#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
NSUN2	54888	genome.wustl.edu	37	5	6600248	6600248	+	Missense_Mutation	SNP	G	G	A	rs190753127		TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr5:6600248G>A	ENST00000264670.6	-	19	2406	c.2095C>T	c.(2095-2097)Ctc>Ttc	p.L699F	NSUN2_ENST00000506139.1_Missense_Mutation_p.L664F|NSUN2_ENST00000539938.1_Missense_Mutation_p.L463F	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	699					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)	p.L699F(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						ATCATCCTGAGATAATGAAGC	0.517													G|||	0	0.0	0.0	0.0	5008	,	,		18431	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	PHE/LEU,PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	88.0	89.0	88.0		1990,2095	5.3	0.5	5		88	0,8600		0,0,4300	no	missense,missense	NSUN2	NM_001193455.1,NM_017755.5	22,22	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	664/733,699/768	6600248	1,13005	2203	4300	6503	6653248	SO:0001583	missense	54888			AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.2095C>T	5.37:g.6600248G>A	ENSP00000264670:p.Leu699Phe	Somatic		Capture	Illumina GAIIx	4	6653248	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	SNP	33	WashU	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	25.2	4.613919	0.87359	2.27E-4	0.0	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.67523	-0.27;-0.27;-0.27	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.82440	0.5037	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.996;0.989	D	0.84727	0.0743	10	0.66056	D	0.02	-29.7662	14.2784	0.66196	0.0739:0.0:0.9261:0.0	.	664;699;699	B4DQW2;Q08J23;A8K529	.;NSUN2_HUMAN;.	F	699;463;664	ENSP00000264670:L699F;ENSP00000444338:L463F;ENSP00000420957:L664F	ENSP00000264670:L699F	L	-	1	0	NSUN2	6653248	1.000000	0.71417	0.543000	0.28128	0.992000	0.81027	4.670000	0.61583	2.468000	0.83385	0.467000	0.42956	CTC		0.517	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755		Missense_Mutation
CD163L1	283316	genome.wustl.edu	37	12	7586119	7586119	+	Missense_Mutation	SNP	C	C	T	rs146684411	byFrequency	TCGA-13-1403-01	TCGA-13-1403-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr12:7586119C>T	ENST00000313599.3	-	3	353	c.296G>A	c.(295-297)cGt>cAt	p.R99H	CD163L1_ENST00000416109.2_Missense_Mutation_p.R99H|CD163L1_ENST00000396630.1_Missense_Mutation_p.R99H			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	99	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.R99H(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TTGTCCAAAACGAAACATGGC	0.478													C|||	4	0.000798722	0.003	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12						C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	120.0	95.0	104.0		296	-0.6	0.0	12	dbSNP_134	104	0,8600		0,0,4300	yes	missense	CD163L1	NM_174941.4	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	99/1454	7586119	4,13002	2203	4300	6503	7477386	SO:0001583	missense	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.296G>A	12.37:g.7586119C>T	ENSP00000315945:p.Arg99His	Somatic		Capture	Illumina GAIIx	4	7477386	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.330519	0.01298	9.08E-4	0.0	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630;ENST00000543276	T;T;T;T	0.35421	1.31;1.31;1.31;3.48	1.5	-0.628	0.11537	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	2.179770	0.03610	N	0.234674	T	0.20659	0.0497	N	0.11023	0.085	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17289	-1.0374	10	0.32370	T	0.25	.	6.7663	0.23568	0.0:0.5433:0.0:0.4567	.	99;99	E7EVK4;Q9NR16	.;C163B_HUMAN	H	99;99;99;3	ENSP00000315945:R99H;ENSP00000393474:R99H;ENSP00000379871:R99H;ENSP00000442328:R3H	ENSP00000315945:R99H	R	-	2	0	CD163L1	7477386	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.234000	0.09028	-0.635000	0.05531	-1.478000	0.00992	CGT		0.478	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	A			TCGA-13-1403-01	TCGA-13-1403-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr17:7579311C>A	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	17	GRCh37	CS951538	TP53	S							66.0	61.0	63.0					17																	7579311		2203	4300	6503	7520036	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579311C>A		Somatic		Capture	Illumina GAIIx	4	7520036	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954926	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
GRM7	2917	genome.wustl.edu	37	3	7620692	7620692	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:7620692C>T	ENST00000357716.4	+	8	2373	c.2099C>T	c.(2098-2100)aCa>aTa	p.T700I	GRM7_ENST00000486284.1_Missense_Mutation_p.T700I|GRM7_ENST00000402647.2_Missense_Mutation_p.T700I|GRM7_ENST00000389336.4_Missense_Mutation_p.T700I|GRM7_ENST00000403881.1_Missense_Mutation_p.T700I|GRM7_ENST00000458641.2_3'UTR	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	700					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.T700I(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						ATAAGCCCAACATCACAACTG	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											121.0	105.0	110.0					3																	7620692		2203	4300	6503	7595692	SO:0001583	missense	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2099C>T	3.37:g.7620692C>T	ENSP00000350348:p.Thr700Ile	Somatic		Capture	Illumina GAIIx	4	7595692	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	SNP	17	WashU	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870164	0.33069	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33	6.17	6.17	0.99709	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90882	0.7135	L	0.37507	1.11	0.58432	D	0.999999	B;P;D;D;B	0.89917	0.03;0.728;1.0;0.997;0.049	B;P;D;D;B	0.87578	0.063;0.447;0.998;0.995;0.037	D	0.89623	0.3850	10	0.44086	T	0.13	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	700;700;455;700;700	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	I	700	ENSP00000350348:T700I;ENSP00000417536:T700I;ENSP00000373987:T700I;ENSP00000385664:T700I;ENSP00000384585:T700I	ENSP00000350348:T700I	T	+	2	0	GRM7	7595692	1.000000	0.71417	0.448000	0.26945	0.133000	0.20885	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	ACA		0.423	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		Missense_Mutation
TAS2R1	50834	genome.wustl.edu	37	5	9629459	9629459	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr5:9629459G>C	ENST00000382492.2	-	1	1004	c.686C>G	c.(685-687)tCt>tGt	p.S229C	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	229					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.S229C(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GGACAGGATAGACAGCAACGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	5											72.0	79.0	76.0					5																	9629459		2203	4300	6503	9682459	SO:0001583	missense	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.686C>G	5.37:g.9629459G>C	ENSP00000371932:p.Ser229Cys	Somatic		Capture	Illumina GAIIx	4	9682459	Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	CCDS3876.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591386	0.46214	.	.	ENSG00000169777	ENST00000382492	T	0.39787	1.06	5.55	5.55	0.83447	.	0.357292	0.26955	N	0.021654	T	0.63129	0.2485	M	0.70842	2.15	0.25327	N	0.989065	D	0.89917	1.0	D	0.79784	0.993	T	0.57195	-0.7853	9	.	.	.	.	14.877	0.70501	0.0:0.0:1.0:0.0	.	229	Q9NYW7	TA2R1_HUMAN	C	229	ENSP00000371932:S229C	.	S	-	2	0	TAS2R1	9682459	0.278000	0.24230	0.980000	0.43619	0.069000	0.16628	1.943000	0.40253	2.894000	0.99253	0.655000	0.94253	TCT		0.498	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			Missense_Mutation
GLRA2	2742	genome.wustl.edu	37	X	14627259	14627259	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chrX:14627259G>A	ENST00000218075.4	+	7	1392	c.862G>A	c.(862-864)Gca>Aca	p.A288T	GLRA2_ENST00000355020.4_Missense_Mutation_p.A288T|GLRA2_ENST00000443437.2_Missense_Mutation_p.A199T	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	288					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.A288T(1)|p.A288S(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	TGCCAGGGTCGCACTGGGCAT	0.468																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	X											84.0	83.0	84.0					X																	14627259		2203	4300	6503	14537180	SO:0001583	missense	2742				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.862G>A	X.37:g.14627259G>A	ENSP00000218075:p.Ala288Thr	Somatic		Capture	Illumina GAIIx	4	14537180	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	37	CCDS14160.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682558	0.88542	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	D;D;D	0.84516	-1.86;-1.86;-1.86	5.4	5.4	0.78164	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.84556	0.5498	L	0.33792	1.035	0.80722	D	1	P;D;P	0.56035	0.839;0.974;0.916	B;P;P	0.49799	0.327;0.55;0.622	D	0.86883	0.2043	10	0.87932	D	0	.	18.3146	0.90215	0.0:0.0:1.0:0.0	.	272;288;288	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	T	199;288;288	ENSP00000387756:A199T;ENSP00000218075:A288T;ENSP00000347123:A288T	ENSP00000218075:A288T	A	+	1	0	GLRA2	14537180	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	9.771000	0.98977	2.264000	0.75181	0.600000	0.82982	GCA		0.468	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1			Missense_Mutation
ITGA8	8516	genome.wustl.edu	37	10	15600155	15600155	+	Missense_Mutation	SNP	C	C	T	rs368464139		TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr10:15600155C>T	ENST00000378076.3	-	26	3037	c.2684G>A	c.(2683-2685)cGa>cAa	p.R895Q		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	895					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.R895Q(2)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AGTAGAGTTTCGCAAAAAGGC	0.478																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	10						C	GLN/ARG	0,4406		0,0,2203	74.0	72.0	72.0		2684	1.2	0.0	10		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITGA8	NM_003638.1	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	895/1064	15600155	1,13005	2203	4300	6503	15640161	SO:0001583	missense	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2684G>A	10.37:g.15600155C>T	ENSP00000367316:p.Arg895Gln	Somatic		Capture	Illumina GAIIx	4	15640161	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	SNP	31	WashU	.	.	.	.	.	.	.	.	.	.	C	11.53	1.666292	0.29604	0.0	1.16E-4	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.47869	0.83	6.06	1.17	0.20885	Integrin alpha-2 (1);	0.799419	0.11376	N	0.570358	T	0.37183	0.0994	L	0.46947	1.48	0.09310	N	1	B;B	0.17038	0.016;0.02	B;B	0.17979	0.012;0.02	T	0.30563	-0.9974	10	0.17369	T	0.5	.	8.8846	0.35396	0.0:0.6376:0.0:0.3624	.	880;895	F5H818;P53708	.;ITA8_HUMAN	Q	895;880	ENSP00000367316:R895Q	ENSP00000367316:R895Q	R	-	2	0	ITGA8	15640161	0.002000	0.14202	0.002000	0.10522	0.535000	0.34838	0.046000	0.14035	-0.028000	0.13850	-0.762000	0.03455	CGA		0.478	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		Missense_Mutation
