#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DNAJC11	55735	broad.mit.edu	37	1	6697389	6697389	+	Missense_Mutation	SNP	C	C	T	rs573944451		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:6697389C>T	ENST00000377577.5	-	14	1516	c.1393G>A	c.(1393-1395)Gtc>Atc	p.V465I	DNAJC11_ENST00000377573.5_Missense_Mutation_p.V375I|DNAJC11_ENST00000465508.1_5'UTR|DNAJC11_ENST00000294401.7_Missense_Mutation_p.V413I|DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000542246.1_Missense_Mutation_p.V427I	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	465						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.V465I(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGCATTGACGATGATGAGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											244.0	200.0	215.0					1																	6697389		2203	4300	6503	6619976	SO:0001583	missense	55735			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1393G>A	1.37:g.6697389C>T	ENSP00000366800:p.Val465Ile	Unknown		x	x	x	6619976	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	ENST00000377577.5	37	CCDS87.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	5.945	0.358418	0.11239	.	.	ENSG00000007923	ENST00000377577;ENST00000294401;ENST00000542246;ENST00000377573	T;T;T;T	0.23348	2.48;2.47;2.22;1.91	5.71	-0.88	0.10610	DnaJ-like protein C11, C-terminal (1);	0.434279	0.23148	N	0.051381	T	0.09949	0.0244	N	0.14661	0.345	0.35427	D	0.79372	P;B;B	0.36199	0.543;0.125;0.126	B;B;B	0.30401	0.115;0.024;0.051	T	0.31392	-0.9945	10	0.25106	T	0.35	-19.2151	5.9532	0.19259	0.1769:0.4176:0.3355:0.07	.	375;413;465	B4DGD5;Q9NVH1-3;Q9NVH1	.;.;DJC11_HUMAN	I	465;413;427;375	ENSP00000366800:V465I;ENSP00000294401:V413I;ENSP00000444020:V427I;ENSP00000366796:V375I	ENSP00000294401:V413I	V	-	1	0	DNAJC11	6619976	0.819000	0.29175	0.065000	0.19835	0.023000	0.10783	1.236000	0.32683	-0.130000	0.11599	-1.713000	0.00713	GTC		0.572	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198		Missense_Mutation
ALPL	249	broad.mit.edu	37	1	21889702	21889702	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:21889702G>A	ENST00000374840.3	+	5	647	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	ALPL_ENST00000539907.1_Missense_Mutation_p.A56T|ALPL_ENST00000540617.1_Missense_Mutation_p.A78T|ALPL_ENST00000425315.2_Missense_Mutation_p.A133T|ALPL_ENST00000468526.1_3'UTR|ALPL_ENST00000374832.1_Missense_Mutation_p.A133T	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	133					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.A133T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	GGTAAGCGCAGCCACTGAGCG	0.667																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	72.0	75.0					1																	21889702		2203	4300	6503	21762289	SO:0001583	missense	249			BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.397G>A	1.37:g.21889702G>A	ENSP00000363973:p.Ala133Thr	Somatic		x	x	x	21762289	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	ENST00000374840.3	37	CCDS217.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705233	0.48412	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315	D;D;D;D;D	0.95949	-3.86;-3.86;-3.86;-3.86;-3.86	4.49	4.49	0.54785	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.160868	0.53938	D	0.000044	D	0.96241	0.8774	L	0.58669	1.825	0.54753	D	0.999985	B;P;D	0.63046	0.292;0.758;0.992	B;P;P	0.60949	0.248;0.511;0.881	D	0.95060	0.8195	10	0.29301	T	0.29	-8.3841	15.8954	0.79329	0.0:0.0:1.0:0.0	.	56;81;133	B7Z387;B7Z1D1;P05186	.;.;PPBT_HUMAN	T	56;78;133;133;133	ENSP00000437674:A56T;ENSP00000442672:A78T;ENSP00000363973:A133T;ENSP00000363965:A133T;ENSP00000394765:A133T	ENSP00000363965:A133T	A	+	1	0	ALPL	21762289	1.000000	0.71417	0.142000	0.22268	0.691000	0.40173	6.321000	0.72881	2.320000	0.78422	0.655000	0.94253	GCC		0.667	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1	NM_000478		Missense_Mutation
CCDC28B	79140	broad.mit.edu	37	1	32667627	32667627	+	Missense_Mutation	SNP	A	A	C	rs200013564		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:32667627A>C	ENST00000373602.5	+	2	438	c.91A>C	c.(91-93)Acc>Ccc	p.T31P	CCDC28B_ENST00000483009.1_3'UTR|RP4-622L5.7_ENST00000373604.4_RNA|CCDC28B_ENST00000421922.2_Missense_Mutation_p.T31P	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	31					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.T31P(1)		large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CCCTGTGCCTACCAGCCACAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											38.0	44.0	42.0					1																	32667627		2202	4299	6501	32440214	SO:0001583	missense	79140			BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.91A>C	1.37:g.32667627A>C	ENSP00000362704:p.Thr31Pro	Unknown		x	x	x	32440214	A8K789|Q8TBV8	Missense_Mutation	SNP	ENST00000373602.5	37	CCDS354.2	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446259	0.43429	.	.	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.46451	0.92;0.87	5.39	4.18	0.49190	.	0.112785	0.64402	D	0.000009	T	0.19886	0.0478	N	0.11106	0.095	0.38845	D	0.956143	B;B	0.19073	0.0;0.033	B;B	0.17433	0.001;0.018	T	0.11891	-1.0569	10	0.18710	T	0.47	0.0382	6.2474	0.20827	0.5845:0.2733:0.0:0.1422	.	31;31	Q9BUN5;E9PM81	CC28B_HUMAN;.	P	31	ENSP00000362704:T31P;ENSP00000413017:T31P	ENSP00000362704:T31P	T	+	1	0	CCDC28B	32440214	0.996000	0.38824	1.000000	0.80357	0.991000	0.79684	2.565000	0.45939	2.182000	0.69389	0.533000	0.62120	ACC		0.622	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015723.4	NM_024296		Missense_Mutation
FAM183A	440585	broad.mit.edu	37	1	43621954	43621954	+	Silent	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:43621954G>A	ENST00000335282.4	+	4	375	c.375G>A	c.(373-375)acG>acA	p.T125T	FAM183A_ENST00000410048.1_Silent_p.T97T|FAM183A_ENST00000409337.1_3'UTR	NM_001101376.2	NP_001094846.2	A6NL82	F183A_HUMAN	family with sequence similarity 183, member A	125								p.T125T(1)		kidney(1)|large_intestine(1)|lung(2)|ovary(3)	7						AGGCTAAAACGTGGGGCTTAG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	1											142.0	141.0	142.0					1																	43621954		2018	4184	6202	43394541	SO:0001819	synonymous_variant	440585			AI192630, AI375550, AL139138	CCDS44126.1	1p34.2	2008-08-11			ENSG00000186973	ENSG00000186973			34347	protein-coding gene	gene with protein product						11181995	Standard	NM_001101376		Approved	LOC440585, hCG23177	uc009vwo.3	A6NL82	OTTHUMG00000007286	ENST00000335282.4:c.375G>A	1.37:g.43621954G>A		Unknown		x	x	x	43394541	B7ZBL8	Silent	SNP	ENST00000335282.4	37	CCDS44126.1	SNP	40	Broad																																																																																				0.488	FAM183A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019024.3	NM_001101376		Silent
RCOR3	55758	broad.mit.edu	37	1	211486113	211486113	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:211486113A>G	ENST00000367005.4	+	10	1094	c.953A>G	c.(952-954)aAc>aGc	p.N318S	RCOR3_ENST00000452621.2_Missense_Mutation_p.N376S|RCOR3_ENST00000367006.4_Intron|RCOR3_ENST00000419091.2_Missense_Mutation_p.N376S|RCOR3_ENST00000526255.1_3'UTR	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	318	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.N318S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		GTAATTGGCAACAAGACTGTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	116.0	116.0					1																	211486113		2203	4300	6503	209552736	SO:0001583	missense	55758			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.953A>G	1.37:g.211486113A>G	ENSP00000355972:p.Asn318Ser	Unknown		x	x	x	209552736	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	11.71	1.718337	0.30503	.	.	ENSG00000117625	ENST00000452621;ENST00000419091;ENST00000367005;ENST00000529763	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.22	4.07	0.47477	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.080945	0.85682	D	0.000000	T	0.44726	0.1307	N	0.20986	0.625	0.40443	D	0.980068	P;D;P	0.57571	0.882;0.98;0.931	B;P;P	0.59948	0.414;0.866;0.55	T	0.38067	-0.9678	10	0.41790	T	0.15	-9.4574	12.4824	0.55852	0.8599:0.1401:0.0:0.0	.	376;318;376	Q9P2K3-3;Q9P2K3;Q9P2K3-4	.;RCOR3_HUMAN;.	S	376;376;318;136	ENSP00000398558:N376S;ENSP00000413929:N376S;ENSP00000355972:N318S;ENSP00000437048:N136S	ENSP00000355972:N318S	N	+	2	0	RCOR3	209552736	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.141000	0.77330	0.908000	0.36671	0.528000	0.53228	AAC		0.428	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254		Missense_Mutation
USH2A	7399	broad.mit.edu	37	1	215807954	215807954	+	Silent	SNP	C	C	T	rs397517998		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr1:215807954C>T	ENST00000307340.3	-	70	15530	c.15144G>A	c.(15142-15144)gcG>gcA	p.A5048A	USH2A_ENST00000366943.2_Silent_p.A5048A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5048					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A5048A(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGCCCAGCATCGCCATTAACA	0.463										HNSCC(13;0.011)																																						1	Substitution - coding silent(1)	ovary(1)	1											137.0	129.0	131.0					1																	215807954		2203	4300	6503	213874577	SO:0001819	synonymous_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15144G>A	1.37:g.215807954C>T		Unknown		x	x	x	213874577	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1	SNP	31	Broad																																																																																				0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		Silent
MYO3A	53904	broad.mit.edu	37	10	26315321	26315321	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1409-01	TCGA-13-1409-10			T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr10:26315321T>G	ENST00000265944.5	+	10	979	c.813T>G	c.(811-813)gaT>gaG	p.D271E	MYO3A_ENST00000543632.1_Missense_Mutation_p.D271E	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D271E(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TGACTAAAGATTATGAAAAGC	0.313																																																1	Substitution - Missense(1)	ovary(1)	10											76.0	74.0	75.0					10																	26315321		2203	4300	6503	26355327	SO:0001583	missense	53904			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.813T>G	10.37:g.26315321T>G	ENSP00000265944:p.Asp271Glu	Somatic		x	x	x	26355327	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846630	0.71603	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;T	0.16897	2.31;2.31	5.76	2.1	0.27182	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.154071	0.64402	D	0.000008	T	0.29458	0.0734	L	0.42487	1.325	0.53688	D	0.999974	D;D;D	0.89917	0.997;0.998;1.0	D;D;D	0.97110	0.993;0.996;1.0	T	0.01484	-1.1343	10	0.87932	D	0	.	9.0669	0.36469	0.0:0.2815:0.0:0.7185	.	271;271;271	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	E	271	ENSP00000265944:D271E;ENSP00000445909:D271E	ENSP00000265944:D271E	D	+	3	2	MYO3A	26355327	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.260000	0.32968	0.505000	0.28104	0.533000	0.62120	GAT		0.313	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433		Missense_Mutation
