thr	Somatic		Capture	Illumina GAIIx	4	147825661	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000314512.6	37	CCDS34271.1	SNP	28	WashU	.	.	.	.	.	.	.	.	.	.	C	11.11	1.543509	0.27563	.	.	ENSG00000164270	ENST00000314512;ENST00000521735	T;T	0.70869	-0.52;-0.52	5.28	2.36	0.29203	.	.	.	.	.	T	0.49813	0.1579	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37244	-0.9714	8	0.22109	T	0.4	.	4.003	0.09588	0.0:0.515:0.1964:0.2886	.	366	Q684M0	.	T	366	ENSP00000314906:S366T;ENSP00000430979:S366T	ENSP00000314906:S366T	S	-	2	0	HTR4	147825661	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.581000	0.46077	1.220000	0.43490	-0.251000	0.11542	AGC		0.438	HTR4-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374235.1	NM_000870		Missense_Mutation
PIP5K1A	8394	genome.wustl.edu	37	1	151205165	151205165	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:151205165C>G	ENST00000368888.4	+	7	1047	c.625C>G	c.(625-627)Cca>Gca	p.P209A	PIP5K1A_ENST00000409426.1_Missense_Mutation_p.P197A|PIP5K1A_ENST00000414290.2_5'Flank|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.P196A|PIP5K1A_ENST00000441902.2_Missense_Mutation_p.P197A	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	209	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)	p.P196A(1)		breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			GAAGCTGCTTCCAGGATACTA	0.498																																					Pancreas(80;36 1443 2325 16095 21302)											1	Substitution - Missense(1)	ovary(1)	1											80.0	76.0	78.0					1																	151205165		2203	4300	6503	149471789	SO:0001583	missense	8394			U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.625C>G	1.37:g.151205165C>G	ENSP00000357883:p.Pro209Ala	Somatic		Capture	Illumina GAIIx	4	149471789	A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	CCDS44219.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876140	0.91664	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11	5.22	5.22	0.72569	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	M	0.91406	3.205	0.80722	D	1	P;D;P;D	0.57899	0.94;0.981;0.736;0.981	D;P;P;P	0.64237	0.923;0.742;0.588;0.846	T	0.73448	-0.3979	10	0.62326	D	0.03	.	18.6216	0.91323	0.0:1.0:0.0:0.0	.	197;196;209;196	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	A	196;197;197;196;209	ENSP00000271663:P196A;ENSP00000386432:P197A;ENSP00000415648:P197A;ENSP00000357885:P196A;ENSP00000357883:P209A	ENSP00000271663:P196A	P	+	1	0	PIP5K1A	149471789	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.606000	0.82863	2.741000	0.93983	0.479000	0.44913	CCA		0.498	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557		Missense_Mutation
CGN	57530	genome.wustl.edu	37	1	151509308	151509308	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:151509308G>A	ENST00000271636.7	+	20	3542	c.3409G>A	c.(3409-3411)Gag>Aag	p.E1137K		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1131					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)	p.E1137K(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGAGGTGGAGGAGCAGCATGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											143.0	147.0	146.0					1																	151509308		2203	4300	6503	149775932	SO:0001583	missense	57530			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3409G>A	1.37:g.151509308G>A	ENSP00000271636:p.Glu1137Lys	Somatic		Capture	Illumina GAIIx	4	149775932	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	ENST00000271636.7	37	CCDS999.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	35	5.583267	0.96578	.	.	ENSG00000143375	ENST00000271636	T	0.80566	-1.39	5.41	5.41	0.78517	Myosin tail (1);	0.099528	0.64402	D	0.000002	D	0.89739	0.6802	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91056	0.4882	10	0.87932	D	0	-26.8742	17.7652	0.88475	0.0:0.0:1.0:0.0	.	1131	Q9P2M7	CING_HUMAN	K	1137	ENSP00000271636:E1137K	ENSP00000271636:E1137K	E	+	1	0	CGN	149775932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.654000	0.98509	2.541000	0.85698	0.655000	0.94253	GAG		0.562	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770		Missense_Mutation
PASD1	139135	genome.wustl.edu	37	X	150842517	150842517	+	Silent	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:150842517A>T	ENST00000370357.4	+	15	2279	c.2034A>T	c.(2032-2034)tcA>tcT	p.S678S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	678						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.S678S(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCAGACTCAACCATAAGCA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	X											128.0	115.0	119.0					X																	150842517		2203	4300	6503	150593173	SO:0001819	synonymous_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.2034A>T	X.37:g.150842517A>T		Somatic		Capture	Illumina GAIIx	4	150593173	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	ENST00000370357.4	37	CCDS35431.1	SNP	5	WashU																																																																																				0.498	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		Silent
FLG2	388698	genome.wustl.edu	37	1	152327876	152327876	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:152327876G>T	ENST00000388718.5	-	3	2458	c.2386C>A	c.(2386-2388)Caa>Aaa	p.Q796K	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	796	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q796K(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCATGTTGTCCAAAGCCA	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											220.0	205.0	210.0					1																	152327876		2203	4297	6500	150594500	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2386C>A	1.37:g.152327876G>T	ENSP00000373370:p.Gln796Lys	Somatic		Capture	Illumina GAIIx	4	150594500	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	2.814	-0.246340	0.05867	.	.	ENSG00000143520	ENST00000388718	T	0.04758	3.56	3.53	2.59	0.31030	.	.	.	.	.	T	0.01489	0.0048	M	0.61703	1.905	0.09310	N	1	P	0.34724	0.465	B	0.30646	0.118	T	0.41805	-0.9488	9	0.06757	T	0.87	-6.4447	9.7553	0.40500	0.0:0.41:0.59:0.0	.	796	Q5D862	FILA2_HUMAN	K	796	ENSP00000373370:Q796K	ENSP00000373370:Q796K	Q	-	1	0	FLG2	150594500	0.001000	0.12720	0.002000	0.10522	0.250000	0.25880	0.560000	0.23500	0.670000	0.31165	0.400000	0.26472	CAA		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Missense_Mutation
P2RY13	53829	genome.wustl.edu	37	3	151046191	151046191	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr3:151046191C>A	ENST00000325602.5	-	2	672	c.653G>T	c.(652-654)tGg>tTg	p.W218L	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	218					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.W197L(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			AAAAACAGTCCAGAAAATAAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	3											63.0	68.0	66.0					3																	151046191		2203	4300	6503	152528881	SO:0001583	missense	53829			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.653G>T	3.37:g.151046191C>A	ENSP00000320376:p.Trp218Leu	Somatic		Capture	Illumina GAIIx	4	152528881	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	ENST00000325602.5	37	CCDS3158.2	SNP	21	WashU	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805143	0.70682	.	.	ENSG00000181631	ENST00000325602	T	0.30448	1.53	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.115379	0.64402	D	0.000005	T	0.50667	0.1629	M	0.63843	1.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.38972	-0.9636	10	0.06494	T	0.89	-9.4136	19.7783	0.96405	0.0:1.0:0.0:0.0	.	218	Q9BPV8	P2Y13_HUMAN	L	218	ENSP00000320376:W218L	ENSP00000320376:W218L	W	-	2	0	P2RY13	152528881	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	5.717000	0.68446	2.673000	0.90976	0.558000	0.71614	TGG		0.353	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341468.1	NM_023914		Missense_Mutation