NDE1	54820	genome.wustl.edu	37	16	15790642	15790642	+	Missense_Mutation	SNP	C	C	A	rs146284370	byFrequency	TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr16:15790642C>A	ENST00000396353.2	+	9	1698	c.872C>A	c.(871-873)tCt>tAt	p.S291Y	NDE1_ENST00000396355.1_Missense_Mutation_p.S291Y|NDE1_ENST00000396354.1_Missense_Mutation_p.S291Y|NDE1_ENST00000342673.5_Missense_Mutation_p.S291Y			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	291					centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)	p.S291Y(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						GGCCCAGCCTCTGGGCGGAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	16											79.0	79.0	79.0					16																	15790642		2197	4300	6497	15698143	SO:0001583	missense	54820			AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.872C>A	16.37:g.15790642C>A	ENSP00000379641:p.Ser291Tyr	Somatic		Capture	Illumina GAIIx	4	15698143	Q49AQ2	Missense_Mutation	SNP	ENST00000396353.2	37		SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631308	0.46944	.	.	ENSG00000072864	ENST00000396355;ENST00000396353;ENST00000396354;ENST00000342673	.	.	.	5.56	3.59	0.41128	NUDE protein, C-terminal (1);	0.587205	0.18511	N	0.139066	T	0.27594	0.0678	L	0.38838	1.175	0.09310	N	1	B;P	0.40144	0.427;0.704	B;B	0.35240	0.161;0.198	T	0.07481	-1.0770	9	0.59425	D	0.04	-38.296	11.6522	0.51295	0.0:0.8552:0.0:0.1448	.	291;291	Q9NXR1;Q9NXR1-2	NDE1_HUMAN;.	Y	291	.	ENSP00000345892:S291Y	S	+	2	0	NDE1	15698143	0.003000	0.15002	0.004000	0.12327	0.962000	0.63368	1.652000	0.37313	0.695000	0.31675	0.655000	0.94253	TCT		0.557	NDE1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017668		Missense_Mutation
ABCC1	4363	genome.wustl.edu	37	16	16208679	16208679	+	Missense_Mutation	SNP	C	C	T	rs376107020		TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr16:16208679C>T	ENST00000399410.3	+	23	3311	c.3136C>T	c.(3136-3138)Cgc>Tgc	p.R1046C	ABCC1_ENST00000351154.5_Missense_Mutation_p.R987C|ABCC1_ENST00000349029.5_Missense_Mutation_p.R931C|ABCC1_ENST00000345148.5_Missense_Mutation_p.R1046C|ABCC1_ENST00000346370.5_Missense_Mutation_p.R990C|ABCC1_ENST00000399408.2_Missense_Mutation_p.R1056C	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1046	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.R1046C(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CTTGGCTTCCCGCTGTCTGCA	0.597																																																1	Substitution - Missense(1)	ovary(1)	16						C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4306		0,0,2153	55.0	57.0	56.0		3136,2959,2968,2791,3136	4.3	1.0	16		56	1,8527		0,1,4263	no	missense,missense,missense,missense,missense	ABCC1	NM_004996.3,NM_019862.2,NM_019898.2,NM_019899.2,NM_019900.2	180,180,180,180,180	0,1,6416	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1046/1532,987/1473,990/1476,931/1417,1046/1467	16208679	1,12833	2153	4264	6417	16116180	SO:0001583	missense	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3136C>T	16.37:g.16208679C>T	ENSP00000382342:p.Arg1046Cys	Somatic		Capture	Illumina GAIIx	4	16116180	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882517	0.33255	0.0	1.17E-4	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	5.22	4.26	0.50523	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.096043	0.64402	D	0.000001	D	0.95478	0.8531	M	0.87682	2.9	0.53005	D	0.999964	B;D;D;D;D;D	0.89917	0.287;1.0;0.999;1.0;1.0;1.0	B;D;D;P;D;D	0.74023	0.064;0.969;0.944;0.9;0.982;0.969	D	0.95968	0.8967	10	0.87932	D	0	-15.0622	14.2793	0.66200	0.1497:0.8503:0.0:0.0	.	931;1046;990;987;1046;1056	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	C	1046;1056;990;987;1046;931;730	ENSP00000382342:R1046C;ENSP00000382340:R1056C;ENSP00000263019:R990C;ENSP00000263017:R987C;ENSP00000263014:R1046C;ENSP00000263016:R931C	ENSP00000263014:R1046C	R	+	1	0	ABCC1	16116180	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	3.909000	0.56363	1.186000	0.42985	0.561000	0.74099	CGC		0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		Missense_Mutation
ATP13A2	23400	genome.wustl.edu	37	1	17331268	17331268	+	Silent	SNP	C	C	A	rs140631323		TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:17331268C>A	ENST00000326735.8	-	5	429	c.396G>T	c.(394-396)gcG>gcT	p.A132A	ATP13A2_ENST00000341676.5_Silent_p.A132A|ATP13A2_ENST00000452699.1_Silent_p.A132A|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	132					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.A132A(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CCCCAACTGCCGCCTGGCTCC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1											66.0	72.0	70.0					1																	17331268		2203	4300	6503	17203855	SO:0001819	synonymous_variant	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.396G>T	1.37:g.17331268C>A		Somatic		Capture	Illumina GAIIx	4	17203855	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Silent	SNP	ENST00000326735.8	37	CCDS175.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	3.940	-0.014502	0.07681	.	.	ENSG00000159363	ENST00000510069;ENST00000508222;ENST00000509619	.	.	.	4.21	-7.06	0.01568	.	.	.	.	.	T	0.16938	0.0407	.	.	.	0.21386	N	0.999707	.	.	.	.	.	.	T	0.22034	-1.0228	4	.	.	.	-8.9754	2.6457	0.04983	0.0988:0.2671:0.1955:0.4386	.	.	.	.	C	108;44;125	.	.	G	-	1	0	ATP13A2	17203855	0.000000	0.05858	0.176000	0.23000	0.401000	0.30781	-4.669000	0.00201	-1.581000	0.01642	-0.657000	0.03884	GGC		0.657	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089		Silent
STAM	8027	genome.wustl.edu	37	10	17730081	17730081	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1403-01	TCGA-13-1403-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr10:17730081A>G	ENST00000377524.3	+	5	568	c.353A>G	c.(352-354)gAa>gGa	p.E118G	STAM_ENST00000540523.1_Missense_Mutation_p.E7G	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	118	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)	p.E118G(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						TGGACAGATGAATTTAAGAAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	10											129.0	133.0	132.0					10																	17730081		2203	4300	6503	17770087	SO:0001583	missense	8027			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.353A>G	10.37:g.17730081A>G	ENSP00000366746:p.Glu118Gly	Somatic		Capture	Illumina GAIIx	4	17770087	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	37	CCDS7122.1	SNP	9	WashU	.	.	.	.	.	.	.	.	.	.	A	29.8	5.035495	0.93630	.	.	ENSG00000136738	ENST00000377524;ENST00000445846;ENST00000377500;ENST00000540523	T;T	0.23348	1.91;1.93	5.83	5.83	0.93111	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.092925	0.64402	D	0.000001	T	0.28034	0.0691	L	0.47078	1.49	0.80722	D	1	P	0.49783	0.928	B	0.42282	0.382	T	0.03695	-1.1012	10	0.66056	D	0.02	-27.7838	16.192	0.81996	1.0:0.0:0.0:0.0	.	118	Q92783	STAM1_HUMAN	G	118;68;21;7	ENSP00000366746:E118G;ENSP00000438073:E7G	ENSP00000366721:E21G	E	+	2	0	STAM	17770087	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.271000	0.95698	2.229000	0.72834	0.482000	0.46254	GAA		0.358	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473		Missense_Mutation
DTD1	92675	genome.wustl.edu	37	20	18724892	18724892	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr20:18724892C>G	ENST00000377452.3	+	5	806	c.626C>G	c.(625-627)cCg>cGg	p.P209R		NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	209					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)	p.P209R(1)		large_intestine(4)|lung(1)|ovary(2)	7						GAACGGGAGCCGTAGCTCAGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	20											56.0	48.0	51.0					20																	18724892		2203	4300	6503	18672892	SO:0001583	missense	92675			AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.626C>G	20.37:g.18724892C>G	ENSP00000366672:p.Pro209Arg	Somatic		Capture	Illumina GAIIx	4	18672892	A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Missense_Mutation	SNP	ENST00000377452.3	37	CCDS13138.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989214	0.74589	.	.	ENSG00000125821	ENST00000377452	.	.	.	5.84	5.84	0.93424	.	0.055041	0.64402	D	0.000001	T	0.63177	0.2489	N	0.19112	0.55	0.58432	D	0.999999	D	0.76494	0.999	D	0.65010	0.931	T	0.67209	-0.5728	9	0.87932	D	0	.	17.6372	0.88125	0.0:1.0:0.0:0.0	.	209	Q8TEA8	DTD1_HUMAN	R	209	.	ENSP00000366672:P209R	P	+	2	0	DTD1	18672892	1.000000	0.71417	0.971000	0.41717	0.468000	0.32798	7.122000	0.77169	2.769000	0.95229	0.563000	0.77884	CCG		0.542	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078189.3	NM_080820		Missense_Mutation
POLA1	5422	genome.wustl.edu	37	X	24732734	24732734	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chrX:24732734C>T	ENST00000379059.3	+	5	407	c.392C>T	c.(391-393)cCg>cTg	p.P131L	POLA1_ENST00000379068.3_Missense_Mutation_p.P137L	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	131					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)	p.P131L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GTGACAAAACCGAACAACATT	0.358																																																1	Substitution - Missense(1)	ovary(1)	X											104.0	93.0	97.0					X																	24732734		2202	4298	6500	24642655	SO:0001583	missense	5422				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.392C>T	X.37:g.24732734C>T	ENSP00000368349:p.Pro131Leu	Somatic		Capture	Illumina GAIIx	4	24642655	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	17.44	3.391039	0.62066	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.18174	2.23;2.23	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	M	0.78637	2.42	0.80722	D	1	P;D	0.89917	0.617;1.0	B;D	0.74023	0.14;0.982	T	0.20240	-1.0281	10	0.34782	T	0.22	-7.8106	19.2516	0.93926	0.0:1.0:0.0:0.0	.	137;131	A6NMQ1;P09884	.;DPOLA_HUMAN	L	137;131	ENSP00000368358:P137L;ENSP00000368349:P131L	ENSP00000368349:P131L	P	+	2	0	POLA1	24642655	1.000000	0.71417	0.997000	0.53966	0.634000	0.38068	6.872000	0.75536	2.498000	0.84270	0.600000	0.82982	CCG		0.358	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937		Missense_Mutation
