#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
EYA3	2140	broad.mit.edu	37	1	28315148	28315148	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:28315148G>C	ENST00000373871.3	-	16	1678	c.1438C>G	c.(1438-1440)Ctg>Gtg	p.L480V	EYA3_ENST00000436342.2_Missense_Mutation_p.L354V|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000540618.1_Missense_Mutation_p.L434V|EYA3_ENST00000373864.1_Missense_Mutation_p.L323V|EYA3_ENST00000373863.3_Missense_Mutation_p.L434V|EYA3_ENST00000545175.1_Missense_Mutation_p.L427V	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	480				L -> P (in Ref. 2; AAB42066). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L480V(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		GTAGTGATCAGAACATTCACA	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											68.0	69.0	69.0					1																	28315148		2203	4300	6503	28187735	SO:0001583	missense	2140			U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.1438C>G	1.37:g.28315148G>C	ENSP00000362978:p.Leu480Val	Unknown		x	x	x	28187735	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Missense_Mutation	SNP	ENST00000373871.3	37	CCDS316.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806488	0.70682	.	.	ENSG00000158161	ENST00000373871;ENST00000436342;ENST00000373864;ENST00000540618;ENST00000545175;ENST00000373863	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	6.07	2.78	0.32641	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.87803	0.6269	L	0.56769	1.78	0.58432	D	0.999996	D;D;D	0.71674	0.987;0.996;0.998	D;D;D	0.81914	0.963;0.993;0.995	D	0.86666	0.1907	10	0.44086	T	0.13	-18.5363	12.6049	0.56516	0.209:0.0:0.791:0.0	.	434;434;480	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	V	480;354;323;434;427;434	ENSP00000362978:L480V;ENSP00000405587:L354V;ENSP00000362971:L323V;ENSP00000442558:L434V;ENSP00000442280:L427V;ENSP00000362970:L434V	ENSP00000362970:L434V	L	-	1	2	EYA3	28187735	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.326000	0.43849	0.898000	0.36418	0.655000	0.94253	CTG		0.408	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1	NM_001990		Missense_Mutation
SPOCD1	90853	broad.mit.edu	37	1	32279608	32279608	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:32279608C>G	ENST00000360482.2	-	2	1456	c.1327G>C	c.(1327-1329)Gac>Cac	p.D443H	SPOCD1_ENST00000533231.1_Missense_Mutation_p.D443H|SPOCD1_ENST00000257100.3_Intron|SPOCD1_ENST00000373648.2_Missense_Mutation_p.D443H	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	443					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.D443H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		TGGGAGTTGTCTGAGCTTCTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											69.0	71.0	71.0					1																	32279608		2203	4300	6503	32052195	SO:0001583	missense	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1327G>C	1.37:g.32279608C>G	ENSP00000353670:p.Asp443His	Unknown		x	x	x	32052195	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674485	0.47781	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.39229	1.69;1.09;1.69	3.34	3.34	0.38264	.	.	.	.	.	T	0.28034	0.0691	N	0.19112	0.55	0.09310	N	1	B;B	0.24882	0.113;0.069	B;B	0.24006	0.05;0.018	T	0.10660	-1.0620	9	0.35671	T	0.21	0.1262	10.4265	0.44380	0.0:1.0:0.0:0.0	.	443;443	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	H	443	ENSP00000353670:D443H;ENSP00000362752:D443H;ENSP00000435851:D443H	ENSP00000353670:D443H	D	-	1	0	SPOCD1	32052195	0.000000	0.05858	0.036000	0.18154	0.211000	0.24417	0.190000	0.17057	2.152000	0.67230	0.305000	0.20034	GAC		0.592	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569		Missense_Mutation
CSMD2	114784	broad.mit.edu	37	1	34128685	34128685	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:34128685A>T	ENST00000373380.1	-	5	899	c.679T>A	c.(679-681)Ttc>Atc	p.F227I	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.F1354I			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1314	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F1314I(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AACACCAGGAAGTGTAGCCTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	60.0	62.0					1																	34128685		2203	4300	6503	33901272	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.679T>A	1.37:g.34128685A>T	ENSP00000362478:p.Phe227Ile	Unknown		x	x	x	33901272	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	27.8	4.867351	0.91511	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.23754	1.89;1.89	5.22	5.22	0.72569	CUB (5);	0.000000	0.85682	D	0.000000	T	0.46814	0.1412	M	0.79475	2.455	0.80722	D	1	P;D;P	0.55605	0.511;0.972;0.923	B;P;P	0.56865	0.26;0.808;0.706	T	0.49476	-0.8936	10	0.52906	T	0.07	.	14.5749	0.68238	1.0:0.0:0.0:0.0	.	227;1314;1354	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	I	1354;227	ENSP00000362479:F1354I;ENSP00000362478:F227I	ENSP00000241312:F1314I	F	-	1	0	CSMD2	33901272	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.287000	0.95975	2.106000	0.64143	0.459000	0.35465	TTC		0.597	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		Missense_Mutation
AGO4	192670	broad.mit.edu	37	1	36291649	36291649	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:36291649A>G	ENST00000373210.3	+	6	993	c.748A>G	c.(748-750)Aaa>Gaa	p.K250E		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	250	PAZ. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)	p.K250E(1)									CAAATTTACCAAAGAAATCAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											106.0	100.0	102.0					1																	36291649		2203	4300	6503	36064236	SO:0001583	missense	192670			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.748A>G	1.37:g.36291649A>G	ENSP00000362306:p.Lys250Glu	Unknown		x	x	x	36064236	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	18.79	3.698017	0.68386	.	.	ENSG00000134698	ENST00000373210	T	0.14391	2.51	5.53	5.53	0.82687	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	M	0.87328	2.875	0.80722	D	1	B	0.14805	0.011	B	0.29353	0.101	T	0.08472	-1.0720	10	0.62326	D	0.03	-14.7527	15.6642	0.77213	1.0:0.0:0.0:0.0	.	250	Q9HCK5	AGO4_HUMAN	E	250	ENSP00000362306:K250E	ENSP00000362306:K250E	K	+	1	0	EIF2C4	36064236	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.098000	0.63641	0.455000	0.32223	AAA		0.458	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629		Missense_Mutation
DAB1	1600	broad.mit.edu	37	1	57481088	57481088	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:57481088G>A	ENST00000371231.1	-	13	1045	c.1011C>T	c.(1009-1011)ggC>ggT	p.G337G	DAB1_ENST00000371234.4_Silent_p.G304G|DAB1_ENST00000371236.2_Silent_p.G304G|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000414851.2_Silent_p.G286G|DAB1_ENST00000439789.2_Silent_p.G218G|DAB1_ENST00000420954.2_Silent_p.G302G			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	337					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.G304G(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGAGGACAGCGCCCATTGCAA	0.572																																																1	Substitution - coding silent(1)	ovary(1)	1											24.0	26.0	25.0					1																	57481088		2199	4289	6488	57253676	SO:0001819	synonymous_variant	1600			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1011C>T	1.37:g.57481088G>A		Unknown		x	x	x	57253676	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37		SNP	38	Broad																																																																																				0.572	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		Silent
PALMD	54873	broad.mit.edu	37	1	100154414	100154414	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:100154414G>C	ENST00000263174.4	+	7	973	c.598G>C	c.(598-600)Gat>Cat	p.D200H	PALMD_ENST00000605497.1_Missense_Mutation_p.D200H	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	200					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)		p.D200H(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		TCTGCCATCAGATGACTTTAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	100.0	98.0					1																	100154414		2203	4300	6503	99927002	SO:0001583	missense	54873			AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.598G>C	1.37:g.100154414G>C	ENSP00000263174:p.Asp200His	Unknown		x	x	x	99927002	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	37	CCDS758.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102373	0.37145	.	.	ENSG00000099260	ENST00000263174	T	0.18657	2.2	5.74	4.83	0.62350	.	0.592820	0.19644	N	0.109398	T	0.20618	0.0496	L	0.47716	1.5	0.22240	N	0.999263	D;D	0.58970	0.984;0.98	P;P	0.62649	0.905;0.847	T	0.07328	-1.0778	10	0.72032	D	0.01	-14.1244	9.069	0.36480	0.2322:0.0:0.7678:0.0	.	200;120	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	H	200	ENSP00000263174:D200H	ENSP00000263174:D200H	D	+	1	0	PALMD	99927002	0.999000	0.42202	0.986000	0.45419	0.493000	0.33554	2.949000	0.49074	1.429000	0.47314	0.563000	0.77884	GAT		0.368	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734		Missense_Mutation
SLC16A4	9122	broad.mit.edu	37	1	110921585	110921585	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:110921585G>C	ENST00000369779.4	-	6	1169	c.920C>G	c.(919-921)tCt>tGt	p.S307C	SLC16A4_ENST00000437429.2_Missense_Mutation_p.S197C|SLC16A4_ENST00000541986.1_Missense_Mutation_p.S245C|SLC16A4_ENST00000497687.1_5'UTR|SLC16A4_ENST00000369781.4_Intron|SLC16A4_ENST00000472422.2_Missense_Mutation_p.S259C	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	307					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)	p.S307C(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	GAGGAGAAAAGACCAAGTAAA	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											111.0	107.0	108.0					1																	110921585		2203	4300	6503	110723108	SO:0001583	missense	9122			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.920C>G	1.37:g.110921585G>C	ENSP00000358794:p.Ser307Cys	Unknown		x	x	x	110723108	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	ENST00000369779.4	37	CCDS823.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	g	16.70	3.196706	0.58126	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000437429;ENST00000541986;ENST00000467986	T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47	5.99	5.03	0.67393	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.168676	0.53938	D	0.000041	T	0.71693	0.3370	L	0.50993	1.605	0.48632	D	0.999684	B;B;B;B	0.22003	0.044;0.024;0.005;0.063	B;B;B;B	0.30716	0.081;0.056;0.102;0.119	T	0.68876	-0.5293	10	0.42905	T	0.14	.	17.2614	0.87071	0.0:0.1353:0.8647:0.0	.	197;245;259;307	E7EPY8;B4DJ67;G3V175;O15374	.;.;.;MOT5_HUMAN	C	307;259;197;245;74	ENSP00000358794:S307C;ENSP00000432495:S259C;ENSP00000394790:S197C;ENSP00000446087:S245C;ENSP00000435768:S74C	ENSP00000358794:S307C	S	-	2	0	SLC16A4	110723108	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.241000	0.65384	2.845000	0.97973	0.651000	0.88453	TCT		0.403	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696		Missense_Mutation
RHOC	389	broad.mit.edu	37	1	113245721	113245721	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:113245721G>T	ENST00000285735.2	-	4	1386	c.177C>A	c.(175-177)gaC>gaA	p.D59E	RHOC_ENST00000339083.7_Missense_Mutation_p.D59E|RP11-426L16.10_ENST00000471038.2_5'UTR|RHOC_ENST00000369633.2_Missense_Mutation_p.D59E|RP11-426L16.10_ENST00000606505.1_Missense_Mutation_p.H223N|RHOC_ENST00000369632.2_Missense_Mutation_p.D59E|RHOC_ENST00000369637.1_Missense_Mutation_p.D59E|RHOC_ENST00000369636.2_Missense_Mutation_p.D59E|RHOC_ENST00000369638.2_Missense_Mutation_p.D59E|RHOC_ENST00000369642.3_Missense_Mutation_p.D59E			P08134	RHOC_HUMAN	ras homolog family member C	59					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)	p.D59E(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCCTGCTGTGTCCCACAGAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	60.0	62.0					1																	113245721		2203	4300	6503	113047244	SO:0001583	missense	389			BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.177C>A	1.37:g.113245721G>T	ENSP00000285735:p.Asp59Glu	Somatic		x	x	x	113047244	B3KSW1|Q6ICN3	Missense_Mutation	SNP	ENST00000285735.2	37	CCDS854.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570964	0.86542	.	.	ENSG00000155366	ENST00000339083;ENST00000369633;ENST00000369642;ENST00000285735;ENST00000369638;ENST00000369637;ENST00000369636;ENST00000369632;ENST00000484054;ENST00000425265;ENST00000534717;ENST00000436685;ENST00000414971	D;D;D;D;D;D;D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	5.4	5.4	0.78164	Small GTP-binding protein domain (1);	0.000000	0.50627	D	0.000110	D	0.91422	0.7293	M	0.94021	3.485	0.80722	D	1	P	0.40144	0.704	P	0.52823	0.71	D	0.92940	0.6371	10	0.87932	D	0	-12.8773	13.147	0.59467	0.0777:0.0:0.9223:0.0	.	59	P08134	RHOC_HUMAN	E	59;59;59;59;59;59;59;59;96;59;59;59;59	ENSP00000345236:D59E;ENSP00000358647:D59E;ENSP00000358656:D59E;ENSP00000285735:D59E;ENSP00000358652:D59E;ENSP00000358651:D59E;ENSP00000358650:D59E;ENSP00000358646:D59E;ENSP00000434877:D96E;ENSP00000390823:D59E;ENSP00000436240:D59E;ENSP00000399424:D59E;ENSP00000395791:D59E	ENSP00000285735:D59E	D	-	3	2	RHOC	113047244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.857000	0.62939	2.537000	0.85549	0.561000	0.74099	GAC		0.607	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	NM_175744		Missense_Mutation
CCT3	7203	broad.mit.edu	37	1	156288685	156288685	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:156288685G>C	ENST00000295688.3	-	8	1013	c.733C>G	c.(733-735)Ctg>Gtg	p.L245V	CCT3_ENST00000368261.3_Missense_Mutation_p.L200V|CCT3_ENST00000472765.2_Missense_Mutation_p.L200V|CCT3_ENST00000368259.2_Missense_Mutation_p.L207V	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	245					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.L245V(1)		endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TTGTATTCCAGAGAAGAATCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	80.0	82.0					1																	156288685		2203	4300	6503	154555309	SO:0001583	missense	7203			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.733C>G	1.37:g.156288685G>C	ENSP00000295688:p.Leu245Val	Somatic		x	x	x	154555309	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	37	CCDS1140.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087738	0.76642	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555	D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01	5.94	0.587	0.17439	.	0.000000	0.64402	D	0.000003	D	0.88108	0.6348	M	0.83692	2.655	0.49213	D	0.999761	D;D;D	0.76494	0.993;0.999;0.99	P;D;D	0.91635	0.826;0.999;0.925	D	0.86656	0.1901	10	0.56958	D	0.05	-11.4721	8.619	0.33849	0.4151:0.0:0.5849:0.0	.	207;244;245	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	V	245;207;200;200;269	ENSP00000295688:L245V;ENSP00000357242:L207V;ENSP00000357244:L200V;ENSP00000431543:L200V;ENSP00000413308:L269V	ENSP00000295688:L245V	L	-	1	2	CCT3	154555309	0.999000	0.42202	0.995000	0.50966	0.876000	0.50452	2.659000	0.46741	0.076000	0.16826	0.643000	0.83706	CTG		0.443	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998		Missense_Mutation
CD1C	911	broad.mit.edu	37	1	158259888	158259888	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:158259888C>T	ENST00000368170.3	+	1	313	c.34C>T	c.(34-36)Ctt>Ttt	p.L12F		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	12					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)	p.L12F(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					GCTAGCTCTTCTTCTCCCAGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											165.0	137.0	147.0					1																	158259888		2203	4300	6503	156526512	SO:0001583	missense	911			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.34C>T	1.37:g.158259888C>T	ENSP00000357152:p.Leu12Phe	Unknown		x	x	x	156526512	Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	ENST00000368170.3	37	CCDS1175.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	-	2.751	-0.260003	0.05791	.	.	ENSG00000158481	ENST00000368169;ENST00000368170	T	0.01369	4.97	2.37	0.424	0.16468	.	0.996520	0.08117	N	0.995325	T	0.00524	0.0017	L	0.45228	1.405	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.42965	-0.9420	10	0.34782	T	0.22	.	4.8941	0.13742	0.0:0.6858:0.0:0.3142	.	12	P29017	CD1C_HUMAN	F	12	ENSP00000357152:L12F	ENSP00000357151:L12F	L	+	1	0	CD1C	156526512	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.420000	0.07062	0.114000	0.18032	-0.272000	0.10252	CTT		0.463	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046351.2	NM_001765		Missense_Mutation
CD84	8832	broad.mit.edu	37	1	160535332	160535332	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:160535332G>A	ENST00000311224.4	-	2	316	c.250C>T	c.(250-252)Cgg>Tgg	p.R84W	CD84_ENST00000368048.3_Missense_Mutation_p.R84W|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000534968.1_Intron|CD84_ENST00000368051.3_Missense_Mutation_p.R84W|CD84_ENST00000368054.3_Missense_Mutation_p.R84W|CD84_ENST00000368047.3_5'UTR	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	84	Ig-like V-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.R84W(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GCATGTATCCGTTCATAATAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											255.0	224.0	234.0					1																	160535332		2203	4300	6503	158801956	SO:0001583	missense	8832			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.250C>T	1.37:g.160535332G>A	ENSP00000312367:p.Arg84Trp	Unknown		x	x	x	158801956	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	ENST00000311224.4	37	CCDS53396.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169431	0.57584	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41	5.11	3.14	0.36123	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	M	0.87971	2.92	0.27201	N	0.960175	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.42050	-0.9474	10	0.87932	D	0	-12.0244	10.2737	0.43497	0.0:0.0:0.5938:0.4062	.	84;84;84;84;84;84	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	W	84	ENSP00000357033:R84W;ENSP00000357027:R84W;ENSP00000312367:R84W;ENSP00000357030:R84W;ENSP00000353163:R84W;ENSP00000357026:R84W	ENSP00000312367:R84W	R	-	1	2	CD84	158801956	0.702000	0.27816	0.028000	0.17463	0.074000	0.17049	2.042000	0.41222	0.764000	0.33197	0.591000	0.81541	CGG		0.433	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059092.1	NM_003874		Missense_Mutation
CD244	51744	broad.mit.edu	37	1	160808270	160808270	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:160808270C>T	ENST00000368033.3	-	5	902	c.820G>A	c.(820-822)Gtc>Atc	p.V274I	CD244_ENST00000368034.4_Missense_Mutation_p.V269I|CD244_ENST00000322302.7_Missense_Mutation_p.V177I|CD244_ENST00000481677.1_5'UTR|CD244_ENST00000368032.2_Missense_Mutation_p.V269I			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	274					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.V269I(1)		central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			AGATCCTTGACATCTTCGTAA	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											151.0	151.0	151.0					1																	160808270		2203	4300	6503	159074894	SO:0001583	missense	51744			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.820G>A	1.37:g.160808270C>T	ENSP00000357012:p.Val274Ile	Unknown		x	x	x	159074894	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	ENST00000368033.3	37	CCDS53399.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338551	0.24253	.	.	ENSG00000122223	ENST00000368034;ENST00000368033;ENST00000322302;ENST00000368032	T;T;T;T	0.54866	0.55;0.55;0.65;0.55	4.61	-0.838	0.10762	.	1.871870	0.02716	N	0.113480	T	0.23210	0.0561	L	0.32530	0.975	0.19300	N	0.999978	P;P;P	0.40619	0.506;0.603;0.724	B;B;B	0.39152	0.276;0.152;0.292	T	0.25082	-1.0142	10	0.62326	D	0.03	-21.0245	7.5762	0.27937	0.0:0.4268:0.0:0.5732	.	177;274;269	Q9BZW8-4;Q9BZW8;Q9BZW8-2	.;CD244_HUMAN;.	I	269;274;177;269	ENSP00000357013:V269I;ENSP00000357012:V274I;ENSP00000313619:V177I;ENSP00000357011:V269I	ENSP00000313619:V177I	V	-	1	0	CD244	159074894	0.043000	0.20138	0.545000	0.28153	0.074000	0.17049	-0.158000	0.10070	-0.240000	0.09696	-0.136000	0.14681	GTC		0.458	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071469.1	NM_016382		Missense_Mutation
MPZ	4359	broad.mit.edu	37	1	161276240	161276240	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:161276240C>T	ENST00000533357.1	-	4	529	c.463G>A	c.(463-465)Ggg>Agg	p.G155R	MPZ_ENST00000336559.4_Missense_Mutation_p.G155R|MPZ_ENST00000491222.2_5'UTR|MPZ_ENST00000526189.1_5'UTR|MPZ_ENST00000360451.6_Missense_Mutation_p.G165R	NM_000530.6	NP_000521.2	P25189	MYP0_HUMAN	myelin protein zero	155					cell death (GO:0008219)|cell-cell junction maintenance (GO:0045217)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.G165R(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	10	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)	Breast(1374;0.181)	BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGAACGACCCCGTACCTAGTT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											114.0	103.0	106.0					1																	161276240		2203	4300	6503	159542864	SO:0001583	missense	4359			BC006491	CCDS1229.1, CCDS1229.2	1q22	2014-09-17	2008-08-01		ENSG00000158887	ENSG00000158887		"""Immunoglobulin superfamily / V-set domain containing"""	7225	protein-coding gene	gene with protein product		159440	"""Charcot-Marie-Tooth neuropathy 1B"""	CMT1, CMT1B		7693129	Standard	NM_000530		Approved	HMSNIB	uc001gaf.4	P25189	OTTHUMG00000034341	ENST00000533357.1:c.463G>A	1.37:g.161276240C>T	ENSP00000432943:p.Gly155Arg	Unknown		x	x	x	159542864	Q16072|Q5VTH4|Q92677|Q9BR67	Missense_Mutation	SNP	ENST00000533357.1	37	CCDS1229.2	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414601	0.83449	.	.	ENSG00000158887	ENST00000533357;ENST00000360451;ENST00000336559	D;D;D	0.96940	-3.97;-3.99;-4.18	5.36	4.45	0.53987	.	0.064478	0.64402	N	0.000009	D	0.86986	0.6065	L	0.32530	0.975	0.41290	D	0.986972	P	0.38711	0.643	B	0.31946	0.138	D	0.84899	0.0841	9	0.23302	T	0.38	-18.2744	12.1705	0.54155	0.0:0.9163:0.0:0.0837	.	155	P25189	MYP0_HUMAN	R	155;165;155	ENSP00000432943:G155R;ENSP00000353634:G165R;ENSP00000337777:G155R	ENSP00000337777:G155R	G	-	1	0	MPZ	159542864	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.174000	0.71943	1.392000	0.46585	0.655000	0.94253	GGG		0.587	MPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082987.2	NM_000530		Missense_Mutation
FCGR2A	2212	broad.mit.edu	37	1	161480679	161480679	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:161480679G>A	ENST00000271450.6	+	5	713	c.675G>A	c.(673-675)gcG>gcA	p.A225A	FCGR2A_ENST00000367972.4_Silent_p.A224A|RP11-25K21.6_ENST00000537821.2_RNA	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	225					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A224A(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGTCATTGCGACTGCTGTAG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	1											224.0	226.0	225.0					1																	161480679		2203	4300	6503	159747303	SO:0001819	synonymous_variant	2212			J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.675G>A	1.37:g.161480679G>A		Unknown		x	x	x	159747303	Q8WUN1|Q8WW64	Silent	SNP	ENST00000271450.6	37	CCDS44264.1	SNP	37	Broad																																																																																				0.502	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642		Silent
PFKFB2	5208	broad.mit.edu	37	1	207236504	207236504	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:207236504G>T	ENST00000367080.3	+	5	449	c.325G>T	c.(325-327)Gcg>Tcg	p.A109S	PFKFB2_ENST00000411990.2_Missense_Mutation_p.A11S|PFKFB2_ENST00000541914.1_5'Flank|PFKFB2_ENST00000367079.2_Missense_Mutation_p.A109S|PFKFB2_ENST00000545806.1_Missense_Mutation_p.A76S	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	109	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)	p.A109S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					TGCTCTGGTGGCGCTGGAAGA	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											200.0	178.0	185.0					1																	207236504		2203	4300	6503	205303127	SO:0001583	missense	5208				CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.325G>T	1.37:g.207236504G>T	ENSP00000356047:p.Ala109Ser	Unknown		x	x	x	205303127	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	37	CCDS31004.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.378787	0.95945	.	.	ENSG00000123836	ENST00000411990;ENST00000367080;ENST00000367079;ENST00000545806	.	.	.	5.32	5.32	0.75619	6-phosphofructo-2-kinase (1);	0.000000	0.85682	D	0.000000	D	0.83986	0.5373	M	0.85777	2.775	0.80722	D	1	P;D;P	0.76494	0.885;0.999;0.869	P;D;P	0.91635	0.874;0.999;0.902	D	0.85478	0.1177	9	0.59425	D	0.04	.	18.1693	0.89740	0.0:0.0:1.0:0.0	.	11;109;109	B4DY91;Q5VVQ3;O60825	.;.;F262_HUMAN	S	11;109;109;76	.	ENSP00000356046:A109S	A	+	1	0	PFKFB2	205303127	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.575000	0.98187	2.767000	0.95098	0.655000	0.94253	GCG		0.498	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1			Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	216497643	216497643	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:216497643T>A	ENST00000307340.3	-	7	1581	c.1195A>T	c.(1195-1197)Att>Ttt	p.I399F	USH2A_ENST00000366943.2_Missense_Mutation_p.I399F|USH2A_ENST00000366942.3_Missense_Mutation_p.I399F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	399	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.I399F(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCCTTTGAATCCTTATTTCC	0.313										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											86.0	91.0	89.0					1																	216497643		2200	4295	6495	214564266	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1195A>T	1.37:g.216497643T>A	ENSP00000305941:p.Ile399Phe	Unknown		x	x	x	214564266	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	28.1	4.888963	0.91814	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;D;D	0.82255	-1.59;-1.59;-1.59	5.7	5.7	0.88788	Laminin, N-terminal (3);	0.305510	0.22328	N	0.061507	D	0.92146	0.7510	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.985	D	0.93323	0.6694	10	0.87932	D	0	.	15.9583	0.79906	0.0:0.0:0.0:1.0	.	399;399	O75445-2;O75445	.;USH2A_HUMAN	F	399	ENSP00000305941:I399F;ENSP00000355910:I399F;ENSP00000355909:I399F	ENSP00000305941:I399F	I	-	1	0	USH2A	214564266	1.000000	0.71417	0.991000	0.47740	0.975000	0.68041	7.760000	0.85248	2.171000	0.68590	0.533000	0.62120	ATT		0.313	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Missense_Mutation
