#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
OLFML1	283298	genome.wustl.edu	37	11	7530967	7530967	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr11:7530967C>G	ENST00000329293.3	+	3	1151	c.757C>G	c.(757-759)Cca>Gca	p.P253A	OLFML1_ENST00000530135.1_Missense_Mutation_p.P253A|OLFML1_ENST00000528758.1_3'UTR|CTD-2516F10.2_ENST00000530201.1_RNA	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	253	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)		p.P253A(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AATGCTGCTCCCAGGAGGGGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											50.0	48.0	48.0					11																	7530967		2201	4296	6497	7487543	SO:0001583	missense	283298			AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.757C>G	11.37:g.7530967C>G	ENSP00000332511:p.Pro253Ala	Somatic		Capture	Illumina GAIIx	4	7487543	B4DP03|Q569G4	Missense_Mutation	SNP	ENST00000329293.3	37	CCDS7779.1	SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	13.14	2.147314	0.37923	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	D;D	0.89485	-2.52;-2.52	5.66	2.77	0.32553	Olfactomedin-like (3);	0.422169	0.25436	N	0.030694	D	0.84906	0.5576	L	0.44542	1.39	0.80722	D	1	B;P	0.36683	0.045;0.565	B;B	0.40825	0.035;0.341	T	0.80979	-0.1140	10	0.66056	D	0.02	.	8.4126	0.32653	0.0:0.7364:0.0:0.2636	.	117;253	B4DN61;Q6UWY5	.;OLFL1_HUMAN	A	253	ENSP00000433455:P253A;ENSP00000332511:P253A	ENSP00000332511:P253A	P	+	1	0	OLFML1	7487543	0.999000	0.42202	0.784000	0.31847	0.900000	0.52787	2.964000	0.49192	0.320000	0.23234	-0.253000	0.11424	CCA		0.483	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474		Missense_Mutation
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	17	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	7518988	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*	Somatic		Capture	Illumina GAIIx	4	7518988	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	39	WashU	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Nonsense_Mutation
MYO1D	4642	genome.wustl.edu	37	17	31082586	31082586	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr17:31082586C>A	ENST00000318217.5	-	11	1695	c.1391G>T	c.(1390-1392)gGc>gTc	p.G464V	MYO1D_ENST00000579584.1_Missense_Mutation_p.G464V|MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000394649.4_Missense_Mutation_p.G376V	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	464	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.G464V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GGTGACTTTGCCGACATTCAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	17											143.0	117.0	126.0					17																	31082586		2203	4300	6503	28106699	SO:0001583	missense	4642			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1391G>T	17.37:g.31082586C>A	ENSP00000324527:p.Gly464Val	Somatic		Capture	Illumina GAIIx	4	28106699	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	37	CCDS32615.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918828	0.92249	.	.	ENSG00000176658	ENST00000318217	D	0.87256	-2.23	6.17	6.17	0.99709	Myosin head, motor domain (2);	0.000000	0.40302	U	0.001130	D	0.95598	0.8569	H	0.94345	3.525	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.995	D	0.96018	0.9007	10	0.87932	D	0	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	375;464	Q7Z3N6;O94832	.;MYO1D_HUMAN	V	464	ENSP00000324527:G464V	ENSP00000324527:G464V	G	-	2	0	MYO1D	28106699	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGC		0.418	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1			Missense_Mutation
DEPDC5	9681	genome.wustl.edu	37	22	32253446	32253446	+	Silent	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr22:32253446G>A	ENST00000382112.3	+	31	3214	c.3144G>A	c.(3142-3144)caG>caA	p.Q1048Q	DEPDC5_ENST00000382105.2_Silent_p.Q979Q|DEPDC5_ENST00000539165.1_5'UTR|DEPDC5_ENST00000400249.2_Silent_p.Q1048Q|DEPDC5_ENST00000266091.3_Silent_p.Q1057Q|DEPDC5_ENST00000494060.1_3'UTR|DEPDC5_ENST00000535622.1_Silent_p.Q979Q|DEPDC5_ENST00000382111.2_Silent_p.Q1057Q|DEPDC5_ENST00000400246.1_Silent_p.Q1057Q|DEPDC5_ENST00000400248.2_Silent_p.Q1048Q	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1057					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.Q1048Q(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TGGGAGAACAGCAGGCAGCTG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	22											32.0	34.0	33.0					22																	32253446		2116	4256	6372	30583446	SO:0001819	synonymous_variant	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.3144G>A	22.37:g.32253446G>A		Somatic		Capture	Illumina GAIIx	4	30583446	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	ENST00000382112.3	37	CCDS46692.1	SNP	34	WashU	.	.	.	.	.	.	.	.	.	.	G	8.974	0.973787	0.18736	.	.	ENSG00000100150	ENST00000433147	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.74107	0.3673	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72769	-0.4193	4	.	.	.	.	17.8169	0.88637	0.0:0.0:1.0:0.0	.	.	.	.	T	455	.	.	A	+	1	0	DEPDC5	30583446	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.437000	0.66544	2.618000	0.88619	0.563000	0.77884	GCA		0.582	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		Silent
TNXB	7148	genome.wustl.edu	37	6	32035624	32035624	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr6:32035624C>A	ENST00000375244.3	-	18	6559	c.6358G>T	c.(6358-6360)Ggc>Tgc	p.G2120C	TNXB_ENST00000375247.2_Missense_Mutation_p.G2120C			P22105	TENX_HUMAN	tenascin XB	2192	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.G2207C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCGAAGCGGCCCTGGGGGACG	0.687																																																1	Substitution - Missense(1)	ovary(1)	6																																								32143602	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6358G>T	6.37:g.32035624C>A	ENSP00000364393:p.Gly2120Cys	Somatic		Capture	Illumina GAIIx	4	32143602	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		SNP	22	WashU	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029589	0.75504	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.07908	3.15;3.15	4.58	4.58	0.56647	.	0.000000	0.41938	D	0.000799	T	0.29321	0.0730	M	0.93420	3.415	0.34968	D	0.752839	D	0.89917	1.0	D	0.97110	1.0	T	0.48445	-0.9035	10	0.66056	D	0.02	.	14.2806	0.66208	0.0:1.0:0.0:0.0	.	2120	P22105-3	.	C	2120	ENSP00000364393:G2120C;ENSP00000364396:G2120C	ENSP00000364393:G2120C	G	-	1	0	TNXB	32143602	0.978000	0.34361	1.000000	0.80357	0.992000	0.81027	4.806000	0.62569	2.077000	0.62373	0.462000	0.41574	GGC		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105		Missense_Mutation