KCNE1	3753	genome.wustl.edu	37	21	35821847	35821847	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr21:35821847C>T	ENST00000337385.3	-	3	461	c.86G>A	c.(85-87)gGc>gAc	p.G29D	KCNE1_ENST00000432085.1_Missense_Mutation_p.G29D|KCNE1_ENST00000416357.2_Missense_Mutation_p.G29D|KCNE1_ENST00000399284.1_Missense_Mutation_p.G29D|KCNE1_ENST00000399286.2_Missense_Mutation_p.G29D|KCNE1_ENST00000399289.3_Missense_Mutation_p.G29D	NM_001270402.1|NM_001270403.1	NP_001257331.1|NP_001257332.1	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related family, member 1	29					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular response to cAMP (GO:0071320)|membrane repolarization (GO:0086009)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|protein N-linked glycosylation (GO:0006487)|protein O-linked glycosylation (GO:0006493)|regulation of delayed rectifier potassium channel activity (GO:1902259)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	potassium channel regulator activity (GO:0015459)|telethonin binding (GO:0031433)|voltage-gated potassium channel activity (GO:0005249)	p.G29D(1)		large_intestine(4)|lung(1)|ovary(2)	7					Indapamide(DB00808)	GCGGGCCAGGCCCGACATGTT	0.602																																																1	Substitution - Missense(1)	ovary(1)	21											62.0	55.0	57.0					21																	35821847		2203	4300	6503	34743717	SO:0001583	missense	3753			L28168	CCDS13636.1	21q22.1-q22.2	2014-09-17			ENSG00000180509	ENSG00000180509		"""Potassium channels"""	6240	protein-coding gene	gene with protein product		176261				8432548	Standard	NM_001127670		Approved	minK, ISK, JLNS2, LQT5	uc010gmp.4	P15382	OTTHUMG00000086236	ENST00000337385.3:c.86G>A	21.37:g.35821847C>T	ENSP00000337255:p.Gly29Asp	Somatic		Capture	Illumina GAIIx	4	34743717	A5H1P2|Q8N709|Q91Z94	Missense_Mutation	SNP	ENST00000337385.3	37	CCDS13636.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621776	0.46840	.	.	ENSG00000180509	ENST00000399289;ENST00000337385;ENST00000432085;ENST00000399286;ENST00000416357;ENST00000399284	D;D;D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21;-3.21;-3.21	3.74	1.88	0.25563	.	0.973928	0.08437	N	0.946032	D	0.90957	0.7157	L	0.57536	1.79	0.09310	N	1	B	0.24768	0.111	B	0.29440	0.102	T	0.82074	-0.0637	10	0.51188	T	0.08	-10.169	6.573	0.22549	0.0:0.7743:0.0:0.2257	.	29	P15382	KCNE1_HUMAN	D	29	ENSP00000382228:G29D;ENSP00000337255:G29D;ENSP00000412498:G29D;ENSP00000382226:G29D;ENSP00000416258:G29D;ENSP00000382225:G29D	ENSP00000337255:G29D	G	-	2	0	KCNE1	34743717	0.170000	0.23016	0.612000	0.29024	0.537000	0.34900	0.173000	0.16724	0.535000	0.28714	0.591000	0.81541	GGC		0.602	KCNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194155.1			Missense_Mutation
UGT3A2	167127	genome.wustl.edu	37	5	36035970	36035970	+	Missense_Mutation	SNP	C	C	T	rs200458466		TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr5:36035970C>T	ENST00000282507.3	-	7	1503	c.1402G>A	c.(1402-1404)Gcg>Acg	p.A468T	UGT3A2_ENST00000545528.1_Missense_Mutation_p.A166T|UGT3A2_ENST00000513300.1_Missense_Mutation_p.A434T	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	468					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.A468T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGGTGCGTCGCGCCCCCTGTC	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16335	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5											50.0	45.0	46.0					5																	36035970		2203	4300	6503	36071727	SO:0001583	missense	167127				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1402G>A	5.37:g.36035970C>T	ENSP00000282507:p.Ala468Thr	Somatic		Capture	Illumina GAIIx	4	36071727	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	37	CCDS3914.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	11.22	1.574251	0.28092	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.71579	-0.58;-0.58;-0.25	2.74	1.84	0.25277	.	0.364632	0.19685	U	0.108411	T	0.74535	0.3729	M	0.74258	2.255	0.09310	N	1	D;D	0.67145	0.978;0.996	P;P	0.55577	0.74;0.779	T	0.64672	-0.6352	10	0.87932	D	0	.	4.8123	0.13349	0.217:0.6619:0.0:0.1211	.	434;468	E9PFK7;Q3SY77	.;UD3A2_HUMAN	T	468;434;166	ENSP00000282507:A468T;ENSP00000427404:A434T;ENSP00000445367:A166T	ENSP00000282507:A468T	A	-	1	0	UGT3A2	36071727	0.003000	0.15002	0.003000	0.11579	0.000000	0.00434	1.274000	0.33132	0.689000	0.31550	-0.309000	0.09137	GCG		0.632	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914		Missense_Mutation
CDKN1A	1026	genome.wustl.edu	37	6	36652297	36652297	+	Missense_Mutation	SNP	G	G	A	rs201631722		TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr6:36652297G>A	ENST00000405375.1	+	2	654	c.419G>A	c.(418-420)cGa>cAa	p.R140Q	CDKN1A_ENST00000448526.2_Missense_Mutation_p.R174Q|CDKN1A_ENST00000244741.5_Missense_Mutation_p.R140Q|CDKN1A_ENST00000373711.2_Missense_Mutation_p.R140Q	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	140					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.R140Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						TCTCAGGGTCGAAAACGGCGG	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											52.0	55.0	54.0					6																	36652297		2203	4300	6503	36760275	SO:0001583	missense	1026			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.419G>A	6.37:g.36652297G>A	ENSP00000384849:p.Arg140Gln	Somatic		Capture	Illumina GAIIx	4	36760275	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	37	CCDS4824.1	SNP	37	WashU	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894284	0.52121	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	5.08	3.3	0.37823	.	0.500458	0.16993	N	0.191226	T	0.53916	0.1826	L	0.49126	1.545	0.32067	N	0.594873	B;B;B	0.28470	0.213;0.064;0.064	B;B;B	0.16289	0.015;0.006;0.006	T	0.31943	-0.9925	9	.	.	.	-6.1044	7.6268	0.28216	0.1911:0.0:0.8089:0.0	.	174;140;140	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	Q	174;140;140;140	ENSP00000409259:R174Q;ENSP00000244741:R140Q;ENSP00000384849:R140Q;ENSP00000362815:R140Q	.	R	+	2	0	CDKN1A	36760275	0.983000	0.35010	0.827000	0.32855	0.766000	0.43426	1.535000	0.36061	0.724000	0.32296	0.561000	0.74099	CGA		0.582	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467		Missense_Mutation
FAM83D	81610	genome.wustl.edu	37	20	37580235	37580235	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr20:37580235G>T	ENST00000217429.4	+	4	961	c.920G>T	c.(919-921)gGc>gTc	p.G307V		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	277					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G307V(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				ATTCTGTCTGGCCAAGTGGTT	0.443																																																1	Substitution - Missense(1)	ovary(1)	20											120.0	116.0	117.0					20																	37580235		1953	4136	6089	37013649	SO:0001583	missense	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.920G>T	20.37:g.37580235G>T	ENSP00000217429:p.Gly307Val	Somatic		Capture	Illumina GAIIx	4	37013649	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760579	0.89932	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.51817	0.69	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.76435	0.3987	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80578	-0.1320	10	0.87932	D	0	.	19.6732	0.95918	0.0:0.0:1.0:0.0	.	277	Q9H4H8	FA83D_HUMAN	V	307;261	ENSP00000217429:G307V	ENSP00000217429:G307V	G	+	2	0	FAM83D	37013649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.344000	0.97050	2.745000	0.94114	0.655000	0.94253	GGC		0.443	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1			Missense_Mutation
CSNK1E	1454	genome.wustl.edu	37	22	38696778	38696778	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1403-01	TCGA-13-1403-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr22:38696778G>T	ENST00000396832.1	-	5	776	c.516C>A	c.(514-516)aaC>aaA	p.N172K	CSNK1E_ENST00000413574.2_Missense_Mutation_p.N172K|CSNK1E_ENST00000405675.3_Missense_Mutation_p.N172K|CSNK1E_ENST00000403904.1_Missense_Mutation_p.N172K|CSNK1E_ENST00000498529.1_5'Flank|CSNK1E_ENST00000400206.2_Missense_Mutation_p.N172K|CSNK1E_ENST00000359867.3_Missense_Mutation_p.N172K	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	172	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N172K(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					TGCCGGTCAGGTTCTTGTTTT	0.642																																					Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)											2	Substitution - Missense(2)	ovary(2)	22											137.0	115.0	123.0					22																	38696778		2203	4300	6503	37026724	SO:0001583	missense	1454				CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.516C>A	22.37:g.38696778G>T	ENSP00000380044:p.Asn172Lys	Somatic		Capture	Illumina GAIIx	4	37026724		Missense_Mutation	SNP	ENST00000396832.1	37	CCDS13970.1	SNP	44	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.449895|4.449895	0.84101|0.84101	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675;ENST00000430335|ENST00000451964	T;T;T;T;T;T;T|.	0.06068|.	3.35;3.35;3.35;3.35;3.35;3.35;3.35|.	4.92|4.92	3.91|3.91	0.45181|0.45181	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.236512|.	0.48286|.	D|.	0.000187|.	T|T	0.74176|0.74176	0.3682|0.3682	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	B;D;D|.	0.61080|.	0.152;0.989;0.974|.	B;P;P|.	0.56434|.	0.047;0.798;0.721|.	T|T	0.75156|0.75156	-0.3417|-0.3417	10|5	0.87932|.	D|.	0|.	.|.	11.6452|11.6452	0.51257|0.51257	0.1299:0.0:0.8701:0.0|0.1299:0.0:0.8701:0.0	.|.	172;172;172|.	B0QY35;B0QY34;P49674|.	.;.;KC1E_HUMAN|.	K|N	172|110	ENSP00000352929:N172K;ENSP00000380044:N172K;ENSP00000383067:N172K;ENSP00000384074:N172K;ENSP00000407235:N172K;ENSP00000384426:N172K;ENSP00000412335:N172K|.	ENSP00000352929:N172K|.	N|T	-|-	3|2	2|0	CSNK1E|CSNK1E	37026724|37026724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	3.053000|3.053000	0.49901|0.49901	2.724000|2.724000	0.93272|0.93272	0.561000|0.561000	0.74099|0.74099	AAC|ACC		0.642	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894		Missense_Mutation