P2RY13	53829	genome.wustl.edu	37	3	151046196	151046196	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr3:151046196A>C	ENST00000325602.5	-	2	667	c.648T>G	c.(646-648)atT>atG	p.I216M	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	216					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.I195M(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			CAGTCCAGAAAATAAACTGGC	0.358																																																1	Substitution - Missense(1)	ovary(1)	3											62.0	67.0	65.0					3																	151046196		2203	4300	6503	152528886	SO:0001583	missense	53829			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.648T>G	3.37:g.151046196A>C	ENSP00000320376:p.Ile216Met	Somatic		Capture	Illumina GAIIx	4	152528886	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	ENST00000325602.5	37	CCDS3158.2	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141912	0.57044	.	.	ENSG00000181631	ENST00000325602	T	0.72835	-0.69	5.64	-0.413	0.12363	GPCR, rhodopsin-like superfamily (1);	0.168065	0.52532	D	0.000079	T	0.74703	0.3751	L	0.58969	1.84	0.37738	D	0.925501	D	0.61080	0.989	D	0.71414	0.973	T	0.72184	-0.4367	10	0.45353	T	0.12	-17.9008	6.2401	0.20785	0.3171:0.0:0.5344:0.1485	.	216	Q9BPV8	P2Y13_HUMAN	M	216	ENSP00000320376:I216M	ENSP00000320376:I216M	I	-	3	3	P2RY13	152528886	0.074000	0.21230	0.968000	0.41197	0.958000	0.62258	-0.034000	0.12225	0.112000	0.17975	0.456000	0.33151	ATT		0.358	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341468.1	NM_023914		Missense_Mutation
MYCT1	80177	genome.wustl.edu	37	6	153042883	153042883	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:153042883T>A	ENST00000367245.5	+	2	211	c.203T>A	c.(202-204)cTt>cAt	p.L68H	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	68						nucleus (GO:0005634)		p.L68H(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TCAGAGGACCTTATCATGTCC	0.368																																																1	Substitution - Missense(1)	ovary(1)	6											120.0	109.0	113.0					6																	153042883		2203	4300	6503	153084576	SO:0001583	missense	80177			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.203T>A	6.37:g.153042883T>A	ENSP00000356214:p.Leu68His	Somatic		Capture	Illumina GAIIx	4	153084576	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	CCDS5239.1	SNP	56	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.410072|4.410072	0.83340|0.83340	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000367245|ENST00000532295	T|T	0.39229|0.35236	1.09|1.32	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.452713|0.452713	0.23898|0.23898	N|N	0.043469|0.043469	T|T	0.31040|0.31040	0.0784|0.0784	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.994|.	D;P|.	0.63192|.	0.912;0.874|.	T|T	0.03587|0.03587	-1.1022|-1.1022	10|8	0.87932|0.26408	D|T	0|0.33	-7.6957|-7.6957	16.2628|16.2628	0.82557|0.82557	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	20;68|.	D6Q1S4;Q8N699|.	.;MYCT1_HUMAN|.	H|I	68|49	ENSP00000356214:L68H|ENSP00000434396:L49I	ENSP00000356214:L68H|ENSP00000434396:L49I	L|L	+|+	2|1	0|2	MYCT1|MYCT1	153084576|153084576	0.645000|0.645000	0.27286|0.27286	0.478000|0.478000	0.27316|0.27316	0.979000|0.979000	0.70002|0.70002	4.887000|4.887000	0.63156|0.63156	2.236000|2.236000	0.73375|0.73375	0.519000|0.519000	0.50382|0.50382	CTT|TTA		0.368	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107		Missense_Mutation
ADAM19	8728	genome.wustl.edu	37	5	156918668	156918668	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr5:156918668G>A	ENST00000517905.1	-	18	2094	c.2050C>T	c.(2050-2052)Ccg>Tcg	p.P684S	ADAM19_ENST00000257527.4_Missense_Mutation_p.P684S|ADAM19_ENST00000430702.2_Missense_Mutation_p.P417S|ADAM19_ENST00000394020.1_Missense_Mutation_p.P686S			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	684					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P685S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCGTGGCCCGGTGTGTTGCAG	0.637																																																1	Substitution - Missense(1)	ovary(1)	5											22.0	24.0	24.0					5																	156918668		2203	4299	6502	156851246	SO:0001583	missense	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.2050C>T	5.37:g.156918668G>A	ENSP00000428654:p.Pro684Ser	Somatic		Capture	Illumina GAIIx	4	156851246	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		SNP	44	WashU	.	.	.	.	.	.	.	.	.	.	G	6.351	0.432893	0.12045	.	.	ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	4.93	3.06	0.35304	.	0.624961	0.14949	N	0.289033	T	0.66167	0.2762	L	0.35793	1.09	0.09310	N	1	B;B;B	0.14438	0.01;0.003;0.001	B;B;B	0.17433	0.018;0.002;0.001	T	0.47711	-0.9096	10	0.17832	T	0.49	.	3.4908	0.07637	0.1749:0.1951:0.5205:0.1095	.	684;684;417	Q9H013-2;Q9H013;E9PD32	.;ADA19_HUMAN;.	S	417;684;686;684	ENSP00000414088:P417S;ENSP00000257527:P684S;ENSP00000377588:P686S;ENSP00000428654:P684S	ENSP00000257527:P684S	P	-	1	0	ADAM19	156851246	0.000000	0.05858	0.019000	0.16419	0.558000	0.35554	0.110000	0.15437	1.058000	0.40530	0.563000	0.77884	CCG		0.637	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1	NM_033274		Missense_Mutation
ITLN1	55600	genome.wustl.edu	37	1	160850971	160850971	+	Silent	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:160850971C>A	ENST00000326245.3	-	5	652	c.537G>T	c.(535-537)ctG>ctT	p.L179L	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	179	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)	p.L179L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GATTATGTCCCAGTGTCTGGA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	1											155.0	135.0	142.0					1																	160850971		2203	4300	6503	159117595	SO:0001819	synonymous_variant	55600			AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.537G>T	1.37:g.160850971C>A		Somatic		Capture	Illumina GAIIx	4	159117595	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Silent	SNP	ENST00000326245.3	37	CCDS1211.1	SNP	21	WashU																																																																																				0.557	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625		Silent
LPA	4018	genome.wustl.edu	37	6	160968890	160968890	+	Silent	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:160968890A>T	ENST00000316300.5	-	32	5279	c.5235T>A	c.(5233-5235)gcT>gcA	p.A1745A	LPA_ENST00000447678.1_Silent_p.A1745A			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4253	Kringle 16. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GCTCCTGGGCAGCCCATTCCT	0.463																																																0			6											94.0	102.0	99.0					6																	160968890		2202	4300	6502	160888880	SO:0001819	synonymous_variant	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5235T>A	6.37:g.160968890A>T		Somatic		Capture	Illumina GAIIx	4	160888880	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	37	CCDS43523.1	SNP	7	WashU																																																																																				0.463	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577		Silent