UNC5B	219699	broad.mit.edu	37	10	73046530	73046530	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr10:73046530C>T	ENST00000335350.6	+	5	1053	c.637C>T	c.(637-639)Cgc>Tgc	p.R213C	UNC5B_ENST00000373192.4_Missense_Mutation_p.R213C	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	213	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)		p.R213C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CCTCATCATCCGCCAGGCCCG	0.597																																																1	Substitution - Missense(1)	ovary(1)	10											206.0	189.0	195.0					10																	73046530		2203	4300	6503	72716536	SO:0001583	missense	219699			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.637C>T	10.37:g.73046530C>T	ENSP00000334329:p.Arg213Cys	Unknown		x	x	x	72716536	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580660	0.86645	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.68479	-0.33;-0.33	5.43	5.43	0.79202	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.097389	0.64402	D	0.000002	T	0.81059	0.4744	M	0.85197	2.74	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	P;D	0.63192	0.857;0.912	D	0.83760	0.0214	10	0.72032	D	0.01	-33.3646	12.397	0.55391	0.2835:0.7165:0.0:0.0	.	213;213	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	C	213	ENSP00000334329:R213C;ENSP00000362288:R213C	ENSP00000334329:R213C	R	+	1	0	UNC5B	72716536	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	6.782000	0.75073	2.561000	0.86390	0.561000	0.74099	CGC		0.597	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744		Missense_Mutation
HABP2	3026	broad.mit.edu	37	10	115337862	115337862	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr10:115337862T>G	ENST00000351270.3	+	6	622	c.526T>G	c.(526-528)Tgt>Ggt	p.C176G	HABP2_ENST00000537906.1_Silent_p.P164P|HABP2_ENST00000542051.1_Missense_Mutation_p.C150G|HABP2_ENST00000541666.1_Missense_Mutation_p.C176G	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	176	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)	p.C176G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CAAGTTCACCTGTGCCTGTCC	0.562																																																1	Substitution - Missense(1)	ovary(1)	10											99.0	89.0	93.0					10																	115337862		2203	4300	6503	115327852	SO:0001583	missense	3026				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	ENST00000351270.3:c.526T>G	10.37:g.115337862T>G	ENSP00000277903:p.Cys176Gly	Unknown		x	x	x	115327852	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	37	CCDS7577.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	15.33	2.801091	0.50315	.	.	ENSG00000148702	ENST00000542051;ENST00000351270;ENST00000541666	D;D;D	0.99992	-12.4;-12.4;-12.4	5.54	5.54	0.83059	Kringle-like fold (1);EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99994	0.9999	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99988	1.3766	10	0.87932	D	0	.	14.2444	0.65978	0.0:0.0:0.0:1.0	.	176	Q14520	HABP2_HUMAN	G	150;176;176	ENSP00000443283:C150G;ENSP00000277903:C176G;ENSP00000438373:C176G	ENSP00000277903:C176G	C	+	1	0	HABP2	115327852	1.000000	0.71417	0.153000	0.22517	0.127000	0.20565	6.257000	0.72480	2.109000	0.64355	0.460000	0.39030	TGT		0.562	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050428.1	NM_004132		Missense_Mutation
OR51Q1	390061	broad.mit.edu	37	11	5443693	5443693	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:5443693G>T	ENST00000300778.4	+	1	353	c.263G>T	c.(262-264)tGg>tTg	p.W88L	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.W88L(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGCTTCTCTGGTTCAACGTT	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											158.0	142.0	147.0					11																	5443693		2201	4297	6498	5400269	SO:0001583	missense	390061			AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.263G>T	11.37:g.5443693G>T	ENSP00000300778:p.Trp88Leu	Unknown		x	x	x	5400269	B2RNN1	Missense_Mutation	SNP	ENST00000300778.4	37	CCDS31381.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792893	0.50102	.	.	ENSG00000167360	ENST00000300778	T	0.00711	5.8	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.228798	0.31747	N	0.007133	T	0.02888	0.0086	L	0.45422	1.42	0.40632	D	0.981864	D	0.89917	1.0	D	0.85130	0.997	T	0.66480	-0.5913	10	0.42905	T	0.14	.	17.191	0.86879	0.0:0.0:1.0:0.0	.	88	Q8NH59	O51Q1_HUMAN	L	88	ENSP00000300778:W88L	ENSP00000300778:W88L	W	+	2	0	OR51Q1	5400269	0.905000	0.30787	1.000000	0.80357	0.698000	0.40448	0.501000	0.22578	2.641000	0.89580	0.380000	0.24917	TGG		0.522	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757		Missense_Mutation
FSHB	2488	broad.mit.edu	37	11	30253521	30253521	+	Silent	SNP	C	C	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:30253521C>A	ENST00000417547.1	+	2	111	c.72C>A	c.(70-72)acC>acA	p.T24T	FSHB_ENST00000254122.3_Silent_p.T24T|FSHB_ENST00000533718.1_Silent_p.T24T	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	24					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)	p.T24T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						GTGAGCTGACCAACATCACCA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	11											103.0	89.0	94.0					11																	30253521		2202	4299	6501	30210097	SO:0001819	synonymous_variant	2488				CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.72C>A	11.37:g.30253521C>A		Unknown		x	x	x	30210097	A2TF08|A5JVV3|Q14D61	Silent	SNP	ENST00000417547.1	37	CCDS7868.1	SNP	21	Broad																																																																																				0.463	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1	NM_000510		Silent
QSER1	79832	broad.mit.edu	37	11	32955638	32955638	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:32955638G>A	ENST00000399302.2	+	4	2782	c.2447G>A	c.(2446-2448)aGt>aAt	p.S816N	QSER1_ENST00000527788.1_Missense_Mutation_p.S577N	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	816								p.S816N(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					GGCCATTTTAGTGAAACAAAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											66.0	65.0	65.0					11																	32955638		1880	4101	5981	32912214	SO:0001583	missense	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2447G>A	11.37:g.32955638G>A	ENSP00000382241:p.Ser816Asn	Unknown		x	x	x	32912214	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	CCDS41631.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	7.757	0.704605	0.15172	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.23348	2.24;1.91	5.47	0.981	0.19756	.	0.203904	0.42548	N	0.000693	T	0.15782	0.0380	L	0.38838	1.175	0.33918	D	0.64046	B;B;B	0.11235	0.004;0.003;0.0	B;B;B	0.13407	0.009;0.004;0.001	T	0.08310	-1.0728	10	0.36615	T	0.2	.	4.3727	0.11255	0.217:0.1202:0.5527:0.1102	.	577;577;816	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	N	816;577;577	ENSP00000382241:S816N;ENSP00000432766:S577N	ENSP00000078652:S577N	S	+	2	0	QSER1	32912214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.110000	0.41873	0.269000	0.21961	0.556000	0.70494	AGT		0.363	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		Missense_Mutation
OR8K1	390157	broad.mit.edu	37	11	56113821	56113821	+	Missense_Mutation	SNP	T	T	C	rs139364859		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:56113821T>C	ENST00000279783.2	+	1	401	c.307T>C	c.(307-309)Tat>Cat	p.Y103H		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y103H(1)		large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TTACAATTGGTATGCCACTCA	0.393										HNSCC(65;0.19)																																						1	Substitution - Missense(1)	ovary(1)	11						T	HIS/TYR	1,4401	2.1+/-5.4	0,1,2200	177.0	175.0	176.0		307	5.0	0.9	11	dbSNP_134	176	0,8592		0,0,4296	no	missense	OR8K1	NM_001002907.1	83	0,1,6496	CC,CT,TT		0.0,0.0227,0.0077	benign	103/320	56113821	1,12993	2201	4296	6497	55870397	SO:0001583	missense	390157			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.307T>C	11.37:g.56113821T>C	ENSP00000279783:p.Tyr103His	Unknown		x	x	x	55870397	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	CCDS31528.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061626	0.55432	2.27E-4	0.0	ENSG00000150261	ENST00000279783	T	0.37411	1.2	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000059	T	0.27063	0.0663	N	0.19112	0.55	0.21105	N	0.999789	P	0.40476	0.718	B	0.38921	0.285	T	0.21586	-1.0241	10	0.87932	D	0	-5.7624	14.7062	0.69191	0.0:0.0:0.0:1.0	.	103	Q8NGG5	OR8K1_HUMAN	H	103	ENSP00000279783:Y103H	ENSP00000279783:Y103H	Y	+	1	0	OR8K1	55870397	1.000000	0.71417	0.889000	0.34880	0.952000	0.60782	6.387000	0.73191	1.862000	0.54008	0.448000	0.29417	TAT		0.393	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907		Missense_Mutation
DPF2	5977	broad.mit.edu	37	11	65108470	65108470	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:65108470C>A	ENST00000528416.1	+	3	360	c.227C>A	c.(226-228)gCc>gAc	p.A76D	DPF2_ENST00000415073.2_Missense_Mutation_p.A76D|DPF2_ENST00000252268.4_Missense_Mutation_p.A76D|DPF2_ENST00000532264.1_3'UTR	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	76					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.A76D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						TCCTACCCTGCCCGGCGCTGG	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											60.0	55.0	57.0					11																	65108470		2201	4297	6498	64865046	SO:0001583	missense	5977			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.227C>A	11.37:g.65108470C>A	ENSP00000436901:p.Ala76Asp	Unknown		x	x	x	64865046	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.268071	0.95429	.	.	ENSG00000133884	ENST00000528416;ENST00000415073;ENST00000252268	D;D;D	0.91521	-2.77;-2.86;-2.79	5.4	5.4	0.78164	.	0.000000	0.37483	N	0.002074	D	0.94703	0.8291	M	0.76328	2.33	0.58432	D	0.999996	D;D;P	0.59767	0.984;0.986;0.863	P;D;P	0.65874	0.883;0.939;0.478	D	0.95123	0.8248	10	0.87932	D	0	-18.4102	16.6638	0.85247	0.0:1.0:0.0:0.0	.	76;76;76	B4DT58;E9PN04;Q92785	.;.;REQU_HUMAN	D	76	ENSP00000436901:A76D;ENSP00000399714:A76D;ENSP00000252268:A76D	ENSP00000252268:A76D	A	+	2	0	DPF2	64865046	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.794000	0.85869	2.553000	0.86117	0.460000	0.39030	GCC		0.532	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268		Missense_Mutation