SUGCT	79783	genome.wustl.edu	37	7	40314151	40314151	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr7:40314151C>T	ENST00000335693.4	+	8	660	c.637C>T	c.(637-639)Ctt>Ttt	p.L213F	C7orf10_ENST00000309930.5_Missense_Mutation_p.L213F|C7orf10_ENST00000401647.2_Intron	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		213					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)	p.L213F(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						TATGACTGATCTTGCCACTGG	0.378																																																1	Substitution - Missense(1)	ovary(1)	7											87.0	84.0	85.0					7																	40314151		1885	4116	6001	40280676	SO:0001583	missense	79783																														ENST00000335693.4:c.637C>T	7.37:g.40314151C>T	ENSP00000338475:p.Leu213Phe	Somatic		Capture	Illumina GAIIx	4	40280676	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	ENST00000335693.4	37	CCDS55105.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620917	0.87460	.	.	ENSG00000175600	ENST00000309930;ENST00000335693	T;T	0.55052	0.54;0.54	5.45	5.45	0.79879	CoA-transferase family III domain (2);	0.000000	0.85682	D	0.000000	T	0.68375	0.2994	L	0.48642	1.525	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.74348	0.983;0.979	T	0.69811	-0.5044	10	0.87932	D	0	-10.8999	19.6593	0.95859	0.0:1.0:0.0:0.0	.	213;176	Q9HAC7;Q9HAC7-2	CG010_HUMAN;.	F	213	ENSP00000312054:L213F;ENSP00000338475:L213F	ENSP00000312054:L213F	L	+	1	0	C7orf10	40280676	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	5.469000	0.66749	2.723000	0.93209	0.655000	0.94253	CTT		0.378	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1			Missense_Mutation
LRFN2	57497	genome.wustl.edu	37	6	40360302	40360302	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr6:40360302G>C	ENST00000338305.6	-	3	2292	c.1750C>G	c.(1750-1752)Cca>Gca	p.P584A		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	584						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P584A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGAGGCGGTGGCTGGGCGCCG	0.697																																																1	Substitution - Missense(1)	ovary(1)	6											15.0	15.0	15.0					6																	40360302		2193	4281	6474	40468280	SO:0001583	missense	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1750C>G	6.37:g.40360302G>C	ENSP00000345985:p.Pro584Ala	Somatic		Capture	Illumina GAIIx	4	40468280	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	g	0.052	-1.247246	0.01481	.	.	ENSG00000156564	ENST00000338305	T	0.54071	0.59	4.63	4.63	0.57726	.	0.157029	0.42821	D	0.000646	T	0.07593	0.0191	N	0.00729	-1.24	0.28801	N	0.898779	B	0.22003	0.063	B	0.19666	0.026	T	0.20974	-1.0259	10	0.13108	T	0.6	.	11.4457	0.50123	0.0:0.0:0.8197:0.1803	.	584	Q9ULH4	LRFN2_HUMAN	A	584	ENSP00000345985:P584A	ENSP00000345985:P584A	P	-	1	0	LRFN2	40468280	0.669000	0.27502	0.908000	0.35775	0.045000	0.14185	0.000000	0.12993	2.394000	0.81467	0.461000	0.40582	CCA		0.697	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372		Missense_Mutation
ZKSCAN7	55888	genome.wustl.edu	37	3	44612517	44612517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:44612517G>T	ENST00000273320.3	+	6	2344	c.1915G>T	c.(1915-1917)Gag>Tag	p.E639*	RP11-944L7.4_ENST00000457331.1_RNA|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000431636.1_Intron|ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000426540.1_Nonsense_Mutation_p.E639*	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	639					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E639*(1)									TAAATGCAATGAGTGTGGAAA	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	3											65.0	68.0	67.0					3																	44612517		2203	4300	6503	44587521	SO:0001587	stop_gained	55888			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1915G>T	3.37:g.44612517G>T	ENSP00000273320:p.Glu639*	Somatic		Capture	Illumina GAIIx	4	44587521	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Nonsense_Mutation	SNP	ENST00000273320.3	37	CCDS2715.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	.	40	8.005097	0.98605	.	.	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000315777	.	.	.	4.2	4.2	0.49525	.	0.502773	0.14878	N	0.293107	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.0482	15.5027	0.75713	0.0:0.0:1.0:0.0	.	.	.	.	X	639;639;77	.	ENSP00000273320:E639X	E	+	1	0	ZNF167	44587521	0.025000	0.19082	0.831000	0.32960	0.967000	0.64934	1.401000	0.34589	2.179000	0.69175	0.655000	0.94253	GAG		0.408	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651		Nonsense_Mutation
GABRA2	2555	genome.wustl.edu	37	4	46305476	46305476	+	Splice_Site	SNP	C	C	A			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr4:46305476C>A	ENST00000510861.1	-	8	1030		c.e8+1		GABRA2_ENST00000514090.1_Splice_Site|GABRA2_ENST00000356504.1_Splice_Site|GABRA2_ENST00000540012.1_Splice_Site|GABRA2_ENST00000381620.4_Splice_Site|GABRA2_ENST00000507069.1_Splice_Site|GABRA2_ENST00000515082.1_Splice_Site			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.?(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	tattCACTCACCAAACACAGT	0.373																																																1	Unknown(1)	ovary(1)	4											107.0	102.0	103.0					4																	46305476		2203	4300	6503	46000233	SO:0001630	splice_region_variant	2555				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.856+1G>T	4.37:g.46305476C>A		Somatic		Capture	Illumina GAIIx	4	46000233	A8K0U7|B7Z1H8|Q59G14	Splice_Site_SNP	SNP	ENST00000510861.1	37	CCDS3471.1	SNP	18	WashU	.	.	.	.	.	.	.	.	.	.	C	19.04	3.750108	0.69533	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0281	0.89275	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GABRA2	46000233	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.776000	0.85560	2.574000	0.86865	0.655000	0.94253	.		0.373	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		Intron	Splice_Site_SNP
YBEY	54059	genome.wustl.edu	37	21	47711315	47711315	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1403-01	TCGA-13-1403-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr21:47711315T>C	ENST00000329319.3	+	3	676	c.278T>C	c.(277-279)cTa>cCa	p.L93P	YBEY_ENST00000397692.1_Intron|YBEY_ENST00000397701.4_Missense_Mutation_p.L93P|YBEY_ENST00000339195.6_Intron|YBEY_ENST00000397691.1_Missense_Mutation_p.L93P|YBEY_ENST00000397694.1_Missense_Mutation_p.L48P	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)	93					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.L93P(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						GACATTTTCCTAGGAGTGGAG	0.403																																																1	Substitution - Missense(1)	ovary(1)	21											97.0	99.0	98.0					21																	47711315		2203	4300	6503	46535743	SO:0001583	missense	54059			AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.278T>C	21.37:g.47711315T>C	ENSP00000329614:p.Leu93Pro	Somatic		Capture	Illumina GAIIx	4	46535743	B7WPA9|B7WPF7|D3DSN2	Missense_Mutation	SNP	ENST00000329319.3	37	CCDS33591.1	SNP	53	WashU	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630850	0.67015	.	.	ENSG00000182362	ENST00000397701;ENST00000397694;ENST00000329319;ENST00000397691	.	.	.	5.09	3.93	0.45458	Metalloprotease catalytic domain, predicted (1);	0.000000	0.64402	D	0.000006	D	0.84392	0.5462	M	0.93638	3.44	0.80722	D	1	B;D;D	0.89917	0.412;1.0;1.0	B;D;D	0.81914	0.192;0.995;0.995	D	0.85983	0.1484	9	0.87932	D	0	-16.8431	10.4734	0.44650	0.0:0.078:0.0:0.922	.	48;93;93	P58557-3;P58557;Q8TBC8	.;YBEY_HUMAN;.	P	93;48;93;93	.	ENSP00000329614:L93P	L	+	2	0	YBEY	46535743	1.000000	0.71417	0.941000	0.38009	0.759000	0.43091	6.715000	0.74697	0.764000	0.33197	0.418000	0.28097	CTA		0.403	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207265.1	NM_058181		Missense_Mutation
SNTG1	54212	genome.wustl.edu	37	8	51705269	51705269	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr8:51705269C>A	ENST00000522124.1	+	19	2095	c.1434C>A	c.(1432-1434)tgC>tgA	p.C478*	SNTG1_ENST00000517473.1_Nonsense_Mutation_p.C441*|SNTG1_ENST00000518864.1_Nonsense_Mutation_p.C478*|SNTG1_ENST00000276467.5_Nonsense_Mutation_p.C441*	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	478					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.C478*(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TTCTTCACTGCATTCATTCCT	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	8											207.0	202.0	204.0					8																	51705269		2203	4300	6503	51867822	SO:0001587	stop_gained	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1434C>A	8.37:g.51705269C>A	ENSP00000429842:p.Cys478*	Somatic		Capture	Illumina GAIIx	4	51867822	Q2M3Q0|Q9NY98	Nonsense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	SNP	25	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.593563	0.96602	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	5.55	1.74	0.24563	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.7539	6.9562	0.24572	0.0:0.5203:0.0:0.4797	.	.	.	.	X	478;478;441;441	.	ENSP00000276467:C441X	C	+	3	2	SNTG1	51867822	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.360000	0.20250	0.713000	0.32060	0.637000	0.83480	TGC		0.373	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1			Nonsense_Mutation
MLIP	90523	genome.wustl.edu	37	6	54122124	54122124	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr6:54122124G>A	ENST00000274897.5	+	12	1449	c.1336G>A	c.(1336-1338)Gct>Act	p.A446T	MLIP_ENST00000370877.2_Intron|MLIP_ENST00000358276.5_Missense_Mutation_p.A278T|MLIP_ENST00000370876.2_Missense_Mutation_p.A222T|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Missense_Mutation_p.A981T	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	446						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)		p.A446T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						TCCAATGGTGGCTATTCCTGA	0.333																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	115.0	116.0					6																	54122124		2203	4300	6503	54230083	SO:0001583	missense	90523			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1336G>A	6.37:g.54122124G>A	ENSP00000274897:p.Ala446Thr	Somatic		Capture	Illumina GAIIx	4	54230083	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	ENST00000274897.5	37	CCDS4954.1	SNP	42	WashU	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277600	0.40294	.	.	ENSG00000146147	ENST00000274897;ENST00000370876;ENST00000502396;ENST00000358276	T;T;T;T	0.28895	2.36;1.59;2.08;1.6	5.63	2.36	0.29203	.	0.159273	0.29861	N	0.011012	T	0.04952	0.0133	N	0.08118	0	0.22050	N	0.999397	B;B;B	0.18166	0.026;0.026;0.003	B;B;B	0.20184	0.028;0.028;0.011	T	0.30475	-0.9977	10	0.44086	T	0.13	-0.5728	5.7624	0.18207	0.374:0.0:0.626:0.0	.	981;222;446	Q5VWP3-3;Q5VWP3-2;Q5VWP3	.;.;MLIP_HUMAN	T	446;222;981;278	ENSP00000274897:A446T;ENSP00000359913:A222T;ENSP00000426290:A981T;ENSP00000351019:A278T	ENSP00000274897:A446T	A	+	1	0	MLIP	54230083	0.979000	0.34478	1.000000	0.80357	0.875000	0.50365	-0.123000	0.10611	0.832000	0.34804	0.591000	0.81541	GCT		0.333	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040979.3	NM_138569		Missense_Mutation