DDR2	4921	genome.wustl.edu	37	1	162722919	162722919	+	Silent	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:162722919C>T	ENST00000367922.3	+	5	555	c.117C>T	c.(115-117)ggC>ggT	p.G39G	DDR2_ENST00000367921.3_Silent_p.G39G	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	39	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G39G(1)		central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TGTCAGGAGGCCAGATTCCAG	0.468																																					NSCLC(161;314 2006 8283 19651 23192)											1	Substitution - coding silent(1)	ovary(1)	1											113.0	104.0	107.0					1																	162722919		2203	4300	6503	160989543	SO:0001819	synonymous_variant	4921			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.117C>T	1.37:g.162722919C>T		Somatic		Capture	Illumina GAIIx	4	160989543	Q7Z730	Silent	SNP	ENST00000367922.3	37	CCDS1241.1	SNP	26	WashU																																																																																				0.468	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182		Silent
TADA1	117143	genome.wustl.edu	37	1	166831529	166831529	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:166831529G>C	ENST00000367874.4	-	5	544	c.451C>G	c.(451-453)Ctt>Gtt	p.L151V	TADA1_ENST00000467021.1_5'UTR	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	151					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.L151V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						CTCCCTTCAAGCTGGCCTCGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											172.0	143.0	153.0					1																	166831529		2203	4300	6503	165098153	SO:0001583	missense	117143			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.451C>G	1.37:g.166831529G>C	ENSP00000356848:p.Leu151Val	Somatic		Capture	Illumina GAIIx	4	165098153	A8K4J9	Missense_Mutation	SNP	ENST00000367874.4	37	CCDS1255.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816843	0.50633	.	.	ENSG00000152382	ENST00000367874	T	0.51574	0.7	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.32882	0.0844	N	0.14661	0.345	0.44030	D	0.996755	P	0.52316	0.952	P	0.56788	0.806	T	0.25847	-1.0120	9	0.41790	T	0.15	-7.5248	11.344	0.49550	0.0821:0.0:0.9179:0.0	.	151	Q96BN2	TADA1_HUMAN	V	151	ENSP00000356848:L151V	ENSP00000356848:L151V	L	-	1	0	TADA1	165098153	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.110000	0.64622	2.937000	0.99478	0.650000	0.86243	CTT		0.502	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082881.1	NM_053053		Missense_Mutation
SLITRK3	22865	genome.wustl.edu	37	3	164908337	164908337	+	Silent	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr3:164908337G>T	ENST00000475390.1	-	2	725	c.282C>A	c.(280-282)acC>acA	p.T94T	SLITRK3_ENST00000241274.3_Silent_p.T94T			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	94					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.T94T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GAAAACTGTTGGTATATAATT	0.343										HNSCC(40;0.11)																																						1	Substitution - coding silent(1)	ovary(1)	3											53.0	57.0	56.0					3																	164908337		2203	4299	6502	166391031	SO:0001819	synonymous_variant	22865			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.282C>A	3.37:g.164908337G>T		Somatic		Capture	Illumina GAIIx	4	166391031	Q1RMY6	Silent	SNP	ENST00000475390.1	37	CCDS3197.1	SNP	47	WashU																																																																																				0.343	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		Silent
F5	2153	genome.wustl.edu	37	1	169483640	169483640	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:169483640T>A	ENST00000367797.3	-	25	6787	c.6586A>T	c.(6586-6588)Atc>Ttc	p.I2196F	F5_ENST00000367796.3_Missense_Mutation_p.I2201F	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2196	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.I2196F(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CTGGAAATGATTGGGGGGTTG	0.343																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	79.0	78.0					1																	169483640		2203	4300	6503	167750264	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6586A>T	1.37:g.169483640T>A	ENSP00000356771:p.Ile2196Phe	Somatic		Capture	Illumina GAIIx	4	167750264	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572850	0.86542	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98666	-5.06;-5.06	5.09	5.09	0.68999	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98592	0.9529	L	0.60845	1.875	0.49582	D	0.999805	D	0.89917	1.0	D	0.97110	1.0	D	0.99898	1.1153	9	0.66056	D	0.02	-17.118	14.5117	0.67791	0.0:0.0:0.0:1.0	.	2196	P12259	FA5_HUMAN	F	2196;2201	ENSP00000356771:I2196F;ENSP00000356770:I2201F	ENSP00000356770:I2201F	I	-	1	0	F5	167750264	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.640000	0.74319	1.909000	0.55274	0.482000	0.46254	ATC		0.343	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130		Missense_Mutation
LRP2	4036	genome.wustl.edu	37	2	170032937	170032937	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:170032937A>C	ENST00000263816.3	-	54	10840	c.10555T>G	c.(10555-10557)Tgc>Ggc	p.C3519G	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3519	LDL-receptor class A 26. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.C3519G(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTGTTAGCGCACAGGAACTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											128.0	102.0	111.0					2																	170032937		2203	4300	6503	169741183	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10555T>G	2.37:g.170032937A>C	ENSP00000263816:p.Cys3519Gly	Somatic		Capture	Illumina GAIIx	4	169741183	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	17.06	3.293481	0.60086	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.99919	-8.0	5.96	5.96	0.96718	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	H	0.98901	4.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96109	0.9075	10	0.72032	D	0.01	.	16.422	0.83766	1.0:0.0:0.0:0.0	.	3519	P98164	LRP2_HUMAN	G	3519;214	ENSP00000263816:C3519G	ENSP00000263816:C3519G	C	-	1	0	LRP2	169741183	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	9.335000	0.96500	2.270000	0.75569	0.533000	0.62120	TGC		0.542	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
LRP2	4036	genome.wustl.edu	37	2	170072840	170072840	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:170072840T>A	ENST00000263816.3	-	35	6034	c.5749A>T	c.(5749-5751)Aac>Tac	p.N1917Y		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1917					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGTTCGAGGTTCCCAGTAAAG	0.502																																																0			2											147.0	132.0	138.0					2																	170072840		2203	4300	6503	169781086	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5749A>T	2.37:g.170072840T>A	ENSP00000263816:p.Asn1917Tyr	Somatic		Capture	Illumina GAIIx	4	169781086	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	SNP	62	WashU	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023474	0.54683	.	.	ENSG00000081479	ENST00000263816	D	0.96802	-4.13	5.49	4.23	0.50019	Six-bladed beta-propeller, TolB-like (1);	0.236800	0.49305	D	0.000154	D	0.97971	0.9332	M	0.89968	3.075	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	D	0.97609	1.0128	10	0.72032	D	0.01	.	9.4861	0.38931	0.0:0.1025:0.0:0.8975	.	1917	P98164	LRP2_HUMAN	Y	1917	ENSP00000263816:N1917Y	ENSP00000263816:N1917Y	N	-	1	0	LRP2	169781086	1.000000	0.71417	0.700000	0.30305	0.169000	0.22640	2.846000	0.48262	0.790000	0.33803	0.533000	0.62120	AAC		0.502	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525		Missense_Mutation
