#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
DNTTIP2	30836	broad.mit.edu	37	1	94342764	94342764	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:94342764G>A	ENST00000436063.2	-	2	784	c.727C>T	c.(727-729)Caa>Taa	p.Q243*	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Q243*(1)		NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TGGGAAGTTTGTCTGGTATCT	0.348																																																1	Substitution - Nonsense(1)	ovary(1)	1											131.0	129.0	130.0					1																	94342764		1828	4077	5905	94115352	SO:0001587	stop_gained	30836			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.727C>T	1.37:g.94342764G>A	ENSP00000411010:p.Gln243*	Unknown		x	x	x	94115352	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Nonsense_Mutation	SNP	ENST00000436063.2	37	CCDS44174.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570544	0.28003	.	.	ENSG00000067334	ENST00000436063	.	.	.	4.34	2.35	0.29111	.	1.314350	0.05767	N	0.606041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	4.6534	0.12606	0.0851:0.1503:0.6094:0.1551	.	.	.	.	X	243	.	ENSP00000352137:Q243X	Q	-	1	0	DNTTIP2	94115352	0.160000	0.22878	0.009000	0.14445	0.133000	0.20885	2.463000	0.45058	0.416000	0.25844	0.655000	0.94253	CAA		0.348	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597		Nonsense_Mutation
PEAR1	375033	broad.mit.edu	37	1	156876650	156876650	+	Missense_Mutation	SNP	C	C	T	rs139898840	byFrequency	TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:156876650C>T	ENST00000338302.3	+	7	847	c.622C>T	c.(622-624)Ccc>Tcc	p.P208S	PEAR1_ENST00000292357.7_Missense_Mutation_p.P208S			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	208					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.P208S(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGCTTCTGCCCCGCAGAGAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											36.0	37.0	37.0					1																	156876650		2203	4300	6503	155143274	SO:0001583	missense	375033			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.622C>T	1.37:g.156876650C>T	ENSP00000344465:p.Pro208Ser	Unknown		x	x	x	155143274	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995873	0.54147	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	T;T	0.23754	1.89;1.89	4.81	4.81	0.61882	EGF-like region, conserved site (1);	0.000000	0.49305	D	0.000153	T	0.13500	0.0327	L	0.49350	1.555	0.35278	D	0.781041	B	0.24721	0.11	B	0.24974	0.057	T	0.04825	-1.0924	9	.	.	.	.	15.4054	0.74874	0.0:1.0:0.0:0.0	.	208	Q5VY43	PEAR1_HUMAN	S	208	ENSP00000344465:P208S;ENSP00000292357:P208S	.	P	+	1	0	PEAR1	155143274	0.984000	0.35163	0.999000	0.59377	0.969000	0.65631	1.416000	0.34759	2.497000	0.84241	0.561000	0.74099	CCC		0.592	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471		Missense_Mutation
FCRL1	115350	broad.mit.edu	37	1	157772190	157772190	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:157772190C>A	ENST00000368176.3	-	4	651	c.584G>T	c.(583-585)gGg>gTg	p.G195V	FCRL1_ENST00000491942.1_Missense_Mutation_p.G195V|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_Missense_Mutation_p.G195V	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	195	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G195V(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCTCACCAGCCCACTGGGGCT	0.512																																					GBM(54;482 1003 11223 30131 35730)											1	Substitution - Missense(1)	ovary(1)	1											102.0	96.0	98.0					1																	157772190		2203	4300	6503	156038814	SO:0001583	missense	115350			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.584G>T	1.37:g.157772190C>A	ENSP00000357158:p.Gly195Val	Unknown		x	x	x	156038814	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	37	CCDS1170.