OBSCN	84033	broad.mit.edu	37	1	228404884	228404884	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:228404884G>T	ENST00000422127.1	+	8	2592	c.2548G>T	c.(2548-2550)Ggg>Tgg	p.G850W	OBSCN_ENST00000570156.2_Missense_Mutation_p.G850W|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.G850W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	850	Ig-like 8.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.G850W(2)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGAGGATGTGGGGACGCGGCA	0.647																																																2	Substitution - Missense(2)	ovary(2)	1											55.0	64.0	61.0					1																	228404884		2152	4256	6408	226471507	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2548G>T	1.37:g.228404884G>T	ENSP00000409493:p.Gly850Trp	Unknown		x	x	x	226471507	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	.	8.718	0.913672	0.17907	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.51817	0.69;0.69	4.94	4.02	0.46733	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.246656	0.32372	N	0.006193	T	0.75236	0.3822	H	0.94808	3.585	0.37171	D	0.903054	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.84336	0.0524	10	0.87932	D	0	.	11.9532	0.52966	0.0847:0.0:0.9153:0.0	.	850;850	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	850	ENSP00000284548:G850W;ENSP00000409493:G850W	ENSP00000284548:G850W	G	+	1	0	OBSCN	226471507	1.000000	0.71417	0.032000	0.17829	0.126000	0.20510	8.185000	0.89704	1.308000	0.44962	0.655000	0.94253	GGG		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		Missense_Mutation
RYR2	6262	broad.mit.edu	37	1	237802398	237802398	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr1:237802398G>C	ENST00000366574.2	+	46	7329	c.7012G>C	c.(7012-7014)Gaa>Caa	p.E2338Q	RYR2_ENST00000542537.1_Missense_Mutation_p.E2322Q|RYR2_ENST00000360064.6_Missense_Mutation_p.E2336Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2338	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.E2336Q(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTGAGAGGAGAAGGTGGGAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											127.0	129.0	128.0					1																	237802398		1932	4126	6058	235869021	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7012G>C	1.37:g.237802398G>C	ENSP00000355533:p.Glu2338Gln	Unknown		x	x	x	235869021	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017493	0.93404	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97959	-4.63;-4.6;-4.62	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000007	D	0.98645	0.9546	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99572	1.0971	10	0.59425	D	0.04	.	18.7649	0.91868	0.0:0.0:1.0:0.0	.	2338	Q92736	RYR2_HUMAN	Q	2338;2336;2322	ENSP00000355533:E2338Q;ENSP00000353174:E2336Q;ENSP00000443798:E2322Q	ENSP00000353174:E2336Q	E	+	1	0	RYR2	235869021	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.675000	0.98638	2.498000	0.84270	0.561000	0.74099	GAA		0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Missense_Mutation
MRC1	4360	broad.mit.edu	37	10	17865237	17865237	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:17865237G>A	ENST00000331429.2	+	2	329	c.226G>A	c.(226-228)Gga>Aga	p.G76R	MRC1L1_ENST00000457317.1_Missense_Mutation_p.G76R														p.G76R(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATTATGCCTGGGAGTGCCATC	0.453																																																1	Substitution - Missense(1)	ovary(1)	10											157.0	158.0	158.0					10																	17865237		2032	3964	5996	17905243	SO:0001583	missense	4360																														ENST00000331429.2:c.226G>A	10.37:g.17865237G>A	ENSP00000332124:p.Gly76Arg	Unknown		x	x	x	17905243		Missense_Mutation	SNP	ENST00000331429.2	37		SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217301	0.79352	.	.	ENSG00000183748	ENST00000331429;ENST00000457317	T;T	0.26223	1.75;1.75	4.17	4.17	0.49024	.	0.000000	0.50627	D	0.000101	T	0.52980	0.1768	.	.	.	0.42157	D	0.991584	D	0.89917	1.0	D	0.97110	1.0	T	0.64748	-0.6334	8	0.87932	D	0	.	16.7185	0.85404	0.0:0.0:1.0:0.0	.	76	B9EJA8	.	R	76	ENSP00000332124:G76R;ENSP00000391843:G76R	ENSP00000332124:G76R	G	+	1	0	AL928580.1	17905243	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	8.814000	0.91968	2.162000	0.67917	0.552000	0.68991	GGA		0.453	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1			Missense_Mutation
DNA2	1763	broad.mit.edu	37	10	70176609	70176609	+	Missense_Mutation	SNP	C	C	A	rs552381837		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:70176609C>A	ENST00000358410.3	-	20	3021	c.2971G>T	c.(2971-2973)Ggt>Tgt	p.G991C	DNA2_ENST00000399180.2_Missense_Mutation_p.G1077C|DNA2_ENST00000399179.2_Missense_Mutation_p.G753C	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	991	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AAGAGTTCACCAACCTGTAAG	0.363																																																0			10											50.0	49.0	49.0					10																	70176609		1847	4095	5942	69846615	SO:0001583	missense	1763			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2971G>T	10.37:g.70176609C>A	ENSP00000351185:p.Gly991Cys	Unknown		x	x	x	69846615	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.540179|4.540179	0.85917|0.85917	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410|ENST00000440722	D;D;D|.	0.96300|.	-3.97;-3.97;-3.97|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.126710|.	0.53938|.	D|.	0.000051|.	D|D	0.90518|0.90518	0.7029|0.7029	H|H	0.97940|0.97940	4.11|4.11	0.47037|0.47037	D|D	0.999299|0.999299	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.94201|0.94201	0.7450|0.7450	10|5	0.87932|.	D|.	0|.	.|.	18.4906|18.4906	0.90846|0.90846	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	753;991|.	F8VR31;P51530|.	.;DNA2L_HUMAN|.	C|L	753;1077;753;991|312	ENSP00000382133:G1077C;ENSP00000382132:G753C;ENSP00000351185:G991C|.	ENSP00000351185:G991C|.	G|W	-|-	1|2	0|0	DNA2|DNA2	69846615|69846615	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	7.320000|7.320000	0.79064|0.79064	2.356000|2.356000	0.79943|0.79943	0.655000|0.655000	0.94253|0.94253	GGT|TGG		0.363	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2			Missense_Mutation
CDH23	64072	broad.mit.edu	37	10	73558212	73558212	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:73558212C>T	ENST00000224721.6	+	49	6951	c.6946C>T	c.(6946-6948)Cct>Tct	p.P2316S	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.P71S	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2311	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)	p.P2316S(1)		NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGGGGCCACCCCTGGGACCAC	0.597																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	63.0	61.0					10																	73558212		2002	4172	6174	73228218	SO:0001583	missense	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6946C>T	10.37:g.73558212C>T	ENSP00000224721:p.Pro2316Ser	Unknown		x	x	x	73228218	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606710	0.46527	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.60797	0.16	5.53	5.53	0.82687	Cadherin (3);Cadherin-like (1);	0.196285	0.44285	D	0.000469	T	0.58032	0.2094	L	0.56769	1.78	0.52501	D	0.999959	B;B	0.32893	0.107;0.389	B;B	0.36766	0.1;0.232	T	0.53472	-0.8434	10	0.16896	T	0.51	.	19.4544	0.94882	0.0:1.0:0.0:0.0	.	2311;2311	E9PEX1;Q9H251	.;CAD23_HUMAN	S	2316;2311;2314;71	ENSP00000381768:P71S	ENSP00000224721:P2316S	P	+	1	0	CDH23	73228218	0.940000	0.31905	0.770000	0.31555	0.400000	0.30750	3.959000	0.56744	2.610000	0.88304	0.655000	0.94253	CCT		0.597	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836		Missense_Mutation
C10orf55	414236	broad.mit.edu	37	10	75673483	75673483	+	Intron	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:75673483C>G	ENST00000409178.1	-	3	268				PLAU_ENST00000446342.1_Missense_Mutation_p.P199R|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372764.3_Missense_Mutation_p.P216R|PLAU_ENST00000372762.4_Missense_Mutation_p.P180R|C10orf55_ENST00000412307.2_Intron	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55									p.P216R(1)		endometrium(1)	1	Prostate(51;0.0112)					CTCATCAGCCCTTGCTGGGTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	10											39.0	45.0	43.0					10																	75673483		2203	4300	6503	75343489	SO:0001627	intron_variant	5328				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-650G>C	10.37:g.75673483C>G		Unknown		x	x	x	75343489	Q3KRG4|Q8NAK4	Missense_Mutation	SNP	ENST00000409178.1	37	CCDS53541.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702124	0.88924	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	T;T;T	0.32272	1.46;1.46;1.46	5.25	5.25	0.73442	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.102548	0.64402	D	0.000002	T	0.42131	0.1189	N	0.25789	0.76	0.80722	D	1	P;D;D;P	0.76494	0.943;0.978;0.999;0.47	P;P;D;B	0.70716	0.64;0.754;0.97;0.093	T	0.35076	-0.9803	10	0.87932	D	0	.	14.7078	0.69203	0.0:1.0:0.0:0.0	.	199;180;216;216	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	R	199;216;180;180	ENSP00000388474:P199R;ENSP00000361850:P216R;ENSP00000361848:P180R	ENSP00000361847:P180R	P	+	2	0	PLAU	75343489	0.985000	0.35326	1.000000	0.80357	0.992000	0.81027	5.798000	0.69095	2.597000	0.87782	0.650000	0.86243	CCT		0.602	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791		Missense_Mutation
DLG5	9231	broad.mit.edu	37	10	79569428	79569428	+	Silent	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:79569428G>T	ENST00000372391.2	-	24	4529	c.4524C>A	c.(4522-4524)tcC>tcA	p.S1508S	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Silent_p.S1168S	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1508	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.S1508S(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GCTCCAGCTGGGACTTTTTGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	10											189.0	190.0	189.0					10																	79569428		2203	4300	6503	79239434	SO:0001819	synonymous_variant	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4524C>A	10.37:g.79569428G>T		Unknown		x	x	x	79239434	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	ENST00000372391.2	37	CCDS7353.2	SNP	43	Broad																																																																																				0.547	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			Silent
CYP2C19	1557	broad.mit.edu	37	10	96602603	96602603	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:96602603A>G	ENST00000371321.3	+	7	1053	c.971A>G	c.(970-972)cAg>cGg	p.Q324R	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	324					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)	p.Q324R(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	GCTAAAGTCCAGGAAGAGATT	0.488																																																1	Substitution - Missense(1)	ovary(1)	10											141.0	128.0	132.0					10																	96602603		2203	4300	6503	96592593	SO:0001583	missense	1557			M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.971A>G	10.37:g.96602603A>G	ENSP00000360372:p.Gln324Arg	Unknown		x	x	x	96592593	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Missense_Mutation	SNP	ENST00000371321.3	37	CCDS7436.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	15.73	2.920663	0.52653	.	.	ENSG00000165841	ENST00000371321	T	0.09723	2.95	3.37	3.37	0.38596	.	0.173419	0.39083	U	0.001475	T	0.15609	0.0376	M	0.62016	1.91	0.32294	N	0.565853	P	0.43094	0.799	P	0.45071	0.468	T	0.11203	-1.0597	10	0.56958	D	0.05	.	10.0786	0.42375	1.0:0.0:0.0:0.0	.	324	P33261	CP2CJ_HUMAN	R	324	ENSP00000360372:Q324R	ENSP00000360372:Q324R	Q	+	2	0	CYP2C19	96592593	1.000000	0.71417	0.989000	0.46669	0.764000	0.43329	6.770000	0.74990	1.302000	0.44855	0.414000	0.27820	CAG		0.488	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049490.1	NM_000769		Missense_Mutation
SLK	9748	broad.mit.edu	37	10	105768064	105768064	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:105768064G>T	ENST00000369755.3	+	12	3279	c.2734G>T	c.(2734-2736)Gag>Tag	p.E912*	SLK_ENST00000335753.4_Nonsense_Mutation_p.E912*|SLK_ENST00000474260.1_3'UTR	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	912					apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.E912*(1)		kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGGAGAACAAGAGAAAGAGTT	0.363																																					NSCLC(111;540 1651 1927 4474 17706)											1	Substitution - Nonsense(1)	ovary(1)	10											79.0	79.0	79.0					10																	105768064		2203	4300	6503	105758054	SO:0001587	stop_gained	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.2734G>T	10.37:g.105768064G>T	ENSP00000358770:p.Glu912*	Somatic		x	x	x	105758054	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Nonsense_Mutation	SNP	ENST00000369755.3	37	CCDS7553.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	46	12.657210	0.99686	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	.	.	.	5.94	4.99	0.66335	.	0.093460	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.6436	0.85155	0.0:0.1296:0.8704:0.0	.	.	.	.	X	912	.	ENSP00000336824:E912X	E	+	1	0	SLK	105758054	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.934000	0.87649	2.820000	0.97059	0.650000	0.86243	GAG		0.363	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720		Nonsense_Mutation
CUZD1	50624	broad.mit.edu	37	10	124598699	124598699	+	Silent	SNP	G	G	A	rs141440856		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr10:124598699G>A	ENST00000368904.1	-	5	1231	c.282C>T	c.(280-282)gaC>gaT	p.D94D	CUZD1_ENST00000545804.1_Silent_p.D94D|CUZD1_ENST00000392790.1_Silent_p.D94D					CUB and zona pellucida-like domains 1									p.D94D(1)		NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TGGAGGTTCCGTCAAAGACTT	0.433													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20863	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	10						G		0,4406		0,0,2203	181.0	169.0	173.0		282	-2.7	0.0	10	dbSNP_134	173	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CUZD1	NM_022034.5		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		94/608	124598699	2,13004	2203	4300	6503	124588689	SO:0001819	synonymous_variant	50624			AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.282C>T	10.37:g.124598699G>A		Unknown		x	x	x	124588689		Silent	SNP	ENST00000368904.1	37	CCDS7631.1	SNP	40	Broad																																																																																				0.433	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2	NM_022034		Silent
ANO5	203859	broad.mit.edu	37	11	22294385	22294385	+	Silent	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:22294385T>A	ENST00000324559.8	+	19	2402	c.2085T>A	c.(2083-2085)ctT>ctA	p.L695L	ANO5_ENST00000532043.1_3'UTR	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	695					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.L695L(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGGCTCCTCTTCTTGCTCTCA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	11											141.0	125.0	130.0					11																	22294385		2203	4300	6503	22250961	SO:0001819	synonymous_variant	203859			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.2085T>A	11.37:g.22294385T>A		Somatic		x	x	x	22250961		Silent	SNP	ENST00000324559.8	37	CCDS31444.1	SNP	62	Broad																																																																																				0.383	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599		Silent
API5	8539	broad.mit.edu	37	11	43342382	43342382	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:43342382A>C	ENST00000531273.1	+	3	382	c.243A>C	c.(241-243)caA>caC	p.Q81H	API5_ENST00000455725.2_Missense_Mutation_p.Q70H|API5_ENST00000420461.2_Missense_Mutation_p.Q27H|API5_ENST00000534600.1_Missense_Mutation_p.Q81H|API5_ENST00000534695.1_Intron|API5_ENST00000378852.3_Missense_Mutation_p.Q81H			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	81	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)	p.Q81H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TTCGACGTCAAGCAATTAAAG	0.323																																					Pancreas(1;98 122 5625 20895 49453)											1	Substitution - Missense(1)	ovary(1)	11											95.0	101.0	99.0					11																	43342382		2203	4300	6503	43298958	SO:0001583	missense	8539			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.243A>C	11.37:g.43342382A>C	ENSP00000431391:p.Gln81His	Unknown		x	x	x	43298958	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	ENST00000531273.1	37	CCDS44572.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249707	0.80024	.	.	ENSG00000166181	ENST00000455725;ENST00000531273;ENST00000420461;ENST00000378852;ENST00000534600	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	6.13	1.22	0.21188	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	M	0.76727	2.345	0.54753	D	0.999982	D;D;D;D	0.65815	0.995;0.989;0.995;0.986	D;P;D;P	0.65323	0.916;0.832;0.934;0.724	T	0.53351	-0.8451	10	0.66056	D	0.02	-24.0468	9.8823	0.41240	0.7397:0.0:0.2603:0.0	.	27;81;70;81	B4DGR0;Q9BZZ5;B4E283;Q9BZZ5-2	.;API5_HUMAN;.;.	H	70;81;27;81;81	ENSP00000399341:Q70H;ENSP00000431391:Q81H;ENSP00000402540:Q27H;ENSP00000368129:Q81H;ENSP00000434462:Q81H	ENSP00000368129:Q81H	Q	+	3	2	API5	43298958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.126000	0.31344	0.208000	0.20626	0.529000	0.55759	CAA		0.323	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595		Missense_Mutation
B3GAT3	26229	broad.mit.edu	37	11	62384507	62384507	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:62384507G>A	ENST00000265471.5	-	3	797	c.570C>T	c.(568-570)gtC>gtT	p.V190V	B3GAT3_ENST00000531383.1_Silent_p.V190V|B3GAT3_ENST00000534026.1_Silent_p.V190V	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	190					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)	p.V190V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						CAGCAAAGTAGACGACTCCTT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	11											120.0	121.0	121.0					11																	62384507		2202	4299	6501	62141083	SO:0001819	synonymous_variant	26229			AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.570C>T	11.37:g.62384507G>A		Unknown		x	x	x	62141083	B7ZAB3|Q96I06|Q9UEP0	Silent	SNP	ENST00000265471.5	37	CCDS8025.1	SNP	33	Broad																																																																																				0.627	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200		Silent
ALG8	79053	broad.mit.edu	37	11	77832111	77832111	+	Splice_Site	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:77832111G>A	ENST00000299626.5	-	4	549	c.478C>T	c.(478-480)Cat>Tat	p.H160Y	ALG8_ENST00000376156.3_Splice_Site_p.H160Y|ALG8_ENST00000532552.2_Intron	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	160					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)	p.H160N(1)|p.H160Y(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			TCAAGGATACGGTCCACAATT	0.323																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	11											158.0	150.0	153.0					11																	77832111		2200	4292	6492	77509759	SO:0001630	splice_region_variant	79053			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.478+1C>T	11.37:g.77832111G>A		Unknown		x	x	x	77509759	A6NDW6|O60860	Missense_Mutation	SNP	ENST00000299626.5	37	CCDS8258.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726563	0.89298	.	.	ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000525755;ENST00000530454;ENST00000525870;ENST00000527099	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.81	5.81	0.92471	.	0.042496	0.85682	D	0.000000	D	0.93344	0.7878	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.74674	0.984;0.984;0.984	D	0.92952	0.6381	9	.	.	.	-12.3946	20.0833	0.97789	0.0:0.0:1.0:0.0	.	160;160;160	B3KQL8;Q9BVK2;A6NDW6	.;ALG8_HUMAN;.	Y	160;160;109;161;72;72	ENSP00000299626:H160Y;ENSP00000365326:H160Y;ENSP00000435467:H109Y;ENSP00000434660:H161Y;ENSP00000435417:H72Y;ENSP00000436064:H72Y	.	H	-	1	0	ALG8	77509759	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	8.502000	0.90505	2.756000	0.94617	0.655000	0.94253	CAT		0.323	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079	Missense_Mutation	Missense_Mutation
MED17	9440	broad.mit.edu	37	11	93527011	93527011	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:93527011A>G	ENST00000251871.3	+	4	1042	c.755A>G	c.(754-756)gAg>gGg	p.E252G		NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	252					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.E252G(1)		large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGTGATTTAGAGGGGTCTGCA	0.308																																																1	Substitution - Missense(1)	ovary(1)	11											75.0	74.0	75.0					11																	93527011		2201	4298	6499	93166659	SO:0001583	missense	9440			AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.755A>G	11.37:g.93527011A>G	ENSP00000251871:p.Glu252Gly	Unknown		x	x	x	93166659	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	37	CCDS8295.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	27.9	4.871715	0.91587	.	.	ENSG00000042429	ENST00000251871;ENST00000427225	T	0.55052	0.54	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66790	0.2825	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.68469	-0.5400	10	0.59425	D	0.04	-28.5212	15.8545	0.78965	1.0:0.0:0.0:0.0	.	252	Q9NVC6	MED17_HUMAN	G	252;222	ENSP00000251871:E252G	ENSP00000251871:E252G	E	+	2	0	MED17	93166659	1.000000	0.71417	0.988000	0.46212	0.963000	0.63663	9.221000	0.95188	2.160000	0.67779	0.533000	0.62120	GAG		0.308	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268		Missense_Mutation
TRIM29	23650	broad.mit.edu	37	11	119996570	119996570	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:119996570A>T	ENST00000341846.5	-	4	1583	c.1162T>A	c.(1162-1164)Tct>Act	p.S388T	TRIM29_ENST00000541857.1_Missense_Mutation_p.S121T|TRIM29_ENST00000528870.1_5'Flank|TRIM29_ENST00000524816.3_5'Flank|TRIM29_ENST00000529044.1_Missense_Mutation_p.S127T	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	388					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S388T(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		GGGGGGAGAGAGTAATTGCTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											63.0	59.0	60.0					11																	119996570		2199	4295	6494	119501780	SO:0001583	missense	23650			AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1162T>A	11.37:g.119996570A>T	ENSP00000343129:p.Ser388Thr	Unknown		x	x	x	119501780	Q96AA9|Q9BZY7	Missense_Mutation	SNP	ENST00000341846.5	37	CCDS8428.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	8.085	0.773259	0.16051	.	.	ENSG00000137699	ENST00000341846;ENST00000541857;ENST00000529044	T	0.38722	1.12	4.09	4.09	0.47781	.	0.556436	0.17301	N	0.179254	T	0.22666	0.0547	N	0.14661	0.345	0.27107	N	0.962476	B;B;B	0.34290	0.447;0.106;0.003	B;B;B	0.35550	0.205;0.042;0.004	T	0.07558	-1.0766	9	.	.	.	.	5.1569	0.15040	0.6308:0.2021:0.0:0.1671	.	121;127;388	B7Z8U9;E9PRL4;Q14134	.;.;TRI29_HUMAN	T	388;121;127	ENSP00000343129:S388T	.	S	-	1	0	TRIM29	119501780	0.935000	0.31712	1.000000	0.80357	0.986000	0.74619	1.658000	0.37376	1.858000	0.53909	0.533000	0.62120	TCT		0.532	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101		Missense_Mutation
ST14	6768	broad.mit.edu	37	11	130060474	130060474	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr11:130060474T>G	ENST00000278742.5	+	7	1178	c.760T>G	c.(760-762)Tca>Gca	p.S254A		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	254	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S254A(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GGACGCCGACTCAGTGCTGAG	0.692																																																1	Substitution - Missense(1)	ovary(1)	11											34.0	28.0	30.0					11																	130060474		2201	4297	6498	129565684	SO:0001583	missense	6768			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.760T>G	11.37:g.130060474T>G	ENSP00000278742:p.Ser254Ala	Unknown		x	x	x	129565684	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	37	CCDS8487.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	9.828	1.187643	0.21870	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.35236	1.32	5.55	1.79	0.24919	CUB (5);	1.326450	0.05642	N	0.583598	T	0.30916	0.0780	L	0.60067	1.865	0.09310	N	1	B;B	0.30563	0.285;0.064	B;B	0.31946	0.138;0.05	T	0.25950	-1.0117	10	0.16896	T	0.51	.	1.5758	0.02624	0.1458:0.1573:0.166:0.5309	.	64;254	B4DYI7;Q9Y5Y6	.;ST14_HUMAN	A	254;156	ENSP00000278742:S254A	ENSP00000278742:S254A	S	+	1	0	ST14	129565684	0.000000	0.05858	0.002000	0.10522	0.537000	0.34900	-0.474000	0.06607	0.365000	0.24400	0.528000	0.53228	TCA		0.692	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1			Missense_Mutation
LRTM2	654429	broad.mit.edu	37	12	1943779	1943779	+	Silent	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:1943779C>T	ENST00000543818.1	+	5	1847	c.1005C>T	c.(1003-1005)taC>taT	p.Y335Y	CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000299194.1_Silent_p.Y335Y|CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000535041.1_Silent_p.Y335Y|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585708.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	335						integral component of membrane (GO:0016021)		p.Y335Y(2)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GCTGCATCTACGCCTCCCTCA	0.637																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	12											44.0	40.0	42.0					12																	1943779		2200	4284	6484	1814040	SO:0001819	synonymous_variant	654429			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.1005C>T	12.37:g.1943779C>T		Unknown		x	x	x	1814040	A7E2U6	Silent	SNP	ENST00000543818.1	37	CCDS31726.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	4.723	0.134459	0.09032	.	.	ENSG00000166159	ENST00000424079	.	.	.	5.3	-5.34	0.02705	.	.	.	.	.	T	0.70430	0.3223	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76233	-0.3034	5	0.87932	D	0	.	15.8497	0.78921	0.0:0.2259:0.0:0.7741	.	.	.	.	C	92	.	ENSP00000394967:R92C	R	+	1	0	LRTM2	1814040	0.021000	0.18746	0.908000	0.35775	0.520000	0.34377	-0.805000	0.04530	-1.063000	0.03177	-1.036000	0.02392	CGC		0.637	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1			Silent
VWF	7450	broad.mit.edu	37	12	6101019	6101019	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:6101019G>C	ENST00000261405.5	-	38	7018	c.6764C>G	c.(6763-6765)aCt>aGt	p.T2255S		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2255	E2.|VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T2255S(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AATGCACTGAGTGCAGGCCTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	12											76.0	65.0	69.0					12																	6101019		2203	4300	6503	5971280	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6764C>G	12.37:g.6101019G>C	ENSP00000261405:p.Thr2255Ser	Unknown		x	x	x	5971280	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	g	12.41	1.930436	0.34096	.	.	ENSG00000110799	ENST00000261405	T	0.35421	1.31	5.66	3.71	0.42584	von Willebrand factor, type C (1);Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	0.151614	0.30890	N	0.008665	T	0.26702	0.0653	L	0.42245	1.32	0.80722	D	1	B	0.17465	0.022	B	0.19946	0.027	T	0.05402	-1.0887	10	0.06891	T	0.86	.	11.5558	0.50748	0.0:0.1351:0.7247:0.1403	.	2255	P04275	VWF_HUMAN	S	2255	ENSP00000261405:T2255S	ENSP00000261405:T2255S	T	-	2	0	VWF	5971280	1.000000	0.71417	0.998000	0.56505	0.731000	0.41821	3.341000	0.52151	1.361000	0.45981	0.655000	0.94253	ACT		0.567	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		Missense_Mutation