PUS3	83480	broad.mit.edu	37	11	125765156	125765156	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr11:125765156G>T	ENST00000530811.1	-	2	952	c.907C>A	c.(907-909)Ctg>Atg	p.L303M	HYLS1_ENST00000425380.2_Intron|PUS3_ENST00000227474.3_Missense_Mutation_p.L303M|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000356438.3_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	303					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.L303M(1)		NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		TCTATATTCAGCAGCTCATCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	11											90.0	94.0	93.0					11																	125765156		2201	4299	6500	125270366	SO:0001583	missense	83480			BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.907C>A	11.37:g.125765156G>T	ENSP00000432386:p.Leu303Met	Unknown		x	x	x	125270366	B2RAM0|Q96D17|Q96J23|Q96NB4	Missense_Mutation	SNP	ENST00000530811.1	37	CCDS8466.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297832	0.60086	.	.	ENSG00000110060	ENST00000227474;ENST00000530811	T;T	0.69561	-0.41;-0.41	5.73	4.82	0.62117	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.000000	0.85682	D	0.000000	D	0.82527	0.5056	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.84947	0.0869	10	0.66056	D	0.02	-8.4307	11.8037	0.52141	0.1412:0.0:0.8588:0.0	.	303	Q9BZE2	PUS3_HUMAN	M	303	ENSP00000227474:L303M;ENSP00000432386:L303M	ENSP00000227474:L303M	L	-	1	2	PUS3	125270366	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.072000	0.41510	1.420000	0.47138	0.591000	0.81541	CTG		0.428	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307		Missense_Mutation
CCNT1	904	broad.mit.edu	37	12	49087926	49087926	+	Silent	SNP	A	A	C			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr12:49087926A>C	ENST00000261900.3	-	9	1293	c.1071T>G	c.(1069-1071)ctT>ctG	p.L357L		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	357					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.L357L(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						CAACTCCTGTAAGTGCTAAAT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	12											162.0	155.0	158.0					12																	49087926		2203	4300	6503	47374193	SO:0001819	synonymous_variant	904			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1071T>G	12.37:g.49087926A>C		Unknown		x	x	x	47374193	A9XU13|E7EX76|O60581	Silent	SNP	ENST00000261900.3	37	CCDS8766.1	SNP	13	Broad																																																																																				0.458	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240		Silent
DIP2B	57609	broad.mit.edu	37	12	51092138	51092138	+	Silent	SNP	A	A	G	rs541979685		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr12:51092138A>G	ENST00000301180.5	+	18	2110	c.2076A>G	c.(2074-2076)ccA>ccG	p.P692P		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	692						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.P692P(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCCCTTTGCCAGGAAGAGCCA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	12											90.0	88.0	89.0					12																	51092138		2203	4300	6503	49378405	SO:0001819	synonymous_variant	57609			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2076A>G	12.37:g.51092138A>G		Unknown		x	x	x	49378405	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	ENST00000301180.5	37	CCDS31799.1	SNP	7	Broad																																																																																				0.433	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		Silent
PAWR	5074	broad.mit.edu	37	12	80083600	80083600	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr12:80083600G>T	ENST00000328827.4	-	2	797	c.425C>A	c.(424-426)cCc>cAc	p.P142H	RP11-530C5.1_ENST00000551995.1_lincRNA|PAWR_ENST00000547571.1_5'UTR	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	142					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)	p.P142H(1)		NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CCTGGCACTGGGGCCCGAGCT	0.706																																																1	Substitution - Missense(1)	ovary(1)	12											11.0	11.0	11.0					12																	80083600		2194	4291	6485	78607731	SO:0001583	missense	5074			U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.425C>A	12.37:g.80083600G>T	ENSP00000328088:p.Pro142His	Unknown		x	x	x	78607731	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	37	CCDS31863.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659033	0.88154	.	.	ENSG00000177425	ENST00000328827	T	0.09445	2.98	3.48	3.48	0.39840	.	0.000000	0.85682	D	0.000000	T	0.26122	0.0637	L	0.50333	1.59	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.01935	-1.1244	9	.	.	.	-6.8155	15.1638	0.72803	0.0:0.0:1.0:0.0	.	142	Q96IZ0	PAWR_HUMAN	H	142	ENSP00000328088:P142H	.	P	-	2	0	PAWR	78607731	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	8.068000	0.89490	1.752000	0.51891	0.563000	0.77884	CCC		0.706	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	NM_002583		Missense_Mutation
LATS2	26524	broad.mit.edu	37	13	21549312	21549312	+	Silent	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr13:21549312G>T	ENST00000382592.4	-	8	3369	c.2964C>A	c.(2962-2964)ccC>ccA	p.P988P	LATS2_ENST00000542899.1_Silent_p.P988P	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.P988P(1)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TGGGAACGTAGGGGGCTGGCT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	13											129.0	132.0	131.0					13																	21549312		2203	4300	6503	20447312	SO:0001819	synonymous_variant	26524			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2964C>A	13.37:g.21549312G>T		Unknown		x	x	x	20447312		Silent	SNP	ENST00000382592.4	37	CCDS9294.1	SNP	35	Broad																																																																																				0.607	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			Silent
FRY	10129	broad.mit.edu	37	13	32652987	32652987	+	Silent	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr13:32652987C>T	ENST00000380250.3	+	2	583	c.87C>T	c.(85-87)aaC>aaT	p.N29N		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	29						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.N29N(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CCGTTGGCAACGGTTACATCA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	13											167.0	164.0	165.0					13																	32652987		1930	4148	6078	31550987	SO:0001819	synonymous_variant	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.87C>T	13.37:g.32652987C>T		Somatic		x	x	x	31550987	Q9Y3N6	Silent	SNP	ENST00000380250.3	37	CCDS41875.1	SNP	19	Broad																																																																																				0.473	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		Silent
ELMSAN1	91748	broad.mit.edu	37	14	74206288	74206288	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr14:74206288A>C	ENST00000286523.5	-	2	1206	c.424T>G	c.(424-426)Tac>Gac	p.Y142D	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.Y142D|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.Y142D(1)									GTTGCACTGTAGAGGGACAGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	14											89.0	94.0	92.0					14																	74206288		2203	4300	6503	73276041	SO:0001583	missense	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.424T>G	14.37:g.74206288A>C	ENSP00000286523:p.Tyr142Asp	Unknown		x	x	x	73276041	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	14.20	2.464012	0.43736	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.19532	2.15;2.15;2.15;2.14	5.19	5.19	0.71726	.	0.307526	0.23750	N	0.044928	T	0.14313	0.0346	N	0.24115	0.695	0.35003	D	0.756198	P;P	0.47409	0.895;0.895	B;B	0.43754	0.43;0.43	T	0.14117	-1.0484	10	0.12430	T	0.62	-13.5321	10.053	0.42228	0.7747:0.2253:0.0:0.0	.	142;142	A0PJD3;Q6PJG2	.;CN043_HUMAN	D	142	ENSP00000377634:Y142D;ENSP00000286523:Y142D;ENSP00000407767:Y142D;ENSP00000402380:Y142D	ENSP00000286523:Y142D	Y	-	1	0	C14orf43	73276041	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.646000	0.46630	1.954000	0.56735	0.379000	0.24179	TAC		0.627	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278		Missense_Mutation
NTRK3	4916	broad.mit.edu	37	15	88483904	88483904	+	Nonsense_Mutation	SNP	C	C	A	rs371770675		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr15:88483904C>A	ENST00000360948.2	-	14	1827	c.1666G>T	c.(1666-1668)Gag>Tag	p.E556*	NTRK3_ENST00000542733.2_Nonsense_Mutation_p.E458*|NTRK3_ENST00000357724.2_Nonsense_Mutation_p.E548*|NTRK3_ENST00000355254.2_Nonsense_Mutation_p.E556*|NTRK3_ENST00000394480.2_Nonsense_Mutation_p.E556*|NTRK3_ENST00000557856.1_Nonsense_Mutation_p.E548*|NTRK3_ENST00000558676.1_Nonsense_Mutation_p.E548*	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	556	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E556*(2)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TTGTAGCACTCGGCCAGGAAG	0.577			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	2	Substitution - Nonsense(2)	ovary(1)|lung(1)	15											152.0	123.0	133.0					15																	88483904		2201	4299	6500	86284908	SO:0001587	stop_gained	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1666G>T	15.37:g.88483904C>A	ENSP00000354207:p.Glu556*	Unknown		x	x	x	86284908	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Nonsense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	43	9.910118	0.99293	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000343782	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	17.9041	0.88913	0.0:1.0:0.0:0.0	.	.	.	.	X	556;556;548;556;458;52	.	ENSP00000342792:E52X	E	-	1	0	NTRK3	86284908	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.556000	0.82233	2.477000	0.83638	0.655000	0.94253	GAG		0.577	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding				Nonsense_Mutation