RUFY1	80230	genome.wustl.edu	37	5	179020599	179020599	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr5:179020599C>G	ENST00000319449.4	+	11	1378	c.1366C>G	c.(1366-1368)Ctg>Gtg	p.L456V	RUFY1_ENST00000393438.2_Missense_Mutation_p.L348V|RP11-1379J22.2_ENST00000500262.1_RNA|RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Missense_Mutation_p.L348V	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	456					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L348V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGCCAGCAGCTGGAAGAAGT	0.473										HNSCC(44;0.11)																																						1	Substitution - Missense(1)	ovary(1)	5											101.0	105.0	104.0					5																	179020599		2203	4300	6503	178953205	SO:0001583	missense	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1366C>G	5.37:g.179020599C>G	ENSP00000325594:p.Leu456Val	Somatic		Capture	Illumina GAIIx	4	178953205	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	SNP	28	WashU	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	7.522|7.522|7.522	0.656867|0.656867|0.656867	0.14580|0.14580|0.14580	.|.|.	.|.|.	ENSG00000176783|ENSG00000176783|ENSG00000176783	ENST00000502434|ENST00000319449;ENST00000437570;ENST00000393438;ENST00000360569|ENST00000508609	.|T;T;T|.	.|0.60672|.	.|0.17;0.27;0.27|.	5.12|5.12|5.12	3.21|3.21|3.21	0.36854|0.36854|0.36854	.|.|.	.|0.069068|.	.|0.64402|.	.|D|.	.|0.000015|.	T|T|T	0.59238|0.59238|0.59238	0.2179|0.2179|0.2179	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P|.	.|0.35959|.	.|0.53|.	.|B|.	.|0.36418|.	.|0.224|.	T|T|T	0.57254|0.57254|0.57254	-0.7843|-0.7843|-0.7843	5|10|5	.|0.66056|.	.|D|.	.|0.02|.	-12.4356|-12.4356|-12.4356	5.4481|5.4481|5.4481	0.16548|0.16548|0.16548	0.0:0.6015:0.1541:0.2444|0.0:0.6015:0.1541:0.2444|0.0:0.6015:0.1541:0.2444	.|.|.	.|456|.	.|Q96T51|.	.|RUFY1_HUMAN|.	G|V|R	133|456;348;348;58|244	.|ENSP00000325594:L456V;ENSP00000390025:L348V;ENSP00000377087:L348V|.	.|ENSP00000325594:L456V|.	A|L|S	+|+|+	2|1|3	0|2|2	RUFY1|RUFY1|RUFY1	178953205|178953205|178953205	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.022000|0.022000|0.022000	0.10575|0.10575|0.10575	2.963000|2.963000|2.963000	0.49184|0.49184|0.49184	1.286000|1.286000|1.286000	0.44565|0.44565|0.44565	-0.291000|-0.291000|-0.291000	0.09656|0.09656|0.09656	GCT|CTG|AGC		0.473	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179464487	179464487	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:179464487G>A	ENST00000591111.1	-	239	51442	c.51218C>T	c.(51217-51219)cCg>cTg	p.P17073L	TTN_ENST00000460472.2_Missense_Mutation_p.P9649L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P18714L|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P16146L|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P9774L|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P9841L|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17073	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P16144L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTAGTGTCGGGAATGGCAC	0.408																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	111.0	114.0					2																	179464487		1867	4104	5971	179172732	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51218C>T	2.37:g.179464487G>A	ENSP00000465570:p.Pro17073Leu	Somatic		Capture	Illumina GAIIx	4	179172732	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805555	0.50315	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.6	5.6	0.85130	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90817	0.7116	H	0.98048	4.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.93846	0.7141	9	0.87932	D	0	.	19.6238	0.95670	0.0:0.0:1.0:0.0	.	9649;9774;9841;17073	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	16146;9649;9841;9774;9647	ENSP00000343764:P16146L;ENSP00000434586:P9649L;ENSP00000340554:P9841L;ENSP00000352154:P9774L	ENSP00000340554:P9841L	P	-	2	0	TTN	179172732	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.793000	0.99091	2.642000	0.89623	0.557000	0.71058	CCG		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
CAMSAP2	23271	genome.wustl.edu	37	1	200801451	200801451	+	Missense_Mutation	SNP	G	G	C	rs200485917		TCGA-13-0920-01	TCGA-13-0920-10	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:200801451G>C	ENST00000236925.4	+	6	851	c.802G>C	c.(802-804)Gat>Cat	p.D268H	CAMSAP2_ENST00000358823.2_Missense_Mutation_p.D257H|CAMSAP2_ENST00000413307.2_Missense_Mutation_p.D257H			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	268	CH.				microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TTACTGTCCTGATGTTGTCAG	0.383																																																0			1											196.0	170.0	179.0					1																	200801451		2203	4300	6503	199068074	SO:0001583	missense	23271			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.802G>C	1.37:g.200801451G>C	ENSP00000236925:p.Asp268His	Somatic		Capture	Illumina GAIIx	4	199068074	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	ENST00000236925.4	37		SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	13.91	2.379345	0.42207	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	D;D;D	0.95482	-3.72;-3.72;-3.72	5.19	4.27	0.50696	Calponin homology domain (2);	0.691280	0.15544	N	0.256782	D	0.94398	0.8198	L	0.38175	1.15	0.30724	N	0.747897	B;B;B	0.31931	0.25;0.347;0.25	B;B;B	0.43783	0.323;0.431;0.24	D	0.93518	0.6859	10	0.59425	D	0.04	-4.0677	14.1386	0.65303	0.073:0.0:0.927:0.0	.	257;268;257	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	H	257;257;268	ENSP00000351684:D257H;ENSP00000416800:D257H;ENSP00000236925:D268H	ENSP00000236925:D268H	D	+	1	0	CAMSAP1L1	199068074	1.000000	0.71417	0.968000	0.41197	0.967000	0.64934	3.653000	0.54446	1.394000	0.46624	0.591000	0.81541	GAT		0.383	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459		Missense_Mutation
CR1	1378	genome.wustl.edu	37	1	207741239	207741239	+	Silent	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:207741239C>A	ENST00000367049.4	+	25	4023	c.4023C>A	c.(4021-4023)ccC>ccA	p.P1341P	CR1_ENST00000367051.1_Silent_p.P891P|CR1_ENST00000400960.2_Silent_p.P891P|CR1_ENST00000367052.1_Intron|CR1_ENST00000367053.1_Silent_p.P891P|RP11-78B10.2_ENST00000597497.1_RNA|RP11-78B10.2_ENST00000596003.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	891	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.P896P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AAGTCTTTCCCTTTGGAAAAG	0.468																																																1	Substitution - coding silent(1)	ovary(1)	1											145.0	162.0	157.0					1																	207741239		1809	4100	5909	205807862	SO:0001819	synonymous_variant	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4023C>A	1.37:g.207741239C>A		Somatic		Capture	Illumina GAIIx	4	205807862	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	CCDS44308.1	SNP	24	WashU																																																																																				0.468	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		Silent