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629466	0.28978	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.12255	2.7;2.7;2.7	5.56	-0.973	0.10297	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.790579	0.11599	N	0.547911	T	0.10035	0.0246	L	0.34521	1.04	0.34586	D	0.714961	P;P;D	0.69078	0.616;0.778;0.997	B;P;D	0.68621	0.343;0.738;0.959	T	0.32214	-0.9915	10	0.30854	T	0.27	.	8.4398	0.32808	0.0:0.356:0.0:0.644	.	195;195;195	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	V	195	ENSP00000351039:G195V;ENSP00000357158:G195V;ENSP00000418130:G195V	ENSP00000351039:G195V	G	-	2	0	FCRL1	156038814	0.000000	0.05858	0.972000	0.41901	0.574000	0.36063	-0.587000	0.05780	-0.009000	0.14296	0.655000	0.94253	GGG		0.512	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938		Missense_Mutation
ABL2	27	broad.mit.edu	37	1	179095523	179095523	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:179095523C>T	ENST00000502732.1	-	4	879	c.676G>A	c.(676-678)Gca>Aca	p.A226T	ABL2_ENST00000504405.1_Missense_Mutation_p.A190T|ABL2_ENST00000344730.3_Missense_Mutation_p.A211T|ABL2_ENST00000507173.1_Missense_Mutation_p.A205T|ABL2_ENST00000408940.3_Missense_Mutation_p.A190T|ABL2_ENST00000511413.1_Missense_Mutation_p.A226T|ABL2_ENST00000392043.3_Missense_Mutation_p.A205T|ABL2_ENST00000367623.4_Missense_Mutation_p.A205T|ABL2_ENST00000512653.1_Missense_Mutation_p.A211T	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	226	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.A190T(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TTGCCATCTGCAGTGGTATTG	0.473			T	ETV6	AML																																		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	1	Substitution - Missense(1)	ovary(1)	1											90.0	79.0	83.0					1																	179095523		2203	4300	6503	177362146	SO:0001583	missense				M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.676G>A	1.37:g.179095523C>T	ENSP00000427562:p.Ala226Thr	Somatic		x	x	x	177362146	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	12.35	1.911057	0.33721	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413;ENST00000392043	D;D;D;D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.51	-2.56	0.06268	SH2 motif (5);	0.592162	0.15085	N	0.281437	T	0.73799	0.3633	N	0.21545	0.675	0.30449	N	0.775481	B;B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B	0.04013	0.0;0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001;0.001	T	0.58064	-0.7702	10	0.27082	T	0.32	.	1.706	0.02882	0.1877:0.3352:0.1055:0.3717	.	205;205;226;190;190;205;190;226;211;190;211	P42684-6;P42684-7;P42684-5;P42684-4;P42684-9;P42684-8;P42684-2;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;.;.;.;ABL2_HUMAN;.;.;.	T	226;190;211;211;190;205;205;226;205	ENSP00000427562:A226T;ENSP00000386152:A190T;ENSP00000339209:A211T;ENSP00000423578:A211T;ENSP00000426831:A190T;ENSP00000356595:A205T;ENSP00000423413:A205T;ENSP00000424697:A226T;ENSP00000375897:A205T	ENSP00000339209:A211T	A	-	1	0	ABL2	177362146	0.094000	0.21725	0.848000	0.33437	0.650000	0.38633	-0.304000	0.08199	-0.479000	0.06813	-0.194000	0.12790	GCA		0.473	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158		Missense_Mutation
TOR1AIP1	26092	broad.mit.edu	37	1	179887039	179887039	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:179887039C>A	ENST00000606911.2	+	10	1608	c.1417C>A	c.(1417-1419)Cag>Aag	p.Q473K	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.Q474K|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.Q352K|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.Q489K			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	473	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)	p.Q473K(1)		breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						TAAGAATGGCCAGAATGCAGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											86.0	86.0	86.0					1																	179887039		2203	4300	6503	178153662	SO:0001583	missense	26092				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1417C>A	1.37:g.179887039C>A	ENSP00000476687:p.Gln473Lys	Unknown		x	x	x	178153662	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	10.41	1.343730	0.24339	.	