CAPRIN1	4076	genome.wustl.edu	37	11	34098146	34098146	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr11:34098146G>T	ENST00000341394.4	+	6	834	c.645G>T	c.(643-645)tgG>tgT	p.W215C	CAPRIN1_ENST00000530820.1_Missense_Mutation_p.W215C|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.W215C|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.W215C|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.W134C	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	215					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.W215C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TTCACCTGTGGGACCTGCTGG	0.343																																																1	Substitution - Missense(1)	ovary(1)	11											87.0	92.0	90.0					11																	34098146		2202	4298	6500	34054722	SO:0001583	missense	4076			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.645G>T	11.37:g.34098146G>T	ENSP00000340329:p.Trp215Cys	Somatic		Capture	Illumina GAIIx	4	34054722	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589010	0.86851	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.56093	0.1962	M	0.80847	2.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.971;0.987	T	0.54159	-0.8335	10	0.45353	T	0.12	.	19.9859	0.97351	0.0:0.0:1.0:0.0	.	215;215	Q14444;Q14444-2	CAPR1_HUMAN;.	C	215;215;215;215;134	ENSP00000340329:W215C;ENSP00000374296:W215C;ENSP00000434150:W215C;ENSP00000434204:W215C;ENSP00000431581:W134C	ENSP00000340329:W215C	W	+	3	0	CAPRIN1	34054722	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.366000	0.97143	2.729000	0.93468	0.655000	0.94253	TGG		0.343	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898		Missense_Mutation
FSCB	84075	genome.wustl.edu	37	14	44974063	44974063	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr14:44974063C>G	ENST00000340446.4	-	1	2419	c.2128G>C	c.(2128-2130)Gaa>Caa	p.E710Q	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	710						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.E710Q(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GAGGCCTCTTCTGCAGGGACA	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											44.0	49.0	47.0					14																	44974063		2203	4300	6503	44043813	SO:0001583	missense	84075			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2128G>C	14.37:g.44974063C>G	ENSP00000344579:p.Glu710Gln	Somatic		Capture	Illumina GAIIx	4	44043813	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	CCDS9679.1	SNP	32	WashU	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405742	0.42715	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.15139	2.45	4.62	0.486	0.16836	.	.	.	.	.	T	0.27489	0.0675	L	0.61218	1.895	0.09310	N	1	D	0.65815	0.995	P	0.61592	0.891	T	0.12167	-1.0558	9	0.33940	T	0.23	-1.4674	3.8412	0.08915	0.1602:0.4799:0.0:0.3599	.	710	Q5H9T9	FSCB_HUMAN	Q	710;603	ENSP00000344579:E710Q	ENSP00000344579:E710Q	E	-	1	0	FSCB	44043813	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.752000	0.26362	-0.007000	0.14345	0.555000	0.69702	GAA		0.537	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		Missense_Mutation
AGAP4	119016	genome.wustl.edu	37	10	46321476	46321476	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr10:46321476C>T	ENST00000448048.2	-	7	2004	c.1879G>A	c.(1879-1881)Gtc>Atc	p.V627I	AGAP4_ENST00000430779.2_5'Flank	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	627					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.V627I(1)		central_nervous_system(1)|lung(1)|ovary(1)	3						CGGGCCATGACGTCCACCCCG	0.672																																																1	Substitution - Missense(1)	ovary(1)	10											1.0	1.0	1.0					10																	46321476		214	382	596	45641482	SO:0001583	missense	119016			AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.1879G>A	10.37:g.46321476C>T	ENSP00000392513:p.Val627Ile	Somatic		Capture	Illumina GAIIx	4	45641482		Missense_Mutation	SNP	ENST00000448048.2	37	CCDS7215.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	c	2.318	-0.356320	0.05138	.	.	ENSG00000188234	ENST00000448048;ENST00000342551	T	0.65916	-0.18	.	.	.	Ankyrin repeat-containing domain (4);	0.223555	0.38436	N	0.001698	T	0.39306	0.1073	N	0.17922	0.545	0.24802	N	0.992697	B;B	0.12630	0.006;0.003	B;B	0.16289	0.015;0.01	T	0.15263	-1.0443	9	0.33141	T	0.24	.	5.89	0.18904	0.0:0.9992:0.0:8.0E-4	.	650;627	C9JRW4;Q96P64	.;AGAP4_HUMAN	I	627;403	ENSP00000392513:V627I	ENSP00000343438:V403I	V	-	1	0	AGAP4	45641482	0.956000	0.32656	0.271000	0.24616	0.274000	0.26718	0.179000	0.16840	0.107000	0.17824	0.109000	0.15622	GTC		0.672	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047799.1	NM_133446		Missense_Mutation