USH2A	7399	genome.wustl.edu	37	1	215963506	215963506	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:215963506A>T	ENST00000307340.3	-	51	10463	c.10077T>A	c.(10075-10077)tgT>tgA	p.C3359*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.C3359*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3359					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.C3359*(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTCAGTCTCACAGCATTTTA	0.383										HNSCC(13;0.011)																																						1	Substitution - Nonsense(1)	ovary(1)	1											133.0	127.0	129.0					1																	215963506		2203	4300	6503	214030129	SO:0001587	stop_gained	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10077T>A	1.37:g.215963506A>T	ENSP00000305941:p.Cys3359*	Somatic		Capture	Illumina GAIIx	4	214030129	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	6	WashU	.	.	.	.	.	.	.	.	.	.	A	53	20.892516	0.99935	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.76	-0.664	0.11406	.	0.000000	0.49305	D	0.000150	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4051	0.16316	0.5412:0.2531:0.2057:0.0	.	.	.	.	X	3359	.	ENSP00000305941:C3359X	C	-	3	2	USH2A	214030129	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	1.344000	0.33941	-0.126000	0.11682	0.533000	0.62120	TGT		0.383	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Nonsense_Mutation
SP100	6672	genome.wustl.edu	37	2	231406646	231406646	+	Silent	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:231406646T>C	ENST00000340126.4	+	28	2474	c.2443T>C	c.(2443-2445)Tta>Cta	p.L815L	AC010149.4_ENST00000414539.1_RNA|AC010149.4_ENST00000455357.1_RNA	NM_001080391.1	NP_001073860.1	P23497	SP100_HUMAN	SP100 nuclear antigen	0					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.L815L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GCCCATGTGGTTAAACAAAGT	0.453																																																1	Substitution - coding silent(1)	ovary(1)	2											102.0	99.0	100.0					2																	231406646		1906	4122	6028	231114890	SO:0001819	synonymous_variant	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000340126.4:c.2443T>C	2.37:g.231406646T>C		Somatic		Capture	Illumina GAIIx	4	231114890	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Silent	SNP	ENST00000340126.4	37	CCDS42832.1	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	t	3.814	-0.039103	0.07497	.	.	ENSG00000067066	ENST00000431952	.	.	.	4.13	1.7	0.24286	.	.	.	.	.	T	0.51991	0.1707	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39563	-0.9608	4	.	.	.	.	5.4148	0.16368	0.0:0.2479:0.0:0.7521	.	.	.	.	A	188	.	.	V	+	2	0	SP100	231114890	0.261000	0.24063	0.978000	0.43139	0.340000	0.28889	-0.095000	0.11077	0.375000	0.24679	0.533000	0.62120	GTT		0.453	SP100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332246.1	NM_003113		Silent
HMGCS2	3158	genome.wustl.edu	37	1	120295937	120295937	+	Silent	SNP	G	G	A	rs15609		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:120295937G>A	ENST00000369406.3	-	7	1309	c.1260C>T	c.(1258-1260)ttC>ttT	p.F420F	HMGCS2_ENST00000476640.1_5'Flank|HMGCS2_ENST00000544913.2_Silent_p.F378F	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	420					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)	p.F420F(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		GAAATGAAAAGAAACTTGCTG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	1											69.0	67.0	68.0					1																	120295937		2203	4300	6503	120097460	SO:0001819	synonymous_variant	3158			BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1260C>T	1.37:g.120295937G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	120097460	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Silent	SNP	ENST00000369406.3	37	CCDS905.1	SNP	33	WashU																																																																																				0.463	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518		Silent
L3HYPDH	112849	genome.wustl.edu	37	14	59945959	59945959	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr14:59945959C>G	ENST00000247194.4	-	2	732	c.619G>C	c.(619-621)Gca>Cca	p.A207P	L3HYPDH_ENST00000487285.1_Missense_Mutation_p.A36P|RP11-701B16.2_ENST00000554253.1_RNA	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	207					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)	p.A207P(1)								L-Proline(DB00172)	CTGGTCTTTGCAGAACAAATG	0.463																																																1	Substitution - Missense(1)	ovary(1)	14											125.0	114.0	118.0					14																	59945959		2203	4300	6503	59015712	SO:0001583	missense	112849			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.619G>C	14.37:g.59945959C>G	ENSP00000247194:p.Ala207Pro	Somatic		Capture	Illumina GAIIx	PhaseIII	59015712	Q96LJ5	Missense_Mutation	SNP	ENST00000247194.4	37	CCDS9739.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704898	0.68615	.	.	ENSG00000126790	ENST00000247194;ENST00000487285;ENST00000481608	T;T;T	0.19394	2.15;2.15;2.15	5.56	2.4	0.29515	.	0.108906	0.64402	D	0.000004	T	0.20700	0.0498	M	0.67700	2.07	0.39172	D	0.962606	B	0.14805	0.011	B	0.19391	0.025	T	0.05500	-1.0881	10	0.33141	T	0.24	.	7.4934	0.27475	0.5413:0.3717:0.0:0.087	.	207	Q96EM0	PRCM_HUMAN	P	207;36;36	ENSP00000247194:A207P;ENSP00000431608:A36P;ENSP00000423874:A36P	ENSP00000247194:A207P	A	-	1	0	C14orf149	59015712	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	3.473000	0.53122	0.681000	0.31386	0.467000	0.42956	GCA		0.463	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581		Missense_Mutation
NRXN3	9369	genome.wustl.edu	37	14	78709496	78709496	+	IGR	SNP	C	C	G			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr14:78709496C>G								RNA5SP388 (65232 upstream) : RP11-332E19.2 (36418 downstream)																							TGCTGGGGTCCCTGCTGGGGC	0.637																																																0			14											6.0	6.0	6.0					14																	78709496		868	1969	2837	77779249	SO:0001628	intergenic_variant	9369																															14.37:g.78709496C>G		Somatic		Capture	Illumina GAIIx	4	77779249		Silent	SNP		37		SNP	22	WashU																																																																																			0	0.637									Silent
CYP11A1	1583	genome.wustl.edu	37	15	74627439	74627439	+	IGR	SNP	C	C	A			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr15:74627439C>A	ENST00000268053.6	-	0	1934				CCDC33_ENST00000558821.1_Missense_Mutation_p.P310T|CCDC33_ENST00000398814.3_Intron|CCDC33_ENST00000268082.4_Missense_Mutation_p.P344T|CCDC33_ENST00000321288.5_Intron	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1						biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.?(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	TGTGAGTGACCCCCCTGGAGT	0.587																																					Esophageal Squamous(87;818 1337 4093 9268 37314)											1	Unknown(1)	ovary(1)	15											97.0	105.0	103.0					15																	74627439		1898	4130	6028	72414492	SO:0001628	intergenic_variant	80125			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716		15.37:g.74627439C>A		Somatic		Capture	Illumina GAIIx	PhaseIII	72414492	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	ENST00000268053.6	37	CCDS32291.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341530	0.41498	.	.	ENSG00000140481	ENST00000321374;ENST00000268082	T;T	0.23754	1.9;1.89	5.07	0.69	0.18039	.	.	.	.	.	T	0.13030	0.0316	.	.	.	0.09310	N	1	B;B	0.32829	0.386;0.386	B;B	0.31101	0.124;0.124	T	0.23940	-1.0174	7	.	.	.	.	3.384	0.07265	0.1586:0.3722:0.373:0.0962	.	310;344	Q8N5R6-4;Q8N5R6-5	.;.	T	310;344	ENSP00000325661:P310T;ENSP00000268082:P344T	.	P	+	1	0	CCDC33	72414492	0.000000	0.05858	0.035000	0.18076	0.126000	0.20510	0.033000	0.13754	0.151000	0.19162	0.478000	0.44815	CCC		0.587	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1			Missense_Mutation