PHB2	11331	broad.mit.edu	37	12	7076351	7076351	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:7076351G>C	ENST00000535923.1	-	7	1053	c.772C>G	c.(772-774)Cag>Gag	p.Q258E	PHB2_ENST00000542912.1_Missense_Mutation_p.Q258E|U47924.29_ENST00000606539.1_RNA|SCARNA12_ENST00000459155.1_RNA|PHB2_ENST00000440277.1_Missense_Mutation_p.Q220E|U47924.27_ENST00000537269.1_lincRNA|PHB2_ENST00000399433.2_Missense_Mutation_p.Q258E|PHB2_ENST00000544134.1_5'Flank|MIR141_ENST00000384975.1_RNA|PHB2_ENST00000546111.1_Intron	NM_001144831.1	NP_001138303.1			prohibitin 2									p.Q258E(1)		ovary(2)|pancreas(1)	3						GAGATATTCTGGGCTGCTCGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	12											101.0	107.0	105.0					12																	7076351		1985	4156	6141	6946612	SO:0001583	missense	11331			AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.772C>G	12.37:g.7076351G>C	ENSP00000441875:p.Gln258Glu	Unknown		x	x	x	6946612		Missense_Mutation	SNP	ENST00000535923.1	37	CCDS53741.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513548	0.64522	.	.	ENSG00000215021	ENST00000535923;ENST00000542912;ENST00000399433;ENST00000440277	.	.	.	5.86	5.86	0.93980	.	0.000000	0.64402	U	0.000001	T	0.68100	0.2964	L	0.38692	1.165	0.80722	D	1	P;P	0.46578	0.88;0.773	P;P	0.56865	0.808;0.515	T	0.58584	-0.7611	9	0.16420	T	0.52	-15.2406	20.1865	0.98220	0.0:0.0:1.0:0.0	.	220;258	B4DP75;Q99623	.;PHB2_HUMAN	E	258;258;258;220	.	ENSP00000382362:Q258E	Q	-	1	0	PHB2	6946612	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.677000	0.98645	2.775000	0.95449	0.655000	0.94253	CAG		0.522	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400040.3	NM_007273		Missense_Mutation
CD163L1	283316	broad.mit.edu	37	12	7531654	7531654	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:7531654G>T	ENST00000313599.3	-	9	2348	c.2291C>A	c.(2290-2292)gCc>gAc	p.A764D	CD163L1_ENST00000416109.2_Missense_Mutation_p.A774D|CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000396630.1_Missense_Mutation_p.A764D			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	764	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.A764D(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CCAGAGAGAGGCTTCCCCTCC	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											79.0	75.0	76.0					12																	7531654		2203	4300	6503	7422921	SO:0001583	missense	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2291C>A	12.37:g.7531654G>T	ENSP00000315945:p.Ala764Asp	Unknown		x	x	x	7422921	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.913	0.959295	0.18507	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.35973	1.28;1.28;1.28	2.03	-0.163	0.13363	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.836890	0.03793	U	0.263246	T	0.37461	0.1004	L	0.28649	0.875	0.09310	N	1	P;P	0.45986	0.623;0.87	B;P	0.52598	0.253;0.703	T	0.25117	-1.0141	10	0.39692	T	0.17	.	5.5328	0.16995	0.0:0.2184:0.5588:0.2228	.	774;764	E7EVK4;Q9NR16	.;C163B_HUMAN	D	764;774;764	ENSP00000315945:A764D;ENSP00000393474:A774D;ENSP00000379871:A764D	ENSP00000315945:A764D	A	-	2	0	CD163L1	7422921	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.614000	0.24314	-0.042000	0.13535	0.455000	0.32223	GCC		0.443	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		Missense_Mutation
DIP2B	57609	broad.mit.edu	37	12	51069111	51069111	+	Splice_Site	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:51069111G>C	ENST00000301180.5	+	7	830		c.e7-1			NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TTCCCTTATAGGTGTTCCTGT	0.383																																																1	Unknown(1)	ovary(1)	12											75.0	78.0	77.0					12																	51069111		2203	4300	6503	49355378	SO:0001630	splice_region_variant	57609			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.797-1G>C	12.37:g.51069111G>C		Unknown		x	x	x	49355378	Q6B011|Q8N1L5|Q8NB38	Splice_Site_SNP	SNP	ENST00000301180.5	37	CCDS31799.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345536	0.82022	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9478	0.89044	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DIP2B	49355378	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	9.657000	0.98554	2.460000	0.83146	0.467000	0.42956	.		0.383	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	Intron	Splice_Site_SNP
ITGB7	3695	broad.mit.edu	37	12	53591298	53591298	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:53591298C>T	ENST00000267082.5	-	5	784	c.553G>A	c.(553-555)Gtc>Atc	p.V185I	ITGB7_ENST00000550743.2_Missense_Mutation_p.V185I|ITGB7_ENST00000338737.4_Missense_Mutation_p.V185I|ITGB7_ENST00000422257.3_Missense_Mutation_p.V185I	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	185	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.V185I(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GAATGGGTGACTTCCTGCAGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	77.0	79.0					12																	53591298		2203	4300	6503	51877565	SO:0001583	missense	3695				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.553G>A	12.37:g.53591298C>T	ENSP00000267082:p.Val185Ile	Unknown		x	x	x	51877565	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	6.607	0.480332	0.12581	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89	4.91	3.99	0.46301	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.000000	0.31370	N	0.007774	T	0.76659	0.4018	N	0.03930	-0.32	0.40994	D	0.984872	P;B	0.42296	0.775;0.051	B;B	0.39660	0.306;0.097	T	0.78074	-0.2346	10	0.02654	T	1	.	8.4089	0.32632	0.0:0.7124:0.1998:0.0877	.	185;185	B7Z769;P26010	.;ITB7_HUMAN	I	185	ENSP00000408741:V185I;ENSP00000267082:V185I;ENSP00000345501:V185I;ENSP00000437375:V185I	ENSP00000267082:V185I	V	-	1	0	ITGB7	51877565	0.473000	0.25878	0.797000	0.32132	0.714000	0.41099	0.964000	0.29306	1.108000	0.41662	0.555000	0.69702	GTC		0.612	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2			Missense_Mutation
MARS	4141	broad.mit.edu	37	12	57892256	57892256	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:57892256A>G	ENST00000262027.5	+	9	1075	c.941A>G	c.(940-942)tAt>tGt	p.Y314C	MARS_ENST00000315473.5_Missense_Mutation_p.Y80C|MARS_ENST00000447721.2_3'UTR	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	314					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)	p.Y314C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	ACAGATGAGTATGGTACAGCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											110.0	97.0	101.0					12																	57892256		2203	4300	6503	56178523	SO:0001583	missense	4141			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.941A>G	12.37:g.57892256A>G	ENSP00000262027:p.Tyr314Cys	Unknown		x	x	x	56178523	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	SNP	16	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.5|23.5	4.425693|4.425693	0.83667|0.83667	.|.	.|.	ENSG00000166986|ENSG00000166986	ENST00000552371|ENST00000262027;ENST00000315473	.|T;T	.|0.50277	.|1.2;0.75	4.88|4.88	4.88|4.88	0.63580|0.63580	.|Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	.|0.179422	.|0.49916	.|D	.|0.000131	T|T	0.78451|0.78451	0.4285|0.4285	H|H	0.96662|0.96662	3.86|3.86	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;1.0	D|D	0.85830|0.85830	0.1391|0.1391	5|10	.|0.87932	.|D	.|0	-9.6615|-9.6615	13.7808|13.7808	0.63081|0.63081	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|80;187;314	.|A6NC17;B4E0E9;P56192	.|.;.;SYMC_HUMAN	V|C	147|314;80	.|ENSP00000262027:Y314C;ENSP00000314653:Y80C	.|ENSP00000262027:Y314C	M|Y	+|+	1|2	0|0	MARS|MARS	56178523|56178523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	8.814000|8.814000	0.91968|0.91968	1.965000|1.965000	0.57142|0.57142	0.459000|0.459000	0.35465|0.35465	ATG|TAT		0.562	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990		Missense_Mutation
KITLG	4254	broad.mit.edu	37	12	88912638	88912638	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:88912638G>A	ENST00000228280.5	-	4	381	c.199C>T	c.(199-201)Cat>Tat	p.H67Y	KITLG_ENST00000347404.5_Missense_Mutation_p.H67Y|KITLG_ENST00000378535.4_5'UTR|KITLG_ENST00000357116.4_Intron	NM_000899.4	NP_000890.1	P21583	SCF_HUMAN	KIT ligand	67					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)	p.H67Y(1)		kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						ATCCAACAATGACTTGGCTGC	0.353									Testicular Cancer, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	12											65.0	63.0	64.0					12																	88912638		2203	4300	6503	87436769	SO:0001583	missense	4254	Familial Cancer Database		M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000228280.5:c.199C>T	12.37:g.88912638G>A	ENSP00000228280:p.His67Tyr	Unknown		x	x	x	87436769	A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	Missense_Mutation	SNP	ENST00000228280.5	37	CCDS31868.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186491	0.78789	.	.	ENSG00000049130	ENST00000378535;ENST00000228280;ENST00000347404	T;T	0.70869	-0.52;-0.52	6.05	6.05	0.98169	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.150547	0.64402	D	0.000005	D	0.83681	0.5307	M	0.65498	2.005	0.53005	D	0.999968	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	D	0.84100	0.0395	10	0.87932	D	0	-15.1986	18.3872	0.90470	0.0:0.0:1.0:0.0	.	67;67	P21583-2;P21583	.;SCF_HUMAN	Y	32;67;67	ENSP00000228280:H67Y;ENSP00000054216:H67Y	ENSP00000228280:H67Y	H	-	1	0	KITLG	87436769	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	5.583000	0.67484	2.871000	0.98454	0.637000	0.83480	CAT		0.353	KITLG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406424.2	NM_003994		Missense_Mutation
APAF1	317	broad.mit.edu	37	12	99043373	99043373	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:99043373A>T	ENST00000551964.1	+	4	1173	c.437A>T	c.(436-438)gAa>gTa	p.E146V	APAF1_ENST00000339433.3_Missense_Mutation_p.E146V|APAF1_ENST00000547045.1_Missense_Mutation_p.E146V|APAF1_ENST00000333991.1_Missense_Mutation_p.E146V|APAF1_ENST00000357310.1_Missense_Mutation_p.E146V|APAF1_ENST00000550527.1_Missense_Mutation_p.E135V|APAF1_ENST00000359972.2_Missense_Mutation_p.E135V|APAF1_ENST00000552268.1_Missense_Mutation_p.E146V|APAF1_ENST00000549007.1_Missense_Mutation_p.E146V	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	146	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.E146V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TTGAAAGGTGAACCAGGATGG	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											112.0	102.0	105.0					12																	99043373		2203	4300	6503	97567504	SO:0001583	missense	317			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.437A>T	12.37:g.99043373A>T	ENSP00000448165:p.Glu146Val	Somatic		x	x	x	97567504	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	20.2	3.944712	0.73672	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26;-1.26	5.55	5.55	0.83447	NB-ARC (1);	0.242172	0.47852	D	0.000202	D	0.82949	0.5148	L	0.39898	1.24	0.39044	D	0.960182	B;B;P;B;P	0.52842	0.252;0.315;0.462;0.391;0.956	B;B;B;B;D	0.68943	0.126;0.266;0.192;0.385;0.961	D	0.83768	0.0218	10	0.41790	T	0.15	-3.0119	15.676	0.77321	1.0:0.0:0.0:0.0	.	146;146;135;146;135	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	V	146;135;146;146;146;146;135;146;146	ENSP00000448165:E146V;ENSP00000353059:E135V;ENSP00000349862:E146V;ENSP00000341830:E146V;ENSP00000334558:E146V;ENSP00000448826:E146V;ENSP00000448449:E135V;ENSP00000449791:E146V;ENSP00000448161:E146V	ENSP00000334558:E146V	E	+	2	0	APAF1	97567504	0.995000	0.38212	0.729000	0.30791	0.867000	0.49689	3.418000	0.52721	2.109000	0.64355	0.533000	0.62120	GAA		0.463	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1		Missense_Mutation
CRY1	1407	broad.mit.edu	37	12	107395058	107395058	+	Splice_Site	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:107395058T>A	ENST00000008527.5	-	5	1551	c.684A>T	c.(682-684)aaA>aaT	p.K228N		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	228					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)	p.K228N(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						ATTATCATACTTTTCTTTCCA	0.328																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	97.0	96.0					12																	107395058		2203	4300	6503	105919188	SO:0001630	splice_region_variant	1407			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.684+1A>T	12.37:g.107395058T>A		Unknown		x	x	x	105919188		Missense_Mutation	SNP	ENST00000008527.5	37	CCDS9112.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	19.16	3.773080	0.69992	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.72	3.41	0.39046	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.44117	0.1278	L	0.48362	1.52	0.80722	D	1	P	0.41710	0.76	B	0.42163	0.378	T	0.26052	-1.0114	8	.	.	.	-21.805	7.262	0.26209	0.0:0.3581:0.0:0.6419	.	228	Q16526	CRY1_HUMAN	N	228	.	.	K	-	3	2	CRY1	105919188	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.497000	0.45354	1.007000	0.39238	0.455000	0.32223	AAA		0.328	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406827.1	NM_004075	Missense_Mutation	Missense_Mutation
CMKLR1	1240	broad.mit.edu	37	12	108686410	108686410	+	Silent	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:108686410G>C	ENST00000312143.7	-	3	693	c.330C>G	c.(328-330)gcC>gcG	p.A110A	CMKLR1_ENST00000397688.2_Silent_p.A108A|CMKLR1_ENST00000412676.1_Silent_p.A110A|CMKLR1_ENST00000550402.1_Silent_p.A110A|CMKLR1_ENST00000552995.1_Silent_p.A108A	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	110					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.A108A(1)		endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						TCTTGCACATGGCTGTCCCGA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	12											138.0	143.0	142.0					12																	108686410		2151	4251	6402	107210540	SO:0001819	synonymous_variant	1240			U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.330C>G	12.37:g.108686410G>C		Unknown		x	x	x	107210540	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Silent	SNP	ENST00000312143.7	37	CCDS44965.1	SNP	47	Broad																																																																																				0.532	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404867.1			Silent
MED13L	23389	broad.mit.edu	37	12	116421066	116421066	+	Missense_Mutation	SNP	G	G	A	rs138117728		TCGA-13-0923-01	TCGA-13-0923-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr12:116421066G>A	ENST00000281928.3	-	21	5017	c.4811C>T	c.(4810-4812)tCt>tTt	p.S1604F		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1604	Ser-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.S1604F(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GAATCCTGAAGAAGAGGTAGT	0.532																																																1	Substitution - Missense(1)	ovary(1)	12											99.0	95.0	96.0					12																	116421066		2203	4300	6503	114905449	SO:0001583	missense	23389			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.4811C>T	12.37:g.116421066G>A	ENSP00000281928:p.Ser1604Phe	Somatic		x	x	x	114905449	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	SNP	33	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.75|19.75	3.885532|3.885532	0.72410|0.72410	.|.	.|.	ENSG00000123066|ENSG00000123066	ENST00000549786|ENST00000281928	.|T	.|0.75704	.|-0.96	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.099373	.|0.45606	.|D	.|0.000359	T|T	0.67915|0.67915	0.2944|0.2944	N|N	0.14661|0.14661	0.345|0.345	0.41319|0.41319	D|D	0.987166|0.987166	.|P	.|0.37864	.|0.61	.|B	.|0.41988	.|0.372	T|T	0.70699|0.70699	-0.4800|-0.4800	5|10	.|0.66056	.|D	.|0.02	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1604	.|Q71F56	.|MD13L_HUMAN	F|F	59|1604	.|ENSP00000281928:S1604F	.|ENSP00000281928:S1604F	L|S	-|-	1|2	0|0	MED13L|MED13L	114905449|114905449	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.366000|6.366000	0.73095|0.73095	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CTT|TCT		0.532	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3			Missense_Mutation
EFNB2	1948	broad.mit.edu	37	13	107145608	107145608	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr13:107145608G>A	ENST00000245323.4	-	5	931	c.782C>T	c.(781-783)cCg>cTg	p.P261L		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	261					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)	p.P261L(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CGTGTGCTGCGGCGAGTGCTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	13											150.0	115.0	127.0					13																	107145608		2203	4300	6503	105943609	SO:0001583	missense	1948			L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.782C>T	13.37:g.107145608G>A	ENSP00000245323:p.Pro261Leu	Unknown		x	x	x	105943609	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	37	CCDS9507.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.135729	0.94517	.	.	ENSG00000125266	ENST00000245323	D	0.90563	-2.69	5.81	5.81	0.92471	.	0.144593	0.64402	D	0.000005	D	0.88070	0.6338	L	0.43152	1.355	0.80722	D	1	P	0.52692	0.955	B	0.39876	0.312	D	0.89187	0.3548	10	0.62326	D	0.03	.	20.0825	0.97783	0.0:0.0:1.0:0.0	.	261	P52799	EFNB2_HUMAN	L	261	ENSP00000245323:P261L	ENSP00000245323:P261L	P	-	2	0	EFNB2	105943609	1.000000	0.71417	0.922000	0.36590	0.997000	0.91878	9.787000	0.99055	2.746000	0.94184	0.655000	0.94253	CCG		0.567	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093		Missense_Mutation
CEBPE	1053	broad.mit.edu	37	14	23586742	23586742	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr14:23586742A>G	ENST00000206513.5	-	2	1324	c.800T>C	c.(799-801)aTt>aCt	p.I267T		NM_001805.3	NP_001796.2	Q15744	CEBPE_HUMAN	CCAAT/enhancer binding protein (C/EBP), epsilon	267	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to lipopolysaccharide (GO:0071222)|cytokine biosynthetic process (GO:0042089)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|macrophage differentiation (GO:0030225)|phagocytosis (GO:0006909)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.I267T(1)		large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0064)		CGCCTCAGGAATCTGGCGGAA	0.652																																					NSCLC(63;1230 1818 14565 22565)											1	Substitution - Missense(1)	ovary(1)	14											47.0	37.0	40.0					14																	23586742		2203	4300	6503	22656582	SO:0001583	missense	1053				CCDS9589.1	14q11.2	2014-09-17			ENSG00000092067	ENSG00000092067		"""basic leucine zipper proteins"""	1836	protein-coding gene	gene with protein product		600749				8661101	Standard	NM_001805		Approved	CRP1	uc001wiv.2	Q15744	OTTHUMG00000028719	ENST00000206513.5:c.800T>C	14.37:g.23586742A>G	ENSP00000206513:p.Ile267Thr	Unknown		x	x	x	22656582	Q15745|Q8IYI2|Q99803	Missense_Mutation	SNP	ENST00000206513.5	37	CCDS9589.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	23.4	4.410402	0.83340	.	.	ENSG00000092067	ENST00000206513	T	0.42131	0.98	5.49	5.49	0.81192	Basic-leucine zipper (bZIP) transcription factor (1);	0.057568	0.64402	D	0.000002	T	0.35068	0.0919	L	0.29908	0.895	0.52501	D	0.999957	P	0.47409	0.895	B	0.42030	0.373	T	0.28776	-1.0033	10	0.87932	D	0	-18.2637	14.5645	0.68165	1.0:0.0:0.0:0.0	.	267	Q15744	CEBPE_HUMAN	T	267	ENSP00000206513:I267T	ENSP00000206513:I267T	I	-	2	0	CEBPE	22656582	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.189000	0.94928	2.084000	0.62774	0.533000	0.62120	ATT		0.652	CEBPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071716.2	NM_001805		Missense_Mutation
TRIP11	9321	broad.mit.edu	37	14	92472704	92472704	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0923-01	TCGA-13-0923-10			T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr14:92472704T>G	ENST00000267622.4	-	11	1989	c.1616A>C	c.(1615-1617)gAa>gCa	p.E539A		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	539					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.E539A(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCTCTTTTTTTCATCATTTAG	0.303			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - Missense(1)	ovary(1)	14											73.0	68.0	70.0					14																	92472704		2203	4292	6495	91542457	SO:0001583	missense	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1616A>C	14.37:g.92472704T>G	ENSP00000267622:p.Glu539Ala	Somatic		x	x	x	91542457	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	SNP	62	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.66|17.66	3.444781|3.444781	0.63178|0.63178	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.04317|.	3.65|.	6.16|6.16	4.99|4.99	0.66335|0.66335	.|.	0.159490|.	0.56097|.	N|.	0.000022|.	T|.	0.73156|.	0.3551|.	M|M	0.76002|0.76002	2.32|2.32	0.51012|0.51012	D|D	0.999906|0.999906	B;D|.	0.53151|.	0.082;0.958|.	B;P|.	0.51487|.	0.096;0.671|.	T|.	0.73075|.	-0.4097|.	10|.	0.09338|.	T|.	0.73|.	.|.	13.5143|13.5143	0.61530|0.61530	0.0:0.0:0.1303:0.8697|0.0:0.0:0.1303:0.8697	.|.	275;539|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	A|C	539;275|254	ENSP00000267622:E539A|.	ENSP00000267622:E539A|.	E|X	-|-	2|3	0|0	TRIP11|TRIP11	91542457|91542457	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.639000|0.639000	0.38242|0.38242	3.487000|3.487000	0.53222|0.53222	1.116000|1.116000	0.41820|0.41820	0.528000|0.528000	0.53228|0.53228	GAA|TGA		0.303	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			Missense_Mutation
TRIP11	9321	broad.mit.edu	37	14	92480575	92480575	+	Silent	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr14:92480575T>C	ENST00000267622.4	-	7	1543	c.1170A>G	c.(1168-1170)ctA>ctG	p.L390L		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	390					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.L390L(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GTGCTTGTTGTAGTCTGAACA	0.388			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - coding silent(1)	ovary(1)	14											139.0	126.0	130.0					14																	92480575		2203	4300	6503	91550328	SO:0001819	synonymous_variant	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1170A>G	14.37:g.92480575T>C		Somatic		x	x	x	91550328	B2RUT2|O14689|O15154|O95949	Silent	SNP	ENST00000267622.4	37	CCDS9899.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	12.41	1.928969	0.34002	.	.	ENSG00000100815	ENST00000554357	.	.	.	5.53	-7.26	0.01466	.	.	.	.	.	T	0.25082	0.0609	.	.	.	0.21355	N	0.999717	.	.	.	.	.	.	T	0.29912	-0.9996	4	.	.	.	.	7.224	0.26005	0.092:0.5425:0.0933:0.2721	.	.	.	.	A	135	.	.	T	-	1	0	TRIP11	91550328	0.037000	0.19845	0.000000	0.03702	0.972000	0.66771	-1.445000	0.02401	-1.566000	0.01673	0.459000	0.35465	ACA		0.388	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1			Silent
DYNC1H1	1778	broad.mit.edu	37	14	102504833	102504833	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr14:102504833C>G	ENST00000360184.4	+	58	11109	c.10945C>G	c.(10945-10947)Ctg>Gtg	p.L3649V	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3649	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.L3649V(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAACCCGGTGCTGAACCGTGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											87.0	81.0	83.0					14																	102504833		2203	4300	6503	101574586	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10945C>G	14.37:g.102504833C>G	ENSP00000348965:p.Leu3649Val	Unknown		x	x	x	101574586	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945716	0.73672	.	.	ENSG00000197102	ENST00000360184	T	0.33216	1.42	5.83	3.05	0.35203	.	0.000000	0.85682	D	0.000000	T	0.63896	0.2550	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70626	-0.4820	10	0.87932	D	0	.	11.5449	0.50688	0.0:0.8057:0.0:0.1943	.	3649	Q14204	DYHC1_HUMAN	V	3649	ENSP00000348965:L3649V	ENSP00000348965:L3649V	L	+	1	2	DYNC1H1	101574586	1.000000	0.71417	0.386000	0.26170	0.860000	0.49131	4.980000	0.63812	0.395000	0.25257	-0.136000	0.14681	CTG		0.537	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		Missense_Mutation
DUOX1	53905	broad.mit.edu	37	15	45448043	45448043	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr15:45448043T>A	ENST00000321429.4	+	29	4025	c.3618T>A	c.(3616-3618)taT>taA	p.Y1206*	DUOX1_ENST00000561166.1_Nonsense_Mutation_p.Y852*|DUOX1_ENST00000389037.3_Nonsense_Mutation_p.Y1206*|CTD-2651B20.1_ENST00000558039.1_lincRNA	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1206	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.Y1206*(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCATCATGTATGTCTTTGCCT	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	15											138.0	128.0	131.0					15																	45448043		2198	4298	6496	43235335	SO:0001587	stop_gained	53905			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3618T>A	15.37:g.45448043T>A	ENSP00000317997:p.Tyr1206*	Unknown		x	x	x	43235335	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Nonsense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	39	7.718581	0.98450	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	.	.	.	4.01	-3.16	0.05217	.	0.126103	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.7952	10.3324	0.43831	0.0:0.2831:0.0:0.7169	.	.	.	.	X	1206	.	ENSP00000317997:Y1206X	Y	+	3	2	DUOX1	43235335	0.000000	0.05858	0.968000	0.41197	0.844000	0.47949	-2.311000	0.01128	-0.492000	0.06687	-0.376000	0.06991	TAT		0.557	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434		Nonsense_Mutation
FANCI	55215	broad.mit.edu	37	15	89847144	89847144	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr15:89847144G>A	ENST00000310775.7	+	28	3142	c.3056G>A	c.(3055-3057)cGg>cAg	p.R1019Q	FANCI_ENST00000300027.8_Missense_Mutation_p.R959Q	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	1019					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.R959Q(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GAAAACAGCCGGGGTAAGTTT	0.363								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							1	Substitution - Missense(1)	ovary(1)	15											83.0	88.0	86.0					15																	89847144		2200	4299	6499	87648148	SO:0001583	missense	55215	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.3056G>A	15.37:g.89847144G>A	ENSP00000310842:p.Arg1019Gln	Unknown		x	x	x	87648148	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205119	0.39003	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.68765	-0.35;-0.35;0.39	5.91	-8.36	0.00980	.	2.142280	0.01665	N	0.025334	T	0.33440	0.0863	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.21821	0.006;0.061;0.061	B;B;B	0.08055	0.002;0.003;0.003	T	0.25847	-1.0120	10	0.21540	T	0.41	8.3091	7.7923	0.29127	0.4167:0.0:0.1176:0.4657	.	1019;959;959	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	Q	959;1019;959	ENSP00000300027:R959Q;ENSP00000310842:R1019Q;ENSP00000413249:R959Q	ENSP00000300027:R959Q	R	+	2	0	FANCI	87648148	0.001000	0.12720	0.006000	0.13384	0.865000	0.49528	0.498000	0.22530	-1.593000	0.01617	-0.266000	0.10368	CGG		0.363	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193		Missense_Mutation