CDH8	1006	broad.mit.edu	37	16	61687975	61687975	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr16:61687975C>T	ENST00000577390.1	-	12	2891	c.1937G>A	c.(1936-1938)cGg>cAg	p.R646Q	CDH8_ENST00000299345.6_Missense_Mutation_p.R646Q|CDH8_ENST00000577730.1_Missense_Mutation_p.R646Q	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	646					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.R646Q(1)|p.R646L(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATTTTTATGCCGCCGTAGAGT	0.393																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	16											64.0	63.0	63.0					16																	61687975		2203	4300	6503	60245476	SO:0001583	missense	1006			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1937G>A	16.37:g.61687975C>T	ENSP00000462701:p.Arg646Gln	Unknown		x	x	x	60245476	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.622957	0.96660	.	.	ENSG00000150394	ENST00000299345	T	0.78816	-1.21	5.7	5.7	0.88788	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.88239	0.6383	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.87239	0.2265	10	0.42905	T	0.14	.	18.8311	0.92139	0.0:1.0:0.0:0.0	.	646	P55286	CADH8_HUMAN	Q	646	ENSP00000299345:R646Q	ENSP00000299345:R646Q	R	-	2	0	CDH8	60245476	1.000000	0.71417	0.963000	0.40424	0.943000	0.58893	6.046000	0.71029	2.679000	0.91253	0.655000	0.94253	CGG		0.393	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		Missense_Mutation
ZFHX3	463	broad.mit.edu	37	16	72822537	72822537	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr16:72822537G>T	ENST00000268489.5	-	10	10310	c.9638C>A	c.(9637-9639)cCg>cAg	p.P3213Q	AC004943.1_ENST00000584072.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA|ZFHX3_ENST00000397992.5_Missense_Mutation_p.P2299Q|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3213	Poly-Pro.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P3213Q(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGCTGCTGGCGGCGGGGGAGg	0.632																																																1	Substitution - Missense(1)	ovary(1)	16											93.0	104.0	100.0					16																	72822537		2198	4300	6498	71380038	SO:0001583	missense	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.9638C>A	16.37:g.72822537G>T	ENSP00000268489:p.Pro3213Gln	Unknown		x	x	x	71380038	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	8.762	0.923949	0.18056	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.73575	-0.76;-0.75	5.44	0.886	0.19194	.	0.000000	0.42682	D	0.000663	T	0.53498	0.1800	L	0.34521	1.04	0.19300	N	0.999974	B	0.06786	0.001	B	0.04013	0.001	T	0.18178	-1.0345	10	0.13108	T	0.6	.	4.4217	0.11482	0.1814:0.0:0.5645:0.2541	.	3213	Q15911	ZFHX3_HUMAN	Q	3213;2299	ENSP00000268489:P3213Q;ENSP00000438926:P2299Q	ENSP00000268489:P3213Q	P	-	2	0	ZFHX3	71380038	0.024000	0.19004	0.786000	0.31890	0.977000	0.68977	1.089000	0.30890	0.672000	0.31204	0.557000	0.71058	CCG		0.632	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885		Missense_Mutation
ANKRD11	29123	broad.mit.edu	37	16	89351543	89351543	+	Silent	SNP	G	G	A	rs201654291		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr16:89351543G>A	ENST00000301030.4	-	9	1867	c.1407C>T	c.(1405-1407)ttC>ttT	p.F469F	ANKRD11_ENST00000378330.2_Silent_p.F469F	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	469					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.F469F(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCCGCTTTCCGAAGCGAACCT	0.512																																																1	Substitution - coding silent(1)	ovary(1)	16											30.0	33.0	32.0					16																	89351543		2198	4300	6498	87879044	SO:0001819	synonymous_variant	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1407C>T	16.37:g.89351543G>A		Unknown		x	x	x	87879044	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1	SNP	37	Broad																																																																																				0.512	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275		Silent
TP53	7157	broad.mit.edu	37	17	7577498	7577498	+	Splice_Site	SNP	C	C	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr17:7577498C>A	ENST00000269305.4	-	7	972		c.e7+1		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(29)|p.0?(8)|p.E258fs*71(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGCTCCTGACCTGGAGTCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(29)|Whole gene deletion(8)|Deletion - Frameshift(1)	breast(5)|ovary(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|upper_aerodigestive_tract(2)|stomach(2)|central_nervous_system(2)|large_intestine(2)|oesophagus(2)|peritoneum(1)|biliary_tract(1)|liver(1)|urinary_tract(1)|salivary_gland(1)|lung(1)|skin(1)|pancreas(1)	17											121.0	85.0	97.0					17																	7577498		2203	4300	6503	7518223	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.782+1G>T	17.37:g.7577498C>A		Unknown		x	x	x	7518223	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site_SNP	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928881	0.34002	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.688	0.69062	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518223	1.000000	0.71417	0.987000	0.45799	0.147000	0.21601	3.111000	0.50360	2.406000	0.81754	0.462000	0.41574	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	Splice_Site_SNP
ZNF560	147741	broad.mit.edu	37	19	9581977	9581977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr19:9581977G>A	ENST00000301480.4	-	6	529	c.316C>T	c.(316-318)Caa>Taa	p.Q106*		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q106*(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						ATTACCATTTGTATCCCATTA	0.333																																																1	Substitution - Nonsense(1)	ovary(1)	19											79.0	80.0	80.0					19																	9581977		2203	4298	6501	9442977	SO:0001587	stop_gained	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.316C>T	19.37:g.9581977G>A	ENSP00000301480:p.Gln106*	Somatic		x	x	x	9442977	Q495S9|Q495T1	Nonsense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331059	0.60853	.	.	ENSG00000198028	ENST00000301480	.	.	.	2.53	-1.5	0.08691	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	0.7753	0.01031	0.1619:0.2415:0.3513:0.2452	.	.	.	.	X	106	.	ENSP00000301480:Q106X	Q	-	1	0	ZNF560	9442977	0.000000	0.05858	0.030000	0.17652	0.200000	0.23975	-0.466000	0.06672	-0.087000	0.12528	0.455000	0.32223	CAA		0.333	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		Nonsense_Mutation
ZNF257	113835	broad.mit.edu	37	19	22271096	22271096	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr19:22271096T>C	ENST00000594947.1	+	4	688	c.544T>C	c.(544-546)Ttt>Ctt	p.F182L	ZNF257_ENST00000600162.1_3'UTR	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F182L(1)		haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGGCAAATCATTTTGCATGCT	0.323																																																1	Substitution - Missense(1)	ovary(1)	19											43.0	45.0	45.0					19																	22271096		2201	4296	6497	22062936	SO:0001583	missense	113835			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.544T>C	19.37:g.22271096T>C	ENSP00000470209:p.Phe182Leu	Unknown		x	x	x	22062936	B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	37	CCDS46030.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	9.508	1.104929	0.20632	.	.	ENSG00000197134	ENST00000435820	.	.	.	0.51	0.51	0.16983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46946	0.1419	M	0.91196	3.185	0.09310	N	1	B	0.32409	0.37	B	0.21151	0.033	T	0.52793	-0.8528	8	0.72032	D	0.01	.	2.6589	0.05020	0.0:0.3754:0.0:0.6246	.	182	Q9Y2Q1	ZN257_HUMAN	L	182	.	ENSP00000406147:F182L	F	+	1	0	ZNF257	22062936	0.388000	0.25197	0.006000	0.13384	0.143000	0.21401	2.507000	0.45442	0.436000	0.26393	0.260000	0.18958	TTT		0.323	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1			Missense_Mutation
FAM83E	54854	broad.mit.edu	37	19	49116423	49116423	+	Silent	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr19:49116423C>T	ENST00000263266.3	-	1	396	c.207G>A	c.(205-207)gcG>gcA	p.A69A	FAM83E_ENST00000595110.1_5'Flank	NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	69								p.A69A(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CTTCAGCTGCCGCTGCCAAGC	0.667																																																1	Substitution - coding silent(1)	ovary(1)	19											22.0	28.0	26.0					19																	49116423		2127	4246	6373	53808235	SO:0001819	synonymous_variant	54854			AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.207G>A	19.37:g.49116423C>T		Unknown		x	x	x	53808235	Q9NXK1	Silent	SNP	ENST00000263266.3	37	CCDS42587.1	SNP	23	Broad																																																																																				0.667	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466145.1	NM_017708		Silent
ZSWIM2	151112	broad.mit.edu	37	2	187713716	187713716	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr2:187713716C>A	ENST00000295131.2	-	1	181	c.142G>T	c.(142-144)Gag>Tag	p.E48*		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	48					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E48*(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TATTCCGGCTCCTCCTCCCTC	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	2											63.0	60.0	61.0					2																	187713716		2203	4300	6503	187421961	SO:0001587	stop_gained	151112			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.142G>T	2.37:g.187713716C>A	ENSP00000295131:p.Glu48*	Unknown		x	x	x	187421961	B3KXV6|Q53SI3|Q57ZY3	Nonsense_Mutation	SNP	ENST00000295131.2	37	CCDS33348.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.665457	0.96745	.	.	ENSG00000163012	ENST00000295131	.	.	.	4.91	4.02	0.46733	.	1.011280	0.07946	N	0.980121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-0.027	10.8978	0.47034	0.1867:0.8133:0.0:0.0	.	.	.	.	X	48	.	ENSP00000295131:E48X	E	-	1	0	ZSWIM2	187421961	1.000000	0.71417	0.994000	0.49952	0.889000	0.51656	3.811000	0.55620	1.395000	0.46643	0.650000	0.86243	GAG		0.617	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521		Nonsense_Mutation
COL4A3	1285	broad.mit.edu	37	2	228147165	228147165	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr2:228147165C>T	ENST00000396578.3	+	32	2735	c.2573C>T	c.(2572-2574)cCa>cTa	p.P858L	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	858	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)	p.P858L(1)		NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		ACTGGATCACCAGGAATTCCA	0.478																																																1	Substitution - Missense(1)	ovary(1)	2											121.0	120.0	120.0					2																	228147165		1834	4094	5928	227855409	SO:0001583	missense	1285				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.2573C>T	2.37:g.228147165C>T	ENSP00000379823:p.Pro858Leu	Unknown		x	x	x	227855409	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	37	CCDS42829.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290583	0.40494	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.97731	-4.51	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000013	D	0.98833	0.9606	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.99271	1.0893	10	0.54805	T	0.06	.	17.2577	0.87062	0.0:1.0:0.0:0.0	.	858;858;858;858	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	L	858	ENSP00000379823:P858L	ENSP00000323334:P858L	P	+	2	0	COL4A3	227855409	1.000000	0.71417	0.994000	0.49952	0.041000	0.13682	5.625000	0.67770	2.814000	0.96858	0.655000	0.94253	CCA		0.478	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091		Missense_Mutation