ERC2	26059	genome.wustl.edu	37	3	56330282	56330282	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-1403-01	TCGA-13-1403-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:56330282A>T	ENST00000288221.6	-	3	1094	c.839T>A	c.(838-840)tTg>tAg	p.L280*		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	280						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.L280*(1)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TGTCTTCCTCAAAAGGAACAG	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	3											229.0	229.0	229.0					3																	56330282		1972	4174	6146	56305322	SO:0001587	stop_gained	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.839T>A	3.37:g.56330282A>T	ENSP00000288221:p.Leu280*	Somatic		Capture	Illumina GAIIx	4	56305322	Q2T9F6|Q86TK4	Nonsense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	SNP	5	WashU	.	.	.	.	.	.	.	.	.	.	A	40	8.076169	0.98640	.	.	ENSG00000187672	ENST00000288221	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0997	16.2322	0.82352	1.0:0.0:0.0:0.0	.	.	.	.	X	280	.	ENSP00000288221:L280X	L	-	2	0	ERC2	56305322	1.000000	0.71417	0.931000	0.37212	0.996000	0.88848	9.287000	0.95975	2.288000	0.76882	0.528000	0.53228	TTG		0.493	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576		Nonsense_Mutation
FAM217B	63939	genome.wustl.edu	37	20	58519911	58519911	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr20:58519911C>T	ENST00000358293.3	+	5	1328	c.913C>T	c.(913-915)Cgc>Tgc	p.R305C	FAM217B_ENST00000360816.3_Missense_Mutation_p.R305C|FAM217B_ENST00000469084.1_3'UTR	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	305								p.R305C(1)									GAAGCTGCAGCGCTGGGATCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	20											48.0	51.0	50.0					20																	58519911		2203	4300	6503	57953306	SO:0001583	missense	63939			AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.913C>T	20.37:g.58519911C>T	ENSP00000351040:p.Arg305Cys	Somatic		Capture	Illumina GAIIx	4	57953306	B3KWH1|Q9NTA3	Missense_Mutation	SNP	ENST00000358293.3	37	CCDS13484.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	16.67	3.187653	0.57909	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.23754	1.89;1.89	5.44	1.35	0.21983	.	2.596660	0.01316	N	0.010791	T	0.18964	0.0455	N	0.19112	0.55	0.09310	N	1	B	0.17465	0.022	B	0.10450	0.005	T	0.22452	-1.0216	10	0.49607	T	0.09	0.0666	6.0818	0.19944	0.0:0.6469:0.135:0.2181	.	305	Q9NTX9	CT177_HUMAN	C	305	ENSP00000351040:R305C;ENSP00000354056:R305C	ENSP00000351040:R305C	R	+	1	0	C20orf177	57953306	0.400000	0.25295	0.001000	0.08648	0.037000	0.13140	1.084000	0.30828	0.023000	0.15187	0.655000	0.94253	CGC		0.488	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268139.1	NM_022106		Missense_Mutation
OR4D11	219986	genome.wustl.edu	37	11	59271585	59271585	+	Silent	SNP	C	C	T	rs374819635		TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr11:59271585C>T	ENST00000313253.1	+	1	537	c.537C>T	c.(535-537)tgC>tgT	p.C179C		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C179C(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						CTTTCTACTGCGATGTCCCCC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	11						T		1,4401	2.1+/-5.4	0,1,2200	259.0	234.0	242.0		537	-8.3	0.2	11		242	2,8588	2.2+/-6.3	0,2,4293	no	coding-synonymous	OR4D11	NM_001004706.1		0,3,6493	TT,TC,CC		0.0233,0.0227,0.0231		179/312	59271585	3,12989	2201	4295	6496	59028161	SO:0001819	synonymous_variant	219986			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.537C>T	11.37:g.59271585C>T		Somatic		Capture	Illumina GAIIx	4	59028161		Silent	SNP	ENST00000313253.1	37	CCDS31563.1	SNP	27	WashU																																																																																				0.507	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706		Silent
LAIR1	3903	genome.wustl.edu	37	19	54867979	54867979	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1403-01	TCGA-13-1403-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr19:54867979C>G	ENST00000391742.2	-	7	764	c.612G>C	c.(610-612)caG>caC	p.Q204H	LAIR1_ENST00000313038.6_Missense_Mutation_p.Q197H|LAIR1_ENST00000474878.1_Missense_Mutation_p.Q186H|LAIR1_ENST00000348231.4_Missense_Mutation_p.Q187H|LAIR1_ENST00000434277.2_Missense_Mutation_p.Q203H|LAIR1_ENST00000391743.3_Missense_Mutation_p.Q186H|LAIR1_ENST00000463489.1_5'UTR			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	204					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q204H(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		GCTGTGGCTTCTGCTCCTCGT	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	84.0	80.0					19																	54867979		2203	4300	6503	59559791	SO:0001583	missense	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.612G>C	19.37:g.54867979C>G	ENSP00000375622:p.Gln204His	Somatic		Capture	Illumina GAIIx	4	59559791		Missense_Mutation	SNP	ENST00000391742.2	37	CCDS12891.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	.	11.95	1.791765	0.31685	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878	T;T;T;T;T;T	0.00515	6.87;6.99;7.01;6.96;6.95;6.96	4.17	1.78	0.24846	.	0.188106	0.26311	N	0.025101	T	0.01029	0.0034	M	0.66939	2.045	0.09310	N	1	D;D;D;P;D;D	0.69078	0.997;0.997;0.995;0.917;0.992;0.991	D;P;P;P;P;P	0.63192	0.912;0.841;0.874;0.62;0.875;0.751	T	0.46665	-0.9175	10	0.72032	D	0.01	.	6.2284	0.20722	0.0:0.749:0.0:0.251	.	204;186;186;203;187;204	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	H	186;204;203;187;197;186	ENSP00000375623:Q186H;ENSP00000375622:Q204H;ENSP00000391003:Q203H;ENSP00000301193:Q187H;ENSP00000319204:Q197H;ENSP00000418998:Q186H	ENSP00000319204:Q197H	Q	-	3	2	LAIR1	59559791	0.000000	0.05858	0.007000	0.13788	0.126000	0.20510	0.589000	0.23939	0.586000	0.29626	0.650000	0.86243	CAG		0.592	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1			Missense_Mutation
LARP1BP1	644578	genome.wustl.edu	37	4	64216511	64216511	+	IGR	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr4:64216511G>A								RP11-257A22.1 (206912 upstream) : RP11-12K22.1 (117907 downstream)																							GGATAGCACAGAAGTAGAAAT	0.428																																																0			4																																								63899106	SO:0001628	intergenic_variant	644578																															4.37:g.64216511G>A		Somatic		Capture	Illumina GAIIx	4	63899106		Missense_Mutation	SNP		37		SNP	33	WashU																																																																																			0	0.428									Missense_Mutation
SGK3	23678	genome.wustl.edu	37	8	67743527	67743527	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr8:67743527G>C	ENST00000396596.1	+	8	720	c.506G>C	c.(505-507)gGa>gCa	p.G169A	SGK3_ENST00000521198.2_Missense_Mutation_p.G169A|SGK3_ENST00000522398.1_Missense_Mutation_p.G169A|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.G169A|SGK3_ENST00000520976.1_Missense_Mutation_p.G169A|SGK3_ENST00000345714.4_Missense_Mutation_p.G169A	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)	p.G102A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AAAGTTATTGGAAAAGGCAGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	8											157.0	163.0	161.0					8																	67743527		2203	4300	6503	67906081	SO:0001583	missense	23678				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.506G>C	8.37:g.67743527G>C	ENSP00000379842:p.Gly169Ala	Somatic		Capture	Illumina GAIIx	4	67906081	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	ENST00000396596.1	37	CCDS6195.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823614	0.90873	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000521960;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000519396	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92967	0.7762	M	0.89601	3.045	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94297	0.7534	9	0.87932	D	0	.	18.7095	0.91651	0.0:0.0:1.0:0.0	.	169;169	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	A	169;169;169;102;169;169;169;169;51	ENSP00000429022:G169A;ENSP00000430463:G169A;ENSP00000430256:G169A;ENSP00000430691:G169A;ENSP00000379842:G169A;ENSP00000331816:G169A;ENSP00000428529:G51A	ENSP00000262211:G169A	G	+	2	0	SGK3	67906081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.783000	0.99037	2.404000	0.81709	0.563000	0.77884	GGA		0.333	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379232.3			Missense_Mutation
WBSCR17	64409	genome.wustl.edu	37	7	71134989	71134989	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1403-01	TCGA-13-1403-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr7:71134989A>C	ENST00000333538.5	+	8	1933	c.1299A>C	c.(1297-1299)gaA>gaC	p.E433D	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	433					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E433D(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATGTCTCCGAAAGAAGAGCAT	0.463																																																1	Substitution - Missense(1)	ovary(1)	7											100.0	101.0	101.0					7																	71134989		2203	4300	6503	70772925	SO:0001583	missense	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1299A>C	7.37:g.71134989A>C	ENSP00000329654:p.Glu433Asp	Somatic		Capture	Illumina GAIIx	4	70772925	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	SNP	1	WashU	.	.	.	.	.	.	.	.	.	.	A	9.907	1.208369	0.22205	.	.	ENSG00000185274	ENST00000333538	T	0.29142	1.58	5.0	0.00875	0.14076	.	0.058258	0.64402	D	0.000003	T	0.19366	0.0465	L	0.41710	1.295	0.53005	D	0.999964	B	0.23442	0.085	B	0.21151	0.033	T	0.04870	-1.0921	10	0.33141	T	0.24	.	5.657	0.17648	0.3797:0.172:0.4483:0.0	.	433	Q6IS24	GLTL3_HUMAN	D	433	ENSP00000329654:E433D	ENSP00000329654:E433D	E	+	3	2	WBSCR17	70772925	0.998000	0.40836	0.974000	0.42286	0.167000	0.22549	0.548000	0.23314	-0.011000	0.14247	-0.326000	0.08463	GAA		0.463	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479		Missense_Mutation