C15orf32	145858	broad.mit.edu	37	15	93015580	93015580	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr15:93015580C>T	ENST00000333334.2	+	1	697	c.202C>T	c.(202-204)Cac>Tac	p.H68Y	RP11-763K15.1_ENST00000554440.1_lincRNA|C15orf32_ENST00000556865.1_Missense_Mutation_p.H68Y	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	68								p.H68N(1)|p.H68Y(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			TGGGGTGTTGCAcccatttta	0.468																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	15											87.0	84.0	85.0					15																	93015580		2198	4298	6496	90816584	SO:0001583	missense	145858				CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.202C>T	15.37:g.93015580C>T	ENSP00000330267:p.His68Tyr	Unknown		x	x	x	90816584	C5HTZ8|Q96M45	Missense_Mutation	SNP	ENST00000333334.2	37	CCDS10373.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	1.201	-0.632371	0.03584	.	.	ENSG00000183643	ENST00000333334	T	0.53206	0.63	1.9	-1.18	0.09617	.	.	.	.	.	T	0.21227	0.0511	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16958	-1.0385	9	0.87932	D	0	.	5.1151	0.14831	0.0:0.4902:0.0:0.5098	.	68	Q32M92	CO032_HUMAN	Y	68	ENSP00000330267:H68Y	ENSP00000330267:H68Y	H	+	1	0	C15orf32	90816584	0.002000	0.14202	0.001000	0.08648	0.000000	0.00434	-0.098000	0.11024	-0.355000	0.08199	-1.008000	0.02478	CAC		0.468	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313527.2	NM_153040		Missense_Mutation
GEMIN4	50628	broad.mit.edu	37	17	650428	650428	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr17:650428G>A	ENST00000319004.5	-	2	973	c.855C>T	c.(853-855)caC>caT	p.H285H	GEMIN4_ENST00000437269.1_3'UTR|GEMIN4_ENST00000576778.1_Silent_p.H274H	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	285					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)		p.H285H(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GCGCCTGCTGGTGGTAGGGAT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	17											146.0	156.0	153.0					17																	650428		2110	4250	6360	597178	SO:0001819	synonymous_variant	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.855C>T	17.37:g.650428G>A		Unknown		x	x	x	597178	Q9NZS7|Q9UG32|Q9Y4Q2	Silent	SNP	ENST00000319004.5	37	CCDS45559.1	SNP	44	Broad																																																																																				0.592	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721		Silent
TP53	7157	broad.mit.edu	37	17	7578369	7578369	+	Splice_Site	SNP	A	A	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr17:7578369A>C	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(17)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGCTGCTCACCATCGCTAT	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Unknown(17)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	liver(8)|upper_aerodigestive_tract(7)|bone(4)|ovary(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)	17											47.0	46.0	46.0					17																	7578369		2203	4300	6503	7519094	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1T>G	17.37:g.7578369A>C		Unknown		x	x	x	7519094	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	10.65	1.410047	0.25465	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7283	0.57183	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519094	0.997000	0.39634	0.970000	0.41538	0.209000	0.24338	3.178000	0.50879	1.967000	0.57214	0.533000	0.62120	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
ALDH3A2	224	broad.mit.edu	37	17	19575148	19575148	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr17:19575148C>T	ENST00000176643.6	+	9	1768	c.1322C>T	c.(1321-1323)cCt>cTt	p.P441L	ALDH3A2_ENST00000571163.1_Intron|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.P441L|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.P441L|ALDH3A2_ENST00000395575.2_Missense_Mutation_p.P441L|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.P441L			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	441					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)	p.P441L(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					CTCAGATATCCTCCCAACAGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	17											111.0	122.0	119.0					17																	19575148		2203	4300	6503	19515740	SO:0001583	missense	224			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1322C>T	17.37:g.19575148C>T	ENSP00000176643:p.Pro441Leu	Unknown		x	x	x	19515740	Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	ENST00000176643.6	37	CCDS11210.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.150199	0.94645	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	D;D;D	0.83419	-1.68;-1.68;-1.72	6.06	6.06	0.98353	Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.87497	0.6192	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88101	0.2819	10	0.87932	D	0	-20.8917	19.6125	0.95613	0.0:1.0:0.0:0.0	.	441;441	P51648;P51648-2	AL3A2_HUMAN;.	L	441	ENSP00000176643:P441L;ENSP00000378942:P441L;ENSP00000345774:P441L	ENSP00000176643:P441L	P	+	2	0	ALDH3A2	19515740	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	6.568000	0.73987	2.879000	0.98667	0.650000	0.86243	CCT		0.393	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1			Missense_Mutation
EFTUD2	9343	broad.mit.edu	37	17	42937325	42937325	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr17:42937325A>T	ENST00000426333.2	-	18	2105	c.1808T>A	c.(1807-1809)aTg>aAg	p.M603K	EFTUD2_ENST00000402521.3_Missense_Mutation_p.M568K|EFTUD2_ENST00000591382.1_Missense_Mutation_p.M603K|EFTUD2_ENST00000592576.1_Missense_Mutation_p.M593K	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	603					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.M603K(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				GCCATCAAGCATCTTGGGCAG	0.542																																					Ovarian(10;65 485 10258 29980 30707)											1	Substitution - Missense(1)	ovary(1)	17											146.0	128.0	134.0					17																	42937325		2203	4300	6503	40292851	SO:0001583	missense	9343			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1808T>A	17.37:g.42937325A>T	ENSP00000392094:p.Met603Lys	Unknown		x	x	x	40292851	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	31	5.081237	0.94050	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.73897	-0.79;-0.79	5.45	5.45	0.79879	Elongation factor G/III/V (1);	0.000000	0.85682	D	0.000000	D	0.89326	0.6683	H	0.94222	3.51	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.65874	0.939;0.939	D	0.92371	0.5905	10	0.87932	D	0	-8.6049	15.5233	0.75881	1.0:0.0:0.0:0.0	.	593;603	B4DMC0;Q15029	.;U5S1_HUMAN	K	603;593;568	ENSP00000392094:M603K;ENSP00000385873:M568K	ENSP00000262414:M593K	M	-	2	0	EFTUD2	40292851	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.297000	0.96120	2.071000	0.62044	0.454000	0.30748	ATG		0.542	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247		Missense_Mutation
HOXB4	3214	broad.mit.edu	37	17	46655279	46655279	+	Missense_Mutation	SNP	C	C	T	rs532963118		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr17:46655279C>T	ENST00000332503.5	-	1	2194	c.403G>A	c.(403-405)Gcg>Acg	p.A135T	HOXB3_ENST00000485909.2_5'Flank|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000465120.3_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000489475.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	135	Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A135T(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						TCTTTGCACGCGGAGTGGGAC	0.716																																																1	Substitution - Missense(1)	ovary(1)	17											23.0	27.0	26.0					17																	46655279		2150	4191	6341	44010278	SO:0001583	missense	3214				CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.403G>A	17.37:g.46655279C>T	ENSP00000328928:p.Ala135Thr	Unknown		x	x	x	44010278	Q9NTA0	Missense_Mutation	SNP	ENST00000332503.5	37	CCDS11529.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.76	2.334339	0.41297	.	.	ENSG00000182742	ENST00000332503	D	0.91407	-2.84	3.86	1.54	0.23209	.	0.581154	0.16414	U	0.215473	T	0.80121	0.4565	L	0.27053	0.805	0.32949	D	0.519471	B	0.23650	0.089	B	0.17433	0.018	T	0.71948	-0.4438	10	0.19590	T	0.45	.	5.5032	0.16840	0.4766:0.3597:0.1637:0.0	.	135	P17483	HXB4_HUMAN	T	135	ENSP00000328928:A135T	ENSP00000328928:A135T	A	-	1	0	HOXB4	44010278	0.944000	0.32072	1.000000	0.80357	0.906000	0.53458	0.013000	0.13310	0.595000	0.29777	0.491000	0.48974	GCG		0.716	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2			Missense_Mutation
MYOM1	8736	broad.mit.edu	37	18	3215130	3215130	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr18:3215130C>A	ENST00000356443.4	-	2	425	c.92G>T	c.(91-93)cGg>cTg	p.R31L	MYOM1_ENST00000261606.7_Missense_Mutation_p.R31L|MYOM1_ENST00000400569.3_Missense_Mutation_p.R31L|RP13-270P17.2_ENST00000580139.1_RNA	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	31					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.R31L(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTTCTTCTCCCGCTGGTAGTG	0.642																																																1	Substitution - Missense(1)	ovary(1)	18											53.0	58.0	56.0					18																	3215130		2089	4235	6324	3205130	SO:0001583	missense	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.92G>T	18.37:g.3215130C>A	ENSP00000348821:p.Arg31Leu	Unknown		x	x	x	3205130	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466081	0.26335	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.45668	1.04;1.05;0.89	5.67	4.52	0.55395	.	0.516121	0.20942	N	0.082914	T	0.23451	0.0567	N	0.08118	0	0.24015	N	0.996165	B;B	0.23937	0.004;0.094	B;B	0.17433	0.002;0.018	T	0.15752	-1.0426	10	0.49607	T	0.09	.	10.6635	0.45717	0.0:0.0763:0.0:0.9237	.	31;31	P52179-2;P52179	.;MYOM1_HUMAN	L	31	ENSP00000348821:R31L;ENSP00000383413:R31L;ENSP00000261606:R31L	ENSP00000261606:R31L	R	-	2	0	MYOM1	3205130	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	4.038000	0.57318	0.989000	0.38761	-0.238000	0.12139	CGG		0.642	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803		Missense_Mutation
RBBP8	5932	broad.mit.edu	37	18	20577641	20577641	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr18:20577641G>A	ENST00000399722.2	+	14	2438	c.2087G>A	c.(2086-2088)aGt>aAt	p.S696N	RBBP8_ENST00000399725.2_Missense_Mutation_p.S696N|RBBP8_ENST00000327155.5_Missense_Mutation_p.S696N|RBBP8_ENST00000360790.5_Missense_Mutation_p.S696N	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	696					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.S696N(1)		central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			ACATTGGTTAGTGAAACCGTT	0.303								Homologous recombination																																								1	Substitution - Missense(1)	ovary(1)	18											69.0	70.0	69.0					18																	20577641		2203	4300	6503	18831639	SO:0001583	missense	5932			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2087G>A	18.37:g.20577641G>A	ENSP00000382628:p.Ser696Asn	Somatic		x	x	x	18831639	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	37	CCDS11875.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590160	0.66105	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T	0.36520	1.32;1.25;1.32;1.31	5.18	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.44540	0.1298	L	0.54323	1.7	0.80722	D	1	P;D;P	0.59767	0.603;0.986;0.603	B;P;B	0.53266	0.057;0.722;0.057	T	0.34700	-0.9818	10	0.38643	T	0.18	-9.2191	12.7638	0.57380	0.0799:0.0:0.9201:0.0	.	696;696;696	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	N	696	ENSP00000323050:S696N;ENSP00000382630:S696N;ENSP00000382628:S696N;ENSP00000354024:S696N	ENSP00000323050:S696N	S	+	2	0	RBBP8	18831639	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.583000	0.53928	1.547000	0.49401	0.650000	0.86243	AGT		0.303	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291		Missense_Mutation
CLPP	8192	broad.mit.edu	37	19	6364626	6364626	+	Silent	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:6364626C>T	ENST00000245816.4	+	4	654	c.531C>T	c.(529-531)atC>atT	p.I177I	CLPP_ENST00000596605.1_Intron|CTB-180A7.3_ENST00000595644.1_RNA|CLPP_ENST00000596149.1_Silent_p.I90I	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	177					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.I177I(1)		endometrium(2)|large_intestine(2)|ovary(2)	6						GTATCATGATCCACCAGCCCT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	19											27.0	30.0	29.0					19																	6364626		2203	4299	6502	6315626	SO:0001819	synonymous_variant	8192			Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.531C>T	19.37:g.6364626C>T		Unknown		x	x	x	6315626	B2R4W5	Silent	SNP	ENST00000245816.4	37	CCDS12162.1	SNP	30	Broad																																																																																				0.667	CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452984.1	NM_006012		Silent
CDKN2D	1032	broad.mit.edu	37	19	10677786	10677787	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-13-0923-01	TCGA-13-0923-10			CC	AG	CC	CC	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:10677786_10677787CC>AG	ENST00000393599.2	-	2	772_773	c.448_449GG>CT	c.(448-450)GGg>CTg	p.G150L	CDKN2D_ENST00000335766.2_Missense_Mutation_p.G150L|KRI1_ENST00000361821.5_5'Flank|KRI1_ENST00000537964.1_5'Flank|KRI1_ENST00000312962.6_5'Flank	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	150					autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.G150L(1)		endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GTCCTGAGCCCCTCTCTGCAGT	0.609																																																1	Substitution - Missense(1)	ovary(1)	19																																								10538787	SO:0001583	missense	1032				CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273		ENST00000393599.2:c.448_449delinsAG	19.37:g.10677786_10677787delinsAG	ENSP00000377224:p.Gly150Leu	Somatic		x	x	x	10538786	Q13102|Q6FGE9	Missense_Mutation	DNP	ENST00000393599.2	37	CCDS12244.1	DNP	22	Broad																																																																																				0.609	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452030.1	NM_079421		Missense_Mutation
ZNF823	55552	broad.mit.edu	37	19	11832769	11832769	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:11832769T>C	ENST00000341191.6	-	4	1733	c.1580A>G	c.(1579-1581)tAt>tGt	p.Y527C	ZNF823_ENST00000545749.1_Missense_Mutation_p.Y345C	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y527C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						CTTACATTCATATGGCTTCTC	0.378										HNSCC(68;0.2)																																						1	Substitution - Missense(1)	ovary(1)	19											60.0	63.0	62.0					19																	11832769		2201	4299	6500	11693769	SO:0001583	missense	55552			X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1580A>G	19.37:g.11832769T>C	ENSP00000340683:p.Tyr527Cys	Somatic		x	x	x	11693769	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	37	CCDS45981.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	N	14.49	2.552428	0.45487	.	.	ENSG00000197933	ENST00000545749;ENST00000341191	T;T	0.25414	1.8;1.8	0.856	0.856	0.19019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46229	0.1382	M	0.80422	2.495	0.21553	N	0.999645	D	0.89917	1.0	D	0.97110	1.0	T	0.19418	-1.0306	9	0.87932	D	0	.	4.3208	0.11016	0.2965:0.0:0.0:0.7035	.	527	P16415	ZN823_HUMAN	C	345;527	ENSP00000440162:Y345C;ENSP00000340683:Y527C	ENSP00000340683:Y527C	Y	-	2	0	ZNF823	11693769	0.000000	0.05858	0.035000	0.18076	0.743000	0.42351	-0.077000	0.11394	0.630000	0.30394	0.254000	0.18369	TAT		0.378	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493		Missense_Mutation
RHPN2	85415	broad.mit.edu	37	19	33482730	33482730	+	Splice_Site	SNP	G	G	A	rs370334049		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:33482730G>A	ENST00000254260.3	-	13	1678	c.1643C>T	c.(1642-1644)tCg>tTg	p.S548L	RHPN2_ENST00000400226.4_Splice_Site_p.S397L|RHPN2_ENST00000588683.1_5'Flank	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	548	PDZ.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.S548L(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TGTGCTTACCGAGGCAGAGCA	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											63.0	54.0	57.0					19																	33482730		2203	4300	6503	38174570	SO:0001630	splice_region_variant	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1644+1C>T	19.37:g.33482730G>A		Unknown		x	x	x	38174570	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	8.835	0.940899	0.18281	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.29917	1.55;1.55	5.22	2.99	0.34606	PDZ/DHR/GLGF (2);	0.153802	0.64402	D	0.000020	T	0.22589	0.0545	L	0.34521	1.04	0.29166	N	0.877422	B	0.11235	0.004	B	0.06405	0.002	T	0.13575	-1.0504	10	0.49607	T	0.09	3.3248	10.4349	0.44430	0.0:0.1456:0.7031:0.1514	.	548	Q8IUC4	RHPN2_HUMAN	L	548;278;397	ENSP00000254260:S548L;ENSP00000402244:S397L	ENSP00000254260:S548L	S	-	2	0	RHPN2	38174570	1.000000	0.71417	0.913000	0.36048	0.104000	0.19210	7.030000	0.76484	0.657000	0.30906	-0.165000	0.13383	TCG		0.512	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	Missense_Mutation	Missense_Mutation
ZNF222	7673	broad.mit.edu	37	19	44536133	44536133	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:44536133G>T	ENST00000187879.8	+	4	468	c.306G>T	c.(304-306)caG>caT	p.Q102H	ZNF222_ENST00000391960.3_Missense_Mutation_p.Q142H|ZNF223_ENST00000591793.1_Intron	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q102H(1)		endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				ACCCCTCCCAGATTAAAGCAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	19											117.0	115.0	116.0					19																	44536133		2203	4300	6503	49227973	SO:0001583	missense	7673			AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.306G>T	19.37:g.44536133G>T	ENSP00000187879:p.Gln102His	Unknown		x	x	x	49227973	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	ENST00000187879.8	37	CCDS33045.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	2.013	-0.426582	0.04701	.	.	ENSG00000159885	ENST00000391960;ENST00000187879;ENST00000251272	T;T	0.06142	3.34;3.42	1.62	-3.24	0.05094	.	.	.	.	.	T	0.04318	0.0119	L	0.35854	1.095	0.09310	N	1	B;B	0.14012	0.009;0.003	B;B	0.19148	0.024;0.004	T	0.42258	-0.9462	9	0.45353	T	0.12	.	0.6701	0.00857	0.1633:0.1843:0.2372:0.4151	.	142;102	G5E9B9;Q9UK12	.;ZN222_HUMAN	H	142;102;48	ENSP00000375822:Q142H;ENSP00000187879:Q102H	ENSP00000187879:Q102H	Q	+	3	2	ZNF222	49227973	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.811000	0.04500	-1.551000	0.01706	-1.043000	0.02367	CAG		0.388	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2			Missense_Mutation
IL4I1	259307	broad.mit.edu	37	19	50398386	50398386	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:50398386G>C	ENST00000391826.2	-	4	446	c.304C>G	c.(304-306)Cgg>Ggg	p.R102G	IL4I1_ENST00000595948.1_Missense_Mutation_p.R124G|IL4I1_ENST00000341114.3_Missense_Mutation_p.R124G	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	102						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)	p.R124G(1)		endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	TTCTGGTCCCGGTAGGTGAAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											107.0	88.0	94.0					19																	50398386		2203	4300	6503	55090198	SO:0001583	missense	259307			AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.304C>G	19.37:g.50398386G>C	ENSP00000375702:p.Arg102Gly	Unknown		x	x	x	55090198	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Missense_Mutation	SNP	ENST00000391826.2	37	CCDS12787.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741779	0.69304	.	.	ENSG00000104951	ENST00000341114;ENST00000391826	D;D	0.93906	-3.31;-3.31	4.89	0.994	0.19832	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.96402	0.8826	M	0.88906	2.99	0.36768	D	0.88364	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.987;0.992;0.995	D	0.96983	0.9716	10	0.87932	D	0	-59.165	11.3184	0.49405	0.0:0.0:0.5229:0.4771	.	124;124;102	Q96RQ9-2;Q1WMJ3;Q96RQ9	.;.;OXLA_HUMAN	G	124;102	ENSP00000342557:R124G;ENSP00000375702:R102G	ENSP00000342557:R124G	R	-	1	2	IL4I1	55090198	1.000000	0.71417	0.964000	0.40570	0.965000	0.64279	2.919000	0.48836	0.455000	0.26910	0.478000	0.44815	CGG		0.632	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1			Missense_Mutation
CNOT3	4849	broad.mit.edu	37	19	54652061	54652061	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:54652061G>T	ENST00000406403.1	+	10	2676	c.1073G>T	c.(1072-1074)aGt>aTt	p.S358I	CNOT3_ENST00000358389.3_Missense_Mutation_p.S177I|CNOT3_ENST00000221232.5_Missense_Mutation_p.S358I			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	358	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.S358I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCCAAGGCCAGTCCAGCTCCC	0.736																																																1	Substitution - Missense(1)	ovary(1)	19											13.0	14.0	14.0					19																	54652061		2192	4288	6480	59343873	SO:0001583	missense	4849			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1073G>T	19.37:g.54652061G>T	ENSP00000383954:p.Ser358Ile	Unknown		x	x	x	59343873	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	SNP	36	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	16.36|16.36	3.100153|3.100153	0.56183|0.56183	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403|ENST00000440571	T;T;T|.	0.65916|.	0.71;-0.18;0.71|.	3.1|3.1	2.06|2.06	0.26882|0.26882	.|.	0.819267|.	0.10812|.	U|.	0.631460|.	T|T	0.27967|0.27967	0.0689|0.0689	N|N	0.14661|0.14661	0.345|0.345	0.36955|0.36955	D|D	0.893071|0.893071	B;B;B|.	0.26975|.	0.089;0.037;0.165|.	B;B;B|.	0.23574|.	0.029;0.029;0.047|.	T|T	0.17623|0.17623	-1.0363|-1.0363	10|5	0.45353|.	T|.	0.12|.	-2.3606|-2.3606	3.8266|3.8266	0.08856|0.08856	0.3717:0.0:0.6283:0.0|0.3717:0.0:0.6283:0.0	.|.	358;358;282|.	B7Z6J7;O75175;Q6ZMJ6|.	.;CNOT3_HUMAN;.|.	I|F	358;177;358|280	ENSP00000221232:S358I;ENSP00000351159:S177I;ENSP00000383954:S358I|.	ENSP00000221232:S358I|.	S|V	+|+	2|1	0|0	CNOT3|CNOT3	59343873|59343873	0.997000|0.997000	0.39634|0.39634	0.998000|0.998000	0.56505|0.56505	0.946000|0.946000	0.59487|0.59487	1.758000|1.758000	0.38410|0.38410	1.751000|1.751000	0.51876|0.51876	0.306000|0.306000	0.20318|0.20318	AGT|GTC		0.736	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516		Missense_Mutation
CNOT3	4849	broad.mit.edu	37	19	54657466	54657466	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:54657466G>C	ENST00000406403.1	+	16	3655	c.2052G>C	c.(2050-2052)caG>caC	p.Q684H	CNOT3_ENST00000496327.1_3'UTR|CNOT3_ENST00000221232.5_Missense_Mutation_p.Q684H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	684	Repressor domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.Q684H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTAAGGCACAGTATCTGGCAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											127.0	98.0	108.0					19																	54657466		2203	4300	6503	59349278	SO:0001583	missense	4849			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.2052G>C	19.37:g.54657466G>C	ENSP00000383954:p.Gln684His	Unknown		x	x	x	59349278	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	SNP	36	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.093829|4.093829	0.76870|0.76870	.|.	.|.	ENSG00000088038|ENSG00000088038	ENST00000221232;ENST00000406403;ENST00000471126|ENST00000457463	T;T;T|.	0.60040|.	0.22;0.22;0.22|.	4.14|4.14	4.14|4.14	0.48551|0.48551	NOT2/NOT3/NOT5 (1);|.	0.071575|.	0.64402|.	D|.	0.000017|.	D|D	0.88009|0.88009	0.6322|0.6322	H|H	0.97587|0.97587	4.035|4.035	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	D|.	0.79108|.	0.992|.	D|D	0.92544|0.92544	0.6044|0.6044	10|5	0.87932|.	D|.	0|.	-15.9521|-15.9521	16.2357|16.2357	0.82371|0.82371	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	684|.	O75175|.	CNOT3_HUMAN|.	H|L	684;684;2|216	ENSP00000221232:Q684H;ENSP00000383954:Q684H;ENSP00000420064:Q2H|.	ENSP00000221232:Q684H|.	Q|V	+|+	3|1	2|0	CNOT3|CNOT3	59349278|59349278	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.254000|9.254000	0.95512|0.95512	2.304000|2.304000	0.77564|0.77564	0.549000|0.549000	0.68633|0.68633	CAG|GTA		0.602	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516		Missense_Mutation
TNNT1	7138	broad.mit.edu	37	19	55648496	55648496	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:55648496C>G	ENST00000588981.1	-	11	790	c.586G>C	c.(586-588)Gac>Cac	p.D196H	TNNT1_ENST00000585321.2_Missense_Mutation_p.D126H|TNNT1_ENST00000587465.2_Missense_Mutation_p.D126H|TNNT1_ENST00000592920.1_5'Flank|TNNT1_ENST00000587758.1_Missense_Mutation_p.D185H|TNNT1_ENST00000291901.8_Missense_Mutation_p.D196H|TNNT1_ENST00000356783.5_Missense_Mutation_p.D185H|TNNT1_ENST00000588426.1_Missense_Mutation_p.D93H|TNNT1_ENST00000536926.1_Missense_Mutation_p.D185H	NM_003283.4	NP_003274.3	P13805	TNNT1_HUMAN	troponin T type 1 (skeletal, slow)	196					muscle filament sliding (GO:0030049)|negative regulation of muscle contraction (GO:0045932)|skeletal muscle contraction (GO:0003009)|slow-twitch skeletal muscle fiber contraction (GO:0031444)	cytosol (GO:0005829)|troponin complex (GO:0005861)	tropomyosin binding (GO:0005523)	p.D196H(1)		endometrium(2)|kidney(3)|lung(4)|ovary(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		CCCATGTAGTCAATGTCCAGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											66.0	55.0	59.0					19																	55648496		2203	4300	6503	60340308	SO:0001583	missense	7138				CCDS12917.1, CCDS46185.1, CCDS59421.1	19q13.4	2014-09-17	2005-09-12			ENSG00000105048			11948	protein-coding gene	gene with protein product	"""slow skeletal muscle troponin T"", ""troponin T1, skeletal, slow"", ""nemaline myopathy type 5"""	191041	"""troponin T1, skeletal, slow"""			1505979	Standard	XM_006723343		Approved	ANM, STNT, TNT, TNTS, FLJ98147, MGC104241, NEM5	uc002qjb.4	P13805		ENST00000588981.1:c.586G>C	19.37:g.55648496C>G	ENSP00000467176:p.Asp196His	Unknown		x	x	x	60340308	O95472|Q16061|Q5U0E1	Missense_Mutation	SNP	ENST00000588981.1	37	CCDS12917.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543420	0.65198	.	.	ENSG00000105048	ENST00000291901;ENST00000356783;ENST00000536926;ENST00000537693	D;D;D	0.93189	-3.18;-3.18;-3.18	3.94	3.94	0.45596	.	0.186234	0.44285	D	0.000479	D	0.96555	0.8876	M	0.88979	2.995	0.52099	D	0.999941	D;D;D;D	0.69078	0.98;0.997;0.988;0.98	P;D;D;P	0.63703	0.847;0.912;0.917;0.847	D	0.97274	0.9913	10	0.87932	D	0	-29.095	13.8404	0.63435	0.0:1.0:0.0:0.0	.	185;196;196;185	P13805-2;P13805-3;P13805;F5H1H4	.;.;TNNT1_HUMAN;.	H	196;185;185;126	ENSP00000291901:D196H;ENSP00000349233:D185H;ENSP00000439640:D185H	ENSP00000291901:D196H	D	-	1	0	TNNT1	60340308	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	6.665000	0.74442	1.930000	0.55929	0.484000	0.47621	GAC		0.627	TNNT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451825.2	NM_003283		Missense_Mutation