.	ENSG00000143337	ENST00000271583;ENST00000435319	T;T	0.31510	1.49;1.49	5.96	5.0	0.66597	.	0.320977	0.33496	N	0.004848	T	0.22975	0.0555	L	0.41415	1.275	0.34402	D	0.695372	B	0.22983	0.078	B	0.26864	0.074	T	0.19031	-1.0318	9	.	.	.	-7.8485	7.316	0.26501	0.2532:0.6657:0.0:0.0811	.	473	Q5JTV8	TOIP1_HUMAN	K	489;473	ENSP00000271583:Q489K;ENSP00000393292:Q473K	.	Q	+	1	0	TOR1AIP1	178153662	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	2.455000	0.44988	2.832000	0.97577	0.655000	0.94253	CAG		0.453	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602		Missense_Mutation
PGBD5	79605	broad.mit.edu	37	1	230498072	230498072	+	Intron	SNP	T	T	C	rs531278155		TCGA-13-1494-01	TCGA-13-1494-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:230498072T>C	ENST00000525115.1	-	2	148				PGBD5_ENST00000391860.1_Intron|PGBD5_ENST00000321327.2_Missense_Mutation_p.N123S			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral component of membrane (GO:0016021)		p.N123S(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GAGGAATGGATTATAGGGCGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											70.0	72.0	71.0					1																	230498072		2203	4300	6503	228564695	SO:0001627	intron_variant	79605			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.125-5005A>G	1.37:g.230498072T>C		Somatic		x	x	x	228564695	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	1.218	-0.627787	0.03610	.	.	ENSG00000177614	ENST00000321327	T	0.18960	2.18	1.32	0.166	0.14999	.	2586.860000	0.00166	N	0.000003	T	0.07188	0.0182	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27536	-1.0071	7	0.06099	T	0.92	.	2.8467	0.05546	0.0:0.4535:0.0:0.5465	.	.	.	.	S	123	ENSP00000322530:N123S	ENSP00000322530:N123S	N	-	2	0	PGBD5	228564695	0.005000	0.15991	0.001000	0.08648	0.001000	0.01503	0.009000	0.13219	0.050000	0.15949	0.416000	0.27883	AAT		0.602	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554		Missense_Mutation
VIM	7431	broad.mit.edu	37	10	17271899	17271899	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr10:17271899C>A	ENST00000224237.5	+	1	623	c.478C>A	c.(478-480)Cag>Aag	p.Q160K	VIM-AS1_ENST00000605833.1_RNA|VIM_ENST00000485947.1_3'UTR|VIM_ENST00000544301.1_Missense_Mutation_p.Q160K			P08670	VIME_HUMAN	vimentin	160	Coil 1B.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.Q160K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGCGCCGGCAGGTGGACCA	0.652																																																1	Substitution - Missense(1)	ovary(1)	10											19.0	20.0	20.0					10																	17271899		2200	4294	6494	17311905	SO:0001583	missense	7431			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.478C>A	10.37:g.17271899C>A	ENSP00000224237:p.Gln160Lys	Unknown		x	x	x	17311905	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003923	0.74932	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.89123	-2.47;-2.47	5.14	4.21	0.49690	Filament (1);	0.000000	0.44285	D	0.000461	D	0.91054	0.7185	M	0.62088	1.915	0.80722	D	1	P;P;P;P;P	0.52842	0.912;0.743;0.931;0.956;0.912	P;P;P;P;P	0.52957	0.714;0.452;0.588;0.666;0.588	D	0.91770	0.5427	10	0.87932	D	0	.	15.3981	0.74812	0.0:0.8601:0.1399:0.0	.	160;147;147;160;160	Q53HU8;F5H288;B3KRK8;B0YJC4;P08670	.;.;.;.;VIME_HUMAN	K	160;160;147	ENSP00000446007:Q160K;ENSP00000224237:Q160K	ENSP00000224237:Q160K	Q	+	1	0	VIM	17311905	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.737000	0.84957	1.119000	0.41883	0.551000	0.68910	CAG		0.652	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380		Missense_Mutation