NIN	51199	genome.wustl.edu	37	14	51221340	51221340	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr14:51221340C>T	ENST00000382041.3	-	20	4865	c.4675G>A	c.(4675-4677)Gaa>Aaa	p.E1559K	NIN_ENST00000389868.3_Missense_Mutation_p.E846K|NIN_ENST00000324330.9_Missense_Mutation_p.E1559K|NIN_ENST00000245441.5_Missense_Mutation_p.E1559K|NIN_ENST00000530997.2_Missense_Mutation_p.E1559K|NIN_ENST00000382043.4_Missense_Mutation_p.E846K|NIN_ENST00000453196.1_Missense_Mutation_p.E1559K	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1559					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)	p.E1565K(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TTTACAGTTTCCGTTTTTTGC	0.279			T	PDGFRB	MPD																																		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	1	Substitution - Missense(1)	ovary(1)	14											70.0	67.0	68.0					14																	51221340		2198	4295	6493	50291090	SO:0001583	missense	51199			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4675G>A	14.37:g.51221340C>T	ENSP00000371472:p.Glu1559Lys	Somatic		Capture	Illumina GAIIx	4	50291090	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	SNP	30	WashU	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.60|15.60	2.881229|2.881229	0.51801|0.51801	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196|ENST00000530997;ENST00000389869;ENST00000530853	T;T;T;T;T;T|.	0.22945|.	2.87;1.93;1.96;2.58;2.55;2.58|.	4.77|4.77	4.77|4.77	0.60923|0.60923	.|.	0.119645|.	0.56097|.	D|.	0.000028|.	T|T	0.69187|0.69187	0.3083|0.3083	M|M	0.66939|0.66939	2.045|2.045	0.35047|0.35047	D|D	0.760274|0.760274	D;D;P;D;P|.	0.69078|.	0.983;0.983;0.882;0.997;0.882|.	P;P;P;P;P|.	0.60789|.	0.879;0.879;0.6;0.779;0.6|.	T|T	0.76512|0.76512	-0.2932|-0.2932	10|5	0.38643|.	T|.	0.18|.	-14.6585|-14.6585	16.7287|16.7287	0.85430|0.85430	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1565;1559;1559;846;1559|.	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7|.	.;.;NIN_HUMAN;.;.|.	K|E	1559;1542;846;846;1565;1559;1559;1559|1049	ENSP00000245441:E1559K;ENSP00000374518:E846K;ENSP00000371474:E846K;ENSP00000371472:E1559K;ENSP00000324210:E1559K;ENSP00000412391:E1559K|.	ENSP00000245441:E1559K|.	E|G	-|-	1|2	0|0	NIN|NIN	50291090|50291090	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.583000|0.583000	0.36354|0.36354	3.849000|3.849000	0.55910|0.55910	2.364000|2.364000	0.80123|0.80123	0.563000|0.563000	0.77884|0.77884	GAA|GGA		0.279	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		Missense_Mutation
EML2	24139	genome.wustl.edu	37	19	46116930	46116930	+	Splice_Site	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr19:46116930C>T	ENST00000245925.3	-	18	1744		c.e18-1		EML2_ENST00000536630.1_Splice_Site|EML2_ENST00000587152.1_Splice_Site|EML2_ENST00000589876.1_Splice_Site	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2						negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.?(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GACCAGATCCCTGTGGGCAAG	0.552																																																1	Unknown(1)	ovary(1)	19											95.0	80.0	85.0					19																	46116930		2203	4300	6503	50808770	SO:0001630	splice_region_variant	24139			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1694-1G>A	19.37:g.46116930C>T		Somatic		Capture	Illumina GAIIx	4	50808770	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Splice_Site_SNP	SNP	ENST00000245925.3	37	CCDS12670.1	SNP	24	WashU	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758273	0.31137	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8917	0.70614	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EML2	50808770	1.000000	0.71417	0.997000	0.53966	0.098000	0.18820	7.251000	0.78297	2.653000	0.90120	0.563000	0.77884	.		0.552	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	Intron	Splice_Site_SNP
ZCCHC11	23318	genome.wustl.edu	37	1	52941173	52941173	+	Silent	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:52941173G>A	ENST00000371544.3	-	13	2320	c.2058C>T	c.(2056-2058)agC>agT	p.S686S	ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Silent_p.S686S	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	686					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.S686S(1)		NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GGCTGTTTAAGCTCCGTGCAA	0.408																																																1	Substitution - coding silent(1)	ovary(1)	1											39.0	36.0	37.0					1																	52941173		2203	4300	6503	52713761	SO:0001819	synonymous_variant	23318			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.2058C>T	1.37:g.52941173G>A		Somatic		Capture	Illumina GAIIx	4	52713761	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Silent	SNP	ENST00000371544.3	37	CCDS30716.1	SNP	34	WashU																																																																																				0.408	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		Silent
SCFD2	152579	genome.wustl.edu	37	4	54231616	54231616	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr4:54231616G>A	ENST00000401642.3	-	1	626	c.493C>T	c.(493-495)Ccc>Tcc	p.P165S	SCFD2_ENST00000388940.4_Missense_Mutation_p.P165S	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	165					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)			p.P165S(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GCAAAGTGGGGAGCAACAGGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	4											86.0	73.0	78.0					4																	54231616		2203	4300	6503	53926373	SO:0001583	missense	152579			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.493C>T	4.37:g.54231616G>A	ENSP00000384182:p.Pro165Ser	Somatic		Capture	Illumina GAIIx	4	53926373	Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	SNP	41	WashU	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.811012	0.00600	.	.	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.43688	0.94;0.94	5.51	2.82	0.32997	.	0.250201	0.40554	N	0.001076	T	0.22820	0.0551	N	0.22421	0.69	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.003	T	0.25187	-1.0139	10	0.08837	T	0.75	.	7.3028	0.26430	0.1591:0.1517:0.6892:0.0	.	165;165	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	S	165	ENSP00000384182:P165S;ENSP00000373592:P165S	ENSP00000373592:P165S	P	-	1	0	SCFD2	53926373	0.998000	0.40836	0.048000	0.18961	0.323000	0.28346	2.709000	0.47160	0.412000	0.25729	0.561000	0.74099	CCC		0.562	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540		Missense_Mutation