ZNF586	54807	broad.mit.edu	37	19	58290195	58290195	+	Silent	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr19:58290195A>G	ENST00000396154.2	+	3	413	c.240A>G	c.(238-240)ggA>ggG	p.G80G	ZNF586_ENST00000396150.4_Missense_Mutation_p.E38G|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000391702.3_Silent_p.G37G|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598183.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G80G(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGACCAGGGAGGTCATAGTG	0.443																																																1	Substitution - coding silent(1)	ovary(1)	19											73.0	71.0	71.0					19																	58290195		2008	4198	6206	62982007	SO:0001819	synonymous_variant	54807			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.240A>G	19.37:g.58290195A>G		Somatic		x	x	x	62982007	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Silent	SNP	ENST00000396154.2	37	CCDS42640.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	9.449	1.090181	0.20390	.	.	ENSG00000083828	ENST00000396150	T	0.50813	0.73	1.75	1.75	0.24633	.	.	.	.	.	T	0.39306	0.1073	.	.	.	0.20873	N	0.999837	P	0.34587	0.458	B	0.40410	0.328	T	0.26883	-1.0090	7	.	.	.	.	8.2724	0.31853	1.0:0.0:0.0:0.0	.	38	A0JLV8	.	G	38	ENSP00000379454:E38G	.	E	+	2	0	ZNF586	62982007	0.001000	0.12720	0.011000	0.14972	0.068000	0.16541	1.118000	0.31246	0.776000	0.33473	0.459000	0.35465	GAG		0.443	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652		Silent
LPIN1	23175	broad.mit.edu	37	2	11943134	11943134	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:11943134C>A	ENST00000256720.2	+	14	1973	c.1880C>A	c.(1879-1881)aCt>aAt	p.T627N	LPIN1_ENST00000396097.1_Missense_Mutation_p.T357N|LPIN1_ENST00000404113.2_Missense_Mutation_p.T128N|LPIN1_ENST00000396099.1_Missense_Mutation_p.T669N|LPIN1_ENST00000449576.2_Missense_Mutation_p.T712N|LPIN1_ENST00000425416.2_Missense_Mutation_p.T633N	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	627	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.T627N(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TACAAGAAGACTCTCCGGCTG	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											148.0	124.0	132.0					2																	11943134		2203	4300	6503	11860585	SO:0001583	missense	23175			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1880C>A	2.37:g.11943134C>A	ENSP00000256720:p.Thr627Asn	Unknown		x	x	x	11860585	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461720	0.63513	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113;ENST00000454151	D;D;D;D;T;T;T	0.82619	-1.63;-1.62;-1.6;-1.6;-1.45;-0.36;0.23	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.92283	0.7552	M	0.91354	3.2	0.80722	D	1	B;D;P	0.61697	0.435;0.99;0.834	B;D;P	0.68621	0.341;0.959;0.477	D	0.93746	0.7054	10	0.72032	D	0.01	-26.5513	14.8882	0.70587	0.0:0.8559:0.144:0.0	.	128;712;627	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	N	712;669;633;627;357;128;154	ENSP00000397908:T712N;ENSP00000379406:T669N;ENSP00000401522:T633N;ENSP00000256720:T627N;ENSP00000379404:T357N;ENSP00000386120:T128N;ENSP00000413714:T154N	ENSP00000256720:T627N	T	+	2	0	LPIN1	11860585	1.000000	0.71417	0.953000	0.39169	0.447000	0.32167	5.589000	0.67523	2.428000	0.82296	0.462000	0.41574	ACT		0.552	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693		Missense_Mutation
SLC5A6	8884	broad.mit.edu	37	2	27426127	27426127	+	Missense_Mutation	SNP	C	C	G	rs201818003	byFrequency	TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:27426127C>G	ENST00000310574.3	-	11	1654	c.1181G>C	c.(1180-1182)cGg>cCg	p.R394P	SLC5A6_ENST00000408041.1_Missense_Mutation_p.R394P|SLC5A6_ENST00000461319.1_5'UTR	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	394					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.R394P(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CATGATGGCCCGGGCTTCAGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											92.0	97.0	96.0					2																	27426127		2203	4300	6503	27279631	SO:0001583	missense	8884			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.1181G>C	2.37:g.27426127C>G	ENSP00000310208:p.Arg394Pro	Unknown		x	x	x	27279631	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	37	CCDS1740.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591004	0.66219	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.88354	-2.37;-2.37	5.71	-1.02	0.10135	.	0.741921	0.13570	N	0.378105	D	0.90854	0.7127	M	0.78344	2.41	0.21675	N	0.999593	P	0.50943	0.94	P	0.54889	0.763	D	0.83383	0.0013	10	0.38643	T	0.18	.	10.2526	0.43377	0.0:0.3637:0.0:0.6363	.	394	Q9Y289	SC5A6_HUMAN	P	394	ENSP00000310208:R394P;ENSP00000384853:R394P	ENSP00000310208:R394P	R	-	2	0	SLC5A6	27279631	0.000000	0.05858	0.968000	0.41197	0.905000	0.53344	-0.372000	0.07504	-0.270000	0.09285	0.563000	0.77884	CGG		0.468	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095		Missense_Mutation
DYSF	8291	broad.mit.edu	37	2	71886113	71886113	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:71886113A>G	ENST00000258104.3	+	43	5021	c.4744A>G	c.(4744-4746)Atc>Gtc	p.I1582V	DYSF_ENST00000409366.1_Missense_Mutation_p.I1604V|DYSF_ENST00000409744.1_Missense_Mutation_p.I1590V|DYSF_ENST00000410020.3_Missense_Mutation_p.I1621V|DYSF_ENST00000429174.2_Missense_Mutation_p.I1603V|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000410041.1_Missense_Mutation_p.I1600V|DYSF_ENST00000409651.1_Missense_Mutation_p.I1614V|DYSF_ENST00000394120.2_Missense_Mutation_p.I1583V|DYSF_ENST00000409762.1_Missense_Mutation_p.I1599V|DYSF_ENST00000409582.3_Missense_Mutation_p.I1620V|DYSF_ENST00000413539.2_Missense_Mutation_p.I1613V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1582	C2 6. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.I1582V(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CTTGGTCCGTATCTACATTGT	0.577																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	90.0	89.0					2																	71886113		2203	4300	6503	71739621	SO:0001583	missense	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4744A>G	2.37:g.71886113A>G	ENSP00000258104:p.Ile1582Val	Unknown		x	x	x	71739621	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	5.936	0.356711	0.11239	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57;1.57	5.63	0.591	0.17465	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.545608	0.20825	N	0.084993	T	0.09949	0.0244	N	0.03304	-0.355	0.25299	N	0.989295	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.0;0.001;0.0;0.001;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.15052	0.012;0.005;0.005;0.003;0.003;0.005;0.005;0.005;0.003;0.003;0.004;0.002;0.003;0.003;0.005	T	0.37798	-0.9690	10	0.02654	T	1	-12.9831	8.2986	0.32001	0.5822:0.0:0.4178:0.0	.	346;1614;1621;1604;1569;1600;1590;1599;1589;1613;1620;1603;1568;1583;1582	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	1613;1599;1620;1603;1582;1614;1583;1590;1604;1621;1600	ENSP00000407046:I1613V;ENSP00000387137:I1599V;ENSP00000386547:I1620V;ENSP00000398305:I1603V;ENSP00000258104:I1582V;ENSP00000386683:I1614V;ENSP00000377678:I1583V;ENSP00000386285:I1590V;ENSP00000386512:I1604V;ENSP00000386881:I1621V;ENSP00000386617:I1600V	ENSP00000258104:I1582V	I	+	1	0	DYSF	71739621	0.991000	0.36638	0.754000	0.31244	0.990000	0.78478	2.329000	0.43876	0.104000	0.17725	0.528000	0.53228	ATC		0.577	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		Missense_Mutation
EIF5B	9669	broad.mit.edu	37	2	100007118	100007118	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:100007118C>A	ENST00000289371.6	+	17	2900	c.2698C>A	c.(2698-2700)Cag>Aag	p.Q900K		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	900					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.Q900K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CATTGTAACTCAGATTCGAGG	0.488																																					Colon(162;2388 2567 2705 3444)											1	Substitution - Missense(1)	ovary(1)	2											142.0	137.0	139.0					2																	100007118		1996	4171	6167	99373550	SO:0001583	missense	9669			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2698C>A	2.37:g.100007118C>A	ENSP00000289371:p.Gln900Lys	Unknown		x	x	x	99373550	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	ENST00000289371.6	37	CCDS42721.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.448979	0.96205	.	.	ENSG00000158417	ENST00000289371	T	0.60548	0.18	5.53	5.53	0.82687	Translation elongation factor EFTu/EF1A, domain 2 (1);	.	.	.	.	T	0.64929	0.2643	N	0.25332	0.735	0.80722	D	1	D	0.63046	0.992	D	0.65874	0.939	T	0.60702	-0.7211	8	.	.	.	-18.8787	19.8113	0.96547	0.0:1.0:0.0:0.0	.	900	O60841	IF2P_HUMAN	K	900	ENSP00000289371:Q900K	.	Q	+	1	0	EIF5B	99373550	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.688000	0.84153	2.746000	0.94184	0.561000	0.74099	CAG		0.488	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904		Missense_Mutation
NEB	4703	broad.mit.edu	37	2	152362072	152362072	+	Missense_Mutation	SNP	C	C	G	rs533393621	byFrequency	TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:152362072C>G	ENST00000172853.10	-	137	18706	c.18559G>C	c.(18559-18561)Gaa>Caa	p.E6187Q	NEB_ENST00000427231.2_Missense_Mutation_p.E7888Q|NEB_ENST00000604864.1_Missense_Mutation_p.E7888Q|NEB_ENST00000603639.1_Missense_Mutation_p.E7888Q|NEB_ENST00000397345.3_Missense_Mutation_p.E7888Q|NEB_ENST00000397336.2_5'Flank|NEB_ENST00000498015.2_5'UTR|NEB_ENST00000409198.1_Missense_Mutation_p.E6187Q|NEB_ENST00000509223.2_Missense_Mutation_p.E18Q			P20929	NEBU_HUMAN	nebulin	6187					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.E6187Q(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCTATTGCTTCCTTATACTTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	2											228.0	220.0	222.0					2																	152362072		1966	4143	6109	152070318	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.18559G>C	2.37:g.152362072C>G	ENSP00000172853:p.Glu6187Gln	Unknown		x	x	x	152070318	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		SNP	30	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	29.7|29.7|29.7	5.024752|5.024752|5.024752	0.93518|0.93518|0.93518	.|.|.	.|.|.	ENSG00000183091|ENSG00000183091|ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853;ENST00000509223;ENST00000424585|ENST00000421461|ENST00000397337;ENST00000434685	T;T;T;T;T;T;T|.|.	0.58060|.|.	0.36;0.36;0.36;0.36;0.36;4.16;0.36|.|.	5.72|5.72|5.72	5.72|5.72|5.72	0.89469|0.89469|0.89469	.|.|.	0.252336|.|.	0.44902|.|.	D|.|.	0.000406|.|.	T|T|T	0.76004|0.76004|0.76004	0.3927|0.3927|0.3927	M|M|M	0.68317|0.68317|0.68317	2.08|2.08|2.08	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;B;D;D;D|.|.	0.76494|.|.	0.992;0.024;0.999;0.999;0.999|.|.	D;B;D;D;D|.|.	0.83275|.|.	0.976;0.012;0.98;0.977;0.996|.|.	T|T|T	0.72520|0.72520|0.72520	-0.4268|-0.4268|-0.4268	10|5|5	0.37606|.|.	T|.|.	0.19|.|.	.|.|.	20.324|20.324|20.324	0.98686|0.98686|0.98686	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	18;18;6187;7888;2618|.|.	B7Z6B9;B7Z6P9;P20929;F8WCP0;Q14215|.|.	.;.;NEBU_HUMAN;.;.|.|.	Q|A|S	6187;7888;7888;2236;2618;6187;18;115|64|83;438	ENSP00000386259:E6187Q;ENSP00000380505:E7888Q;ENSP00000416578:E7888Q;ENSP00000410961:E2618Q;ENSP00000172853:E6187Q;ENSP00000427083:E18Q;ENSP00000404876:E115Q|.|.	ENSP00000172853:E6187Q|.|.	E|G|R	-|-|-	1|2|3	0|0|2	NEB|NEB|NEB	152070318|152070318|152070318	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	6.740000|6.740000|6.740000	0.74832|0.74832|0.74832	2.881000|2.881000|2.881000	0.98747|0.98747|0.98747	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAA|GGA|AGG		0.438	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		Missense_Mutation
KIAA1715	80856	broad.mit.edu	37	2	176804339	176804339	+	Silent	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:176804339T>C	ENST00000272748.4	-	10	1000	c.753A>G	c.(751-753)cgA>cgG	p.R251R	KIAA1715_ENST00000535310.1_Silent_p.R176R|KIAA1715_ENST00000544803.1_Silent_p.R282R	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	251					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.R251R(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			CACCTCGTTCTCGGGGGAGAA	0.328																																																1	Substitution - coding silent(1)	ovary(1)	2											87.0	86.0	86.0					2																	176804339		2203	4300	6503	176512585	SO:0001819	synonymous_variant	80856			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.753A>G	2.37:g.176804339T>C		Unknown		x	x	x	176512585	B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Silent	SNP	ENST00000272748.4	37	CCDS33332.1	SNP	54	Broad																																																																																				0.328	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834		Silent
PARD3B	117583	broad.mit.edu	37	2	206480345	206480345	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:206480345C>G	ENST00000406610.2	+	23	3633	c.3426C>G	c.(3424-3426)caC>caG	p.H1142Q	PARD3B_ENST00000488622.1_3'UTR|PARD3B_ENST00000358768.2_Missense_Mutation_p.H1080Q|PARD3B_ENST00000349953.3_Missense_Mutation_p.H1041Q|PARD3B_ENST00000351153.1_Missense_Mutation_p.H1073Q	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	1142					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.H1081Q(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		ATCCTCAGCACTACCCACCCC	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	76.0	73.0					2																	206480345		1980	4149	6129	206188590	SO:0001583	missense	117583			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.3426C>G	2.37:g.206480345C>G	ENSP00000385848:p.His1142Gln	Unknown		x	x	x	206188590	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37		SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	4.259	0.047191	0.08243	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.11063	3.01;2.81;3.02;2.87	5.87	-0.0567	0.13804	.	0.125321	0.36932	N	0.002324	T	0.05502	0.0145	N	0.14661	0.345	0.21020	N	0.999806	B;B;B;B	0.28258	0.203;0.002;0.205;0.003	B;B;B;B	0.24394	0.033;0.0;0.053;0.001	T	0.39121	-0.9629	10	0.25751	T	0.34	.	10.9372	0.47251	0.0:0.485:0.0:0.515	.	1142;1073;1080;1041	Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	PAR3L_HUMAN;.;.;.	Q	1142;1080;1073;1041	ENSP00000385848:H1142Q;ENSP00000351618:H1080Q;ENSP00000317261:H1073Q;ENSP00000340280:H1041Q	ENSP00000340280:H1041Q	H	+	3	2	PARD3B	206188590	0.605000	0.26941	0.996000	0.52242	0.382000	0.30200	-0.607000	0.05648	-0.084000	0.12595	0.650000	0.86243	CAC		0.597	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177		Missense_Mutation
ADAM23	8745	broad.mit.edu	37	2	207437914	207437914	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:207437914G>A	ENST00000264377.3	+	18	2060	c.1732G>A	c.(1732-1734)Ggt>Agt	p.G578S	ADAM23_ENST00000374415.3_Missense_Mutation_p.G578S|ADAM23_ENST00000374416.1_Missense_Mutation_p.G578S	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	578	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G578S(1)		NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TGGAGACTCTGGTCAGGTATG	0.413																																					Melanoma(194;1127 2130 19620 24042 27855)											1	Substitution - Missense(1)	ovary(1)	2											241.0	212.0	222.0					2																	207437914		2203	4300	6503	207146159	SO:0001583	missense	8745			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1732G>A	2.37:g.207437914G>A	ENSP00000264377:p.Gly578Ser	Unknown		x	x	x	207146159	A2RU59	Missense_Mutation	SNP	ENST00000264377.3	37	CCDS2369.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	11.95	1.791101	0.31685	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.10573	2.86;2.86;2.86	5.81	5.81	0.92471	Blood coagulation inhibitor, Disintegrin (5);	0.204686	0.34700	N	0.003753	T	0.05502	0.0145	N	0.02192	-0.645	0.80722	D	1	B	0.23591	0.088	B	0.31101	0.124	T	0.24083	-1.0170	10	0.02654	T	1	.	18.9069	0.92466	0.0:0.0:1.0:0.0	.	578	O75077	ADA23_HUMAN	S	578;578;472;578	ENSP00000264377:G578S;ENSP00000363537:G578S;ENSP00000363536:G578S	ENSP00000264377:G578S	G	+	1	0	ADAM23	207146159	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.446000	0.73460	2.755000	0.94549	0.650000	0.86243	GGT		0.413	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812		Missense_Mutation
PIKFYVE	200576	broad.mit.edu	37	2	209218727	209218727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:209218727C>T	ENST00000264380.4	+	40	6108	c.5950C>T	c.(5950-5952)Cga>Tga	p.R1984*		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1984	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.R1984*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AAAGATGGTTCGAGACAACCC	0.413																																																1	Substitution - Nonsense(1)	ovary(1)	2											148.0	151.0	150.0					2																	209218727		2203	4300	6503	208926972	SO:0001587	stop_gained	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5950C>T	2.37:g.209218727C>T	ENSP00000264380:p.Arg1984*	Somatic		x	x	x	208926972	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Nonsense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	48	13.982856	0.99773	.	.	ENSG00000115020	ENST00000264380	.	.	.	6.17	6.17	0.99709	.	0.055528	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-10.4615	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	1984	.	ENSP00000264380:R1984X	R	+	1	2	PIKFYVE	208926972	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.666000	0.83877	2.941000	0.99782	0.655000	0.94253	CGA		0.413	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040		Nonsense_Mutation
FARSB	10056	broad.mit.edu	37	2	223464758	223464758	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:223464758T>G	ENST00000281828.6	-	16	1770	c.1507A>C	c.(1507-1509)Aac>Cac	p.N503H	FARSB_ENST00000536361.1_Missense_Mutation_p.N404H	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	503					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)	p.N503H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	GGATTCTTGTTGTAATAAACA	0.418																																																1	Substitution - Missense(1)	ovary(1)	2											133.0	125.0	128.0					2																	223464758		2203	4300	6503	223173002	SO:0001583	missense	10056			AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.1507A>C	2.37:g.223464758T>G	ENSP00000281828:p.Asn503His	Unknown		x	x	x	223173002	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	CCDS2454.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536738	0.85812	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.74374	0.3708	M	0.69248	2.105	0.80722	D	1	D;D	0.76494	0.999;0.999	P;D	0.65874	0.892;0.939	T	0.70784	-0.4778	9	0.16896	T	0.51	-20.9208	15.8277	0.78727	0.0:0.0:0.0:1.0	.	503;503	A8K666;Q9NSD9	.;SYFB_HUMAN	H	503;404	.	ENSP00000281828:N503H	N	-	1	0	FARSB	223173002	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.735000	0.68587	2.144000	0.66660	0.533000	0.62120	AAC		0.418	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687		Missense_Mutation
NCL	4691	broad.mit.edu	37	2	232325561	232325561	+	Silent	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr2:232325561A>T	ENST00000322723.4	-	4	870	c.630T>A	c.(628-630)gcT>gcA	p.A210A	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	210					angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.A210A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TAGTCTCCATAGCTTCTTCTT	0.413																																																1	Substitution - coding silent(1)	ovary(1)	2											130.0	126.0	127.0					2																	232325561		2203	4300	6503	232033805	SO:0001819	synonymous_variant	4691				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.630T>A	2.37:g.232325561A>T		Unknown		x	x	x	232033805	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Silent	SNP	ENST00000322723.4	37	CCDS33397.1	SNP	15	Broad																																																																																				0.413	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381		Silent
DEFB118	117285	broad.mit.edu	37	20	29960873	29960873	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:29960873C>A	ENST00000253381.2	+	2	305	c.272C>A	c.(271-273)aCa>aAa	p.T91K		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	91					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)		p.T91K(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AGGTTCACGACAGACTACTTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	20											120.0	112.0	115.0					20																	29960873		2203	4300	6503	29424534	SO:0001583	missense	117285			AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.272C>A	20.37:g.29960873C>A	ENSP00000253381:p.Thr91Lys	Unknown		x	x	x	29424534	Q17RC4|Q8N691|Q9NUH0	Missense_Mutation	SNP	ENST00000253381.2	37	CCDS13177.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114014	0.37339	.	.	ENSG00000131068	ENST00000253381	T	0.09255	3.0	2.3	0.189	0.15119	.	.	.	.	.	T	0.06371	0.0164	N	0.24115	0.695	0.09310	N	1	P	0.41978	0.767	B	0.37780	0.258	T	0.30650	-0.9971	9	0.59425	D	0.04	.	4.5571	0.12141	0.2565:0.4932:0.2504:0.0	.	91	Q96PH6	DB118_HUMAN	K	91	ENSP00000253381:T91K	ENSP00000253381:T91K	T	+	2	0	DEFB118	29424534	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.846000	0.00735	0.078000	0.16900	-0.181000	0.13052	ACA		0.453	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078501.2	NM_054112		Missense_Mutation
TTLL9	164395	broad.mit.edu	37	20	30497691	30497691	+	Missense_Mutation	SNP	G	G	C	rs368404184		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:30497691G>C	ENST00000375938.4	+	6	723	c.470G>C	c.(469-471)cGc>cCc	p.R157P	TTLL9_ENST00000375922.4_Missense_Mutation_p.R107P|TTLL9_ENST00000375934.4_Missense_Mutation_p.R139P|TTLL9_ENST00000375921.2_Missense_Mutation_p.R107P|TTLL9_ENST00000535842.1_Missense_Mutation_p.R157P|TTLL9_ENST00000310998.4_Missense_Mutation_p.R107P			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	157	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.R157P(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GAGGAGTTTCGCAAAAACCCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	20											76.0	74.0	74.0					20																	30497691		1980	4187	6167	29961352	SO:0001583	missense	164395			AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.470G>C	20.37:g.30497691G>C	ENSP00000365105:p.Arg157Pro	Unknown		x	x	x	29961352	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	ENST00000375938.4	37	CCDS42863.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078902	0.76528	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375921;ENST00000375935;ENST00000375934;ENST00000375922	T;T;T;T;T;T	0.07800	3.16;3.16;3.16;3.41;3.16;3.16	5.51	5.51	0.81932	.	0.349068	0.31438	N	0.007659	T	0.25680	0.0625	L	0.61218	1.895	0.52099	D	0.999948	D	0.58970	0.984	D	0.64144	0.922	T	0.00126	-1.2020	10	0.87932	D	0	.	16.5728	0.84629	0.0:0.0:1.0:0.0	.	157	Q3SXZ7	TTLL9_HUMAN	P	157;157;107;107;102;139;107	ENSP00000365105:R157P;ENSP00000442515:R157P;ENSP00000308980:R107P;ENSP00000365086:R107P;ENSP00000365100:R139P;ENSP00000365088:R107P	ENSP00000308980:R107P	R	+	2	0	TTLL9	29961352	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.953000	0.56699	2.592000	0.87571	0.561000	0.74099	CGC		0.562	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409		Missense_Mutation
GSS	2937	broad.mit.edu	37	20	33530370	33530370	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:33530370G>C	ENST00000216951.2	-	5	510	c.412C>G	c.(412-414)Cca>Gca	p.P138A	GSS_ENST00000451957.2_Intron|GSS_ENST00000541098.1_Missense_Mutation_p.P10A	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	138					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.P138A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	TTCAGGGCTGGGGAGCCATCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											67.0	60.0	63.0					20																	33530370		2203	4300	6503	32994031	SO:0001583	missense	2937				CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.412C>G	20.37:g.33530370G>C	ENSP00000216951:p.Pro138Ala	Unknown		x	x	x	32994031	B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	ENST00000216951.2	37	CCDS13245.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	3.330	-0.136812	0.06711	.	.	ENSG00000100983	ENST00000216951;ENST00000541098	D;D	0.90197	-2.63;-2.63	5.77	3.76	0.43208	Glutathione synthase, N-terminal, eukaryotic (1);	0.451624	0.27004	N	0.021413	T	0.81361	0.4806	N	0.26092	0.79	0.38830	D	0.95583	B	0.02656	0.0	B	0.01281	0.0	T	0.71178	-0.4669	10	0.05351	T	0.99	-0.9893	12.213	0.54389	0.0:0.1332:0.7328:0.134	.	138	P48637	GSHB_HUMAN	A	138;10	ENSP00000216951:P138A;ENSP00000439744:P10A	ENSP00000216951:P138A	P	-	1	0	GSS	32994031	0.001000	0.12720	1.000000	0.80357	0.905000	0.53344	-0.131000	0.10482	0.715000	0.32103	0.655000	0.94253	CCA		0.622	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2			Missense_Mutation
ADNP	23394	broad.mit.edu	37	20	49518641	49518641	+	Silent	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:49518641A>G	ENST00000396029.3	-	4	681	c.114T>C	c.(112-114)ttT>ttC	p.F38F	ADNP_ENST00000396032.3_Silent_p.F38F|ADNP_ENST00000349014.3_Silent_p.F38F|ADNP_ENST00000371602.4_Silent_p.F38F	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	38					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F38F(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CAAATTGTTTAAAATCCTAGA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	20											93.0	94.0	94.0					20																	49518641		2203	4300	6503	48952048	SO:0001819	synonymous_variant	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.114T>C	20.37:g.49518641A>G		Unknown		x	x	x	48952048	E1P5Y2|O94881|Q5BKU2|Q9UG34	Silent	SNP	ENST00000396029.3	37	CCDS13433.1	SNP	13	Broad																																																																																				0.363	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442		Silent