CABS1	85438	genome.wustl.edu	37	4	71201244	71201244	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr4:71201244C>G	ENST00000273936.5	+	1	562	c.488C>G	c.(487-489)tCt>tGt	p.S163C		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	163					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)	p.S163C(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCTGAAGTCTCTGGCACACTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	4											54.0	57.0	56.0					4																	71201244		2201	4298	6499	71235833	SO:0001583	missense	85438			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.488C>G	4.37:g.71201244C>G	ENSP00000273936:p.Ser163Cys	Somatic		Capture	Illumina GAIIx	4	71235833	B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	ENST00000273936.5	37	CCDS3539.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	16.03	3.008367	0.54361	.	.	ENSG00000145309	ENST00000273936	T	0.37058	1.22	4.16	4.16	0.48862	.	0.385300	0.19291	N	0.117890	T	0.46229	0.1382	L	0.34521	1.04	0.21861	N	0.9995	D	0.76494	0.999	D	0.68483	0.958	T	0.23976	-1.0173	10	0.72032	D	0.01	-20.455	12.264	0.54668	0.0:1.0:0.0:0.0	.	163	Q96KC9	CABS1_HUMAN	C	163	ENSP00000273936:S163C	ENSP00000273936:S163C	S	+	2	0	CABS1	71235833	0.951000	0.32395	0.354000	0.25760	0.013000	0.08279	1.874000	0.39568	2.609000	0.88269	0.655000	0.94253	TCT		0.413	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251561.3	NM_033122		Missense_Mutation
P2RY2	5029	genome.wustl.edu	37	11	72945583	72945583	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1403-01	TCGA-13-1403-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr11:72945583A>T	ENST00000311131.2	+	3	846	c.379A>T	c.(379-381)Atc>Ttc	p.I127F	P2RY2_ENST00000393596.2_Missense_Mutation_p.I127F|P2RY2_ENST00000393597.2_Missense_Mutation_p.I127F	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	127					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)	p.I127F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CCTCACCTGCATCAGCGTGCA	0.677																																																1	Substitution - Missense(1)	ovary(1)	11											92.0	87.0	89.0					11																	72945583		2200	4293	6493	72623231	SO:0001583	missense	5029			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.379A>T	11.37:g.72945583A>T	ENSP00000310305:p.Ile127Phe	Somatic		Capture	Illumina GAIIx	4	72623231	B2R9W3|Q96EM8	Missense_Mutation	SNP	ENST00000311131.2	37	CCDS8219.1	SNP	8	WashU	.	.	.	.	.	.	.	.	.	.	A	26.9	4.784780	0.90282	.	.	ENSG00000175591	ENST00000393597;ENST00000311131;ENST00000393596	T;T;T	0.81247	-1.47;-1.47;-1.47	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92280	0.7551	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94264	0.7505	10	0.87932	D	0	.	14.5447	0.68020	1.0:0.0:0.0:0.0	.	127	P41231	P2RY2_HUMAN	F	127	ENSP00000377222:I127F;ENSP00000310305:I127F;ENSP00000377221:I127F	ENSP00000310305:I127F	I	+	1	0	P2RY2	72623231	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.195000	0.77798	2.039000	0.60335	0.533000	0.62120	ATC		0.677	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072		Missense_Mutation
MYCBP2	23077	genome.wustl.edu	37	13	77740565	77740565	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1403-01	TCGA-13-1403-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr13:77740565C>G	ENST00000544440.2	-	41	6142	c.6125G>C	c.(6124-6126)gGa>gCa	p.G2042A	MYCBP2_ENST00000407578.2_Missense_Mutation_p.G2080A|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.G2042A					MYC binding protein 2, E3 ubiquitin protein ligase									p.G2042A(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CAATTTTGGTCCATATCCTGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											104.0	102.0	102.0					13																	77740565		2203	4300	6503	76638566	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6125G>C	13.37:g.77740565C>G	ENSP00000444596:p.Gly2042Ala	Somatic		Capture	Illumina GAIIx	4	76638566		Missense_Mutation	SNP	ENST00000544440.2	37		SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863729	0.91511	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.26373	1.74;1.74;1.74	5.79	5.79	0.91817	.	0.060874	0.64402	D	0.000003	T	0.16300	0.0392	N	0.08118	0	0.58432	D	0.999997	B	0.31435	0.323	B	0.32624	0.149	T	0.12319	-1.0552	10	0.13470	T	0.59	.	20.0221	0.97508	0.0:1.0:0.0:0.0	.	2042	O75592	MYCB2_HUMAN	A	2042;2080;2042	ENSP00000349892:G2042A;ENSP00000384288:G2080A;ENSP00000444596:G2042A	ENSP00000349892:G2042A	G	-	2	0	MYCBP2	76638566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.637000	0.54324	2.732000	0.93576	0.650000	0.86243	GGA		0.398	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		Missense_Mutation
ANGPTL5	253935	genome.wustl.edu	37	11	101773368	101773368	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr11:101773368G>A	ENST00000334289.3	-	6	1119	c.524C>T	c.(523-525)tCt>tTt	p.S175F		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	175	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.		S -> P (in dbSNP:rs7946238).			extracellular region (GO:0005576)		p.S175F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TGGGTAGCTAGATCCTTCTGG	0.338																																																1	Substitution - Missense(1)	ovary(1)	11											118.0	123.0	121.0					11																	101773368		2203	4299	6502	101278578	SO:0001583	missense	253935			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.524C>T	11.37:g.101773368G>A	ENSP00000335255:p.Ser175Phe	Somatic		Capture	Illumina GAIIx	4	101278578	A8K658|Q86VR9	Missense_Mutation	SNP	ENST00000334289.3	37	CCDS8312.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675734	0.88445	.	.	ENSG00000187151	ENST00000334289	T	0.77877	-1.13	5.05	5.05	0.67936	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.290389	0.37669	N	0.002000	T	0.80215	0.4582	L	0.46567	1.45	0.47778	D	0.999515	P	0.48016	0.904	P	0.54312	0.748	T	0.75031	-0.3461	10	0.11794	T	0.64	.	18.4269	0.90612	0.0:0.0:1.0:0.0	.	175	Q86XS5	ANGL5_HUMAN	F	175	ENSP00000335255:S175F	ENSP00000335255:S175F	S	-	2	0	ANGPTL5	101278578	1.000000	0.71417	0.958000	0.39756	0.992000	0.81027	5.149000	0.64863	2.339000	0.79563	0.591000	0.81541	TCT		0.338	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394138.1	NM_178127		Missense_Mutation
SLC41A2	84102	genome.wustl.edu	37	12	105321786	105321786	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1403-01	TCGA-13-1403-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr12:105321786T>C	ENST00000258538.3	-	1	647	c.520A>G	c.(520-522)Aca>Gca	p.T174A		NM_032148.3	NP_115524.3	Q96JW4	S41A2_HUMAN	solute carrier family 41 (magnesium transporter), member 2	174					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.T91A(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	22						GCTGAAACTGTTCCAAAACCA	0.373																																					Esophageal Squamous(195;176 2919 4272 35572)											1	Substitution - Missense(1)	ovary(1)	12											147.0	127.0	134.0					12																	105321786		2203	4300	6503	103845916	SO:0001583	missense	84102			BC036734	CCDS9100.2	12q24.11	2013-07-17	2013-07-17		ENSG00000136052	ENSG00000136052		"""Solute carriers"""	31045	protein-coding gene	gene with protein product		610802	"""solute carrier family 41, member 2"""				Standard	NM_032148		Approved	DKFZP434K0427	uc001tla.3	Q96JW4	OTTHUMG00000156965	ENST00000258538.3:c.520A>G	12.37:g.105321786T>C	ENSP00000258538:p.Thr174Ala	Somatic		Capture	Illumina GAIIx	4	103845916	Q3KP68|Q9H0E5	Missense_Mutation	SNP	ENST00000258538.3	37	CCDS9100.2	SNP	60	WashU	.	.	.	.	.	.	.	.	.	.	T	24.0	4.486017	0.84854	.	.	ENSG00000136052	ENST00000258538	T	0.25414	1.8	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.39733	0.1089	M	0.84219	2.685	0.80722	D	1	D	0.54397	0.966	P	0.48598	0.583	T	0.43261	-0.9402	10	0.08837	T	0.75	-3.0929	16.8061	0.85666	0.0:0.0:0.0:1.0	.	174	Q96JW4	S41A2_HUMAN	A	174	ENSP00000258538:T174A	ENSP00000258538:T174A	T	-	1	0	SLC41A2	103845916	1.000000	0.71417	0.971000	0.41717	0.982000	0.71751	7.006000	0.76329	2.367000	0.80283	0.528000	0.53228	ACA		0.373	SLC41A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346850.3	NM_032148		Missense_Mutation
ADCY5	111	genome.wustl.edu	37	3	123010123	123010123	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:123010123C>T	ENST00000462833.1	-	18	4376	c.3164G>A	c.(3163-3165)cGc>cAc	p.R1055H	ADCY5_ENST00000491190.1_Missense_Mutation_p.R713H|ADCY5_ENST00000309879.5_Missense_Mutation_p.R705H	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1055					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.R1055H(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GCGCCGCTCGCGGGCCAGGAA	0.602																																																1	Substitution - Missense(1)	ovary(1)	3											84.0	71.0	76.0					3																	123010123		2203	4300	6503	124492813	SO:0001583	missense	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3164G>A	3.37:g.123010123C>T	ENSP00000419361:p.Arg1055His	Somatic		Capture	Illumina GAIIx	4	124492813	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	SNP	27	WashU	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837652	0.91117	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;D;D	0.81996	-1.14;-1.54;-1.56	4.53	4.53	0.55603	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.076544	0.53938	D	0.000055	D	0.84719	0.5534	M	0.71871	2.18	0.58432	D	0.999999	P;D	0.56035	0.602;0.974	B;P	0.51918	0.042;0.684	D	0.85312	0.1079	10	0.56958	D	0.05	.	8.6843	0.34227	0.0:0.8609:0.0:0.1391	.	1055;713	O95622;B3KWA8	ADCY5_HUMAN;.	H	1055;713;705	ENSP00000419361:R1055H;ENSP00000418537:R713H;ENSP00000308685:R705H	ENSP00000308685:R705H	R	-	2	0	ADCY5	124492813	0.993000	0.37304	0.992000	0.48379	0.962000	0.63368	3.012000	0.49575	2.362000	0.80069	0.563000	0.77884	CGC		0.602	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048		Missense_Mutation
MEGF10	84466	genome.wustl.edu	37	5	126792970	126792970	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr5:126792970G>C	ENST00000274473.6	+	26	3650	c.3383G>C	c.(3382-3384)aGt>aCt	p.S1128T	MEGF10_ENST00000503335.2_Missense_Mutation_p.S1128T	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1128	Necessary for formation of large intracellular vacuoles.|Ser-rich.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.S1128T(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CAAGAGGACAGTGGTGGTagc	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	81.0	86.0					5																	126792970		2203	4300	6503	126820869	SO:0001583	missense	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3383G>C	5.37:g.126792970G>C	ENSP00000274473:p.Ser1128Thr	Somatic		Capture	Illumina GAIIx	4	126820869	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	SNP	36	WashU	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.890248	0.00527	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.80214	-1.35;-1.35	6.01	2.93	0.34026	.	0.610454	0.14898	N	0.291971	T	0.57301	0.2044	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40098	-0.9581	10	0.08599	T	0.76	-4.2052	8.1306	0.31024	0.1632:0.2219:0.6149:0.0	.	1128	Q96KG7	MEG10_HUMAN	T	1128	ENSP00000423354:S1128T;ENSP00000274473:S1128T	ENSP00000274473:S1128T	S	+	2	0	MEGF10	126820869	0.989000	0.36119	0.513000	0.27749	0.245000	0.25701	3.807000	0.55591	1.410000	0.46936	0.650000	0.86243	AGT		0.522	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		Missense_Mutation