GPR75	10936	genome.wustl.edu	37	2	54080567	54080567	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr2:54080567C>A	ENST00000394705.2	-	2	1597	c.1327G>T	c.(1327-1329)Gac>Tac	p.D443Y	ASB3_ENST00000406625.2_Intron|ASB3_ENST00000498475.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	443					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)	p.D443Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CAAGCCTGGTCCACAAATTTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											119.0	113.0	115.0					2																	54080567		2203	4300	6503	53934071	SO:0001583	missense	10936			AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1327G>T	2.37:g.54080567C>A	ENSP00000378195:p.Asp443Tyr	Somatic		Capture	Illumina GAIIx	4	53934071	B2RC02|Q6NWR2	Missense_Mutation	SNP	ENST00000394705.2	37	CCDS1849.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685480	0.68157	.	.	ENSG00000119737	ENST00000394705	T	0.37584	1.19	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.66337	-0.5949	9	0.87932	D	0	-16.6563	18.82	0.92092	0.0:1.0:0.0:0.0	.	443	O95800	GPR75_HUMAN	Y	443	ENSP00000378195:D443Y	ENSP00000378195:D443Y	D	-	1	0	GPR75	53934071	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.189000	0.77747	2.756000	0.94617	0.561000	0.74099	GAC		0.468	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2			Missense_Mutation
SIGLEC11	114132	genome.wustl.edu	37	19	50461973	50461973	+	Silent	SNP	G	G	A	rs201076601		TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr19:50461973G>A	ENST00000447370.2	-	7	1380	c.1290C>T	c.(1288-1290)caC>caT	p.H430H	SIGLEC11_ENST00000426971.2_Silent_p.H430H|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	430	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.H418H(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		ACTCTCCTTCGTGCTCCATTT	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		15349	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19											71.0	69.0	69.0					19																	50461973		2203	4300	6503	55153785	SO:0001819	synonymous_variant	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1290C>T	19.37:g.50461973G>A		Somatic		Capture	Illumina GAIIx	4	55153785		Silent	SNP	ENST00000447370.2	37	CCDS12790.2	SNP	40	WashU	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	0.784	-0.761104	0.02996	.	.	ENSG00000161640	ENST00000426971	.	.	.	3.1	-6.2	0.02072	.	.	.	.	.	T	0.17746	0.0426	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.05321	-1.0892	4	.	.	.	.	1.7087	0.02888	0.2173:0.1032:0.372:0.3075	.	.	.	.	M	420	.	.	T	-	2	0	SIGLEC11	55153785	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-2.290000	0.01148	-5.374000	0.00015	-2.985000	0.00079	ACG		0.672	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		Silent
OR8H3	390152	genome.wustl.edu	37	11	55890368	55890368	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1405-01	TCGA-13-1405-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr11:55890368A>T	ENST00000313472.3	+	1	520	c.520A>T	c.(520-522)Att>Ttt	p.I174F		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I174F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					CTCAAACATAATTCATCACTT	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											252.0	225.0	234.0					11																	55890368		2201	4296	6497	55646944	SO:0001583	missense	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.520A>T	11.37:g.55890368A>T	ENSP00000323928:p.Ile174Phe	Somatic		Capture	Illumina GAIIx	4	55646944	Q6IFB7	Missense_Mutation	SNP	ENST00000313472.3	37	CCDS31519.1	SNP	4	WashU	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683733	0.29872	.	.	ENSG00000181761	ENST00000313472	T	0.00216	8.53	3.62	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.131866	0.36200	N	0.002737	T	0.00754	0.0025	H	0.97491	4.015	0.09310	N	0.999996	D	0.54397	0.966	D	0.66979	0.948	T	0.28808	-1.0032	10	0.87932	D	0	.	7.5883	0.28006	0.7341:0.0:0.2659:0.0	.	174	Q8N146	OR8H3_HUMAN	F	174	ENSP00000323928:I174F	ENSP00000323928:I174F	I	+	1	0	OR8H3	55646944	0.287000	0.24315	0.033000	0.17914	0.377000	0.30045	0.993000	0.29680	0.411000	0.25702	0.145000	0.16022	ATT		0.438	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391541.1	NM_001005201		Missense_Mutation
KIR2DL3	3804	genome.wustl.edu	37	19	55255434	55255434	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr19:55255434G>A	ENST00000342376.3	+	4	593	c.562G>A	c.(562-564)Ggc>Agc	p.G188S	KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000538269.1_Intron|KIR2DL3_ENST00000434419.2_Missense_Mutation_p.G188S|KIR3DL1_ENST00000402254.2_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	188	Ig-like C2-type 2.				immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.G188S(1)		breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CTTTCCTCTGGGCCCTGCCAC	0.562																																																1	Substitution - Missense(1)	ovary(1)	19											6.0	7.0	7.0					19																	55255434		877	1917	2794	59947246	SO:0001583	missense	3804			L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.562G>A	19.37:g.55255434G>A	ENSP00000342215:p.Gly188Ser	Somatic		Capture	Illumina GAIIx	4	59947246	O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	ENST00000342376.3	37	CCDS33107.1	SNP	43	WashU	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323151	0.41096	.	.	ENSG00000243772	ENST00000342376;ENST00000434419	T;T	0.12039	2.72;2.72	1.01	-2.01	0.07410	Immunoglobulin subtype (2);Immunoglobulin (2);Immunoglobulin-like fold (2);	.	.	.	.	T	0.21962	0.0529	L	0.46670	1.46	0.09310	N	1	B;B;D;D	0.60160	0.174;0.296;0.987;0.987	B;P;D;D	0.65573	0.203;0.486;0.936;0.936	T	0.13045	-1.0524	9	0.87932	D	0	.	4.7498	0.13056	0.5001:0.0:0.4999:0.0	.	188;188;188;188	E3NZD7;P43627;P43628;E3NZD8	.;KI2L2_HUMAN;KI2L3_HUMAN;.	S	188	ENSP00000342215:G188S;ENSP00000415758:G188S	ENSP00000342215:G188S	G	+	1	0	KIR2DL3	59947246	0.000000	0.05858	0.001000	0.08648	0.097000	0.18754	-0.019000	0.12546	-0.848000	0.04163	0.184000	0.17185	GGC		0.562	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141150.1			Missense_Mutation