CYP24A1	1591	broad.mit.edu	37	20	52782304	52782304	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:52782304T>A	ENST00000216862.3	-	5	1102	c.709A>T	c.(709-711)Aac>Tac	p.N237Y	CYP24A1_ENST00000395955.3_Missense_Mutation_p.N237Y|CYP24A1_ENST00000395954.3_Missense_Mutation_p.N95Y	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	237					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.N237Y(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	ATGATGAAGTTCACAGCTTCA	0.378																																																1	Substitution - Missense(1)	ovary(1)	20											129.0	116.0	120.0					20																	52782304		2203	4300	6503	52215711	SO:0001583	missense	1591			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.709A>T	20.37:g.52782304T>A	ENSP00000216862:p.Asn237Tyr	Unknown		x	x	x	52215711	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	CCDS33491.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	14.48	2.547311	0.45383	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.69306	-0.39;-0.39;-0.39	5.37	3.1	0.35709	.	0.349888	0.32401	N	0.006149	T	0.67590	0.2909	L	0.43152	1.355	0.40762	D	0.983011	D;D;P	0.60160	0.987;0.97;0.948	P;P;P	0.60789	0.879;0.879;0.83	T	0.67883	-0.5555	10	0.62326	D	0.03	-0.6024	5.0208	0.14360	0.0:0.1605:0.1565:0.683	.	237;237;95	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	Y	237;237;95	ENSP00000216862:N237Y;ENSP00000379285:N237Y;ENSP00000379284:N95Y	ENSP00000216862:N237Y	N	-	1	0	CYP24A1	52215711	1.000000	0.71417	0.999000	0.59377	0.451000	0.32288	2.637000	0.46553	0.984000	0.38629	0.455000	0.32223	AAC		0.378	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2			Missense_Mutation
TAF4	6874	broad.mit.edu	37	20	60589749	60589749	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr20:60589749G>C	ENST00000252996.4	-	2	1374	c.1375C>G	c.(1375-1377)Cga>Gga	p.R459G	TAF4_ENST00000609045.1_5'Flank	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	459					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.R459G(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TTCTCACTTCGGACGAGGACC	0.627																																																1	Substitution - Missense(1)	ovary(1)	20											90.0	82.0	85.0					20																	60589749		2203	4300	6503	60023144	SO:0001583	missense	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1375C>G	20.37:g.60589749G>C	ENSP00000252996:p.Arg459Gly	Unknown		x	x	x	60023144	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	g	12.96	2.094641	0.36952	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.36878	1.28;1.23	4.97	3.03	0.35002	.	0.134840	0.51477	D	0.000098	T	0.52289	0.1725	M	0.71206	2.165	0.58432	D	0.999996	D	0.65815	0.995	P	0.61592	0.891	T	0.48906	-0.8993	10	0.20519	T	0.43	-14.6762	14.1858	0.65605	0.0:0.0:0.7317:0.2682	.	459	O00268	TAF4_HUMAN	G	459;323	ENSP00000252996:R459G;ENSP00000399091:R323G	ENSP00000252996:R459G	R	-	1	2	TAF4	60023144	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	6.014000	0.70784	0.525000	0.28522	-1.316000	0.01300	CGA		0.627	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		Missense_Mutation
ZNF385D	79750	broad.mit.edu	37	3	21462839	21462839	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:21462839C>A	ENST00000281523.2	-	8	1573	c.1055G>T	c.(1054-1056)aGt>aTt	p.S352I		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	352						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S352I(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						GAAGGGGGAACTCActgccac	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											45.0	47.0	46.0					3																	21462839		2203	4300	6503	21437843	SO:0001583	missense	79750			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.1055G>T	3.37:g.21462839C>A	ENSP00000281523:p.Ser352Ile	Unknown		x	x	x	21437843		Missense_Mutation	SNP	ENST00000281523.2	37	CCDS2636.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	7.016	0.557705	0.13436	.	.	ENSG00000151789	ENST00000281523	T	0.34275	1.37	6.08	1.17	0.20885	.	0.218563	0.48286	D	0.000189	T	0.20577	0.0495	N	0.24115	0.695	0.09310	N	1	B	0.15141	0.012	B	0.17979	0.02	T	0.13872	-1.0493	10	0.39692	T	0.17	-30.2357	6.0934	0.20007	0.0:0.1928:0.1282:0.6791	.	352	Q9H6B1	Z385D_HUMAN	I	352	ENSP00000281523:S352I	ENSP00000281523:S352I	S	-	2	0	ZNF385D	21437843	0.936000	0.31750	0.136000	0.22124	0.412000	0.31113	0.935000	0.28924	-0.025000	0.13918	0.650000	0.86243	AGT		0.542	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252884.1	NM_024697		Missense_Mutation
TOP2B	7155	broad.mit.edu	37	3	25665148	25665148	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:25665148T>C	ENST00000264331.4	-	21	2584	c.2585A>G	c.(2584-2586)tAt>tGt	p.Y862C	TOP2B_ENST00000435706.2_Missense_Mutation_p.Y857C	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	862					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)	p.Y857C(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TATAGGAATATACCACTCAGG	0.403																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	86.0	88.0					3																	25665148		1872	4101	5973	25640152	SO:0001583	missense	7155			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2585A>G	3.37:g.25665148T>C	ENSP00000264331:p.Tyr862Cys	Somatic		x	x	x	25640152	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526041	0.85600	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.53206	0.63;0.63	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.79064	0.4383	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86061	0.1532	10	0.87932	D	0	-11.7676	16.1472	0.81578	0.0:0.0:0.0:1.0	.	857	Q02880-2	.	C	857;862;857	ENSP00000396704:Y857C;ENSP00000264331:Y862C	ENSP00000264331:Y862C	Y	-	2	0	TOP2B	25640152	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.960000	0.87893	2.272000	0.75746	0.455000	0.32223	TAT		0.403	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				Missense_Mutation
SETD2	29072	broad.mit.edu	37	3	47125871	47125871	+	Splice_Site	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:47125871A>T	ENST00000409792.3	-	12	5441	c.5399T>A	c.(5398-5400)aTt>aAt	p.I1800N	SETD2_ENST00000492397.1_5'Flank	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1800					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.I1297N(1)|p.I1800N(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGTCTTTATAATCTGATTAAA	0.348			"""N, F, S, Mis"""		clear cell renal carcinoma																																		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	ovary(2)	3											33.0	32.0	32.0					3																	47125871		2201	4299	6500	47100875	SO:0001630	splice_region_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5398-1T>A	3.37:g.47125871A>T		Somatic		x	x	x	47100875	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	19.99	3.928630	0.73327	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.91464	-2.85	4.56	4.56	0.56223	.	0.000000	0.56097	D	0.000039	D	0.93197	0.7833	L	0.53249	1.67	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	D	0.93963	0.7242	10	0.87932	D	0	.	14.3831	0.66923	1.0:0.0:0.0:0.0	.	1800;1800	F2Z317;Q9BYW2	.;SETD2_HUMAN	N	1800	ENSP00000386759:I1800N	ENSP00000386759:I1800N	I	-	2	0	SETD2	47100875	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.683000	0.91236	2.036000	0.60181	0.528000	0.53228	ATT		0.348	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Missense_Mutation	Missense_Mutation
ZNF80	7634	broad.mit.edu	37	3	113955646	113955646	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:113955646G>A	ENST00000482457.2	-	1	779	c.276C>T	c.(274-276)ttC>ttT	p.F92F	RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	92					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F92F(1)		NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TGGGTCGAACGAAGTCGACCT	0.537																																					GBM(23;986 1114 21716)											1	Substitution - coding silent(1)	ovary(1)	3											69.0	60.0	63.0					3																	113955646		2203	4300	6503	115438336	SO:0001819	synonymous_variant	7634			X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.276C>T	3.37:g.113955646G>A		Unknown		x	x	x	115438336	Q6NSW4|Q6NT14	Silent	SNP	ENST00000482457.2	37	CCDS2979.1	SNP	37	Broad																																																																																				0.537	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136		Silent
ZBTB20	26137	broad.mit.edu	37	3	114069892	114069892	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:114069892C>G	ENST00000474710.1	-	4	1211	c.1033G>C	c.(1033-1035)Gtg>Ctg	p.V345L	ZBTB20_ENST00000481632.1_Missense_Mutation_p.V272L|ZBTB20_ENST00000471418.1_Missense_Mutation_p.V272L|ZBTB20_ENST00000462705.1_Missense_Mutation_p.V272L|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20_ENST00000357258.3_Missense_Mutation_p.V272L|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000464560.1_Missense_Mutation_p.V272L|ZBTB20_ENST00000393785.2_Missense_Mutation_p.V272L	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	345						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.V272L(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		AGGATCTGCACCCTTTGCTGC	0.602																																					NSCLC(69;748 1344 9802 11203 30933)											1	Substitution - Missense(1)	ovary(1)	3											136.0	98.0	111.0					3																	114069892		2203	4300	6503	115552582	SO:0001583	missense	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1033G>C	3.37:g.114069892C>G	ENSP00000419153:p.Val345Leu	Unknown		x	x	x	115552582	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017870	0.35606	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.99;2.94;2.94	5.28	5.28	0.74379	.	0.000000	0.52532	D	0.000061	T	0.08044	0.0201	N	0.14661	0.345	0.35043	D	0.759929	B	0.21147	0.052	B	0.22152	0.038	T	0.16660	-1.0395	10	0.49607	T	0.09	.	14.0046	0.64456	0.151:0.8489:0.0:0.0	.	345	Q9HC78	ZBT20_HUMAN	L	272;272;272;272;345;272;272	ENSP00000420324:V272L;ENSP00000377375:V272L;ENSP00000418092:V272L;ENSP00000419902:V272L;ENSP00000419153:V345L;ENSP00000349803:V272L;ENSP00000417307:V272L	ENSP00000349803:V272L	V	-	1	0	ZBTB20	115552582	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.734000	0.47368	2.763000	0.94921	0.650000	0.86243	GTG		0.602	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642		Missense_Mutation
GOLGB1	2804	broad.mit.edu	37	3	121410506	121410506	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:121410506C>A	ENST00000340645.5	-	14	7815	c.7690G>T	c.(7690-7692)Gag>Tag	p.E2564*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.E2569*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2564					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.E2564*(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTTTCCAGCTCCTTATTTTGC	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	3											113.0	117.0	116.0					3																	121410506		2203	4300	6503	122893196	SO:0001587	stop_gained	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7690G>T	3.37:g.121410506C>A	ENSP00000341848:p.Glu2564*	Unknown		x	x	x	122893196	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	46	12.289650	0.99654	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	.	.	.	5.25	5.25	0.73442	.	0.310848	0.28317	N	0.015796	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	9.7098	0.40238	0.0:0.9086:0.0:0.0914	.	.	.	.	X	2564;2569	.	ENSP00000341848:E2564X	E	-	1	0	GOLGB1	122893196	0.003000	0.15002	0.992000	0.48379	0.374000	0.29953	0.752000	0.26362	2.717000	0.92951	0.655000	0.94253	GAG		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		Nonsense_Mutation
ACAD9	28976	broad.mit.edu	37	3	128618296	128618296	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:128618296G>T	ENST00000308982.7	+	7	881	c.800G>T	c.(799-801)gGc>gTc	p.G267V	ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	267						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.G267V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						GGCATTCGGGGCTCCAACAGT	0.493																																																1	Substitution - Missense(1)	ovary(1)	3											100.0	98.0	99.0					3																	128618296		2203	4300	6503	130100986	SO:0001583	missense	28976			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.800G>T	3.37:g.128618296G>T	ENSP00000312618:p.Gly267Val	Unknown		x	x	x	130100986	D3DNB8|Q8WXX3	Missense_Mutation	SNP	ENST00000308982.7	37	CCDS3053.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931653	0.92389	.	.	ENSG00000177646	ENST00000308982;ENST00000334167	D	0.99060	-5.38	5.32	5.32	0.75619	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.048448	0.85682	D	0.000000	D	0.99214	0.9727	M	0.87827	2.91	0.80722	D	1	P;D;D	0.60575	0.531;0.988;0.988	P;P;P	0.60345	0.594;0.807;0.873	D	0.99274	1.0894	10	0.72032	D	0.01	.	16.484	0.84179	0.0:0.0:1.0:0.0	.	144;217;267	Q9H9W4;Q59FN3;Q9H845	.;.;ACAD9_HUMAN	V	267;134	ENSP00000312618:G267V	ENSP00000312618:G267V	G	+	2	0	ACAD9	130100986	1.000000	0.71417	0.998000	0.56505	0.842000	0.47809	9.293000	0.96082	2.499000	0.84300	0.655000	0.94253	GGC		0.493	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049		Missense_Mutation
PLSCR1	5359	broad.mit.edu	37	3	146233888	146233888	+	Splice_Site	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:146233888C>G	ENST00000342435.4	-	9	1311	c.901G>C	c.(901-903)Gac>Cac	p.D301H	PLSCR1_ENST00000484560.1_5'Flank|PLSCR1_ENST00000487389.1_Splice_Site_p.D294H|PLSCR1_ENST00000448787.2_Splice_Site_p.D220H|PLSCR1_ENST00000448205.1_Splice_Site_p.D13H	NM_021105.2	NP_066928.1	O15162	PLS1_HUMAN	phospholipid scramblase 1	301					acute-phase response (GO:0006953)|apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|negative regulation of viral genome replication (GO:0045071)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid scrambling (GO:0017121)|platelet activation (GO:0030168)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of gene expression (GO:0010628)|positive regulation of innate immune response (GO:0045089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|regulation of mast cell activation (GO:0033003)|response to interferon-beta (GO:0035456)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|epidermal growth factor receptor binding (GO:0005154)|phospholipid scramblase activity (GO:0017128)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SH3 domain binding (GO:0017124)	p.D301H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15						AACATGAAGTCCTAGATAAAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	83.0	83.0					3																	146233888		2203	4300	6503	147716578	SO:0001630	splice_region_variant	5359			AF098642	CCDS3135.1	3q23	2004-02-27			ENSG00000188313	ENSG00000188313			9092	protein-coding gene	gene with protein product		604170				9218461	Standard	NM_021105		Approved	MMTRA1B	uc003evx.4	O15162	OTTHUMG00000159427	ENST00000342435.4:c.901-1G>C	3.37:g.146233888C>G		Unknown		x	x	x	147716578	B2R8H8|B4DTE8	Missense_Mutation	SNP	ENST00000342435.4	37	CCDS3135.1	SNP	30	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.32|12.32	1.901416|1.901416	0.33535|0.33535	.|.	.|.	ENSG00000188313|ENSG00000188313	ENST00000342435;ENST00000448205;ENST00000487389;ENST00000448787|ENST00000483300	T;T;T;T|.	0.57436|.	0.4;0.4;0.4;0.4|.	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.000000|.	0.36101|.	U|.	0.002795|.	T|T	0.81394|0.81394	0.4813|0.4813	H|H	0.94264|0.94264	3.515|3.515	0.29307|0.29307	N|N	0.868318|0.868318	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.992;0.998|.	T|T	0.80714|0.80714	-0.1259|-0.1259	10|5	0.87932|.	D|.	0|.	.|.	16.6974|16.6974	0.85339|0.85339	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	220;301|.	B4DTE8;O15162|.	.;PLS1_HUMAN|.	H|F	301;13;294;220|167	ENSP00000345494:D301H;ENSP00000414653:D13H;ENSP00000417792:D294H;ENSP00000411675:D220H|.	ENSP00000345494:D301H|.	D|L	-|-	1|3	0|2	PLSCR1|PLSCR1	147716578|147716578	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.121000|0.121000	0.20230|0.20230	6.097000|6.097000	0.71452|0.71452	2.352000|2.352000	0.79861|0.79861	0.655000|0.655000	0.94253|0.94253	GAC|TTG		0.348	PLSCR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355257.2	NM_021105	Missense_Mutation	Missense_Mutation
CLNK	116449	broad.mit.edu	37	4	10573381	10573381	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr4:10573381T>C	ENST00000226951.6	-	5	373	c.134A>G	c.(133-135)aAg>aGg	p.K45R	CLNK_ENST00000507719.1_Missense_Mutation_p.K3R|CLNK_ENST00000442825.2_Missense_Mutation_p.K3R	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	45					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)	p.K45R(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						TAGAAGAGGCTTGTTCATCCT	0.403																																					GBM(87;402 1286 6949 13902 35851)											1	Substitution - Missense(1)	ovary(1)	4											57.0	58.0	58.0					4																	10573381		1853	4101	5954	10182479	SO:0001583	missense	116449			AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.134A>G	4.37:g.10573381T>C	ENSP00000226951:p.Lys45Arg	Unknown		x	x	x	10182479	Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	37	CCDS47024.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	10.09	1.253942	0.22965	.	.	ENSG00000109684	ENST00000226951;ENST00000429087;ENST00000442825;ENST00000507719	T;T;T	0.46451	1.88;0.87;0.87	3.9	2.67	0.31697	.	2.861140	0.01338	N	0.011470	T	0.31071	0.0785	N	0.14661	0.345	0.09310	N	1	B;B	0.19583	0.027;0.037	B;B	0.19391	0.025;0.011	T	0.29274	-1.0017	10	0.72032	D	0.01	-10.9552	7.3114	0.26477	0.0:0.0:0.2248:0.7752	.	3;45	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	R	45;45;3;3	ENSP00000226951:K45R;ENSP00000390744:K3R;ENSP00000427208:K3R	ENSP00000226951:K45R	K	-	2	0	CLNK	10182479	0.066000	0.20996	0.059000	0.19551	0.006000	0.05464	1.568000	0.36418	0.807000	0.34208	0.460000	0.39030	AAG		0.403	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964		Missense_Mutation
HERC5	51191	broad.mit.edu	37	4	89415416	89415416	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr4:89415416T>G	ENST00000264350.3	+	18	2531	c.2378T>G	c.(2377-2379)tTt>tGt	p.F793C	HERC5_ENST00000508159.1_Missense_Mutation_p.F431C|AC083829.1_ENST00000408152.2_RNA	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	793	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.F793C(1)		NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		CTGGCACTGTTTAAGAAACTT	0.398																																					Esophageal Squamous(39;887 1012 34045 50514)											1	Substitution - Missense(1)	ovary(1)	4											94.0	98.0	97.0					4																	89415416		2203	4300	6503	89634439	SO:0001583	missense	51191			AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2378T>G	4.37:g.89415416T>G	ENSP00000264350:p.Phe793Cys	Unknown		x	x	x	89634439	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	37	CCDS3630.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432934	0.62844	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.47177	0.85;0.85	4.47	4.47	0.54385	HECT (4);	0.000000	0.56097	D	0.000036	T	0.71484	0.3345	M	0.89478	3.035	0.31145	N	0.706168	D	0.89917	1.0	D	0.87578	0.998	T	0.76997	-0.2751	10	0.87932	D	0	.	12.0278	0.53382	0.0:0.0:0.0:1.0	.	793	Q9UII4	HERC5_HUMAN	C	793;431	ENSP00000264350:F793C;ENSP00000424129:F431C	ENSP00000264350:F793C	F	+	2	0	HERC5	89634439	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.343000	0.33930	2.003000	0.58678	0.397000	0.26171	TTT		0.398	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323		Missense_Mutation
DDX60	55601	broad.mit.edu	37	4	169206560	169206560	+	Silent	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr4:169206560A>G	ENST00000393743.3	-	11	1720	c.1429T>C	c.(1429-1431)Ttg>Ctg	p.L477L		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	477					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.L477L(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AGAAAAGGCAAATCTTTCAAA	0.358																																																2	Substitution - coding silent(2)	ovary(2)	4											55.0	53.0	54.0					4																	169206560		2203	4300	6503	169443135	SO:0001819	synonymous_variant	55601			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1429T>C	4.37:g.169206560A>G		Unknown		x	x	x	169443135	Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	37	CCDS34097.1	SNP	1	Broad																																																																																				0.358	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631		Silent
SLC45A2	51151	broad.mit.edu	37	5	33964006	33964006	+	Silent	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:33964006G>A	ENST00000296589.4	-	3	824	c.678C>T	c.(676-678)ctC>ctT	p.L226L	SLC45A2_ENST00000382102.3_Silent_p.L226L|SLC45A2_ENST00000509381.1_Intron|SLC45A2_ENST00000345083.5_Intron|SLC45A2_ENST00000342059.3_Silent_p.L167L	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	226					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.L226L(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						AACACAAAGTGAGCACCAATG	0.502																																					Ovarian(31;380 859 8490 22203 49048)											1	Substitution - coding silent(1)	ovary(1)	5											115.0	114.0	114.0					5																	33964006		2203	4300	6503	33999763	SO:0001819	synonymous_variant	51151			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.678C>T	5.37:g.33964006G>A		Unknown		x	x	x	33999763	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000296589.4	37	CCDS3901.1	SNP	45	Broad																																																																																				0.502	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180		Silent
GPR98	84059	broad.mit.edu	37	5	89990498	89990498	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:89990498A>T	ENST00000405460.2	+	33	8021	c.7925A>T	c.(7924-7926)gAg>gTg	p.E2642V		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2642	Calx-beta 18. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E2642V(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGTGCTGGAGAGATTCTGACC	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											78.0	82.0	81.0					5																	89990498		1942	4130	6072	90026254	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7925A>T	5.37:g.89990498A>T	ENSP00000384582:p.Glu2642Val	Unknown		x	x	x	90026254	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	SNP	11	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.48|18.48	3.633192|3.633192	0.67015|0.67015	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.27104|.	1.69|.	5.51|5.51	4.34|4.34	0.51931|0.51931	Na-Ca exchanger/integrin-beta4 (2);|.	0.378209|.	0.35407|.	N|.	0.003223|.	T|.	0.58652|.	0.2137|.	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	P;P|.	0.38565|.	0.637;0.484|.	P;P|.	0.49502|.	0.511;0.613|.	T|.	0.54549|.	-0.8277|.	10|.	0.62326|.	D|.	0.03|.	.|.	11.7439|11.7439	0.51809|0.51809	0.9301:0.0:0.0699:0.0|0.9301:0.0:0.0699:0.0	.|.	2642;2642|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	V|X	2642|208	ENSP00000384582:E2642V|.	ENSP00000296619:E2642V|.	E|R	+|+	2|1	0|2	GPR98|GPR98	90026254|90026254	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.944000|0.944000	0.59088|0.59088	5.069000|5.069000	0.64370|0.64370	1.006000|1.006000	0.39211|0.39211	0.533000|0.533000	0.62120|0.62120	GAG|AGA		0.413	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119		Missense_Mutation
LNPEP	4012	broad.mit.edu	37	5	96333740	96333740	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:96333740G>T	ENST00000231368.5	+	8	2236	c.1544G>T	c.(1543-1545)cGa>cTa	p.R515L	LNPEP_ENST00000395770.3_Missense_Mutation_p.R501L	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	515					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R515L(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TTAGATGCTCGATTTAAAACC	0.279																																																1	Substitution - Missense(1)	ovary(1)	5											77.0	85.0	82.0					5																	96333740		2203	4292	6495	96359496	SO:0001583	missense	4012			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1544G>T	5.37:g.96333740G>T	ENSP00000231368:p.Arg515Leu	Unknown		x	x	x	96359496	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307744	0.81247	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.02579	4.24;4.24	6.17	5.3	0.74995	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.114883	0.56097	D	0.000024	T	0.01976	0.0062	N	0.05534	-0.03	0.58432	D	0.999992	B	0.18863	0.031	B	0.24701	0.055	T	0.57946	-0.7723	10	0.18710	T	0.47	.	10.987	0.47528	0.0679:0.0:0.8021:0.13	.	515	Q9UIQ6	LCAP_HUMAN	L	515;501	ENSP00000231368:R515L;ENSP00000379117:R501L	ENSP00000231368:R515L	R	+	2	0	LNPEP	96359496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.500000	0.53318	1.616000	0.50265	0.655000	0.94253	CGA		0.279	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575		Missense_Mutation
SLCO6A1	133482	broad.mit.edu	37	5	101755550	101755550	+	Silent	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:101755550C>T	ENST00000506729.1	-	8	1623	c.1452G>A	c.(1450-1452)ggG>ggA	p.G484G	SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000379807.3_Silent_p.G484G|SLCO6A1_ENST00000389019.3_Silent_p.G422G|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	484						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.G484G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CTTCATTGATCCCAGCAAATT	0.318																																																1	Substitution - coding silent(1)	ovary(1)	5											103.0	109.0	107.0					5																	101755550		2203	4300	6503	101783449	SO:0001819	synonymous_variant	133482			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1452G>A	5.37:g.101755550C>T		Unknown		x	x	x	101783449	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	37	CCDS34206.1	SNP	30	Broad																																																																																				0.318	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488		Silent
ITK	3702	broad.mit.edu	37	5	156668715	156668715	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:156668715G>T	ENST00000422843.3	+	11	1197	c.1045G>T	c.(1045-1047)Gca>Tca	p.A349S	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	349					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.A349S(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CCCAGTTACAGCAGGGCTGAG	0.493			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)	5											79.0	67.0	71.0					5																	156668715		2203	4300	6503	156601293	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1045G>T	5.37:g.156668715G>T	ENSP00000398655:p.Ala349Ser	Somatic		x	x	x	156601293	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562505	0.45694	.	.	ENSG00000113263	ENST00000422843	T	0.75367	-0.93	6.08	6.08	0.98989	Protein kinase-like domain (1);	0.219510	0.47455	D	0.000238	T	0.76478	0.3993	M	0.69823	2.125	0.53005	D	0.999963	B	0.11235	0.004	B	0.09377	0.004	T	0.71481	-0.4580	10	0.72032	D	0.01	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	349	Q08881	ITK_HUMAN	S	349	ENSP00000398655:A349S	ENSP00000398655:A349S	A	+	1	0	ITK	156601293	1.000000	0.71417	0.979000	0.43373	0.052000	0.14988	8.161000	0.89655	2.894000	0.99253	0.655000	0.94253	GCA		0.493	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Missense_Mutation