CSGALNACT2	55454	broad.mit.edu	37	10	43662538	43662538	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr10:43662538C>A	ENST00000374466.3	+	6	1581	c.1246C>A	c.(1246-1248)Cag>Aag	p.Q416K		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	416					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.Q416K(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ACCTGTGGAGCAGCAGCTGGT	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											63.0	59.0	60.0					10																	43662538		2203	4300	6503	42982544	SO:0001583	missense	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1246C>A	10.37:g.43662538C>A	ENSP00000363590:p.Gln416Lys	Somatic		x	x	x	42982544	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550601	0.86127	.	.	ENSG00000169826	ENST00000374466	T	0.14516	2.5	5.83	5.83	0.93111	.	0.239200	0.46442	D	0.000296	T	0.19805	0.0476	M	0.63843	1.955	0.80722	D	1	B	0.19445	0.036	B	0.18871	0.023	T	0.02512	-1.1148	10	0.30078	T	0.28	-13.794	20.1141	0.97919	0.0:1.0:0.0:0.0	.	416	Q8N6G5	CGAT2_HUMAN	K	416	ENSP00000363590:Q416K	ENSP00000363590:Q416K	Q	+	1	0	CSGALNACT2	42982544	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.554000	0.67294	2.757000	0.94681	0.591000	0.81541	CAG		0.373	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590		Missense_Mutation
PLA2G12B	84647	broad.mit.edu	37	10	74702417	74702417	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr10:74702417G>A	ENST00000373032.3	-	2	385	c.293C>T	c.(292-294)cCa>cTa	p.P98L		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	98					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.P98L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					TACACTTTCTGGTACCTTGAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	10											60.0	57.0	58.0					10																	74702417		2203	4300	6503	74372423	SO:0001583	missense	84647			AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.293C>T	10.37:g.74702417G>A	ENSP00000362123:p.Pro98Leu	Unknown		x	x	x	74372423	B7ZL23|Q52LB2|Q96Q99	Missense_Mutation	SNP	ENST00000373032.3	37	CCDS7319.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229274	0.79688	.	.	ENSG00000138308	ENST00000373032	.	.	.	5.17	5.17	0.71159	Phospholipase A2 (1);	0.120026	0.56097	D	0.000025	T	0.74627	0.3741	L	0.48362	1.52	0.58432	D	0.999997	D;D	0.71674	0.998;0.998	D;D	0.69824	0.966;0.966	T	0.76394	-0.2975	9	0.66056	D	0.02	-4.2769	19.031	0.92957	0.0:0.0:1.0:0.0	.	98;98	B7ZL23;Q9BX93	.;PG12B_HUMAN	L	98	.	ENSP00000362123:P98L	P	-	2	0	PLA2G12B	74372423	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.177000	0.89688	2.573000	0.86826	0.561000	0.74099	CCA		0.483	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048598.1	NM_032562		Missense_Mutation
C10orf12	26148	broad.mit.edu	37	10	98743854	98743854	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr10:98743854G>A	ENST00000286067.2	+	1	2814	c.2707G>A	c.(2707-2709)Gtc>Atc	p.V903I		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	903								p.V903I(1)|p.V903fs*22(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CGTTCCCCCTGTCAAGCATCC	0.448																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(2)	10											71.0	72.0	72.0					10																	98743854		2203	4300	6503	98733844	SO:0001583	missense	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.2707G>A	10.37:g.98743854G>A	ENSP00000286067:p.Val903Ile	Unknown		x	x	x	98733844	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	2.450	-0.326635	0.05350	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.06528	3.29	5.71	4.71	0.59529	.	0.634660	0.12927	N	0.427665	T	0.02610	0.0079	N	0.08118	0	0.27295	N	0.957726	B	0.31931	0.347	B	0.26416	0.069	T	0.39121	-0.9629	10	0.16896	T	0.51	-7.6895	3.2872	0.06936	0.1812:0.2925:0.5263:0.0	.	903	Q8N655	CJ012_HUMAN	I	903;737	ENSP00000286067:V903I	ENSP00000286067:V903I	V	+	1	0	C10orf12	98733844	1.000000	0.71417	0.987000	0.45799	0.190000	0.23558	3.678000	0.54627	2.718000	0.92993	0.655000	0.94253	GTC		0.448	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652		Missense_Mutation