NMS	129521	genome.wustl.edu	37	2	101096958	101096958	+	Splice_Site	SNP	G	G	T	rs202227228		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:101096958G>T	ENST00000376865.1	+	7	344	c.337G>T	c.(337-339)Ggc>Tgc	p.G113C		NM_001011717.1	NP_001011717.1	Q5H8A3	NMS_HUMAN	neuromedin S	113					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.G113C(1)		breast(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)	14						TTCCTTGCAGGGCTCGGGGAC	0.537																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	116.0	118.0					2																	101096958		2203	4300	6503	100463390	SO:0001630	splice_region_variant	129521			AB164464	CCDS33259.1	2q11.2	2013-02-26			ENSG00000204640	ENSG00000204640		"""Endogenous ligands"""	32203	protein-coding gene	gene with protein product	"""prepro-NMS"""					15635449	Standard	NM_001011717		Approved		uc002tan.1	Q5H8A3	OTTHUMG00000153142	ENST00000376865.1:c.337-1G>T	2.37:g.101096958G>T		Somatic		Capture	Illumina GAIIx	PhaseIII	100463390		Missense_Mutation	SNP	ENST00000376865.1	37	CCDS33259.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	10.94	1.491886	0.26774	.	.	ENSG00000204640	ENST00000376865	T	0.23147	1.92	3.65	2.77	0.32553	.	0.315558	0.25511	N	0.030167	T	0.14056	0.0340	N	0.22421	0.69	0.09310	N	1	D	0.54047	0.964	B	0.40602	0.334	T	0.10706	-1.0618	9	.	.	.	0.277	7.0031	0.24821	0.1229:0.0:0.8771:0.0	.	113	Q5H8A3	NMS_HUMAN	C	113	ENSP00000366061:G113C	.	G	+	1	0	NMS	100463390	0.997000	0.39634	0.028000	0.17463	0.025000	0.11179	3.964000	0.56780	1.110000	0.41699	0.650000	0.86243	GGC		0.537	NMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329737.1	NM_001011717	Missense_Mutation	Missense_Mutation
EML4	27436	genome.wustl.edu	37	2	42556028	42556028	+	Missense_Mutation	SNP	G	G	C	rs541549971		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:42556028G>C	ENST00000318522.5	+	22	2606	c.2344G>C	c.(2344-2346)Gtc>Ctc	p.V782L	EML4_ENST00000402711.2_Missense_Mutation_p.V724L|EML4_ENST00000401738.3_Missense_Mutation_p.V793L|EML4_ENST00000453191.2_Missense_Mutation_p.V46L	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	782					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)		p.V782L(1)	EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TATCAAAGGTGTCTGGCCAGA	0.373			T	ALK	NSCLC																																		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	1	Substitution - Missense(1)	ovary(1)	2											113.0	107.0	109.0					2																	42556028		2203	4300	6503	42409532	SO:0001583	missense	27436			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.2344G>C	2.37:g.42556028G>C	ENSP00000320663:p.Val782Leu	Somatic		Capture	Illumina GAIIx	PhaseIII	42409532	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	37	CCDS1807.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694927	0.88830	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738;ENST00000453191	T;T;T;T	0.69040	2.45;1.06;2.45;-0.37	5.65	4.75	0.60458	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77157	0.4089	L	0.59967	1.855	0.80722	D	1	D;B;D;D	0.67145	0.996;0.185;0.964;0.996	D;B;P;D	0.77557	0.99;0.042;0.778;0.99	T	0.71988	-0.4426	10	0.27785	T	0.31	-12.9768	15.1889	0.73028	0.0684:0.0:0.9316:0.0	.	724;724;793;782	A6H8Y6;B5MCW9;B5MBZ0;Q9HC35	.;.;.;EMAL4_HUMAN	L	782;724;793;46	ENSP00000320663:V782L;ENSP00000385059:V724L;ENSP00000384939:V793L;ENSP00000400590:V46L	ENSP00000320663:V782L	V	+	1	0	EML4	42409532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.529000	0.98049	2.941000	0.99782	0.655000	0.94253	GTC		0.373	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063		Missense_Mutation
FAM171B	165215	genome.wustl.edu	37	2	187627365	187627365	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr2:187627365G>T	ENST00000304698.5	+	8	2499	c.2296G>T	c.(2296-2298)Gga>Tga	p.G766*		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	766						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.G766*(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CATCCTAGATGGAGGGAGTGG	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	2											69.0	71.0	71.0					2																	187627365		2203	4300	6503	187335610	SO:0001587	stop_gained	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2296G>T	2.37:g.187627365G>T	ENSP00000304108:p.Gly766*	Somatic		Capture	Illumina GAIIx	PhaseIII	187335610	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Nonsense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	SNP	47	WashU	.	.	.	.	.	.	.	.	.	.	G	39	7.501716	0.98322	.	.	ENSG00000144369	ENST00000304698	.	.	.	6.02	6.02	0.97574	.	0.106575	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-10.5947	13.7061	0.62639	0.07:0.0:0.93:0.0	.	.	.	.	X	766	.	ENSP00000304108:G766X	G	+	1	0	FAM171B	187335610	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.137000	0.64789	2.850000	0.98022	0.650000	0.86243	GGA		0.488	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454		Nonsense_Mutation
RIPK4	54101	genome.wustl.edu	37	21	43161481	43161481	+	Missense_Mutation	SNP	G	G	C	rs549988231		TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr21:43161481G>C	ENST00000352483.2	-	9	2080	c.2016C>G	c.(2014-2016)atC>atG	p.I672M	RIPK4_ENST00000332512.3_Missense_Mutation_p.I624M|AP001615.9_ENST00000423276.1_RNA|RIPK4_ENST00000544709.1_Missense_Mutation_p.I561M|RIPK4_ENST00000542057.1_Missense_Mutation_p.I561M			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	672					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.I624M(1)		NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AGCACAGGTCGATGAGGATGC	0.692																																																1	Substitution - Missense(1)	ovary(1)	21											56.0	59.0	58.0					21																	43161481		2202	4296	6498	42034550	SO:0001583	missense	54101			AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2016C>G	21.37:g.43161481G>C	ENSP00000330161:p.Ile672Met	Somatic		Capture	Illumina GAIIx	4	42034550	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37		SNP	37	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.29|12.29	1.892325|1.892325	0.33442|0.33442	.|.	.|.	ENSG00000183421|ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057|ENST00000330470	T;T;T;T|.	0.69306|.	1.86;-0.39;1.86;1.86|.	4.92|4.92	-7.07|-7.07	0.01563|0.01563	.|.	0.203433|.	0.33572|.	N|.	0.004780|.	T|T	0.41119|0.41119	0.1145|0.1145	M|M	0.82517|0.82517	2.595|2.595	0.23036|0.23036	N|N	0.998398|0.998398	D|.	0.69078|.	0.997|.	D|.	0.66497|.	0.944|.	T|T	0.42378|0.42378	-0.9455|-0.9455	10|6	0.72032|0.33940	D|T	0.01|0.23	-13.6464|-13.6464	0.5524|0.5524	0.00664|0.00664	0.3662:0.1589:0.2345:0.2404|0.3662:0.1589:0.2345:0.2404	.|.	624|.	P57078-2|.	.|.	M|G	624;672;561;561|361	ENSP00000332454:I624M;ENSP00000330161:I672M;ENSP00000441754:I561M;ENSP00000442901:I561M|.	ENSP00000332454:I624M|ENSP00000330975:R361G	I|R	-|-	3|1	3|2	RIPK4|RIPK4	42034550|42034550	0.037000|0.037000	0.19845|0.19845	0.161000|0.161000	0.22692|0.22692	0.722000|0.722000	0.41435|0.41435	-0.949000|-0.949000	0.03893|0.03893	-1.535000|-1.535000	0.01740|0.01740	-0.733000|-0.733000	0.03571|0.03571	ATC|CGA		0.692	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639		Missense_Mutation