TENM2	57451	broad.mit.edu	37	5	167653236	167653236	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:167653236C>A	ENST00000518659.1	+	24	5291	c.5252C>A	c.(5251-5253)tCt>tAt	p.S1751Y	TENM2_ENST00000545108.1_Missense_Mutation_p.S1750Y|TENM2_ENST00000519204.1_Missense_Mutation_p.S1630Y|TENM2_ENST00000520394.1_Missense_Mutation_p.S1512Y|TENM2_ENST00000403607.2_Missense_Mutation_p.S1575Y	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1751					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.S1584Y(1)									ACCAACCTCTCTTCAGTAGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											60.0	62.0	61.0					5																	167653236		2022	4176	6198	167585814	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5252C>A	5.37:g.167653236C>A	ENSP00000429430:p.Ser1751Tyr	Unknown		x	x	x	167585814	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494085	0.85069	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90563	-2.21;-2.2;-2.32;-2.65;-2.69	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.95589	0.8566	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.992	D	0.95497	0.8574	10	0.56958	D	0.05	.	19.1283	0.93394	0.0:1.0:0.0:0.0	.	1750;1751;1512	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Y	1751;1750;1630;1512;1575	ENSP00000429430:S1751Y;ENSP00000438635:S1750Y;ENSP00000428964:S1630Y;ENSP00000427874:S1512Y;ENSP00000384905:S1575Y	ENSP00000384905:S1575Y	S	+	2	0	ODZ2	167585814	1.000000	0.71417	0.919000	0.36401	0.835000	0.47333	7.818000	0.86416	2.543000	0.85770	0.555000	0.69702	TCT		0.522	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679		Missense_Mutation
DDX41	51428	broad.mit.edu	37	5	176943129	176943129	+	Missense_Mutation	SNP	C	C	T	rs200567842		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:176943129C>T	ENST00000507955.1	-	4	887	c.364G>A	c.(364-366)Gag>Aag	p.E122K	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	122					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E122K(1)				all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CCTCGGCCCTCGGCAACACTC	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											182.0	186.0	185.0					5																	176943129		2203	4300	6503	176875735	SO:0001583	missense	51428			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.364G>A	5.37:g.176943129C>T	ENSP00000422753:p.Glu122Lys	Unknown		x	x	x	176875735	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	37	CCDS4427.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734359	0.89482	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.27104	1.69;1.69	5.47	5.47	0.80525	.	0.062791	0.64402	D	0.000007	T	0.26593	0.0650	M	0.66378	2.025	0.80722	D	1	P	0.48694	0.914	B	0.34038	0.174	T	0.14699	-1.0463	10	0.25106	T	0.35	-30.3933	19.3222	0.94246	0.0:1.0:0.0:0.0	.	122	Q9UJV9	DDX41_HUMAN	K	140;122	ENSP00000330349:E140K;ENSP00000422753:E122K	ENSP00000330349:E140K	E	-	1	0	DDX41	176875735	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	5.612000	0.67681	2.560000	0.86352	0.561000	0.74099	GAG		0.522	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222		Missense_Mutation
RMND5B	64777	broad.mit.edu	37	5	177571013	177571013	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:177571013C>G	ENST00000515098.1	+	8	949	c.598C>G	c.(598-600)Cac>Gac	p.H200D	RMND5B_ENST00000313386.4_Missense_Mutation_p.H200D|RMND5B_ENST00000542098.1_Missense_Mutation_p.H187D			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	200	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.							p.H200D(1)		endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCACCGACTGCACTTCATCCG	0.627																																																1	Substitution - Missense(1)	ovary(1)	5											62.0	66.0	65.0					5																	177571013		2203	4300	6503	177503619	SO:0001583	missense	64777			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.598C>G	5.37:g.177571013C>G	ENSP00000420875:p.His200Asp	Unknown		x	x	x	177503619	Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	ENST00000515098.1	37	CCDS4431.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535267	0.45176	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	4.3	3.43	0.39272	CTLH, C-terminal LisH motif (2);	0.376195	0.30949	N	0.008556	T	0.47746	0.1462	L	0.51422	1.61	0.36864	D	0.888557	P;P;B	0.44344	0.833;0.799;0.27	P;B;B	0.45971	0.499;0.366;0.281	T	0.52495	-0.8568	9	0.40728	T	0.16	-9.2957	6.4456	0.21875	0.0:0.7835:0.0:0.2165	.	187;187;200	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	D	200;200;187	.	ENSP00000320623:H200D	H	+	1	0	RMND5B	177503619	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.053000	0.41326	1.020000	0.39573	0.313000	0.20887	CAC		0.627	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1	NM_022762		Missense_Mutation
CLK4	57396	broad.mit.edu	37	5	178050414	178050414	+	Missense_Mutation	SNP	G	G	A	rs140778498	byFrequency	TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:178050414G>A	ENST00000316308.4	-	2	172	c.4C>T	c.(4-6)Cgg>Tgg	p.R2W	CLK4_ENST00000520957.1_Missense_Mutation_p.R2W	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	2					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R2W(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTGGAATGCCGCATCTGTTGA	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											116.0	99.0	105.0					5																	178050414		2203	4300	6503	177983020	SO:0001583	missense	57396			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.4C>T	5.37:g.178050414G>A	ENSP00000316948:p.Arg2Trp	Unknown		x	x	x	177983020		Missense_Mutation	SNP	ENST00000316308.4	37	CCDS4437.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411057	0.83340	.	.	ENSG00000113240	ENST00000316308;ENST00000536763;ENST00000520957	T	0.08370	3.1	5.56	4.69	0.59074	.	0.058754	0.64402	D	0.000002	T	0.29491	0.0735	M	0.80982	2.52	0.43814	D	0.996376	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.976;0.976;0.999;0.988;0.993	T	0.03344	-1.1046	10	0.72032	D	0.01	.	11.9505	0.52952	0.0:0.0:0.8266:0.1734	.	2;2;2;2;2	B7Z990;B7ZL31;E7EWJ6;Q4G0Z5;Q9HAZ1	.;.;.;.;CLK4_HUMAN	W	2	ENSP00000316948:R2W	ENSP00000316948:R2W	R	-	1	2	CLK4	177983020	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.216000	0.51176	1.346000	0.45694	0.491000	0.48974	CGG		0.383	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2			Missense_Mutation
ZNF354B	117608	broad.mit.edu	37	5	178311066	178311066	+	Missense_Mutation	SNP	T	T	A	rs183547942	byFrequency	TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr5:178311066T>A	ENST00000322434.3	+	5	1839	c.1613T>A	c.(1612-1614)aTa>aAa	p.I538K	RNU1-39P_ENST00000383897.1_RNA|ZNF354B_ENST00000522714.1_3'UTR	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I538K(1)		breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAGCTCTTATACAACATCAG	0.358																																																1	Substitution - Missense(1)	ovary(1)	5											92.0	85.0	88.0					5																	178311066		2203	4300	6503	178243672	SO:0001583	missense	117608			AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.1613T>A	5.37:g.178311066T>A	ENSP00000327143:p.Ile538Lys	Unknown		x	x	x	178243672	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	37	CCDS4439.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	7.957	0.746111	0.15710	.	.	ENSG00000178338	ENST00000322434	T	0.44482	0.92	3.52	-0.521	0.11931	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18045	0.0433	N	0.05078	-0.115	0.09310	N	0.999998	B	0.10296	0.003	B	0.14578	0.011	T	0.17561	-1.0365	9	0.40728	T	0.16	-12.4976	3.0377	0.06128	0.1943:0.3419:0.0:0.4638	.	538	Q96LW1	Z354B_HUMAN	K	538	ENSP00000327143:I538K	ENSP00000327143:I538K	I	+	2	0	ZNF354B	178243672	0.000000	0.05858	0.956000	0.39512	0.094000	0.18550	0.138000	0.16016	0.027000	0.15297	0.454000	0.30748	ATA		0.358	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230		Missense_Mutation
DDX39B	7919	broad.mit.edu	37	6	31508234	31508234	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr6:31508234C>T	ENST00000396172.1	-	2	706	c.76G>A	c.(76-78)Ggg>Agg	p.G26R	DDX39B-AS1_ENST00000420520.1_RNA|DDX39B_ENST00000449074.2_Missense_Mutation_p.G26R|DDX39B-AS1_ENST00000416684.1_RNA|ATP6V1G2-DDX39B_ENST00000475917.1_5'Flank|DDX39B_ENST00000415382.2_Missense_Mutation_p.M21I|SNORD84_ENST00000584275.1_RNA|DDX39B_ENST00000458640.1_Missense_Mutation_p.G26R|ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR|DDX39B_ENST00000376177.2_Missense_Mutation_p.G26R|DDX39B_ENST00000453105.2_Missense_Mutation_p.M21I|DDX39B_ENST00000417556.2_Missense_Mutation_p.G26R	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	26					ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)	p.G26R(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						GCCTCAGCCCCATCTCCCCCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	80.0	82.0					6																	31508234		2203	4300	6503	31616213	SO:0001583	missense	7919			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.76G>A	6.37:g.31508234C>T	ENSP00000379475:p.Gly26Arg	Unknown		x	x	x	31616213	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	37	CCDS4697.1	SNP	21	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.219435|4.219435	0.79464|0.79464	.|.	.|.	ENSG00000198563|ENSG00000198563	ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000427214;ENST00000428098;ENST00000419338;ENST00000456662;ENST00000449074;ENST00000428450;ENST00000449757;ENST00000456976;ENST00000418897;ENST00000419020;ENST00000458215|ENST00000415382;ENST00000431908;ENST00000453105	T;T;T;T;T;T;T;T;T;T;T;T;T;T|T;T;T	0.46819|0.43688	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86|0.94;2.61;3.44	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.066314|.	0.56097|.	D|.	0.000021|.	T|T	0.26991|0.26991	0.0661|0.0661	L|L	0.58510|0.58510	1.815|1.815	0.53688|0.53688	D|D	0.999972|0.999972	B;B;B|B;B;B	0.27264|0.27853	0.157;0.0;0.173|0.001;0.191;0.0	B;B;B|B;B;B	0.28916|0.10450	0.096;0.001;0.067|0.001;0.005;0.0	T|T	0.10636|0.10636	-1.0621|-1.0621	10|9	0.48119|0.52906	T|T	0.1|0.07	-19.6861|-19.6861	14.9572|14.9572	0.71124|0.71124	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	46;26;26|21;21;21	Q59G92;Q13838;Q5STU3|B4DIZ8;B4DIJ6;B4DP52	.;DX39B_HUMAN;.|.;.;.	R|I	26;26;26;26;26;26;26;26;26;26;49;26;41;26;26|21	ENSP00000365347:G26R;ENSP00000416269:G26R;ENSP00000379475:G26R;ENSP00000412582:G26R;ENSP00000399371:G26R;ENSP00000392672:G26R;ENSP00000410313:G26R;ENSP00000416350:G26R;ENSP00000391946:G26R;ENSP00000405707:G26R;ENSP00000409426:G49R;ENSP00000393984:G26R;ENSP00000399841:G41R;ENSP00000405245:G26R|ENSP00000392669:M21I;ENSP00000408000:M21I;ENSP00000400328:M21I	ENSP00000365347:G26R|ENSP00000392669:M21I	G|M	-|-	1|3	0|0	DDX39B|DDX39B	31616213|31616213	0.936000|0.936000	0.31750|0.31750	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.525000|5.525000	0.67110|0.67110	2.592000|2.592000	0.87571|0.87571	0.563000|0.563000	0.77884|0.77884	GGG|ATG		0.577	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640		Missense_Mutation
TBX18	9096	broad.mit.edu	37	6	85447043	85447043	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr6:85447043C>A	ENST00000369663.5	-	8	1521	c.1184G>T	c.(1183-1185)tGc>tTc	p.C395F	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	395					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.C395F(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AGGAGAGGAGCAAGAGGAGCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											75.0	77.0	77.0					6																	85447043		2203	4300	6503	85503762	SO:0001583	missense	9096			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1184G>T	6.37:g.85447043C>A	ENSP00000358677:p.Cys395Phe	Unknown		x	x	x	85503762	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262309	0.59431	.	.	ENSG00000112837	ENST00000369663	D	0.92752	-3.1	5.36	5.36	0.76844	.	0.504726	0.25009	N	0.033844	D	0.90359	0.6983	L	0.34521	1.04	0.80722	D	1	D	0.58970	0.984	P	0.56343	0.796	D	0.88520	0.3095	10	0.27082	T	0.32	.	19.072	0.93143	0.0:1.0:0.0:0.0	.	395	O95935	TBX18_HUMAN	F	395	ENSP00000358677:C395F	ENSP00000358677:C395F	C	-	2	0	TBX18	85503762	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	7.153000	0.77428	2.511000	0.84671	0.585000	0.79938	TGC		0.572	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508		Missense_Mutation
EPHA7	2045	broad.mit.edu	37	6	93982019	93982019	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr6:93982019C>A	ENST00000369303.4	-	6	1630	c.1446G>T	c.(1444-1446)gaG>gaT	p.E482D		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	482	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.E482D(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CACTTACTTTCTCGTAATACT	0.418																																																1	Substitution - Missense(1)	ovary(1)	6											303.0	270.0	281.0					6																	93982019		2203	4300	6503	94038740	SO:0001583	missense	2045			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1446G>T	6.37:g.93982019C>A	ENSP00000358309:p.Glu482Asp	Somatic		x	x	x	94038740	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641394	0.67244	.	.	ENSG00000135333	ENST00000369303	T	0.58506	0.33	5.49	5.49	0.81192	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73401	0.3582	M	0.76727	2.345	0.58432	D	0.999994	D;D;D	0.89917	0.974;1.0;1.0	D;D;D	0.77004	0.953;0.981;0.989	T	0.74526	-0.3636	10	0.62326	D	0.03	.	19.7279	0.96172	0.0:1.0:0.0:0.0	.	482;482;482	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	D	482	ENSP00000358309:E482D	ENSP00000358309:E482D	E	-	3	2	EPHA7	94038740	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	3.604000	0.54081	2.750000	0.94351	0.561000	0.74099	GAG		0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			Missense_Mutation
MCHR2	84539	broad.mit.edu	37	6	100368898	100368898	+	Missense_Mutation	SNP	T	T	C	rs369501589		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr6:100368898T>C	ENST00000281806.2	-	6	1255	c.941A>G	c.(940-942)cAg>cGg	p.Q314R	MCHR2_ENST00000369212.2_Missense_Mutation_p.Q314R	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.Q314R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CAGACGTTTCTGGAAATTTCC	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											136.0	140.0	139.0					6																	100368898		2203	4300	6503	100475619	SO:0001583	missense	84539			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.941A>G	6.37:g.100368898T>C	ENSP00000281806:p.Gln314Arg	Unknown		x	x	x	100475619	B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	ENST00000281806.2	37	CCDS5044.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	0.433	-0.902615	0.02453	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.20881	2.04;2.04;2.04	5.47	1.7	0.24286	.	0.312029	0.24793	N	0.035557	T	0.02083	0.0065	N	0.08118	0	0.24909	N	0.992054	B	0.02656	0.0	B	0.01281	0.0	T	0.46952	-0.9154	10	0.06625	T	0.88	.	8.7748	0.34756	0.0:0.6747:0.0:0.3253	.	314	Q969V1	MCHR2_HUMAN	R	314	ENSP00000403490:Q314R;ENSP00000281806:Q314R;ENSP00000358214:Q314R	ENSP00000281806:Q314R	Q	-	2	0	MCHR2	100475619	0.871000	0.30034	0.989000	0.46669	0.565000	0.35776	0.130000	0.15850	0.019000	0.15079	-0.242000	0.12053	CAG		0.438	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2	NM_032503		Missense_Mutation
LAMA4	3910	broad.mit.edu	37	6	112506504	112506504	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr6:112506504G>A	ENST00000230538.7	-	9	1409	c.1012C>T	c.(1012-1014)Caa>Taa	p.Q338*	LAMA4_ENST00000389463.4_Nonsense_Mutation_p.Q331*|LAMA4_ENST00000522006.1_Nonsense_Mutation_p.Q331*|LAMA4_ENST00000424408.2_Nonsense_Mutation_p.Q331*	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	338	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.Q331*(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TTGTTGATTTGTATCTTTCTT	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	6											369.0	297.0	321.0					6																	112506504		2203	4300	6503	112613197	SO:0001587	stop_gained	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1012C>T	6.37:g.112506504G>A	ENSP00000230538:p.Gln338*	Unknown		x	x	x	112613197	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Nonsense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.824638|7.824638	0.98510|0.98510	.|.	.|.	ENSG00000112769|ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881|ENST00000521732	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.317949|.	0.34676|.	N|.	0.003777|.	.|T	.|0.65903	.|0.2736	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63559	.|-0.6610	.|4	0.36615|.	T|.	0.2|.	.|.	16.5213|16.5213	0.84317|0.84317	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	338;331;331;331;338|150	.|.	ENSP00000230538:Q338X|.	Q|T	-|-	1|2	0|0	LAMA4|LAMA4	112613197|112613197	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.184000|5.184000	0.65070|0.65070	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	CAA|ACA		0.378	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		Nonsense_Mutation
SP4	6671	broad.mit.edu	37	7	21469947	21469947	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:21469947T>A	ENST00000222584.3	+	3	1382	c.1164T>A	c.(1162-1164)gaT>gaA	p.D388E		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	388					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.D388E(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						ATGCACAGGATCAATCAAATT	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	87.0	88.0					7																	21469947		2203	4300	6503	21436472	SO:0001583	missense	6671				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1164T>A	7.37:g.21469947T>A	ENSP00000222584:p.Asp388Glu	Unknown		x	x	x	21436472	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	0.037	-1.301657	0.01353	.	.	ENSG00000105866	ENST00000222584	T	0.08282	3.11	4.85	-2.46	0.06461	.	0.259984	0.43747	N	0.000521	T	0.02012	0.0063	N	0.03608	-0.345	0.33937	D	0.642835	B	0.02656	0.0	B	0.04013	0.001	T	0.44205	-0.9343	10	0.05959	T	0.93	.	2.8679	0.05607	0.1986:0.069:0.3177:0.4146	.	388	Q02446	SP4_HUMAN	E	388	ENSP00000222584:D388E	ENSP00000222584:D388E	D	+	3	2	SP4	21436472	0.773000	0.28580	0.998000	0.56505	0.930000	0.56654	-0.296000	0.08287	-0.008000	0.14320	-0.435000	0.05868	GAT		0.473	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112		Missense_Mutation
HERPUD2	64224	broad.mit.edu	37	7	35674922	35674922	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:35674922T>C	ENST00000396081.1	-	6	1568	c.764A>G	c.(763-765)gAg>gGg	p.E255G	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Missense_Mutation_p.E255G	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	255					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E255G(1)		kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						TTGAACATTCTCATTCATGGG	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											218.0	211.0	213.0					7																	35674922		2203	4300	6503	35641447	SO:0001583	missense	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.764A>G	7.37:g.35674922T>C	ENSP00000379390:p.Glu255Gly	Unknown		x	x	x	35641447	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	37	CCDS5446.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862098	0.51482	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	T;T	0.17213	2.29;2.29	5.96	4.86	0.63082	.	0.368409	0.33057	N	0.005340	T	0.10423	0.0255	N	0.14661	0.345	0.30565	N	0.764103	B	0.29716	0.255	B	0.26614	0.071	T	0.08973	-1.0696	10	0.25751	T	0.34	-13.1199	13.9622	0.64188	0.0:0.0:0.2221:0.7779	.	255	Q9BSE4	HERP2_HUMAN	G	255	ENSP00000379390:E255G;ENSP00000310729:E255G	ENSP00000310729:E255G	E	-	2	0	HERPUD2	35641447	0.993000	0.37304	1.000000	0.80357	0.977000	0.68977	0.726000	0.25984	2.285000	0.76669	0.533000	0.62120	GAG		0.473	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373		Missense_Mutation
PKD1L1	168507	broad.mit.edu	37	7	47851485	47851485	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:47851485G>T	ENST00000289672.2	-	50	7561	c.7511C>A	c.(7510-7512)tCa>tAa	p.S2504*	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron|PKD1L1_ENST00000462350.1_5'Flank	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2504					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S2504*(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CACCAGGGATGAGGGGACGAG	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	7											63.0	52.0	56.0					7																	47851485		2203	4300	6503	47818010	SO:0001587	stop_gained	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7511C>A	7.37:g.47851485G>T	ENSP00000289672:p.Ser2504*	Unknown		x	x	x	47818010	Q6UWK1	Nonsense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886816	0.51908	.	.	ENSG00000158683	ENST00000289672	.	.	.	5.3	5.3	0.74995	.	0.088631	0.44688	D	0.000432	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1399	16.4477	0.83947	0.0:0.0:1.0:0.0	.	.	.	.	X	2504	.	ENSP00000289672:S2504X	S	-	2	0	PKD1L1	47818010	0.976000	0.34144	0.398000	0.26321	0.048000	0.14542	4.926000	0.63433	2.481000	0.83766	0.453000	0.30009	TCA		0.592	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		Nonsense_Mutation
SEMA3E	9723	broad.mit.edu	37	7	83119492	83119492	+	Missense_Mutation	SNP	C	C	G	rs371960755		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:83119492C>G	ENST00000307792.3	-	2	681	c.214G>C	c.(214-216)Gtg>Ctg	p.V72L	SEMA3E_ENST00000427262.1_Missense_Mutation_p.V12L	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	72	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.V72L(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				CTGCCTCCCACGAAGAGCCTC	0.408																																																1	Substitution - Missense(1)	ovary(1)	7						C	LEU/VAL,LEU/VAL	0,4406		0,0,2203	85.0	80.0	81.0		34,214	4.1	1.0	7		81	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SEMA3E	NM_001178129.1,NM_012431.2	32,32	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	benign,benign	12/716,72/776	83119492	1,13005	2203	4300	6503	82957428	SO:0001583	missense	9723			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.214G>C	7.37:g.83119492C>G	ENSP00000303212:p.Val72Leu	Unknown		x	x	x	82957428	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	13.14	2.148665	0.37923	0.0	1.16E-4	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514;ENST00000442159	T;T;T	0.24538	1.85;1.85;1.85	5.92	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.378221	0.27654	N	0.018406	T	0.19725	0.0474	L	0.31526	0.94	0.40564	D	0.981234	B	0.12013	0.005	B	0.22880	0.042	T	0.03818	-1.1001	10	0.36615	T	0.2	.	11.4178	0.49962	0.0:0.7898:0.142:0.0681	.	72	O15041	SEM3E_HUMAN	L	72;12;72;12	ENSP00000303212:V72L;ENSP00000405052:V12L;ENSP00000412867:V12L	ENSP00000303212:V72L	V	-	1	0	SEMA3E	82957428	0.835000	0.29415	0.989000	0.46669	0.961000	0.63080	1.303000	0.33470	0.805000	0.34159	0.585000	0.79938	GTG		0.408	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431		Missense_Mutation
ZNF804B	219578	broad.mit.edu	37	7	88964351	88964351	+	Silent	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:88964351C>A	ENST00000333190.4	+	4	2664	c.2055C>A	c.(2053-2055)acC>acA	p.T685T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	685							metal ion binding (GO:0046872)	p.T685T(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCAGCATGACCAGCAAGGTTT	0.448										HNSCC(36;0.09)																																						1	Substitution - coding silent(1)	ovary(1)	7											80.0	77.0	78.0					7																	88964351		2203	4300	6503	88802287	SO:0001819	synonymous_variant	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2055C>A	7.37:g.88964351C>A		Unknown		x	x	x	88802287	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1	SNP	21	Broad																																																																																				0.448	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646		Silent
MUC17	140453	broad.mit.edu	37	7	100681639	100681639	+	Silent	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:100681639T>A	ENST00000306151.4	+	3	7006	c.6942T>A	c.(6940-6942)acT>acA	p.T2314T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2314	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T2314T(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTACTTCTACTGAAGCCAGTT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	7											232.0	233.0	232.0					7																	100681639		2203	4300	6503	100468359	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6942T>A	7.37:g.100681639T>A		Unknown		x	x	x	100468359	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	55	Broad																																																																																				0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Silent
MOGAT3	346606	broad.mit.edu	37	7	100844094	100844094	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:100844094T>G	ENST00000223114.4	-	1	208	c.42A>C	c.(40-42)aaA>aaC	p.K14N	MOGAT3_ENST00000440203.2_Missense_Mutation_p.K14N|MOGAT3_ENST00000379423.3_Missense_Mutation_p.K14N	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	14					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.K14N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					TCTGCAAGGTTTTGGAAGTGG	0.577																																																1	Substitution - Missense(1)	ovary(1)	7											92.0	74.0	80.0					7																	100844094		2203	4300	6503	100630814	SO:0001583	missense	346606			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.42A>C	7.37:g.100844094T>G	ENSP00000223114:p.Lys14Asn	Unknown		x	x	x	100630814	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	.	12.21	1.870295	0.33069	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	T;T;T	0.33216	2.42;1.71;1.42	4.46	-2.68	0.06041	.	0.141273	0.45126	D	0.000383	T	0.11623	0.0283	N	0.08118	0	0.09310	N	1	B;B	0.32800	0.385;0.044	B;B	0.33295	0.161;0.029	T	0.17379	-1.0371	10	0.39692	T	0.17	-7.7953	5.5499	0.17086	0.1762:0.5295:0.0:0.2943	.	14;14	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	N	14	ENSP00000223114:K14N;ENSP00000403756:K14N;ENSP00000368734:K14N	ENSP00000223114:K14N	K	-	3	2	MOGAT3	100630814	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.684000	0.05173	-0.309000	0.08779	0.448000	0.29417	AAA		0.577	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176		Missense_Mutation
CUX1	1523	broad.mit.edu	37	7	101870679	101870679	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:101870679C>A	ENST00000292535.7	+	21	3201	c.3163C>A	c.(3163-3165)Cct>Act	p.P1055T	CUX1_ENST00000546411.2_Missense_Mutation_p.P953T|CUX1_ENST00000550008.2_Missense_Mutation_p.P999T|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.P897T|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.P1066T|CUX1_ENST00000549414.2_Missense_Mutation_p.P1033T	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1055					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.P1055T(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CAGCTGCAGCCCTGCCCCTGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											88.0	98.0	95.0					7																	101870679		2203	4300	6503	101657399	SO:0001583	missense	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3163C>A	7.37:g.101870679C>A	ENSP00000292535:p.Pro1055Thr	Unknown		x	x	x	101657399	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512694	0.85389	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.64260	-0.06;-0.05;-0.09;-0.09;-0.09;-0.05	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.75772	-0.3200	10	0.45353	T	0.12	-9.0857	19.7848	0.96432	0.0:1.0:0.0:0.0	.	1055;1066	P39880;P39880-3	CUX1_HUMAN;.	T	1066;1055;1033;999;953;897	ENSP00000353401:P1066T;ENSP00000292535:P1055T;ENSP00000446630:P1033T;ENSP00000447373:P999T;ENSP00000450125:P953T;ENSP00000451558:P897T	ENSP00000292535:P1055T	P	+	1	0	CUX1	101657399	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.673000	0.90976	0.655000	0.94253	CCT		0.567	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913		Missense_Mutation