SYNE2	23224	genome.wustl.edu	37	14	64457275	64457275	+	Silent	SNP	A	A	G			TCGA-13-1405-01	TCGA-13-1405-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr14:64457275A>G	ENST00000344113.4	+	20	2672	c.2460A>G	c.(2458-2460)aaA>aaG	p.K820K	SYNE2_ENST00000554584.1_Silent_p.K820K|SYNE2_ENST00000358025.3_Silent_p.K820K|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	820					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.K820K(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGAAGCTAAAGAGAAAGTCC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	14											90.0	87.0	88.0					14																	64457275		1830	4085	5915	63527028	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2460A>G	14.37:g.64457275A>G		Somatic		Capture	Illumina GAIIx	4	63527028	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1	SNP	3	WashU																																																																																				0.413	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		Silent
SF3B3	23450	genome.wustl.edu	37	16	70575628	70575628	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr16:70575628C>T	ENST00000302516.5	+	9	1335	c.1124C>T	c.(1123-1125)tCa>tTa	p.S375L		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	375					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.S375L(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GAGTTTTCATCAGCCATGCCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	16											206.0	202.0	203.0					16																	70575628		2198	4300	6498	69133129	SO:0001583	missense	23450			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.1124C>T	16.37:g.70575628C>T	ENSP00000305790:p.Ser375Leu	Somatic		Capture	Illumina GAIIx	4	69133129	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	35	5.442068	0.96187	.	.	ENSG00000189091	ENST00000302516	T	0.37058	1.22	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.71745	0.3376	H	0.94503	3.545	0.80722	D	1	D	0.67145	0.996	D	0.72338	0.977	T	0.78597	-0.2142	10	0.52906	T	0.07	.	19.6425	0.95763	0.0:1.0:0.0:0.0	.	375	Q15393	SF3B3_HUMAN	L	375	ENSP00000305790:S375L	ENSP00000305790:S375L	S	+	2	0	SF3B3	69133129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.726000	0.84824	2.713000	0.92767	0.655000	0.94253	TCA		0.433	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		Missense_Mutation
GBP1	2633	genome.wustl.edu	37	1	89522551	89522551	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:89522551G>A	ENST00000370473.4	-	7	1360	c.1141C>T	c.(1141-1143)Caa>Taa	p.Q381*	GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	381					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.Q381*(1)		endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AACTCCTTTTGAAATAGATGG	0.418																																																1	Substitution - Nonsense(1)	ovary(1)	1											91.0	95.0	94.0					1																	89522551		2202	4300	6502	89295139	SO:0001587	stop_gained	2633			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1141C>T	1.37:g.89522551G>A	ENSP00000359504:p.Gln381*	Somatic		Capture	Illumina GAIIx	4	89295139	D3DT26|Q5T8M1	Nonsense_Mutation	SNP	ENST00000370473.4	37	CCDS718.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	39	7.444244	0.98289	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	.	.	.	4.8	2.85	0.33270	.	0.136177	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	11.6004	0.50999	0.0:0.0:0.6779:0.3221	.	.	.	.	X	381;344	.	ENSP00000359504:Q381X	Q	-	1	0	GBP1	89295139	0.955000	0.32602	0.047000	0.18901	0.409000	0.31022	3.866000	0.56040	0.391000	0.25143	0.491000	0.48974	CAA		0.418	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3	NM_002053		Nonsense_Mutation
EPHA3	2042	genome.wustl.edu	37	3	89259500	89259500	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr3:89259500C>T	ENST00000336596.2	+	3	869	c.644C>T	c.(643-645)aCg>aTg	p.T215M	EPHA3_ENST00000452448.2_Missense_Mutation_p.T215M|EPHA3_ENST00000494014.1_Missense_Mutation_p.T215M	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	215	Cys-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.T215M(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TTTCCAGACACGGTACCCATG	0.473										TSP Lung(6;0.00050)																																						1	Substitution - Missense(1)	ovary(1)	3											136.0	131.0	133.0					3																	89259500		2203	4300	6503	89342190	SO:0001583	missense	2042			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.644C>T	3.37:g.89259500C>T	ENSP00000337451:p.Thr215Met	Somatic		Capture	Illumina GAIIx	4	89342190	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	SNP	19	WashU	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523630	0.85600	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.78126	-1.15;2.24;-1.14	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.92097	0.7495	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.993;1.0	D	0.93335	0.6704	9	.	.	.	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	215;215	P29320;P29320-2	EPHA3_HUMAN;.	M	215	ENSP00000337451:T215M;ENSP00000399926:T215M;ENSP00000419190:T215M	.	T	+	2	0	EPHA3	89342190	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.798000	0.96311	0.655000	0.94253	ACG		0.473	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		Missense_Mutation