ACTRT1	139741	genome.wustl.edu	37	X	127185238	127185238	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chrX:127185238C>G	ENST00000371124.3	-	1	1144	c.948G>C	c.(946-948)aaG>aaC	p.K316N		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	316						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.K316N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						GTTCCACTTCCTTCATGAGCC	0.493																																																1	Substitution - Missense(1)	ovary(1)	X											129.0	93.0	105.0					X																	127185238		2203	4300	6503	127012919	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.948G>C	X.37:g.127185238C>G	ENSP00000360165:p.Lys316Asn	Somatic		Capture	Illumina GAIIx	4	127012919	Q6X7C1|Q96L10	Missense_Mutation	SNP	ENST00000371124.3	37	CCDS14611.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	4.149	0.025963	0.08054	.	.	ENSG00000123165	ENST00000371124	D	0.94897	-3.55	3.58	-1.81	0.07882	.	0.219866	0.32952	N	0.005457	D	0.92014	0.7470	M	0.69248	2.105	0.32154	N	0.583896	B	0.29481	0.245	B	0.35039	0.194	D	0.87618	0.2508	10	0.87932	D	0	.	9.2817	0.37733	0.0:0.6237:0.0:0.3762	.	316	Q8TDG2	ACTT1_HUMAN	N	316	ENSP00000360165:K316N	ENSP00000360165:K316N	K	-	3	2	ACTRT1	127012919	0.995000	0.38212	0.011000	0.14972	0.018000	0.09664	0.259000	0.18405	-0.436000	0.07254	-0.354000	0.07668	AAG		0.493	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	NM_138289		Missense_Mutation
ADAM12	8038	genome.wustl.edu	37	10	127843850	127843850	+	Silent	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr10:127843850C>T	ENST00000368679.4	-	4	594	c.285G>A	c.(283-285)acG>acA	p.T95T	ADAM12_ENST00000368676.4_Silent_p.T95T	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	95					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.T95T(1)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AGTGGGTTTCCGTGAAACTGC	0.438																																																1	Substitution - coding silent(1)	ovary(1)	10											154.0	146.0	148.0					10																	127843850		2203	4300	6503	127833840	SO:0001819	synonymous_variant	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.285G>A	10.37:g.127843850C>T		Somatic		Capture	Illumina GAIIx	4	127833840	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	ENST00000368679.4	37	CCDS7653.1	SNP	23	WashU																																																																																				0.438	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1			Silent
PCDHGB6	56100	genome.wustl.edu	37	5	140789113	140789113	+	Silent	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr5:140789113C>T	ENST00000520790.1	+	1	1344	c.1344C>T	c.(1342-1344)aaC>aaT	p.N448N	PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	448	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAACGACAACGCCCCAGTTT	0.567																																																0			5											62.0	68.0	66.0					5																	140789113		2125	4242	6367	140769297	SO:0001819	synonymous_variant	56100			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1344C>T	5.37:g.140789113C>T		Somatic		Capture	Illumina GAIIx	4	140769297	Q9Y5C5	Silent	SNP	ENST00000520790.1	37	CCDS54929.1	SNP	19	WashU																																																																																				0.567	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926		Silent
PCOLCE2	26577	genome.wustl.edu	37	3	142561848	142561848	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:142561848G>T	ENST00000295992.3	-	4	797	c.491C>A	c.(490-492)tCt>tAt	p.S164Y	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.S164Y	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	164	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.S164Y(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						GGTTTTAAAAGAGCCGGAAGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	84.0	83.0					3																	142561848		2203	4300	6503	144044538	SO:0001583	missense	26577			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.491C>A	3.37:g.142561848G>T	ENSP00000295992:p.Ser164Tyr	Somatic		Capture	Illumina GAIIx	4	144044538	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	CCDS3127.1	SNP	33	WashU	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289062	0.23478	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.27890	1.64;1.64	5.22	4.32	0.51571	CUB (5);	0.274051	0.42420	D	0.000709	T	0.43188	0.1236	L	0.46947	1.48	0.36974	D	0.893979	P	0.42248	0.774	P	0.52710	0.707	T	0.54450	-0.8292	10	0.72032	D	0.01	-24.3321	15.6884	0.77430	0.0:0.1374:0.8626:0.0	.	164	Q9UKZ9	PCOC2_HUMAN	Y	164	ENSP00000295992:S164Y;ENSP00000419842:S164Y	ENSP00000295992:S164Y	S	-	2	0	PCOLCE2	144044538	1.000000	0.71417	0.990000	0.47175	0.072000	0.16883	7.360000	0.79487	1.389000	0.46526	0.555000	0.69702	TCT		0.468	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363		Missense_Mutation
FLG2	388698	genome.wustl.edu	37	1	152326906	152326906	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:152326906C>A	ENST00000388718.5	-	3	3428	c.3356G>T	c.(3355-3357)gGa>gTa	p.G1119V	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1119	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1119V(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCCGATCCATATTGGCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											233.0	237.0	236.0					1																	152326906		2203	4300	6503	150593530	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3356G>T	1.37:g.152326906C>A	ENSP00000373370:p.Gly1119Val	Somatic		Capture	Illumina GAIIx	4	150593530	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570535	0.28003	.	.	ENSG00000143520	ENST00000388718	T	0.24350	1.86	4.37	2.44	0.29823	.	.	.	.	.	T	0.16128	0.0388	L	0.29908	0.895	0.19945	N	0.999949	D	0.76494	0.999	D	0.70716	0.97	T	0.10200	-1.0640	9	0.24483	T	0.36	.	7.2788	0.26300	0.0:0.7884:0.0:0.2116	.	1119	Q5D862	FILA2_HUMAN	V	1119	ENSP00000373370:G1119V	ENSP00000373370:G1119V	G	-	2	0	FLG2	150593530	0.000000	0.05858	0.009000	0.14445	0.030000	0.12068	0.159000	0.16442	0.286000	0.22352	0.558000	0.71614	GGA		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		Missense_Mutation
KMT2C	58508	genome.wustl.edu	37	7	151860622	151860622	+	Missense_Mutation	SNP	T	T	C	rs536894778	byFrequency	TCGA-13-1403-01	TCGA-13-1403-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr7:151860622T>C	ENST00000262189.6	-	43	10258	c.10040A>G	c.(10039-10041)aAt>aGt	p.N3347S	KMT2C_ENST00000355193.2_Missense_Mutation_p.N3347S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3347	Gln-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.N3347S(1)									TCTAGGAGGATTGAGGGGCAG	0.512													T|||	2	0.000399361	0.0	0.0	5008	,	,		19739	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	7											90.0	89.0	89.0					7																	151860622		2203	4300	6503	151491555	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.10040A>G	7.37:g.151860622T>C	ENSP00000262189:p.Asn3347Ser	Somatic		Capture	Illumina GAIIx	4	151491555	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	SNP	52	WashU	.	.	.	.	.	.	.	.	.	.	T	8.634	0.894309	0.17613	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83419	-1.72;-1.72	5.28	4.11	0.48088	.	0.000000	0.49305	D	0.000147	D	0.85331	0.5672	L	0.57536	1.79	0.80722	D	1	B;D;B	0.54047	0.209;0.964;0.131	B;D;B	0.63381	0.021;0.914;0.05	T	0.81558	-0.0878	10	0.08837	T	0.75	.	11.314	0.49381	0.0:0.0726:0.0:0.9274	.	3347;2408;3347	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	S	3347	ENSP00000262189:N3347S;ENSP00000347325:N3347S	ENSP00000262189:N3347S	N	-	2	0	MLL3	151491555	0.076000	0.21285	0.961000	0.40146	0.769000	0.43574	1.087000	0.30865	1.997000	0.58415	0.533000	0.62120	AAT		0.512	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			Missense_Mutation
MED12L	116931	genome.wustl.edu	37	3	151130982	151130982	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:151130982G>T	ENST00000474524.1	+	40	6129	c.6091G>T	c.(6091-6093)Gtg>Ttg	p.V2031L	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2031	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.V2031L(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AATTGATGCTGTGCTGACTTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	3											88.0	81.0	84.0					3																	151130982		2203	4300	6503	152613672	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6091G>T	3.37:g.151130982G>T	ENSP00000417235:p.Val2031Leu	Somatic		Capture	Illumina GAIIx	4	152613672	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	SNP	48	WashU	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504429	0.26949	.	.	ENSG00000144893	ENST00000474524	T	0.57107	0.42	5.61	5.61	0.85477	.	0.557342	0.18927	N	0.127308	T	0.29817	0.0745	N	0.08118	0	0.80722	D	1	B	0.13145	0.007	B	0.10450	0.005	T	0.16660	-1.0395	10	0.09590	T	0.72	-19.2088	11.8258	0.52267	0.0811:0.0:0.9189:0.0	.	2031	Q86YW9	MD12L_HUMAN	L	2031	ENSP00000417235:V2031L	ENSP00000417235:V2031L	V	+	1	0	MED12L	152613672	0.988000	0.35896	0.992000	0.48379	0.968000	0.65278	2.678000	0.46900	2.636000	0.89361	0.655000	0.94253	GTG		0.557	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002		Missense_Mutation