RPS3A	6189	genome.wustl.edu	37	4	152024193	152024193	+	Silent	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:152024193G>A	ENST00000509736.1	+	2	262	c.168G>A	c.(166-168)gaG>gaA	p.E56E	SNORD73A_ENST00000386062.1_RNA|RPS3A_ENST00000506126.1_Silent_p.E138E|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000514682.1_Silent_p.E138E|RPS3A_ENST00000274065.4_Silent_p.E175E|RPS3A_ENST00000512690.1_Silent_p.E175E|RPS3A_ENST00000322686.6_Silent_p.E162E					ribosomal protein S3A									p.E175E(1)		endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					TGACCCGAGAGGTGCAGACAA	0.413																																																1	Substitution - coding silent(1)	ovary(1)	4											24.0	22.0	23.0					4																	152024193		2201	4284	6485	152243643	SO:0001819	synonymous_variant	6189			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000509736.1:c.168G>A	4.37:g.152024193G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	152243643		Silent	SNP	ENST00000509736.1	37		SNP	35	WashU																																																																																				0.413	RPS3A-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000364962.2			Silent
KLKB1	3818	genome.wustl.edu	37	4	187177216	187177216	+	Silent	SNP	C	C	A	rs376558433	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr4:187177216C>A	ENST00000264690.6	+	13	1747	c.1560C>A	c.(1558-1560)acC>acA	p.T520T	KLKB1_ENST00000513864.1_Silent_p.T520T	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	520	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.T520T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		GTTGGGTAACCGGATGGGGCT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	4											66.0	68.0	67.0					4																	187177216		2203	4300	6503	187414210	SO:0001819	synonymous_variant	3818			M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1560C>A	4.37:g.187177216C>A		Somatic		Capture	Illumina GAIIx	4	187414210	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Silent	SNP	ENST00000264690.6	37	CCDS34120.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	0.560	-0.845685	0.02671	.	.	ENSG00000164344	ENST00000511608	.	.	.	5.77	-1.7	0.08159	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28650	-1.0037	4	.	.	.	.	2.1511	0.03800	0.1167:0.1328:0.2424:0.508	.	.	.	.	Q	568	.	.	P	+	2	0	KLKB1	187414210	0.932000	0.31603	0.939000	0.37840	0.070000	0.16714	-0.130000	0.10498	-0.137000	0.11455	-1.264000	0.01445	CCG		0.378	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892		Silent
SLC44A4	80736	genome.wustl.edu	37	6	31838621	31838621	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr6:31838621T>C	ENST00000229729.6	-	10	925	c.905A>G	c.(904-906)tAc>tGc	p.Y302C	SLC44A4_ENST00000544672.1_Missense_Mutation_p.Y226C|SLC44A4_ENST00000375562.4_Missense_Mutation_p.Y260C	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	302					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y302C(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	CACGCTCTGGTAGGCACTGAG	0.672																																																1	Substitution - Missense(1)	ovary(1)	6											63.0	57.0	60.0					6																	31838621		1510	2707	4217	31946600	SO:0001583	missense	80736			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.905A>G	6.37:g.31838621T>C	ENSP00000229729:p.Tyr302Cys	Somatic		Capture	Illumina GAIIx	4	31946600	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	SNP	57	WashU	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766385	0.69878	.	.	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.14266	2.89;2.52;2.71	4.38	4.38	0.52667	.	0.147206	0.47093	D	0.000249	T	0.28034	0.0691	M	0.78049	2.395	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.987	T	0.05954	-1.0854	10	0.87932	D	0	-16.3532	12.9925	0.58627	0.0:0.0:0.0:1.0	.	260;302	E9PEK7;Q53GD3	.;CTL4_HUMAN	C	302;260;226	ENSP00000229729:Y302C;ENSP00000364712:Y260C;ENSP00000444109:Y226C	ENSP00000229729:Y302C	Y	-	2	0	SLC44A4	31946600	1.000000	0.71417	0.982000	0.44146	0.800000	0.45204	7.197000	0.77814	1.980000	0.57719	0.459000	0.35465	TAC		0.672	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3			Missense_Mutation
ABCA13	154664	genome.wustl.edu	37	7	48313812	48313812	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0920-01	TCGA-13-0920-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr7:48313812T>A	ENST00000435803.1	+	17	4573	c.4549T>A	c.(4549-4551)Tcc>Acc	p.S1517T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1517					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S1462T(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCATCTCAGTCCAATTGGAG	0.289																																																1	Substitution - Missense(1)	ovary(1)	7											32.0	33.0	33.0					7																	48313812		1817	4055	5872	48284358	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4549T>A	7.37:g.48313812T>A	ENSP00000411096:p.Ser1517Thr	Somatic		Capture	Illumina GAIIx	4	48284358	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	SNP	58	WashU	.	.	.	.	.	.	.	.	.	.	T	2.543	-0.305901	0.05458	.	.	ENSG00000179869	ENST00000435803	D	0.86769	-2.17	5.03	1.15	0.20763	.	0.319686	0.22595	N	0.058036	T	0.80481	0.4631	M	0.64997	1.995	0.09310	N	1	B	0.18310	0.027	B	0.14023	0.01	T	0.65026	-0.6268	9	.	.	.	.	3.6277	0.08119	0.1606:0.1821:0.0:0.6572	.	1517	Q86UQ4	ABCAD_HUMAN	T	1517	ENSP00000411096:S1517T	.	S	+	1	0	ABCA13	48284358	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.692000	0.25482	0.016000	0.14998	-0.371000	0.07208	TCC		0.289	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701		Missense_Mutation
TEX15	56154	genome.wustl.edu	37	8	30702387	30702387	+	Missense_Mutation	SNP	G	G	A	rs61732458	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr8:30702387G>A	ENST00000256246.2	-	1	4221	c.4147C>T	c.(4147-4149)Ctt>Ttt	p.L1383F		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1383					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.L1383F(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCTTTAGAAGCTCTTTTTCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	8											89.0	89.0	89.0					8																	30702387		2203	4300	6503	30821929	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4147C>T	8.37:g.30702387G>A	ENSP00000256246:p.Leu1383Phe	Somatic		Capture	Illumina GAIIx	PhaseIII	30821929		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579575	0.28180	.	.	ENSG00000133863	ENST00000256246	T	0.24538	1.85	5.7	-4.15	0.03881	.	1.043940	0.07551	N	0.915406	T	0.10895	0.0266	N	0.12182	0.205	0.09310	N	1	B	0.20671	0.047	B	0.22386	0.039	T	0.36016	-0.9765	10	0.87932	D	0	.	0.1604	0.00102	0.3217:0.2336:0.2066:0.2381	.	1383	Q9BXT5	TEX15_HUMAN	F	1383	ENSP00000256246:L1383F	ENSP00000256246:L1383F	L	-	1	0	TEX15	30821929	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.906000	0.04071	-0.191000	0.10448	-0.169000	0.13324	CTT		0.398	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			Missense_Mutation