AGL	178	genome.wustl.edu	37	1	100349684	100349684	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:100349684G>A	ENST00000294724.4	+	18	2795	c.2317G>A	c.(2317-2319)Gaa>Aaa	p.E773K	AGL_ENST00000361302.3_Missense_Mutation_p.E757K|AGL_ENST00000370165.3_Missense_Mutation_p.E773K|AGL_ENST00000361522.4_Missense_Mutation_p.E756K|AGL_ENST00000370163.3_Missense_Mutation_p.E773K|AGL_ENST00000361915.3_Missense_Mutation_p.E773K|AGL_ENST00000370161.2_Missense_Mutation_p.E757K	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	773					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.E773K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		AGGCAAAATTGAAGAAGTAGT	0.308																																																1	Substitution - Missense(1)	ovary(1)	1											76.0	82.0	80.0					1																	100349684		2203	4297	6500	100122272	SO:0001583	missense	178			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2317G>A	1.37:g.100349684G>A	ENSP00000294724:p.Glu773Lys	Somatic		Capture	Illumina GAIIx	4	100122272	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	SNP	45	WashU	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367703	0.61513	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.14356	0.0347	L	0.40543	1.245	0.80722	D	1	B;B;B	0.21381	0.055;0.055;0.032	B;B;B	0.21917	0.037;0.037;0.027	T	0.10613	-1.0622	10	0.08179	T	0.78	.	20.0425	0.97596	0.0:0.0:1.0:0.0	.	756;757;773	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	K	773;773;773;773;757;757;756	ENSP00000355106:E773K;ENSP00000359184:E773K;ENSP00000359182:E773K;ENSP00000294724:E773K;ENSP00000354971:E757K;ENSP00000359180:E757K;ENSP00000354635:E756K	ENSP00000294724:E773K	E	+	1	0	AGL	100122272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.135000	0.94478	2.745000	0.94114	0.650000	0.86243	GAA		0.308	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028		Missense_Mutation
CENPE	1062	genome.wustl.edu	37	4	104037760	104037760	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr4:104037760C>T	ENST00000265148.3	-	45	7505	c.7416G>A	c.(7414-7416)atG>atA	p.M2472I	CENPE_ENST00000380026.3_Missense_Mutation_p.M2351I	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2472	Kinetochore-binding domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.M2435I(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGGCATTTTTCATTTTCTCTA	0.264																																																1	Substitution - Missense(1)	ovary(1)	4											59.0	59.0	59.0					4																	104037760		2201	4293	6494	104257209	SO:0001583	missense	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7416G>A	4.37:g.104037760C>T	ENSP00000265148:p.Met2472Ile	Somatic		Capture	Illumina GAIIx	4	104257209	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	SNP	29	WashU	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844399	0.32606	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.66638	-0.22;-0.21	5.2	3.44	0.39384	.	.	.	.	.	T	0.44664	0.1304	N	0.19112	0.55	0.20489	N	0.999893	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.28170	-1.0052	9	0.08837	T	0.75	.	6.3892	0.21577	0.1927:0.7136:0.0:0.0937	.	2351;2472	Q02224-3;Q02224	.;CENPE_HUMAN	I	2472;2351	ENSP00000265148:M2472I;ENSP00000369365:M2351I	ENSP00000265148:M2472I	M	-	3	0	CENPE	104257209	0.696000	0.27757	0.156000	0.22583	0.995000	0.86356	2.492000	0.45311	0.551000	0.29008	0.655000	0.94253	ATG		0.264	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
COL4A6	1288	genome.wustl.edu	37	X	107417827	107417827	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chrX:107417827G>T	ENST00000372216.4	-	31	3084	c.2984C>A	c.(2983-2985)cCt>cAt	p.P995H	COL4A6_ENST00000538570.1_Missense_Mutation_p.P994H|COL4A6_ENST00000334504.7_Missense_Mutation_p.P994H|COL4A6_ENST00000394872.2_Missense_Mutation_p.P995H|COL4A6_ENST00000545689.1_Missense_Mutation_p.P994H	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	995	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P994H(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TGGTGGTCCAGGTCGACCAGC	0.537									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - Missense(1)	ovary(1)	X											24.0	26.0	25.0					X																	107417827		2202	4299	6501	107304483	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2984C>A	X.37:g.107417827G>T	ENSP00000361290:p.Pro995His	Somatic		Capture	Illumina GAIIx	4	107304483	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	SNP	35	WashU	.	.	.	.	.	.	.	.	.	.	G	2.440	-0.328832	0.05314	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.96967	-3.75;-3.75;-4.19;-4.19;-4.19	5.03	3.23	0.37069	.	0.746506	0.11546	N	0.553265	D	0.95001	0.8382	M	0.75615	2.305	0.28058	N	0.933073	B;B;B;B	0.27498	0.148;0.148;0.106;0.18	B;B;B;B	0.32342	0.048;0.07;0.115;0.144	D	0.90823	0.4710	10	0.72032	D	0.01	.	5.4947	0.16795	0.0834:0.1842:0.6062:0.1262	.	994;994;995;994	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	H	995;994;995;994;994;994	ENSP00000361290:P995H;ENSP00000334733:P994H;ENSP00000378340:P995H;ENSP00000443707:P994H;ENSP00000445236:P994H	ENSP00000334733:P994H	P	-	2	0	COL4A6	107304483	1.000000	0.71417	0.029000	0.17559	0.185000	0.23345	2.703000	0.47110	0.580000	0.29522	0.594000	0.82650	CCT		0.537	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2			Missense_Mutation
KIAA1407	57577	genome.wustl.edu	37	3	113737638	113737638	+	Silent	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr3:113737638C>A	ENST00000295878.3	-	8	1196	c.1050G>T	c.(1048-1050)ctG>ctT	p.L350L	KIAA1407_ENST00000545063.1_Silent_p.L181L	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	350								p.L350L(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						TCCAGTCAGACAGGGTCCCAG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	3											224.0	232.0	229.0					3																	113737638		2203	4300	6503	115220328	SO:0001819	synonymous_variant	57577			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1050G>T	3.37:g.113737638C>A		Somatic		Capture	Illumina GAIIx	4	115220328	B4DYL1|Q9P2E0	Silent	SNP	ENST00000295878.3	37	CCDS2977.1	SNP	17	WashU																																																																																				0.483	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817		Silent