SP100	6672	broad.mit.edu	37	2	231309028	231309028	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr2:231309028G>A	ENST00000264052.5	+	4	761	c.406G>A	c.(406-408)Gat>Aat	p.D136N	SP100_ENST00000409112.1_Missense_Mutation_p.D136N|SP100_ENST00000409341.1_Missense_Mutation_p.D136N|SP100_ENST00000340126.4_Missense_Mutation_p.D136N|SP100_ENST00000409897.1_Missense_Mutation_p.D101N|SP100_ENST00000341950.4_Missense_Mutation_p.D136N|SP100_ENST00000409824.1_Missense_Mutation_p.D111N|SP100_ENST00000427101.2_Missense_Mutation_p.D111N	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	136	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.D136N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GGAATACCCCGATTTAATTCA	0.358																																																1	Substitution - Missense(1)	ovary(1)	2											119.0	122.0	121.0					2																	231309028		2203	4300	6503	231017272	SO:0001583	missense	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.406G>A	2.37:g.231309028G>A	ENSP00000264052:p.Asp136Asn	Unknown		x	x	x	231017272	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	ENST00000264052.5	37	CCDS2477.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124922	0.56613	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000432979;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	D;D;D;D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42	3.89	3.01	0.34805	Sp100 (2);	.	.	.	.	D	0.95300	0.8475	L	0.56124	1.755	0.09310	N	1	D;D;D;D;D;D;P;D	0.89917	0.992;1.0;0.997;0.999;0.996;1.0;0.897;0.996	P;D;P;P;P;D;P;P	0.72982	0.803;0.979;0.876;0.905;0.885;0.932;0.447;0.803	D	0.87584	0.2486	9	0.48119	T	0.1	.	7.4744	0.27368	0.1177:0.0:0.8823:0.0	.	111;136;101;136;136;136;111;136	F8WFE2;B4E2B9;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.;.;.;.;SP100_HUMAN;.;.;.	N	136;111;111;111;136;136;136;136;101	ENSP00000264052:D136N;ENSP00000399389:D111N;ENSP00000391616:D111N;ENSP00000387311:D111N;ENSP00000386404:D136N;ENSP00000386427:D136N;ENSP00000343023:D136N;ENSP00000342729:D136N;ENSP00000386998:D101N	ENSP00000264052:D136N	D	+	1	0	SP100	231017272	0.001000	0.12720	0.002000	0.10522	0.060000	0.15804	0.865000	0.27940	1.218000	0.43458	0.557000	0.71058	GAT		0.358	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113		Missense_Mutation
KIF16B	55614	broad.mit.edu	37	20	16496271	16496271	+	Silent	SNP	T	T	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr20:16496271T>A	ENST00000354981.2	-	4	427	c.270A>T	c.(268-270)gcA>gcT	p.A90A	KIF16B_ENST00000355755.3_Silent_p.A90A|KIF16B_ENST00000408042.1_Silent_p.A90A|KIF16B_ENST00000378003.2_5'UTR	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	90	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)	p.A90A(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						AACCTTCAAATGCAGACTTCA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	20											117.0	104.0	109.0					20																	16496271		2203	4300	6503	16444271	SO:0001819	synonymous_variant	55614			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.270A>T	20.37:g.16496271T>A		Unknown		x	x	x	16444271	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1	SNP	51	Broad																																																																																				0.378	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683		Silent
PLXNB2	23654	broad.mit.edu	37	22	50720026	50720026	+	Missense_Mutation	SNP	C	C	T	rs373453904		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr22:50720026C>T	ENST00000449103.1	-	21	3631	c.3491G>A	c.(3490-3492)cGa>cAa	p.R1164Q	PLXNB2_ENST00000359337.4_Missense_Mutation_p.R1164Q|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1164		Cleavage; by proprotein convertases.			brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.R1207Q(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTGGTGTCTCGTTTCTGCCG	0.692																																																1	Substitution - Missense(1)	ovary(1)	22						C	GLN/ARG	0,4136		0,0,2068	31.0	40.0	37.0		3491	4.3	0.8	22		37	1,8371		0,1,4185	no	missense	PLXNB2	NM_012401.3	43	0,1,6253	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging	1164/1839	50720026	1,12507	2068	4186	6254	49062153	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3491G>A	22.37:g.50720026C>T	ENSP00000409171:p.Arg1164Gln	Unknown		x	x	x	49062153	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	SNP	31	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.53|13.53	2.263736|2.263736	0.39995|0.39995	0.0|0.0	1.19E-4|1.19E-4	ENSG00000196576|ENSG00000196576	ENST00000427829|ENST00000449103;ENST00000359337	.|T;T	.|0.03413	.|3.94;3.94	4.33|4.33	4.33|4.33	0.51752|0.51752	.|.	.|0.306413	.|0.22834	.|N	.|0.055080	T|T	0.07728|0.07728	0.0194|0.0194	M|M	0.68317|0.68317	2.08|2.08	0.28645|0.28645	N|N	0.906961|0.906961	.|D	.|0.60160	.|0.987	.|P	.|0.46320	.|0.512	T|T	0.31779|0.31779	-0.9931|-0.9931	5|10	.|0.13470	.|T	.|0.59	.|.	17.0107|17.0107	0.86405|0.86405	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1164	.|O15031	.|PLXB2_HUMAN	K|Q	182|1164	.|ENSP00000409171:R1164Q;ENSP00000352288:R1164Q	.|ENSP00000352288:R1164Q	E|R	-|-	1|2	0|0	PLXNB2|PLXNB2	49062153|49062153	1.000000|1.000000	0.71417|0.71417	0.765000|0.765000	0.31456|0.31456	0.053000|0.053000	0.15095|0.15095	5.359000|5.359000	0.66074|0.66074	2.252000|2.252000	0.74401|0.74401	0.561000|0.561000	0.74099|0.74099	GAG|CGA		0.692	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		Missense_Mutation
PLXNB2	23654	broad.mit.edu	37	22	50724253	50724253	+	Silent	SNP	C	C	T			TCGA-13-1409-01	TCGA-13-1409-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr22:50724253C>T	ENST00000449103.1	-	11	2204	c.2064G>A	c.(2062-2064)caG>caA	p.Q688Q	PLXNB2_ENST00000359337.4_Silent_p.Q688Q|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	688					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.Q731Q(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGTTCTTGCCCTGGAAGTTCA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	22											78.0	81.0	80.0					22																	50724253		1974	4162	6136	49066380	SO:0001819	synonymous_variant	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.2064G>A	22.37:g.50724253C>T		Somatic		x	x	x	49066380	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	9.798	1.179706	0.21787	.	.	ENSG00000196576	ENST00000434732	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	T	0.68769	0.3037	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67707	-0.5601	4	.	.	.	.	13.5784	0.61888	0.0:1.0:0.0:0.0	.	.	.	.	K	7	.	.	R	-	2	0	PLXNB2	49066380	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	3.145000	0.50623	2.275000	0.75901	0.561000	0.74099	AGG		0.657	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		Silent
PLXNB2	23654	broad.mit.edu	37	22	50724633	50724633	+	Missense_Mutation	SNP	G	G	T	rs371223423		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr22:50724633G>T	ENST00000449103.1	-	9	1986	c.1846C>A	c.(1846-1848)Cgc>Agc	p.R616S	PLXNB2_ENST00000359337.4_Missense_Mutation_p.R616S|PLXNB2_ENST00000496720.1_5'UTR			O15031	PLXB2_HUMAN	plexin B2	616					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.R659S(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ATGGCCTGGCGGCAGTCGTAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	22											93.0	112.0	105.0					22																	50724633		2108	4231	6339	49066760	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1846C>A	22.37:g.50724633G>T	ENSP00000409171:p.Arg616Ser	Unknown		x	x	x	49066760	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	37	CCDS43035.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	3.182	-0.167635	0.06461	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.02498	4.27;4.27	4.01	1.38	0.22167	.	0.638529	0.13239	N	0.403019	T	0.01489	0.0048	N	0.11313	0.125	0.30033	N	0.813311	B	0.09022	0.002	B	0.06405	0.002	T	0.42447	-0.9451	10	0.02654	T	1	.	9.1352	0.36870	0.0:0.0:0.4049:0.595	.	616	O15031	PLXB2_HUMAN	S	616	ENSP00000409171:R616S;ENSP00000352288:R616S	ENSP00000352288:R616S	R	-	1	0	PLXNB2	49066760	0.013000	0.17824	0.770000	0.31555	0.934000	0.57294	0.472000	0.22116	0.782000	0.33613	0.491000	0.48974	CGC		0.632	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401		Missense_Mutation
BSN	8927	broad.mit.edu	37	3	49680334	49680334	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr3:49680334G>T	ENST00000296452.4	+	3	1381	c.1267G>T	c.(1267-1269)Gga>Tga	p.G423*	BSN-AS1_ENST00000442384.1_RNA	NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	423					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.G423*(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AATGGGTCCTGGATCTGGACC	0.612																																																1	Substitution - Nonsense(1)	ovary(1)	3											35.0	41.0	39.0					3																	49680334		2203	4300	6503	49655338	SO:0001587	stop_gained	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.1267G>T	3.37:g.49680334G>T	ENSP00000296452:p.Gly423*	Unknown		x	x	x	49655338	O43161|Q7LGH3	Nonsense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.815152	0.96982	.	.	ENSG00000164061	ENST00000296452	.	.	.	4.79	3.89	0.44902	.	0.363325	0.19818	N	0.105395	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	10.5282	0.44960	0.0:0.0:0.806:0.194	.	.	.	.	X	423	.	ENSP00000296452:G423X	G	+	1	0	BSN	49655338	0.089000	0.21612	0.434000	0.26772	0.752000	0.42762	0.735000	0.26115	1.090000	0.41315	0.557000	0.71058	GGA		0.612	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458		Nonsense_Mutation
MON1A	84315	broad.mit.edu	37	3	49947955	49947955	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr3:49947955G>A	ENST00000417270.1	-	5	1693	c.1000C>T	c.(1000-1002)Cgc>Tgc	p.R334C	CTD-2330K9.3_ENST00000419183.1_Intron|MON1A_ENST00000455683.2_Missense_Mutation_p.R261C|MON1A_ENST00000296473.3_Missense_Mutation_p.R423C|MON1A_ENST00000483022.1_5'Flank			Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	326								p.R326C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AGCTGGTTGCGGGCCAGCAGG	0.662																																																1	Substitution - Missense(1)	ovary(1)	3											28.0	31.0	30.0					3																	49947955		2203	4299	6502	49922959	SO:0001583	missense	84315			AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000417270.1:c.1000C>T	3.37:g.49947955G>A	ENSP00000399613:p.Arg334Cys	Unknown		x	x	x	49922959	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Missense_Mutation	SNP	ENST00000417270.1	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826543	0.71143	.	.	ENSG00000164077	ENST00000296473;ENST00000417270;ENST00000455683	.	.	.	5.72	4.8	0.61643	.	0.234649	0.51477	D	0.000100	T	0.57007	0.2024	L	0.46157	1.445	0.48236	D	0.999614	D;D;D	0.76494	0.999;0.987;0.958	P;P;P	0.59221	0.854;0.502;0.713	T	0.53823	-0.8384	8	.	.	.	-6.593	8.5674	0.33547	0.0:0.1386:0.5323:0.3291	.	164;261;326	Q86VX9-3;G5E9N1;Q86VX9	.;.;MON1A_HUMAN	C	423;334;261	.	.	R	-	1	0	MON1A	49922959	0.997000	0.39634	1.000000	0.80357	0.767000	0.43475	2.930000	0.48924	2.712000	0.92718	0.555000	0.69702	CGC		0.662	MON1A-005	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000345538.2	NM_032355		Missense_Mutation