CCDC136	64753	broad.mit.edu	37	7	128452773	128452773	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:128452773A>T	ENST00000297788.4	+	14	2920	c.2553A>T	c.(2551-2553)gaA>gaT	p.E851D	CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	851						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.E851D(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GCTTTGAGGAAATGGTTGTGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	7											38.0	38.0	38.0					7																	128452773		1969	4144	6113	128240009	SO:0001583	missense	64753				CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.2553A>T	7.37:g.128452773A>T	ENSP00000297788:p.Glu851Asp	Unknown		x	x	x	128240009	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	SNP	1	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.32|10.32	1.318570|1.318570	0.23994|0.23994	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.47177|.	0.85;0.85|.	5.08|5.08	-8.1|-8.1	0.01086|0.01086	.|.	0.694331|.	0.14125|.	N|.	0.339758|.	T|T	0.11196|0.11196	0.0273|0.0273	N|N	0.05012|0.05012	-0.13|-0.13	0.09310|0.09310	N|N	1|1	B;B;B|.	0.12630|.	0.006;0.001;0.002|.	B;B;B|.	0.16722|.	0.016;0.003;0.004|.	T|T	0.20338|0.20338	-1.0278|-1.0278	10|5	0.16896|.	T|.	0.51|.	-0.0255|-0.0255	3.3127|3.3127	0.07022|0.07022	0.2198:0.4187:0.2641:0.0974|0.2198:0.4187:0.2641:0.0974	.|.	851;851;851|.	Q96JN2-4;Q96JN2-2;Q96JN2|.	.;.;CC136_HUMAN|.	D|I	851;851;851;442|728	ENSP00000297788:E851D;ENSP00000417991:E442D|.	ENSP00000297788:E851D|.	E|K	+|+	3|2	2|0	CCDC136|CCDC136	128240009|128240009	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.038000|0.038000	0.13279|0.13279	-3.017000|-3.017000	0.00644|0.00644	-1.222000|-1.222000	0.02587|0.02587	0.533000|0.533000	0.62120|0.62120	GAA|AAA		0.562	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742		Missense_Mutation
CNTNAP2	26047	broad.mit.edu	37	7	147600767	147600767	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:147600767A>T	ENST00000361727.3	+	14	2725	c.2209A>T	c.(2209-2211)Aca>Tca	p.T737S		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	737	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.T737S(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACGCAACTGCACAGATCCCAA	0.567										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	ovary(1)	7											73.0	60.0	64.0					7																	147600767		2203	4300	6503	147231700	SO:0001583	missense	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2209A>T	7.37:g.147600767A>T	ENSP00000354778:p.Thr737Ser	Unknown		x	x	x	147231700	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093485	0.56075	.	.	ENSG00000174469	ENST00000361727;ENST00000455301	T;T	0.13420	2.59;2.59	5.7	5.7	0.88788	.	0.125328	0.52532	D	0.000071	T	0.11196	0.0273	N	0.24115	0.695	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.10660	-1.0620	10	0.35671	T	0.21	.	14.8022	0.69924	1.0:0.0:0.0:0.0	.	737	Q9UHC6	CNTP2_HUMAN	S	737;128	ENSP00000354778:T737S;ENSP00000392208:T128S	ENSP00000354778:T737S	T	+	1	0	CNTNAP2	147231700	1.000000	0.71417	0.991000	0.47740	0.960000	0.62799	4.869000	0.63028	2.181000	0.69327	0.460000	0.39030	ACA		0.567	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1			Missense_Mutation
PDIA4	9601	broad.mit.edu	37	7	148716240	148716240	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:148716240T>C	ENST00000286091.4	-	3	551	c.319A>G	c.(319-321)Ata>Gta	p.I107V		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	107	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.I107V(1)		large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			TCCTTTAATATGTTGGCAATT	0.443																																																1	Substitution - Missense(1)	ovary(1)	7											105.0	101.0	102.0					7																	148716240		2203	4300	6503	148347173	SO:0001583	missense	9601			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.319A>G	7.37:g.148716240T>C	ENSP00000286091:p.Ile107Val	Unknown		x	x	x	148347173	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	4.888	0.165036	0.09339	.	.	ENSG00000155660	ENST00000286091;ENST00000413966	T;T	0.03242	4.0;4.0	5.04	-0.121	0.13535	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.444686	0.24901	N	0.034692	T	0.02047	0.0064	N	0.10618	0.005	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43589	-0.9382	10	0.45353	T	0.12	.	9.0957	0.36638	0.0:0.4086:0.0:0.5914	.	107	P13667	PDIA4_HUMAN	V	107;155	ENSP00000286091:I107V;ENSP00000408628:I155V	ENSP00000286091:I107V	I	-	1	0	PDIA4	148347173	0.222000	0.23652	0.000000	0.03702	0.143000	0.21401	0.972000	0.29409	-0.183000	0.10585	-0.376000	0.06991	ATA		0.443	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911		Missense_Mutation
CHPF2	54480	broad.mit.edu	37	7	150931256	150931256	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr7:150931256G>C	ENST00000035307.2	+	1	1672	c.159G>C	c.(157-159)caG>caC	p.Q53H	CHPF2_ENST00000495645.1_Missense_Mutation_p.Q45H	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	53					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.Q53H(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GAGGGCCACAGAATCCAGATT	0.587																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	77.0	76.0					7																	150931256		2203	4300	6503	150562189	SO:0001583	missense	54480			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.159G>C	7.37:g.150931256G>C	ENSP00000035307:p.Gln53His	Unknown		x	x	x	150562189	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	11.82	1.754170	0.31046	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.26518	1.74;1.73	5.25	2.33	0.28932	.	0.568163	0.19455	N	0.113835	T	0.14056	0.0340	L	0.38175	1.15	0.26304	N	0.977936	P;B	0.44946	0.846;0.0	B;B	0.35813	0.211;0.001	T	0.19353	-1.0308	10	0.08381	T	0.77	-7.7947	9.1169	0.36764	0.0:0.2896:0.5443:0.1661	.	53;45	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	H	45;53;53	ENSP00000418914:Q45H;ENSP00000035307:Q53H	ENSP00000035307:Q53H	Q	+	3	2	CHPF2	150562189	0.976000	0.34144	0.996000	0.52242	0.795000	0.44927	1.770000	0.38532	0.169000	0.19679	0.462000	0.41574	CAG		0.587	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015		Missense_Mutation
LZTS1	11178	broad.mit.edu	37	8	20110429	20110429	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr8:20110429A>T	ENST00000381569.1	-	3	1370	c.1013T>A	c.(1012-1014)cTt>cAt	p.L338H	LZTS1_ENST00000265801.6_Missense_Mutation_p.L338H|LZTS1_ENST00000522290.1_Missense_Mutation_p.L338H			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	338					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L338H(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CTCCTGCTGAAGCTGCAGTAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	8											20.0	21.0	21.0					8																	20110429		2201	4300	6501	20154709	SO:0001583	missense	11178			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1013T>A	8.37:g.20110429A>T	ENSP00000370981:p.Leu338His	Unknown		x	x	x	20154709	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	37	CCDS6015.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683428	0.68157	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.34275	1.69;1.69;1.37	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.82716	2.605	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.66536	-0.5899	10	0.54805	T	0.06	-24.2043	12.8865	0.58047	1.0:0.0:0.0:0.0	.	338;338	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	H	338	ENSP00000370981:L338H;ENSP00000265801:L338H;ENSP00000429263:L338H	ENSP00000265801:L338H	L	-	2	0	LZTS1	20154709	1.000000	0.71417	0.961000	0.40146	0.697000	0.40408	8.982000	0.93471	2.068000	0.61886	0.459000	0.35465	CTT		0.647	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020		Missense_Mutation
MPDZ	8777	broad.mit.edu	37	9	13224467	13224467	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr9:13224467C>A	ENST00000319217.7	-	4	546	c.299G>T	c.(298-300)gGg>gTg	p.G100V	MPDZ_ENST00000447879.1_Missense_Mutation_p.G100V|MPDZ_ENST00000381022.2_Missense_Mutation_p.G100V|MPDZ_ENST00000546205.1_Missense_Mutation_p.G100V|MPDZ_ENST00000536827.1_Missense_Mutation_p.G100V|MPDZ_ENST00000541718.1_Missense_Mutation_p.G100V|MPDZ_ENST00000381015.4_Missense_Mutation_p.G100V	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	100					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.G100V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTCCAGATTCCCATTGTTTGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	9											127.0	121.0	123.0					9																	13224467		1856	4091	5947	13214467	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.299G>T	9.37:g.13224467C>A	ENSP00000320006:p.Gly100Val	Unknown		x	x	x	13214467	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304037	0.81136	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.11385	2.84;2.79;2.79;2.78;2.82;2.84;2.84	5.72	5.72	0.89469	.	0.000000	0.45867	D	0.000325	T	0.26011	0.0634	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76071	0.965;0.967;0.987	T	0.00549	-1.1676	10	0.62326	D	0.03	.	19.8891	0.96923	0.0:1.0:0.0:0.0	.	100;100;100	B7ZMI4;O75970-3;O75970-2	.;.;.	V	100	ENSP00000320006:G100V;ENSP00000439807:G100V;ENSP00000370410:G100V;ENSP00000444151:G100V;ENSP00000415208:G100V;ENSP00000370403:G100V;ENSP00000446358:G100V	ENSP00000320006:G100V	G	-	2	0	MPDZ	13214467	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.502000	0.66956	2.689000	0.91719	0.655000	0.94253	GGG		0.408	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829		Missense_Mutation
SPATA31A3	727830	broad.mit.edu	37	9	40704225	40704225	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr9:40704225G>A	ENST00000356699.5	+	4	1911	c.1882G>A	c.(1882-1884)Gac>Aac	p.D628N	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	628					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.D628N(1)									GCAGCTTCAGGACGAATCACC	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											14.0	12.0	13.0					9																	40704225		1412	2693	4105	40694225	SO:0001583	missense	727830					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.1882G>A	9.37:g.40704225G>A	ENSP00000349132:p.Asp628Asn	Unknown		x	x	x	40694225		Missense_Mutation	SNP	ENST00000356699.5	37	CCDS47969.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	3.460	-0.110152	0.06924	.	.	ENSG00000147926	ENST00000356699	T	0.06294	3.32	2.69	0.646	0.17789	.	2.110680	0.02054	N	0.050239	T	0.04497	0.0123	N	0.16743	0.435	0.09310	N	1	B	0.28998	0.23	B	0.29524	0.103	T	0.34850	-0.9812	10	0.25106	T	0.35	1.1179	2.6407	0.04970	0.1722:0.0:0.5438:0.284	.	628	Q5VYP0	F75A3_HUMAN	N	628	ENSP00000349132:D628N	ENSP00000349132:D628N	D	+	1	0	FAM75A3	40694225	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.248000	0.08854	0.167000	0.19631	0.398000	0.26397	GAC		0.532	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124		Missense_Mutation
SH2D3C	10044	broad.mit.edu	37	9	130511535	130511535	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr9:130511535C>A	ENST00000314830.8	-	5	1207	c.1094G>T	c.(1093-1095)gGg>gTg	p.G365V	SH2D3C_ENST00000420366.1_Missense_Mutation_p.G207V|SH2D3C_ENST00000373276.3_Missense_Mutation_p.G297V|SH2D3C_ENST00000373274.3_Missense_Mutation_p.G205V|SH2D3C_ENST00000429553.1_Missense_Mutation_p.G11V|SH2D3C_ENST00000471939.1_Intron|SH2D3C_ENST00000373277.4_Missense_Mutation_p.G208V	NM_170600.2	NP_733745.1	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C	365					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)	p.G365V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGCAGTGAGCCCATCGGTCAT	0.632																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	63.0	63.0					9																	130511535		2203	4300	6503	129551356	SO:0001583	missense	10044			AF124251	CCDS6877.1, CCDS6878.1, CCDS48026.1, CCDS48028.1, CCDS59145.1	9q33.1-q33.3	2013-02-14	2002-01-14		ENSG00000095370	ENSG00000095370		"""SH2 domain containing"""	16884	protein-coding gene	gene with protein product		604722	"""SH2 domain-containing 3C"""			10187783	Standard	NM_170600		Approved	NSP3	uc004bsc.3	Q8N5H7	OTTHUMG00000020717	ENST00000314830.8:c.1094G>T	9.37:g.130511535C>A	ENSP00000317817:p.Gly365Val	Unknown		x	x	x	129551356	A8K5S8|E9PG48|Q5HYE5|Q5JU31|Q6UY42|Q8N6X3|Q9Y2X5	Missense_Mutation	SNP	ENST00000314830.8	37	CCDS6877.1	SNP	22	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.60|17.60	3.428844|3.428844	0.62844|0.62844	.|.	.|.	ENSG00000095370|ENSG00000095370	ENST00000440630|ENST00000373277;ENST00000420366;ENST00000373276;ENST00000373274;ENST00000429553;ENST00000314830;ENST00000414380	T|T;T;T;T;T;T;T	0.26957|0.39229	1.7|2.62;2.64;2.38;2.62;1.63;2.58;1.09	5.37|5.37	4.45|4.45	0.53987|0.53987	.|.	0.047429|0.047429	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.56366|0.56366	0.1980|0.1980	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|P;D;D;D;D	.|0.89917	.|0.944;0.968;0.999;1.0;0.967	.|P;P;D;D;P	.|0.75484	.|0.554;0.633;0.968;0.986;0.74	T|T	0.60021|0.60021	-0.7344|-0.7344	8|10	0.87932|0.72032	D|D	0|0.01	-32.9815|-32.9815	14.7105|14.7105	0.69229|0.69229	0.1459:0.8541:0.0:0.0|0.1459:0.8541:0.0:0.0	.|.	.|205;365;297;208;207	.|E9PG48;Q8N5H7;E7EUN5;Q8N5H7-2;Q8N5H7-5	.|.;SH2D3_HUMAN;.;.;.	C|V	202|208;207;297;205;11;365;182	ENSP00000401641:G202C|ENSP00000362374:G208V;ENSP00000388536:G207V;ENSP00000362373:G297V;ENSP00000362371:G205V;ENSP00000394632:G11V;ENSP00000317817:G365V;ENSP00000413760:G182V	ENSP00000401641:G202C|ENSP00000317817:G365V	G|G	-|-	1|2	0|0	SH2D3C|SH2D3C	129551356|129551356	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.474000|0.474000	0.32979|0.32979	5.466000|5.466000	0.66731|0.66731	1.365000|1.365000	0.46057|0.46057	0.561000|0.561000	0.74099|0.74099	GGC|GGG		0.632	SH2D3C-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054264.1	NM_005489		Missense_Mutation
FUBP3	8939	broad.mit.edu	37	9	133506147	133506147	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr9:133506147C>A	ENST00000319725.9	+	13	1325	c.1250C>A	c.(1249-1251)gCc>gAc	p.A417D		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	417	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A417D(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		ATCGAGGTGGCCAGGCAGCTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	9											48.0	53.0	51.0					9																	133506147		1991	4171	6162	132495968	SO:0001583	missense	8939			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1250C>A	9.37:g.133506147C>A	ENSP00000318177:p.Ala417Asp	Unknown		x	x	x	132495968	A3KFK8|A3KFL0|Q92946|Q9BVB6	Missense_Mutation	SNP	ENST00000319725.9	37	CCDS43893.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	31	5.092839	0.94149	.	.	ENSG00000107164	ENST00000319725	D	0.84516	-1.86	5.53	5.53	0.82687	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.95993	0.8695	H	0.98965	4.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97722	1.0197	10	0.87932	D	0	-18.453	18.4501	0.90700	0.0:1.0:0.0:0.0	.	417;417	A3KFK8;Q96I24	.;FUBP3_HUMAN	D	417	ENSP00000318177:A417D	ENSP00000318177:A417D	A	+	2	0	FUBP3	132495968	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.818000	0.86416	2.592000	0.87571	0.655000	0.94253	GCC		0.577	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1			Missense_Mutation
GRPR	2925	broad.mit.edu	37	X	16168743	16168743	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0923-01	TCGA-13-0923-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:16168743T>A	ENST00000380289.2	+	2	1127	c.729T>A	c.(727-729)aaT>aaA	p.N243K	RP11-431J24.2_ENST00000422438.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000435789.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	243					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)	p.N243K(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					GTGCTTACAATCTTCCCGTGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											92.0	82.0	85.0					X																	16168743		2203	4300	6503	16078664	SO:0001583	missense	2925				CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.729T>A	X.37:g.16168743T>A	ENSP00000369643:p.Asn243Lys	Somatic		x	x	x	16078664	B2R910	Missense_Mutation	SNP	ENST00000380289.2	37	CCDS14174.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	18.96	3.734092	0.69189	.	.	ENSG00000126010	ENST00000380289;ENST00000535371	T	0.70045	-0.45	5.48	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	0.194001	0.52532	D	0.000064	T	0.70343	0.3213	L	0.61036	1.89	0.48762	D	0.999701	P	0.51933	0.949	P	0.58780	0.845	T	0.64449	-0.6405	10	0.22706	T	0.39	-7.5626	8.4051	0.32610	0.0:0.4554:0.0:0.5446	.	243	P30550	GRPR_HUMAN	K	243;32	ENSP00000369643:N243K	ENSP00000369643:N243K	N	+	3	2	GRPR	16078664	0.986000	0.35501	0.982000	0.44146	0.996000	0.88848	0.589000	0.23939	0.237000	0.21200	0.486000	0.48141	AAT		0.418	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		Missense_Mutation
GPR173	54328	broad.mit.edu	37	X	53106025	53106025	+	Silent	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:53106025C>T	ENST00000332582.4	+	2	713	c.222C>T	c.(220-222)gtC>gtT	p.V74V		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	74					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)	p.V74V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						GCTCTGCCGTCTGCTTCCCCT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	X											132.0	100.0	111.0					X																	53106025		2203	4300	6503	53122750	SO:0001819	synonymous_variant	54328			AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.222C>T	X.37:g.53106025C>T		Unknown		x	x	x	53122750	B1B0A5	Silent	SNP	ENST00000332582.4	37	CCDS14349.1	SNP	32	Broad																																																																																				0.582	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056717.2	NM_018969		Silent
HTR2C	3358	broad.mit.edu	37	X	114141164	114141164	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:114141164C>T	ENST00000276198.1	+	6	1291	c.563C>T	c.(562-564)cCt>cTt	p.P188L	HTR2C_ENST00000371950.3_Silent_p.S156S|HTR2C_ENST00000371951.1_Missense_Mutation_p.P188L	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	188					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.P188L(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTATCAGTTCCTATCCCTGTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											112.0	102.0	105.0					X																	114141164		2203	4300	6503	114047420	SO:0001583	missense	3358				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.563C>T	X.37:g.114141164C>T	ENSP00000276198:p.Pro188Leu	Unknown		x	x	x	114047420	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266182	0.80358	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	T;T	0.44482	0.92;0.92	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61022	0.2314	M	0.62154	1.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61811	-0.6986	10	0.46703	T	0.11	.	14.6716	0.68948	0.0:1.0:0.0:0.0	.	188	P28335	5HT2C_HUMAN	L	188	ENSP00000276198:P188L;ENSP00000361019:P188L	ENSP00000276198:P188L	P	+	2	0	HTR2C	114047420	1.000000	0.71417	0.867000	0.34043	0.950000	0.60333	7.715000	0.84713	2.135000	0.66039	0.538000	0.68166	CCT		0.428	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868		Missense_Mutation
GLUD2	2747	broad.mit.edu	37	X	120182417	120182417	+	Silent	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:120182417A>G	ENST00000328078.1	+	1	956	c.879A>G	c.(877-879)ttA>ttG	p.L293L		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	293					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.L293L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						TGAGCATTTTAGGAATGACAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	X											155.0	137.0	143.0					X																	120182417		2203	4300	6503	120010098	SO:0001819	synonymous_variant	2747			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.879A>G	X.37:g.120182417A>G		Unknown		x	x	x	120010098	B2R8G0|Q9UDQ4	Silent	SNP	ENST00000328078.1	37	CCDS14603.1	SNP	15	Broad																																																																																				0.423	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084		Silent
GRIA3	2892	broad.mit.edu	37	X	122532558	122532558	+	Silent	SNP	A	A	G			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:122532558A>G	ENST00000371251.1	+	7	1036	c.984A>G	c.(982-984)cgA>cgG	p.R328R	GRIA3_ENST00000542149.1_Silent_p.R328R|GRIA3_ENST00000371256.5_Silent_p.R328R|GRIA3_ENST00000541091.1_Silent_p.R312R|GRIA3_ENST00000264357.5_Silent_p.R328R			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	328					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.R328R(2)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GGAGGCAGCGAGTAGATGTGT	0.463																																																2	Substitution - coding silent(2)	ovary(2)	X											112.0	87.0	96.0					X																	122532558		2203	4300	6503	122360239	SO:0001819	synonymous_variant	2892			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.984A>G	X.37:g.122532558A>G		Unknown		x	x	x	122360239	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	ENST00000371251.1	37	CCDS14604.1	SNP	11	Broad																																																																																				0.463	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828		Silent
ZIC3	7547	broad.mit.edu	37	X	136651155	136651155	+	Silent	SNP	C	C	T			TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:136651155C>T	ENST00000287538.5	+	2	1705	c.1155C>T	c.(1153-1155)gaC>gaT	p.D385D	ZIC3_ENST00000370606.3_Silent_p.D385D|ZIC3_ENST00000478471.1_3'UTR	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	385					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D385D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ATACCTCGGACAAGCCCTATA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	X											203.0	171.0	182.0					X																	136651155		2203	4300	6503	136478821	SO:0001819	synonymous_variant	7547			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1155C>T	X.37:g.136651155C>T		Unknown		x	x	x	136478821	B2CNW4|Q14DE5|Q5JY75	Silent	SNP	ENST00000287538.5	37	CCDS14663.1	SNP	17	Broad																																																																																				0.498	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1			Silent
NBEA	26960	broad.mit.edu	37	13	35738551	35738567	+	Frame_Shift_Del	DEL	CATAACACAATTCACCT	CATAACACAATTCACCT	-	rs546855534		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr13:35738551_35738567delCATAACACAATTCACCT	ENST00000400445.3	+	24	4672_4688	c.4138_4154delCATAACACAATTCACCT	c.(4138-4155)cataacacaattcacctcfs	p.HNTIHL1380fs	NBEA_ENST00000540320.1_Frame_Shift_Del_p.HNTIHL1380fs|NBEA_ENST00000379939.2_Frame_Shift_Del_p.HNTIHL1380fs|NBEA_ENST00000310336.4_Frame_Shift_Del_p.HNTIHL1380fs	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1380					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.N1381fs*28(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TATTTTTGTACATAACACAATTCACCTCATTTCCCAA	0.346																																																1	Deletion - Frameshift(1)	ovary(1)	13																																								34636567	SO:0001589	frameshift_variant	26960			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4138_4154delCATAACACAATTCACCT	13.37:g.35738551_35738567delCATAACACAATTCACCT	ENSP00000383295:p.His1380fs	Unknown		Capture	Illumina GAIIx	Phase_I	34636551	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Frame_Shift_Del	DEL	ENST00000400445.3	37	CCDS45026.1	DEL	17	Broad																																																																																				0.346	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678		Frame_Shift_Del
PTPRG	5793	broad.mit.edu	37	3	61548036	61548057	+	Splice_Site	DEL	GTGCTTCCCCGGTGAGTGCCGG	GTGCTTCCCCGGTGAGTGCCGG	-	rs201903648|rs2365955|rs142428806	byFrequency	TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chr3:61548036_61548057delGTGCTTCCCCGGTGAGTGCCGG	ENST00000474889.1	+	1	452_462	c.75_85delGTGCTTCCCCGGTGAGTGCCGG	c.(73-87)gtgtgcttccccggt>gtgt	p.CFPG26fs	PTPRG_ENST00000295874.10_Splice_Site_p.CFPG26fs|PTPRG_ENST00000495879.1_3'UTR	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	26					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		ATTATGTCGTGTGCTTCCCCGGTGAGTGCCGGCCGCCGAGGG	0.644																																																1	Unknown(1)	ovary(1)	3																																								61523097	SO:0001630	splice_region_variant	5793			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.85+1GTGCTTCCCCGGTGAGTGCCGG>-	3.37:g.61548036_61548057delGTGCTTCCCCGGTGAGTGCCGG		Unknown		Capture	Illumina GAIIx	Phase_I	61523076	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Splice_Site_Del	DEL	ENST00000474889.1	37	CCDS2895.1	DEL	48	Broad																																																																																				0.644	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	Frame_Shift_Del	Splice_Site_Del
PHKA2	5256	broad.mit.edu	37	X	18969308	18969327	+	Frame_Shift_Del	DEL	GTGCCACAGGTGGCGGTGTT	GTGCCACAGGTGGCGGTGTT	-	rs201548823		TCGA-13-0923-01	TCGA-13-0923-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-0923-01	TCGA-13-0923-10	g.chrX:18969308_18969327delGTGCCACAGGTGGCGGTGTT	ENST00000379942.4	-	4	1014_1033	c.349_368delAACACCGCCACCTGTGGCAC	c.(349-369)aacaccgccacctgtggcacgfs	p.NTATCGT117fs		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	117					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.N117fs*38(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCCCACCACCGTGCCACAGGTGGCGGTGTTGTACTTGGCG	0.609																																																1	Deletion - Frameshift(1)	ovary(1)	X	GRCh37	CI075673	PHKA2	I																																				18879248	SO:0001589	frameshift_variant	5256				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.349_368delAACACCGCCACCTGTGGCAC	X.37:g.18969308_18969327delGTGCCACAGGTGGCGGTGTT	ENSP00000369274:p.Asn117fs	Unknown		Capture	Illumina GAIIx	Phase_I	18879229	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Frame_Shift_Del	DEL	ENST00000379942.4	37	CCDS14190.1	DEL	40	Broad																																																																																				0.609	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292		Frame_Shift_Del