ACP6	51205	genome.wustl.edu	37	1	147126384	147126384	+	Silent	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:147126384C>A	ENST00000369238.6	-	6	1152	c.705G>T	c.(703-705)gtG>gtT	p.V235V	ACP6_ENST00000392988.2_Silent_p.V235V	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	235					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.V235V(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					TCCTGTCCTTCACCTTTTTCA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	1											147.0	123.0	131.0					1																	147126384		2203	4300	6503	145593008	SO:0001819	synonymous_variant	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.705G>T	1.37:g.147126384C>A		Somatic		Capture	Illumina GAIIx	4	145593008	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Silent	SNP	ENST00000369238.6	37	CCDS928.1	SNP	29	WashU																																																																																				0.478	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361		Silent
GIMAP8	155038	genome.wustl.edu	37	7	150174229	150174229	+	Silent	SNP	G	G	A	rs376371559		TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr7:150174229G>A	ENST00000307271.3	+	5	1933	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	453	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.A453A(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GGAAGAGTGCGACCGGGAACT	0.577																																																1	Substitution - coding silent(1)	ovary(1)	7						G		0,4406		0,0,2203	72.0	75.0	74.0		1359	-8.9	0.0	7		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GIMAP8	NM_175571.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		453/666	150174229	1,13005	2203	4300	6503	149805162	SO:0001819	synonymous_variant	155038			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1359G>A	7.37:g.150174229G>A		Somatic		Capture	Illumina GAIIx	4	149805162		Silent	SNP	ENST00000307271.3	37	CCDS34777.1	SNP	37	WashU																																																																																				0.577	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571		Silent
OLFM3	118427	genome.wustl.edu	37	1	102269828	102269828	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1405-01	TCGA-13-1405-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:102269828A>C	ENST00000338858.5	-	6	1402	c.1403T>G	c.(1402-1404)cTt>cGt	p.L468R	OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.L448R|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	468	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.L448R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		GATATGGAAAAGGGTGACATT	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	122.0	124.0					1																	102269828		2203	4300	6503	102042416	SO:0001583	missense	118427			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1403T>G	1.37:g.102269828A>C	ENSP00000345192:p.Leu468Arg	Somatic		Capture	Illumina GAIIx	4	102042416	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		SNP	3	WashU	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663194	0.67700	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.90900	-2.75;-2.75	5.47	5.47	0.80525	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95506	0.8540	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.996;0.998	D	0.96355	0.9261	10	0.87932	D	0	.	15.8388	0.78824	1.0:0.0:0.0:0.0	.	448;468	Q5T3V6;Q96PB7	.;NOE3_HUMAN	R	448;468	ENSP00000359121:L448R;ENSP00000345192:L468R	ENSP00000345192:L468R	L	-	2	0	OLFM3	102042416	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.910000	0.92685	2.202000	0.70862	0.528000	0.53228	CTT		0.403	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1			Missense_Mutation
ACP6	51205	genome.wustl.edu	37	1	147126379	147126380	+	Frame_Shift_Ins	INS	-	-	A	rs587742332		TCGA-13-1405-01	TCGA-13-1405-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:147126379_147126380insA	ENST00000369238.6	-	6	1156_1157	c.709_710insT	c.(709-711)gacfs	p.D237fs	ACP6_ENST00000392988.2_Frame_Shift_Ins_p.D237fs	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	237					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.D237fs*6(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					GCCCATCCTGTCCTTCACCTTT	0.48																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								145593004	SO:0001589	frameshift_variant	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.709_710insT	1.37:g.147126379_147126380insA	ENSP00000358241:p.Asp237fs	Somatic		Capture	Illumina GAIIx	Phase_III	145593003	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Frame_Shift_Ins	INS	ENST00000369238.6	37	CCDS928.1	INS	58	WashU																																																																																				0.480	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361		Frame_Shift_Ins
OR6N1	128372	genome.wustl.edu	37	1	158735656	158735656	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr1:158735656C>A	ENST00000335094.2	-	1	836	c.817G>T	c.(817-819)Gcc>Tcc	p.A273S		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A273S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					ACTGCCAGGGCCTGGTCATAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											182.0	171.0	175.0					1																	158735656		2203	4300	6503	157002280	SO:0001583	missense	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.817G>T	1.37:g.158735656C>A	ENSP00000335535:p.Ala273Ser	Somatic		Capture	Illumina GAIIx	4	157002280	Q5VUU8|Q96R35	Missense_Mutation	SNP	ENST00000335094.2	37	CCDS30905.1	SNP	26	WashU	.	.	.	.	.	.	.	.	.	.	C	9.460	1.092977	0.20471	.	.	ENSG00000197403	ENST00000335094	T	0.00145	8.67	4.94	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.148945	0.31156	N	0.008151	T	0.00039	0.0001	L	0.40543	1.245	0.09310	N	1	B	0.22983	0.078	B	0.23275	0.045	T	0.45440	-0.9261	10	0.72032	D	0.01	-16.2982	3.839	0.08906	0.1722:0.5746:0.166:0.0873	.	273	Q8NGY5	OR6N1_HUMAN	S	273	ENSP00000335535:A273S	ENSP00000335535:A273S	A	-	1	0	OR6N1	157002280	0.000000	0.05858	0.960000	0.40013	0.662000	0.39071	-0.835000	0.04386	1.268000	0.44264	0.655000	0.94253	GCC		0.527	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059067.1	NM_001005185		Missense_Mutation