ROPN1	54763	broad.mit.edu	37	3	123695767	123695767	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr3:123695767C>A	ENST00000184183.4	-	4	518	c.178G>T	c.(178-180)Gct>Tct	p.A60S	ROPN1_ENST00000405845.3_Missense_Mutation_p.A60S	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	60						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A60S(1)		lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		TTACACAAAGCGACTCGCTCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	3											104.0	96.0	99.0					3																	123695767		2203	4300	6503	125178457	SO:0001583	missense	54763			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.178G>T	3.37:g.123695767C>A	ENSP00000184183:p.Ala60Ser	Unknown		x	x	x	125178457	D3DN99|Q9UF38	Missense_Mutation	SNP	ENST00000184183.4	37	CCDS3026.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	1.566	-0.535520	0.04082	.	.	ENSG00000065371	ENST00000184183;ENST00000405845;ENST00000467907;ENST00000460743;ENST00000495336;ENST00000496145	T;T;T;T	0.42131	0.98;0.98;0.98;1.56	4.37	-8.74	0.00838	.	1.370560	0.04501	N	0.381253	T	0.12902	0.0313	N	0.02539	-0.55	0.41976	D	0.990773	B	0.09022	0.002	B	0.09377	0.004	T	0.07654	-1.0761	10	0.10636	T	0.68	-24.3895	4.6542	0.12610	0.0904:0.1153:0.4148:0.3795	.	60	Q9HAT0	ROP1A_HUMAN	S	60	ENSP00000184183:A60S;ENSP00000385919:A60S;ENSP00000417067:A60S;ENSP00000420310:A60S	ENSP00000184183:A60S	A	-	1	0	ROPN1	125178457	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.694000	0.01915	-2.485000	0.00520	-1.172000	0.01736	GCT		0.517	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356188.2	NM_017578		Missense_Mutation
EIF2B5	8893	broad.mit.edu	37	3	183860606	183860606	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1409-01	TCGA-13-1409-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr3:183860606G>C	ENST00000273783.3	+	11	1708	c.1586G>C	c.(1585-1587)aGt>aCt	p.S529T	EIF2B5_ENST00000444495.1_Missense_Mutation_p.S529T	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	529					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.S529T(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GAAAGTGAAAGTGAGCAAAGT	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											38.0	42.0	41.0					3																	183860606		2203	4300	6503	185343300	SO:0001583	missense	8893			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.1586G>C	3.37:g.183860606G>C	ENSP00000273783:p.Ser529Thr	Somatic		x	x	x	185343300	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	g	20.1	3.931448	0.73442	.	.	ENSG00000145191	ENST00000273783;ENST00000444495;ENST00000544027	D;D	0.98150	-4.75;-4.72	5.89	5.02	0.67125	.	0.080417	0.85682	D	0.000000	D	0.97648	0.9229	M	0.65498	2.005	0.80722	D	1	P;D	0.67145	0.75;0.996	B;P	0.54759	0.236;0.76	D	0.96947	0.9692	10	0.32370	T	0.25	.	15.2412	0.73471	0.0674:0.0:0.9326:0.0	.	529;529	E9PC74;Q13144	.;EI2BE_HUMAN	T	529;529;285	ENSP00000273783:S529T;ENSP00000409142:S529T	ENSP00000273783:S529T	S	+	2	0	EIF2B5	185343300	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	7.382000	0.79729	1.499000	0.48617	0.561000	0.74099	AGT		0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1			Missense_Mutation
ADH5	128	broad.mit.edu	37	4	99993588	99993588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr4:99993588G>A	ENST00000296412.8	-	9	1155	c.1105C>T	c.(1105-1107)Cga>Tga	p.R369*		NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide									p.R369*(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		ACAACAGTTCGAATGCTGTAA	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	4											70.0	65.0	66.0					4																	99993588		1855	4112	5967	100212611	SO:0001587	stop_gained	128			M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.1105C>T	4.37:g.99993588G>A	ENSP00000296412:p.Arg369*	Somatic		x	x	x	100212611		Nonsense_Mutation	SNP	ENST00000296412.8	37	CCDS47111.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922551	0.92319	.	.	ENSG00000197894	ENST00000296412	.	.	.	3.97	3.08	0.35506	.	0.084250	0.46758	D	0.000263	.	.	.	.	.	.	0.53005	D	0.999967	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.2671	10.423	0.44361	0.0:0.0:0.8038:0.1962	.	.	.	.	X	369	.	.	R	-	1	2	ADH5	100212611	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	3.128000	0.50492	1.178000	0.42870	0.650000	0.86243	CGA		0.378	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364224.1	NM_000671		Nonsense_Mutation
CXXC4	80319	broad.mit.edu	37	4	105412305	105412305	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1409-01	TCGA-13-1409-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr4:105412305A>G	ENST00000426831.1	-	1	162	c.148T>C	c.(148-150)Tgc>Cgc	p.C50R	AC093628.1_ENST00000606234.1_RNA|AC004053.1_ENST00000500179.1_RNA|CXXC4_ENST00000394767.2_Missense_Mutation_p.C219R|CXXC4_ENST00000466963.1_Intron			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	50					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)	p.C50R(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		GCAGCGCCGCATTTGAGCTTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	4											125.0	135.0	132.0					4																	105412305		2203	4300	6503	105631754	SO:0001583	missense	80319				CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.148T>C	4.37:g.105412305A>G	ENSP00000412267:p.Cys50Arg	Somatic		x	x	x	105631754		Missense_Mutation	SNP	ENST00000426831.1	37		SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	17.46	3.395466	0.62066	.	.	ENSG00000168772	ENST00000394767;ENST00000426831	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	T	0.50871	0.1641	N	0.08118	0	0.80722	D	1	D	0.57571	0.98	D	0.69142	0.962	T	0.58736	-0.7584	8	0.51188	T	0.08	-6.564	13.1379	0.59419	1.0:0.0:0.0:0.0	.	50	Q9H2H0	CXXC4_HUMAN	R	50	.	ENSP00000378248:C50R	C	-	1	0	CXXC4	105631754	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.936000	0.70153	1.655000	0.50712	0.248000	0.18094	TGC		0.537	CXXC4-201	KNOWN	basic	protein_coding	protein_coding		NM_025212		Missense_Mutation
CDH6	1004	broad.mit.edu	37	5	31299654	31299654	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:31299654G>A	ENST00000265071.2	+	5	992	c.727G>A	c.(727-729)Ggc>Agc	p.G243S	CDH6_ENST00000514738.1_Missense_Mutation_p.G188S	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	243	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G243S(2)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GGATATGGGCGGCCAGATGGG	0.483																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	5											140.0	130.0	134.0					5																	31299654		2203	4300	6503	31335411	SO:0001583	missense	1004			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.727G>A	5.37:g.31299654G>A	ENSP00000265071:p.Gly243Ser	Somatic		x	x	x	31335411	A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	CCDS3894.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.727699	0.96847	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.49720	0.77;0.77	6.07	6.07	0.98685	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.62233	0.2411	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.99;0.999	P;D	0.69142	0.893;0.962	T	0.61950	-0.6957	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	243;243	P55285;P55285-2	CADH6_HUMAN;.	S	188;243	ENSP00000424843:G188S;ENSP00000265071:G243S	ENSP00000265071:G243S	G	+	1	0	CDH6	31335411	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	GGC		0.483	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		Missense_Mutation
PRLR	5618	broad.mit.edu	37	5	35070322	35070322	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:35070322G>A	ENST00000382002.5	-	7	1015	c.589C>T	c.(589-591)Cat>Tat	p.H197Y	PRLR_ENST00000231423.3_Missense_Mutation_p.H197Y|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000542609.1_Missense_Mutation_p.H197Y|PRLR_ENST00000348262.3_Missense_Mutation_p.H197Y|PRLR_ENST00000397391.3_Missense_Mutation_p.H126Y|PRLR_ENST00000342362.5_Missense_Mutation_p.H96Y|PRLR_ENST00000511486.1_Missense_Mutation_p.H96Y|PRLR_ENST00000513753.1_Missense_Mutation_p.H197Y|PRLR_ENST00000310101.5_Missense_Mutation_p.H197Y	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	197	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)	p.H197Y(1)		central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	TGTCCTGGATGTAGGCTGAGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	5											111.0	95.0	100.0					5																	35070322		2203	4300	6503	35106079	SO:0001583	missense	5618				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.589C>T	5.37:g.35070322G>A	ENSP00000371432:p.His197Tyr	Unknown		x	x	x	35106079	B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	CCDS3909.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	1.600	-0.526870	0.04141	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000397391;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	T;T;T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.13	-0.0505	0.13830	Fibronectin, type III (3);Long hematopoietin receptor, single chain, conserved site (1);Immunoglobulin-like fold (1);	0.532219	0.20930	N	0.083102	T	0.10423	0.0255	N	0.03930	-0.32	0.25157	N	0.990385	B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B	0.06405	0.0;0.0;0.0;0.002;0.0;0.0;0.001	T	0.30650	-0.9971	10	0.02654	T	1	-3.649	3.9764	0.09476	0.4004:0.0:0.2172:0.3825	.	197;197;96;126;197;197;197	P16471-3;P16471;P16471-2;Q8TD76;P16471-7;P16471-6;P16471-4	.;PRLR_HUMAN;.;.;.;.;.	Y	197;197;197;126;197;96;197;96;197	ENSP00000231423:H197Y;ENSP00000424841:H197Y;ENSP00000311613:H197Y;ENSP00000380546:H126Y;ENSP00000441813:H197Y;ENSP00000339213:H96Y;ENSP00000371432:H197Y;ENSP00000422556:H96Y;ENSP00000309008:H197Y	ENSP00000231423:H197Y	H	-	1	0	PRLR	35106079	1.000000	0.71417	0.994000	0.49952	0.966000	0.64601	1.938000	0.40203	-0.144000	0.11314	-0.150000	0.13652	CAT		0.433	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			Missense_Mutation