UBAP2	55833	genome.wustl.edu	37	9	33953309	33953309	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr9:33953309C>T	ENST00000379238.1	-	12	1147	c.1030G>A	c.(1030-1032)Gtc>Atc	p.V344I	SNORD121A_ENST00000459386.1_RNA|UBAP2_ENST00000539807.1_Missense_Mutation_p.V99I|UBAP2_ENST00000418786.2_Missense_Mutation_p.V291I|UBAP2_ENST00000360802.1_Missense_Mutation_p.V344I|UBAP2_ENST00000449054.1_Missense_Mutation_p.V344I|UBAP2_ENST00000379239.4_Missense_Mutation_p.V77I					ubiquitin associated protein 2									p.V344I(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		CAGGAGTTGACGGCAGTGGAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	9											66.0	69.0	68.0					9																	33953309		2203	4300	6503	33943309	SO:0001583	missense	55833			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1030G>A	9.37:g.33953309C>T	ENSP00000368540:p.Val344Ile	Somatic		Capture	Illumina GAIIx	4	33943309		Missense_Mutation	SNP	ENST00000379238.1	37	CCDS6547.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719499	0.30503	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379260;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000412543;ENST00000421278	T;T;T;T;T;T;T	0.30714	2.73;2.73;2.73;2.51;2.53;2.22;1.52	5.85	2.98	0.34508	.	0.463892	0.26268	N	0.025350	T	0.23492	0.0568	L	0.57536	1.79	0.27867	N	0.940199	B;P;B;B;B;P;P	0.49090	0.196;0.919;0.03;0.03;0.03;0.868;0.787	B;B;B;B;B;B;B	0.35278	0.019;0.199;0.007;0.007;0.007;0.098;0.099	T	0.12915	-1.0529	10	0.33940	T	0.23	-0.1017	9.2243	0.37395	0.0:0.7476:0.1208:0.1316	.	291;269;99;77;253;269;344	E7EWG4;F5H4D5;F5H2U4;A6NCA8;F5H2C8;B4DH66;Q5T6F2	.;.;.;.;.;.;UBAP2_HUMAN	I	344;344;344;253;262;77;99;291;291;198	ENSP00000368540:V344I;ENSP00000416932:V344I;ENSP00000354039:V344I;ENSP00000368541:V77I;ENSP00000439329:V99I;ENSP00000404436:V291I;ENSP00000414800:V291I	ENSP00000354039:V344I	V	-	1	0	UBAP2	33943309	1.000000	0.71417	0.391000	0.26233	0.005000	0.04900	1.775000	0.38584	0.365000	0.24400	-0.422000	0.05995	GTC		0.443	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001071.1	NM_018449		Missense_Mutation
SPTAN1	6709	genome.wustl.edu	37	9	131349970	131349970	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr9:131349970delC	ENST00000372731.4	+	20	2974	c.2864delC	c.(2863-2865)tccfs	p.S955fs	SPTAN1_ENST00000358161.5_Frame_Shift_Del_p.S955fs|SPTAN1_ENST00000372739.3_Frame_Shift_Del_p.S955fs	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	955					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.C956fs*33(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CAAGCACAGTCCTGCCGGGTA	0.493																																					NSCLC(120;833 1744 2558 35612 37579)											1	Deletion - Frameshift(1)	ovary(1)	9											90.0	77.0	81.0					9																	131349970		2203	4300	6503	130389791	SO:0001589	frameshift_variant	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2864delC	9.37:g.131349970delC	ENSP00000361816:p.Ser955fs	Somatic		Capture	Illumina GAIIx	PhaseIII	130389791	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Frame_Shift_Del	DEL	ENST00000372731.4	37	CCDS6905.1	DEL	30	WashU																																																																																				0.493	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127		Frame_Shift_Del
UBR4	23352	genome.wustl.edu	37	1	19443876	19443876	+	Silent	SNP	C	C	T	rs61996287	byFrequency	TCGA-13-0920-01	TCGA-13-0920-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr1:19443876C>T	ENST00000375254.3	-	73	10689	c.10662G>A	c.(10660-10662)acG>acA	p.T3554T	UBR4_ENST00000375267.2_Silent_p.T3554T|UBR4_ENST00000375217.2_Silent_p.T3547T|UBR4_ENST00000375218.3_5'UTR|UBR4_ENST00000375226.2_Silent_p.T3530T	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3554					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T3554T(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGGTGTACCGCGTGTCCACTT	0.433													C|||	42	0.00838658	0.0272	0.0072	5008	,	,		17878	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	1						C		88,4318	73.6+/-111.7	0,88,2115	150.0	126.0	134.0		10662	-11.0	0.6	1	dbSNP_129	134	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	UBR4	NM_020765.2		0,89,6414	TT,TC,CC		0.0116,1.9973,0.6843		3554/5184	19443876	89,12917	2203	4300	6503	19316463	SO:0001819	synonymous_variant	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.10662G>A	1.37:g.19443876C>T		Somatic		Capture	Illumina GAIIx	PhaseIII	19316463	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1	SNP	27	WashU																																																																																				0.433	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765		Silent
MUC16	94025	genome.wustl.edu	37	19	8976817	8976817	+	Silent	SNP	G	G	A			TCGA-13-0920-01	TCGA-13-0920-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chr19:8976817G>A	ENST00000397910.4	-	73	42452	c.42249C>T	c.(42247-42249)atC>atT	p.I14083I	MUC16_ENST00000596956.1_5'UTR|MUC16_ENST00000380951.5_Silent_p.I724I	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14113				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.?(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAGATTGGAGATGGTGAAGT	0.567																																																1	Unknown(1)	ovary(1)	19											117.0	119.0	118.0					19																	8976817		2001	4156	6157	8837817	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42249C>T	19.37:g.8976817G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	8837817	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	g	2.360	-0.346833	0.05208	.	.	ENSG00000181143	ENST00000542240	.	.	.	4.37	3.33	0.38152	.	.	.	.	.	T	0.48995	0.1531	.	.	.	.	.	.	.	.	.	.	.	.	T	0.57866	-0.7737	3	.	.	.	.	8.2743	0.31864	0.1093:0.0:0.8907:0.0	.	.	.	.	F	906	.	.	S	-	2	0	MUC16	8837817	0.997000	0.39634	1.000000	0.80357	0.221000	0.24807	0.588000	0.23924	1.199000	0.43173	0.457000	0.33378	TCT		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Silent
LUZP4	51213	genome.wustl.edu	37	X	114537922	114537922	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0920-01	TCGA-13-0920-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-0920-01	TCGA-13-0920-10	g.chrX:114537922A>T	ENST00000371920.3	+	3	288	c.281A>T	c.(280-282)cAa>cTa	p.Q94L	LUZP4_ENST00000451986.2_Intron	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	94						nucleus (GO:0005634)		p.Q94L(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AAACCATCCCAAAAACCTTCT	0.338																																																1	Substitution - Missense(1)	ovary(1)	X											117.0	114.0	115.0					X																	114537922		2203	4300	6503	114444178	SO:0001583	missense	51213			AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.281A>T	X.37:g.114537922A>T	ENSP00000360988:p.Gln94Leu	Somatic		Capture	Illumina GAIIx	PhaseIII	114444178	B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	37	CCDS14567.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	13.25	2.179690	0.38511	.	.	ENSG00000102021	ENST00000371920	T	0.36520	1.25	3.06	1.87	0.25490	.	.	.	.	.	T	0.34542	0.0901	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	P	0.58130	0.833	T	0.11891	-1.0569	9	0.72032	D	0.01	.	4.434	0.11542	0.8402:0.0:0.1598:0.0	.	94	Q9P127	LUZP4_HUMAN	L	94	ENSP00000360988:Q94L	ENSP00000360988:Q94L	Q	+	2	0	LUZP4	114444178	0.086000	0.21541	0.001000	0.08648	0.102000	0.19082	0.761000	0.26489	0.422000	0.26005	0.417000	0.27973	CAA		0.338	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383		Missense_Mutation