PAX9	5083	genome.wustl.edu	37	14	37132540	37132540	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr14:37132540C>T	ENST00000361487.6	+	2	668	c.443C>T	c.(442-444)cCg>cTg	p.P148L	PAX9_ENST00000554201.1_5'UTR|PAX9_ENST00000402703.2_Missense_Mutation_p.P148L			P55771	PAX9_HUMAN	paired box 9	148					cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.P148L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		CAGCACCAGCCGACGCCGCAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	14											58.0	50.0	53.0					14																	37132540		2203	4300	6503	36202291	SO:0001583	missense	5083			AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.443C>T	14.37:g.37132540C>T	ENSP00000355245:p.Pro148Leu	Somatic		Capture	Illumina GAIIx	4	36202291	Q99582|Q9UQR4	Missense_Mutation	SNP	ENST00000361487.6	37	CCDS9662.1	SNP	23	WashU	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672835	0.67928	.	.	ENSG00000198807	ENST00000402703;ENST00000361487	D;D	0.98901	-5.22;-5.22	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.97278	0.9110	M	0.66939	2.045	0.80722	D	1	P	0.48998	0.918	B	0.36378	0.223	D	0.97585	1.0113	10	0.45353	T	0.12	.	18.8295	0.92132	0.0:1.0:0.0:0.0	.	148	P55771	PAX9_HUMAN	L	148	ENSP00000384817:P148L;ENSP00000355245:P148L	ENSP00000355245:P148L	P	+	2	0	PAX9	36202291	1.000000	0.71417	0.996000	0.52242	0.945000	0.59286	4.748000	0.62148	2.445000	0.82738	0.561000	0.74099	CCG		0.642	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276733.2			Missense_Mutation
IRGQ	126298	genome.wustl.edu	37	19	44099167	44099167	+	Silent	SNP	G	G	A			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr19:44099167G>A	ENST00000602269.1	-	1	509	c.324C>T	c.(322-324)acC>acT	p.T108T	ZNF576_ENST00000529930.1_5'Flank|SRRM5_ENST00000607544.1_5'Flank|L34079.2_ENST00000594374.1_5'Flank|ZNF576_ENST00000391965.2_5'Flank|SRRM5_ENST00000526798.1_5'Flank|ZNF576_ENST00000336564.4_5'Flank|IRGQ_ENST00000601520.1_5'Flank|ZNF576_ENST00000528387.1_5'Flank|ZNF576_ENST00000525771.1_5'Flank|ZNF576_ENST00000533118.1_5'Flank|IRGQ_ENST00000422989.1_Silent_p.T108T			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	108								p.T108T(1)		endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CCAGTAGCGGGGTCCCTCGGG	0.692																																																1	Substitution - coding silent(1)	ovary(1)	19											22.0	27.0	25.0					19																	44099167		2202	4300	6502	48791007	SO:0001819	synonymous_variant	126298			AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.324C>T	19.37:g.44099167G>A		Somatic		Capture	Illumina GAIIx	4	48791007	B2RNP3	Silent	SNP	ENST00000602269.1	37	CCDS33040.1	SNP	43	WashU																																																																																				0.692	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561		Silent
Unknown	0	genome.wustl.edu	37	2	162137759	162137759	+	IGR	SNP	G	G	C			TCGA-13-1405-01	TCGA-13-1405-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr2:162137759G>C								AC009299.2 (26580 upstream) : PSMD14 (26789 downstream)																							TCGCAGAGCGGAGCAGCGGCC	0.607																																																0			2																																								161846005	SO:0001628	intergenic_variant	643194																															2.37:g.162137759G>C		Somatic		Capture	Illumina GAIIx	4	161846005		Missense_Mutation	SNP		37		SNP	41	WashU																																																																																			0	0.607									Missense_Mutation
ZBTB21	49854	genome.wustl.edu	37	21	43414201	43414202	+	Start_Codon_SNP	DNP	CC	CC	AG			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr21:43414201_43414202CC>AG	ENST00000310826.5	-	3	186_187	c.3_4GG>CT	c.(1-6)atGGag>atCTag	p.1_2ME>I*	ZBTB21_ENST00000398505.3_Start_Codon_SNP_p.1_2ME>I*|ZBTB21_ENST00000398499.1_Start_Codon_SNP_p.1_2ME>I*|ZBTB21_ENST00000398511.3_Start_Codon_SNP_p.1_2ME>I*|ZBTB21_ENST00000465968.1_Intron	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	1					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										AGTAATCCCTCCATGGCTTGAG	0.45																																																0			21																																								42287271	SO:0001582	initiator_codon_variant	49854			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.3_4delinsAG	21.37:g.43414201_43414202delinsAG	ENSP00000308759:p.M1_E2delinsI*	Somatic		Capture	Illumina GAIIx	4	42287270	Q5R2W1|Q5R2W2|Q6P4R0	Missense	DNP	ENST00000310826.5	37	CCDS13678.1	DNP	30	WashU																																																																																				0.450	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	Nonsense_Mutation	Missense
IPPK	64768	genome.wustl.edu	37	9	95400509	95400509	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1405-01	TCGA-13-1405-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	TCGA-13-1405-01	TCGA-13-1405-10	g.chr9:95400509C>G	ENST00000287996.3	-	9	966	c.690G>C	c.(688-690)tgG>tgC	p.W230C	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	230					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.W230C(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAAGCTCGCTCCAGTCAGCCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	9											71.0	74.0	73.0					9																	95400509		2203	4300	6503	94440330	SO:0001583	missense	64768			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.690G>C	9.37:g.95400509C>G	ENSP00000287996:p.Trp230Cys	Somatic		Capture	Illumina GAIIx	4	94440330	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	ENST00000287996.3	37	CCDS6699.1	SNP	30	WashU	.	.	.	.	.	.	.	.	.	.	C	13.98	2.398328	0.42512	.	.	ENSG00000127080	ENST00000287996	T	0.29917	1.55	4.99	4.99	0.66335	.	0.468554	0.23422	N	0.048351	T	0.24851	0.0603	N	0.19112	0.55	0.80722	D	1	B	0.33826	0.427	B	0.40565	0.333	T	0.06373	-1.0830	10	0.37606	T	0.19	-4.1635	12.0757	0.53643	0.0:0.9204:0.0:0.0796	.	230	Q9H8X2	IPPK_HUMAN	C	230	ENSP00000287996:W230C	ENSP00000287996:W230C	W	-	3	0	IPPK	94440330	1.000000	0.71417	0.930000	0.37139	0.840000	0.47671	3.391000	0.52530	2.486000	0.83907	0.313000	0.20887	TGG		0.582	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053101.1	NM_022755		Missense_Mutation