SPZ1	84654	broad.mit.edu	37	5	79617085	79617085	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:79617085G>C	ENST00000296739.4	+	1	1296	c.1051G>C	c.(1051-1053)Gag>Cag	p.E351Q		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	351					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E351Q(1)		endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		AACTCTGCAAGAGAAGCCAAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	5											85.0	80.0	81.0					5																	79617085		1841	4094	5935	79652841	SO:0001583	missense	84654				CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.1051G>C	5.37:g.79617085G>C	ENSP00000369611:p.Glu351Gln	Unknown		x	x	x	79652841	B2RA21|Q8N4P1|Q8N7E9	Missense_Mutation	SNP	ENST00000296739.4	37	CCDS43336.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580815	0.46006	.	.	ENSG00000164299	ENST00000296739	T	0.32272	1.46	4.04	1.24	0.21308	.	1.013970	0.07924	N	0.976388	T	0.22322	0.0538	L	0.43923	1.385	0.09310	N	1	P	0.37955	0.612	B	0.33750	0.169	T	0.21280	-1.0250	10	0.48119	T	0.1	-13.0592	3.8553	0.08973	0.2998:0.1811:0.5191:0.0	.	351	Q9BXG8	SPZ1_HUMAN	Q	351	ENSP00000369611:E351Q	ENSP00000369611:E351Q	E	+	1	0	SPZ1	79652841	0.006000	0.16342	0.000000	0.03702	0.315000	0.28087	0.335000	0.19806	0.266000	0.21894	0.557000	0.71058	GAG		0.393	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369322.1	NM_032567		Missense_Mutation
GEMIN5	25929	broad.mit.edu	37	5	154278854	154278854	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:154278854C>G	ENST00000285873.7	-	22	3106	c.3031G>C	c.(3031-3033)Gcc>Ccc	p.A1011P		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1011					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.A1011P(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGGGCCTTGGCAATCGCAATA	0.547																																																1	Substitution - Missense(1)	ovary(1)	5											87.0	92.0	90.0					5																	154278854		2203	4300	6503	154259047	SO:0001583	missense	25929			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.3031G>C	5.37:g.154278854C>G	ENSP00000285873:p.Ala1011Pro	Unknown		x	x	x	154259047	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802447	0.90538	.	.	ENSG00000082516	ENST00000285873	T	0.78126	-1.15	5.62	5.62	0.85841	.	0.116168	0.64402	D	0.000018	D	0.87132	0.6101	M	0.74881	2.28	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61070	0.883;0.883	D	0.88156	0.2854	10	0.87932	D	0	-10.3986	19.263	0.93975	0.0:1.0:0.0:0.0	.	1010;1011	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	P	1011	ENSP00000285873:A1011P	ENSP00000285873:A1011P	A	-	1	0	GEMIN5	154259047	1.000000	0.71417	0.997000	0.53966	0.756000	0.42949	7.219000	0.78000	2.641000	0.89580	0.655000	0.94253	GCC		0.547	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1			Missense_Mutation
RNF145	153830	broad.mit.edu	37	5	158588283	158588283	+	Silent	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:158588283G>A	ENST00000424310.2	-	10	1976	c.1617C>T	c.(1615-1617)atC>atT	p.I539I	RNF145_ENST00000518284.1_5'UTR|RNF145_ENST00000520638.1_Silent_p.I553I|RNF145_ENST00000518802.1_Silent_p.I569I|RNF145_ENST00000519865.1_Silent_p.I539I|RNF145_ENST00000274542.2_Silent_p.I567I|RNF145_ENST00000521606.2_Silent_p.I556I	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	539						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.I567I(1)		endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTGATAACAGATGGCACAAA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	5											53.0	54.0	54.0					5																	158588283		2190	4263	6453	158520861	SO:0001819	synonymous_variant	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1617C>T	5.37:g.158588283G>A		Unknown		x	x	x	158520861	B7Z903|B7Z949|E7EVI7|Q8IVP7	Silent	SNP	ENST00000424310.2	37	CCDS56390.1	SNP	33	Broad																																																																																				0.383	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726		Silent
MGAT4B	11282	broad.mit.edu	37	5	179228625	179228625	+	Missense_Mutation	SNP	T	T	G	rs201306829		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr5:179228625T>G	ENST00000292591.7	-	3	703	c.353A>C	c.(352-354)cAc>cCc	p.H118P	MGAT4B_ENST00000521305.1_5'UTR|MGAT4B_ENST00000337755.5_Missense_Mutation_p.H133P	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	118					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.H133P(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGTGGCAGGTGATGGAAGAC	0.687																																					GBM(13;414 434 4098 22176 23230)											1	Substitution - Missense(1)	ovary(1)	5											24.0	23.0	23.0					5																	179228625		2200	4299	6499	179161231	SO:0001583	missense	11282			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.353A>C	5.37:g.179228625T>G	ENSP00000292591:p.His118Pro	Unknown		x	x	x	179161231	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	37	CCDS4448.1	SNP	59	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.8|26.8	4.768332|4.768332	0.90020|0.90020	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591|ENST00000519836	T;T|.	0.42900|.	0.96;0.96|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75221|0.75221	0.3820|0.3820	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.986|.	D;P|.	0.68621|.	0.959;0.899|.	T|T	0.76661|0.76661	-0.2877|-0.2877	10|5	0.48119|.	T|.	0.1|.	-46.3423|-46.3423	14.8814|14.8814	0.70537|0.70537	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	118;133|.	Q9UQ53;A8MPR0|.	MGT4B_HUMAN;.|.	P|P	133;118|66	ENSP00000338487:H133P;ENSP00000292591:H118P|.	ENSP00000292591:H118P|.	H|T	-|-	2|1	0|0	MGAT4B|MGAT4B	179161231|179161231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	5.870000|5.870000	0.69620|0.69620	1.922000|1.922000	0.55676|0.55676	0.386000|0.386000	0.25728|0.25728	CAC|ACC		0.687	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275		Missense_Mutation
PGBD1	84547	broad.mit.edu	37	6	28264666	28264666	+	Missense_Mutation	SNP	G	G	A	rs115946459		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr6:28264666G>A	ENST00000405948.2	+	5	1136	c.716G>A	c.(715-717)cGg>cAg	p.R239Q	PGBD1_ENST00000259883.3_Missense_Mutation_p.R239Q	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	239						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R239Q(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						AGTCTGACTCGGAGGAACCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	6											114.0	105.0	108.0					6																	28264666		2203	4300	6503	28372645	SO:0001583	missense	84547			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.716G>A	6.37:g.28264666G>A	ENSP00000385213:p.Arg239Gln	Unknown		x	x	x	28372645	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	9.005	0.981134	0.18812	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01133	5.29;5.29	4.01	-0.0146	0.13980	.	1.839010	0.03458	N	0.211816	T	0.00178	0.0005	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31613	-0.9937	10	0.02654	T	1	-20.8605	4.2593	0.10733	0.6877:0.2002:0.1121:0.0	.	239	Q96JS3	PGBD1_HUMAN	Q	239	ENSP00000385213:R239Q;ENSP00000259883:R239Q	ENSP00000259883:R239Q	R	+	2	0	PGBD1	28372645	0.000000	0.05858	0.068000	0.19968	0.833000	0.47200	-0.670000	0.05256	0.282000	0.22254	-0.436000	0.05848	CGG		0.507	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2			Missense_Mutation
DDO	8528	broad.mit.edu	37	6	110729542	110729542	+	Silent	SNP	T	T	C			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr6:110729542T>C	ENST00000368924.3	-	3	375	c.360A>G	c.(358-360)gtA>gtG	p.V120V	DDO_ENST00000368923.3_Silent_p.V120V	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	92					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.V120V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CTTACCCTGATACCAAATGAA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	6											115.0	111.0	113.0					6																	110729542		2203	4300	6503	110836235	SO:0001819	synonymous_variant	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.360A>G	6.37:g.110729542T>C		Unknown		x	x	x	110836235	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Silent	SNP	ENST00000368924.3	37	CCDS5082.1	SNP	49	Broad																																																																																				0.393	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1			Silent
KIAA1244	57221	broad.mit.edu	37	6	138655880	138655880	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr6:138655880G>A	ENST00000251691.4	+	33	6063	c.5897G>A	c.(5896-5898)aGa>aAa	p.R1966K		NM_020340.4	NP_065073.3			KIAA1244									p.R1895K(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GAGGATGACAGAAGCCAGTCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	6											17.0	18.0	17.0					6																	138655880		2203	4299	6502	138697573	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5897G>A	6.37:g.138655880G>A	ENSP00000251691:p.Arg1966Lys	Unknown		x	x	x	138697573		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888722	0.33348	.	.	ENSG00000112379	ENST00000251691;ENST00000367706	T	0.15487	2.42	5.87	4.99	0.66335	.	1.041800	0.07533	N	0.912566	T	0.05686	0.0149	L	0.27053	0.805	0.30219	N	0.796995	B	0.06786	0.001	B	0.06405	0.002	T	0.18935	-1.0321	10	0.27082	T	0.32	-23.4232	11.6888	0.51503	0.1346:0.0:0.8654:0.0	.	1966	Q5TH69	BIG3_HUMAN	K	1966;131	ENSP00000251691:R1966K	ENSP00000251691:R1966K	R	+	2	0	KIAA1244	138697573	0.992000	0.36948	0.985000	0.45067	0.189000	0.23516	2.440000	0.44855	2.780000	0.95670	0.543000	0.68304	AGA		0.637	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		Missense_Mutation
PPP1R3A	5506	broad.mit.edu	37	7	113518503	113518503	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr7:113518503G>T	ENST00000284601.3	-	4	2712	c.2644C>A	c.(2644-2646)Ctt>Att	p.L882I		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	882			L -> H (in dbSNP:rs2974938). {ECO:0000269|PubMed:12690205, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7926294, ECO:0000269|PubMed:9726244}.		glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.H882N(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ACCTGCCTAAGATCTCTGTTT	0.378																																																1	Substitution - Missense(1)	ovary(1)	7											95.0	92.0	93.0					7																	113518503		2203	4299	6502	113305739	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2644C>A	7.37:g.113518503G>T	ENSP00000284601:p.Leu882Ile	Unknown		x	x	x	113305739	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	0.283	-0.984940	0.02180	.	.	ENSG00000154415	ENST00000284601	T	0.17528	2.27	5.81	3.98	0.46160	.	0.941171	0.08924	N	0.874017	T	0.12008	0.0292	L	0.38175	1.15	0.09310	N	1	B	0.31153	0.31	B	0.24974	0.057	T	0.34675	-0.9819	10	0.27785	T	0.31	0.3983	3.8701	0.09033	0.1365:0.1188:0.5652:0.1794	.	882	Q16821	PPR3A_HUMAN	I	882	ENSP00000284601:L882I	ENSP00000284601:L882I	L	-	1	0	PPP1R3A	113305739	0.005000	0.15991	0.506000	0.27664	0.215000	0.24574	0.815000	0.27253	0.750000	0.32877	0.650000	0.86243	CTT		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Missense_Mutation