TTN	7273	genome.wustl.edu	37	2	179472248	179472248	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1403-01	TCGA-13-1403-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr2:179472248C>T	ENST00000591111.1	-	227	48468	c.48244G>A	c.(48244-48246)Gtt>Att	p.V16082I	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V15155I|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V8850I|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V8783I|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V17723I|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V8658I			Q8WZ42	TITIN_HUMAN	titin	16082	Ig-like 99.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V8658I(1)|p.V15155I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGTTCCAACGTTGTCTATT	0.433																																																2	Substitution - Missense(2)	ovary(2)	2											426.0	401.0	409.0					2																	179472248		1904	4130	6034	179180493	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48244G>A	2.37:g.179472248C>T	ENSP00000465570:p.Val16082Ile	Somatic		Capture	Illumina GAIIx	4	179180493	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026818	0.35797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.99	5.99	0.97316	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62233	0.2411	L	0.28054	0.825	0.39843	D	0.973136	D;D;D;D	0.54047	0.964;0.964;0.964;0.964	B;B;B;P	0.44860	0.386;0.386;0.386;0.462	T	0.68002	-0.5524	9	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	8658;8783;8850;16082	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	15155;8658;8850;8783;8658	ENSP00000343764:V15155I;ENSP00000434586:V8658I;ENSP00000340554:V8850I;ENSP00000352154:V8783I	ENSP00000340554:V8850I	V	-	1	0	TTN	179180493	1.000000	0.71417	0.976000	0.42696	0.856000	0.48823	5.731000	0.68554	2.840000	0.97914	0.655000	0.94253	GTT		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
CACNA1E	777	genome.wustl.edu	37	1	181767517	181767517	+	Silent	SNP	G	G	T	rs377180948		TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:181767517G>T	ENST00000367573.2	+	48	6489	c.6489G>T	c.(6487-6489)ccG>ccT	p.P2163P	CACNA1E_ENST00000358338.5_Silent_p.P2052P|CACNA1E_ENST00000526775.1_Silent_p.P2101P|CACNA1E_ENST00000367567.4_Silent_p.P1727P|CACNA1E_ENST00000360108.3_Silent_p.P2144P|CACNA1E_ENST00000367570.1_Silent_p.P2120P|CACNA1E_ENST00000357570.5_Silent_p.P2114P	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2163					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.P2120P(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CACCCGTCCCGCCAAAGCCCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1						G	,,	2,3976		0,2,1987	79.0	91.0	87.0		6360,6489,6303	-10.2	0.5	1		87	0,8312		0,0,4156	no	coding-synonymous,coding-synonymous,coding-synonymous	CACNA1E	NM_000721.3,NM_001205293.1,NM_001205294.1	,,	0,2,6143	TT,TG,GG		0.0,0.0503,0.0163	,,	2120/2271,2163/2314,2101/2252	181767517	2,12288	1989	4156	6145	180034140	SO:0001819	synonymous_variant	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6489G>T	1.37:g.181767517G>T		Somatic		Capture	Illumina GAIIx	4	180034140	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	37	CCDS55664.1	SNP	38	WashU																																																																																				0.627	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721		Silent
RAB29	8934	genome.wustl.edu	37	1	205740628	205740628	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:205740628G>A	ENST00000367139.3	-	4	653	c.350C>T	c.(349-351)cCg>cTg	p.P117L	RAB7L1_ENST00000446390.2_Missense_Mutation_p.P93L|RAB7L1_ENST00000468887.1_Intron|RAB7L1_ENST00000414729.1_Missense_Mutation_p.P117L|RAB7L1_ENST00000437324.2_Missense_Mutation_p.P45L|RAB7L1_ENST00000235932.4_Missense_Mutation_p.P117L	NM_003929.2	NP_003920.1	O14966	RAB7L_HUMAN		117					cell differentiation (GO:0030154)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|positive regulation of intracellular protein transport (GO:0090316)|protein transport (GO:0015031)|retrograde transport, plasma membrane to Golgi (GO:0035526)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P117L(2)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	10	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GCAGGGCACCGGCTCTCCATT	0.488																																					Pancreas(25;658 872 27763 34889 38531)											2	Substitution - Missense(2)	ovary(1)|endometrium(1)	1											269.0	259.0	263.0					1																	205740628		2203	4300	6503	204007251	SO:0001583	missense	8934																														ENST00000367139.3:c.350C>T	1.37:g.205740628G>A	ENSP00000356107:p.Pro117Leu	Somatic		Capture	Illumina GAIIx	4	204007251	B4E1K3|C9JE77	Missense_Mutation	SNP	ENST00000367139.3	37	CCDS1459.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	14.36	2.510860	0.44660	.	.	ENSG00000117280	ENST00000367139;ENST00000235932;ENST00000437324;ENST00000446390;ENST00000414729	T;T;T;T;T	0.79749	-1.3;-1.3;-0.45;-1.3;-1.3	5.41	3.53	0.40419	Small GTP-binding protein domain (1);	0.192953	0.45867	N	0.000331	T	0.72558	0.3475	L	0.39898	1.24	0.38966	D	0.958646	P;P	0.43662	0.814;0.717	B;B	0.37888	0.162;0.26	T	0.71623	-0.4537	10	0.51188	T	0.08	-9.7494	14.2633	0.66099	0.1025:0.0:0.8975:0.0	.	93;117	B4E1K3;O14966	.;RAB7L_HUMAN	L	117;117;45;93;117	ENSP00000356107:P117L;ENSP00000235932:P117L;ENSP00000416613:P45L;ENSP00000389899:P93L;ENSP00000402910:P117L	ENSP00000235932:P117L	P	-	2	0	RAB7L1	204007251	1.000000	0.71417	0.244000	0.24202	0.886000	0.51366	4.247000	0.58750	0.269000	0.21961	-1.628000	0.00784	CCG		0.488	RAB7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087732.1			Missense_Mutation
ADAMTSL4	54507	genome.wustl.edu	37	1	150528034	150528034	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:150528034G>A	ENST00000369038.2	+	6	1565	c.1364G>A	c.(1363-1365)cGc>cAc	p.R455H	RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.R455H|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.R455H|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.R478H			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	455					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.R455H(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GTGGCTGGACGCTGTCTGGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	73.0	76.0					1																	150528034		2203	4300	6503	148794658	SO:0001583	missense	54507			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1364G>A	1.37:g.150528034G>A	ENSP00000358034:p.Arg455His	Somatic		Capture	Illumina GAIIx	PhaseIII	148794658	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	SNP	38	WashU	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525224	0.44969	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.70164	0.04;0.04;-0.46;0.04	4.69	1.78	0.24846	.	.	.	.	.	T	0.36468	0.0968	L	0.48642	1.525	0.49798	D	0.999823	B;B;B;B	0.28667	0.171;0.069;0.14;0.219	B;B;B;B	0.21360	0.021;0.022;0.015;0.034	T	0.22730	-1.0208	9	0.51188	T	0.08	.	6.8714	0.24123	0.3773:0.0:0.6227:0.0	.	478;478;455;455	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	H	455;455;478;455	ENSP00000358037:R455H;ENSP00000271643:R455H;ENSP00000358035:R478H;ENSP00000358034:R455H	ENSP00000271643:R455H	R	+	2	0	ADAMTSL4	148794658	0.961000	0.32948	0.998000	0.56505	0.969000	0.65631	0.685000	0.25378	0.203000	0.20529	-0.258000	0.10820	CGC		0.547	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032		Missense_Mutation
CENPF	1063	genome.wustl.edu	37	1	214795474	214795474	+	Silent	SNP	A	A	G			TCGA-13-1403-01	TCGA-13-1403-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr1:214795474A>G	ENST00000366955.3	+	7	1086	c.918A>G	c.(916-918)aaA>aaG	p.K306K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.K306K(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GACATGAAAAAGAAATGAAAG	0.343																																					Colon(80;575 1284 11000 14801 43496)											1	Substitution - coding silent(1)	ovary(1)	1											102.0	106.0	105.0					1																	214795474		2203	4300	6503	212862097	SO:0001819	synonymous_variant	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.918A>G	1.37:g.214795474A>G		Somatic		Capture	Illumina GAIIx	4	212862097	Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	CCDS31023.1	SNP	3	WashU																																																																																				0.343	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		Silent
Unknown	0	genome.wustl.edu	37	18	15271452	15271452	+	IGR	SNP	G	G	A			TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr18:15271452G>A								RP11-454P7.3 (73724 upstream) : AP005901.1 (42102 downstream)														p.K413K(1)									CTATACAAAAGAGAATTCATA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	18																																								15261452	SO:0001628	intergenic_variant																																18.37:g.15271452G>A		Somatic		Capture	Illumina GAIIx	4	15261452		Silent	SNP		37		SNP	33	WashU																																																																																			0	0.378									Silent
MORC1	27136	genome.wustl.edu	37	3	108773723	108773723	+	Silent	SNP	G	G	A	rs7631480	byFrequency	TCGA-13-1403-01	TCGA-13-1403-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr3:108773723G>A	ENST00000483760.1	-	14	1225	c.1182C>T	c.(1180-1182)ggC>ggT	p.G394G	MORC1_ENST00000232603.5_Silent_p.G394G					MORC family CW-type zinc finger 1									p.G394G(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CCACGCCTGCGCCAAGTCTGA	0.303													g|||	11	0.00219649	0.0076	0.0	5008	,	,		16447	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						A		34,4372	38.4+/-70.7	0,34,2169	73.0	70.0	71.0		1182	-6.0	0.6	3	dbSNP_116	71	0,8600		0,0,4300	no	coding-synonymous	MORC1	NM_014429.3		0,34,6469	AA,AG,GG		0.0,0.7717,0.2614		394/985	108773723	34,12972	2203	4300	6503	110256413	SO:0001819	synonymous_variant	27136			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1182C>T	3.37:g.108773723G>A		Somatic		Capture	Illumina GAIIx	PhaseIII	110256413		Silent	SNP	ENST00000483760.1	37		SNP	38	WashU																																																																																				0.303	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1			Silent
PDE6C	5146	genome.wustl.edu	37	10	95385364	95385369	+	In_Frame_Del	DEL	AGAAGT	AGAAGT	-			TCGA-13-1403-01	TCGA-13-1403-10	AGAAGT	AGAAGT	AGAAGT	-	AGAAGT	AGAAGT	Unknown	Valid	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	TCGA-13-1403-01	TCGA-13-1403-10	g.chr10:95385364_95385369delAGAAGT	ENST00000371447.3	+	5	1035_1040	c.897_902delAGAAGT	c.(895-903)ggagaagta>gga	p.EV300del		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	300	GAF 2.				phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)	p.V301_E302del(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	TCAAGCTTGGAGAAGTAGAGCCTTAT	0.417																																																1	Deletion - In frame(1)	ovary(1)	10																																								95375359	SO:0001651	inframe_deletion	5146			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.897_902delAGAAGT	10.37:g.95385364_95385369delAGAAGT	ENSP00000360502:p.Glu300_Val301del	Somatic		Capture	Illumina GAIIx	PhaseIII	95375354	A6NCR6|Q5VY29	In_Frame_Del	DEL	ENST00000371447.3	37	CCDS7429.1	DEL	11	WashU																																																																																				0.417	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204		In_Frame_Del