ANK1	286	broad.mit.edu	37	8	41615650	41615650	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1409-01	TCGA-13-1409-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr8:41615650A>T	ENST00000347528.4	-	2	116	c.33T>A	c.(31-33)gaT>gaA	p.D11E	ANK1_ENST00000265709.8_Missense_Mutation_p.D44E|ANK1_ENST00000379758.2_Missense_Mutation_p.D11E|ANK1_ENST00000352337.4_Missense_Mutation_p.D11E|ANK1_ENST00000396942.1_Missense_Mutation_p.D11E|ANK1_ENST00000396945.1_Missense_Mutation_p.D11E|ANK1_ENST00000289734.7_Missense_Mutation_p.D11E	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	11	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.D11E(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGGTAGCAGCATCGGCCTGTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	8											203.0	195.0	198.0					8																	41615650		2203	4300	6503	41734807	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.33T>A	8.37:g.41615650A>T	ENSP00000339620:p.Asp11Glu	Somatic		x	x	x	41734807	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863660	0.51482	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.67523	-0.26;-0.27;-0.23;-0.21;-0.23;-0.23;-0.27	5.54	1.88	0.25563	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.67515	0.2901	L	0.28192	0.835	0.52501	D	0.999958	D;D;P;D;D	0.89917	0.998;1.0;0.928;0.997;1.0	D;D;P;D;D	0.91635	0.995;0.998;0.823;0.919;0.999	T	0.63111	-0.6710	10	0.42905	T	0.14	.	9.2968	0.37819	0.7952:0.0:0.2048:0.0	.	44;11;11;11;11	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	E	11;11;11;11;11;11;44;11	ENSP00000339620:D11E;ENSP00000289734:D11E;ENSP00000369082:D11E;ENSP00000380149:D11E;ENSP00000380147:D11E;ENSP00000309131:D11E;ENSP00000265709:D44E	ENSP00000265709:D44E	D	-	3	2	ANK1	41734807	1.000000	0.71417	0.938000	0.37757	0.336000	0.28762	2.628000	0.46477	0.151000	0.19162	-0.376000	0.06991	GAT		0.527	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475		Missense_Mutation
CSMD3	114788	broad.mit.edu	37	8	113392655	113392655	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr8:113392655G>T	ENST00000297405.5	-	38	6306	c.6062C>A	c.(6061-6063)aCg>aAg	p.T2021K	CSMD3_ENST00000352409.3_Missense_Mutation_p.T1951K|CSMD3_ENST00000343508.3_Missense_Mutation_p.T1981K|CSMD3_ENST00000455883.2_Missense_Mutation_p.T1917K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2021	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T2021K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATTATTAGACGTACTATTCAA	0.303										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											105.0	112.0	110.0					8																	113392655		2203	4292	6495	113461831	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6062C>A	8.37:g.113392655G>T	ENSP00000297405:p.Thr2021Lys	Somatic		x	x	x	113461831	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557217	0.86231	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000001	T	0.42698	0.1214	M	0.68317	2.08	0.53005	D	0.999967	D;D;D	0.89917	1.0;0.981;1.0	D;D;D	0.97110	0.999;0.969;1.0	T	0.05599	-1.0875	10	0.38643	T	0.18	.	19.2842	0.94065	0.0:0.0:1.0:0.0	.	1917;2021;1981	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	1981;2021;1291;1917;1951	ENSP00000345799:T1981K;ENSP00000297405:T2021K;ENSP00000341558:T1291K;ENSP00000412263:T1917K;ENSP00000343124:T1951K	ENSP00000297405:T2021K	T	-	2	0	CSMD3	113461831	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.573000	0.82421	2.654000	0.90174	0.591000	0.81541	ACG		0.303	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		Missense_Mutation
GPKOW	27238	broad.mit.edu	37	X	48976067	48976067	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chrX:48976067G>T	ENST00000156109.5	-	4	635	c.557C>A	c.(556-558)aCc>aAc	p.T186N		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	186	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.					nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.T186N(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						CTGATTGAAGGTGCGGCCGAT	0.607																																																1	Substitution - Missense(1)	ovary(1)	X											60.0	46.0	51.0					X																	48976067		2203	4300	6503	48863011	SO:0001583	missense	27238			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.557C>A	X.37:g.48976067G>T	ENSP00000156109:p.Thr186Asn	Unknown		x	x	x	48863011	Q59EK5|Q9BQA8	Missense_Mutation	SNP	ENST00000156109.5	37	CCDS35251.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670404	0.88348	.	.	ENSG00000068394	ENST00000156109	.	.	.	4.79	4.79	0.61399	D111/G-patch (2);	0.000000	0.85682	D	0.000000	T	0.52419	0.1733	N	0.12663	0.25	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.47302	-0.9128	9	0.12430	T	0.62	-3.5937	16.2578	0.82526	0.0:0.0:1.0:0.0	.	186	Q92917	GPKOW_HUMAN	N	186	.	ENSP00000156109:T186N	T	-	2	0	GPKOW	48863011	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	7.413000	0.80104	2.293000	0.77203	0.597000	0.82753	ACC		0.607	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698		Missense_Mutation
BRCC3	79184	broad.mit.edu	37	X	154299902	154299902	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1409-01	TCGA-13-1409-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chrX:154299902G>A	ENST00000369462.1	+	1	125	c.100G>A	c.(100-102)Gta>Ata	p.V34I	CMC4_ENST00000369484.3_5'Flank|MTCP1_ENST00000362018.2_Intron|BRCC3_ENST00000330045.7_Missense_Mutation_p.V34I|MTCP1_ENST00000369476.3_5'Flank|BRCC3_ENST00000369459.2_Missense_Mutation_p.V34I|MTCP1_ENST00000482244.1_5'Flank|BRCC3_ENST00000340647.4_Missense_Mutation_p.V34I|BRCC3_ENST00000399042.1_Missense_Mutation_p.V34I	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	34	MPN.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.V34I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAAGGAGGAAGTAATGGGGCT	0.612																																																1	Substitution - Missense(1)	ovary(1)	X											42.0	55.0	51.0					X																	154299902		2119	4200	6319	153953096	SO:0001583	missense	79184			X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.100G>A	X.37:g.154299902G>A	ENSP00000358474:p.Val34Ile	Somatic		x	x	x	153953096	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Missense_Mutation	SNP	ENST00000369462.1	37	CCDS56611.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970308	0.74246	.	.	ENSG00000185515	ENST00000340647;ENST00000330045;ENST00000369459;ENST00000369462;ENST00000411985;ENST00000399042;ENST00000457026	T;T;T;T;T;T	0.63580	-0.05;-0.0;-0.0;-0.0;-0.0;-0.0	4.09	4.09	0.47781	.	0.000000	0.64402	D	0.000003	T	0.67702	0.2921	L	0.52126	1.63	0.80722	D	1	D;D;D	0.55385	0.971;0.971;0.958	P;P;P	0.57911	0.629;0.629;0.829	T	0.68307	-0.5443	10	0.46703	T	0.11	-12.1638	11.407	0.49904	0.0:0.0:1.0:0.0	.	34;34;34	P46736-3;P46736-2;P46736	.;.;BRCC3_HUMAN	I	34	ENSP00000344103:V34I;ENSP00000328641:V34I;ENSP00000358471:V34I;ENSP00000358474:V34I;ENSP00000413170:V34I;ENSP00000381998:V34I	ENSP00000328641:V34I	V	+	1	0	BRCC3	153953096	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	6.750000	0.74888	1.968000	0.57251	0.600000	0.82982	GTA		0.612	BRCC3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058788.4	NM_024332		Missense_Mutation
FAM86B2	653333	broad.mit.edu	37	8	12291593	12291595	+	In_Frame_Del	DEL	CTG	CTG	-	rs146321506		TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr8:12291593_12291595delCTG	ENST00000262365.4	-	2	124_126	c.125_127delCAG	c.(124-129)tcagat>tat	p.42_43SD>Y	FAM86B2_ENST00000393715.3_Intron|FAM86B2_ENST00000309608.5_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000351291.4_In_Frame_Del_p.42_43SD>Y	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	42			D -> Y (in dbSNP:rs2684093).							endometrium(1)|kidney(2)	3						AGCTCAGAATCTGATGAGTCTCT	0.473																																																0			8																																								12335966	SO:0001651	inframe_deletion	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.125_127delCAG	8.37:g.12291593_12291595delCTG	ENSP00000262365:p.Ser42_Asp43delinsTyr	Unknown		Capture	Illumina GAIIx	Phase_I	12335964		In_Frame_Del	DEL	ENST00000262365.4	37	CCDS59092.1	DEL	32	Broad																																																																																				0.473	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_928336		In_Frame_Del
FUT7	2529	broad.mit.edu	37	9	139925497	139925498	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-13-1409-01	TCGA-13-1409-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1409-01	TCGA-13-1409-10	g.chr9:139925497_139925498delGA	ENST00000314412.6	-	2	1711_1712	c.693_694delTC	c.(691-696)tctcagfs	p.Q232fs	C9orf139_ENST00000314330.2_Intron|ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_5'Flank|ABCA2_ENST00000265662.5_5'Flank|ABCA2_ENST00000371605.3_5'Flank	NM_004479.3	NP_004470.1	Q11130	FUT7_HUMAN	fucosyltransferase 7 (alpha (1,3) fucosyltransferase)	232					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|leukocyte migration involved in immune response (GO:0002522)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.Q232fs*31(1)		NS(1)|endometrium(1)|lung(4)|ovary(1)|skin(1)	8	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TCGCGGTGCTGAGAGTTCTCAA	0.629																																																1	Deletion - Frameshift(1)	ovary(1)	9																																								139045319	SO:0001589	frameshift_variant	2529			X78031, AB012668	CCDS7022.1	9q34.3	2013-02-26			ENSG00000180549	ENSG00000180549		"""Fucosyltransferases"""	4018	protein-coding gene	gene with protein product		602030				8207002, 8182079	Standard	NM_004479		Approved		uc004ckq.2	Q11130	OTTHUMG00000020964	ENST00000314412.6:c.693_694delTC	9.37:g.139925499_139925500delGA	ENSP00000318142:p.Gln232fs	Unknown		Capture	Illumina GAIIx	Phase_I	139045318	B2R7U7|Q6DK54	Frame_Shift_Del	DEL	ENST00000314412.6	37	CCDS7022.1	DEL	45	Broad																																																																																				0.629	FUT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055220.1	NM_004479		Frame_Shift_Del