COL17A1	1308	broad.mit.edu	37	10	105799749	105799749	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr10:105799749C>A	ENST00000353479.5	-	41	3060	c.2770G>T	c.(2770-2772)Ggc>Tgc	p.G924C	COL17A1_ENST00000369733.3_Intron	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	924	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.G924C(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCTCTGGGGCCTGGGGGACCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	83.0	85.0					10																	105799749		2203	4300	6503	105789739	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2770G>T	10.37:g.105799749C>A	ENSP00000340937:p.Gly924Cys	Somatic		x	x	x	105789739	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791167	0.70452	.	.	ENSG00000065618	ENST00000353479	D	0.84442	-1.85	4.88	4.88	0.63580	.	0.000000	0.38326	N	0.001727	D	0.94716	0.8295	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96063	0.9040	10	0.87932	D	0	-10.1577	13.5247	0.61589	0.0:1.0:0.0:0.0	.	924	Q9UMD9	COHA1_HUMAN	C	924	ENSP00000340937:G924C	ENSP00000340937:G924C	G	-	1	0	COL17A1	105789739	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.748000	0.55142	2.263000	0.75096	0.491000	0.48974	GGC		0.562	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494		Missense_Mutation
TMEM132A	54972	broad.mit.edu	37	11	60701182	60701182	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr11:60701182G>T	ENST00000453848.2	+	8	1683	c.1525G>T	c.(1525-1527)Gtc>Ttc	p.V509F	TMEM132A_ENST00000005286.4_Missense_Mutation_p.V510F			Q24JP5	T132A_HUMAN	transmembrane protein 132A	509						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.V510F(1)		breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CCTCGAGCAGGTCCGCGGCTG	0.706																																																1	Substitution - Missense(1)	ovary(1)	11											12.0	12.0	12.0					11																	60701182		2189	4272	6461	60457758	SO:0001583	missense	54972			AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1525G>T	11.37:g.60701182G>T	ENSP00000405823:p.Val509Phe	Unknown		x	x	x	60457758	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.58|14.58	2.578785|2.578785	0.46006|0.46006	.|.	.|.	ENSG00000006118|ENSG00000006118	ENST00000536409|ENST00000444690;ENST00000453848;ENST00000005286	.|T;T	.|0.21191	.|2.02;2.02	4.25|4.25	-0.734|-0.734	0.11140|0.11140	.|.	.|0.514257	.|0.17911	.|N	.|0.157831	T|T	0.25344|0.25344	0.0616|0.0616	M|M	0.61703|0.61703	1.905|1.905	0.33522|0.33522	D|D	0.592521|0.592521	.|P;P;P	.|0.49783	.|0.928;0.785;0.888	.|P;P;P	.|0.50049	.|0.494;0.546;0.629	T|T	0.36792|0.36792	-0.9733|-0.9733	5|10	.|0.87932	.|D	.|0	.|.	5.5719|5.5719	0.17202|0.17202	0.3852:0.1361:0.4787:0.0|0.3852:0.1361:0.4787:0.0	.|.	.|260;509;510	.|Q24JP5-4;Q24JP5;Q24JP5-2	.|.;T132A_HUMAN;.	V|F	100|260;509;510	.|ENSP00000405823:V509F;ENSP00000005286:V510F	.|ENSP00000005286:V510F	G|V	+|+	2|1	0|0	TMEM132A|TMEM132A	60457758|60457758	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.950000|0.950000	0.60333|0.60333	2.102000|2.102000	0.41796|0.41796	-0.250000|-0.250000	0.09555|0.09555	0.555000|0.555000	0.69702|0.69702	GGT|GTC		0.706	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870		Missense_Mutation
CD248	57124	broad.mit.edu	37	11	66082550	66082550	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr11:66082550C>A	ENST00000311330.3	-	1	1965	c.1949G>T	c.(1948-1950)gGc>gTc	p.G650V	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	650	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)	p.G650V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GGGACTGGGGCCATCTTCCCT	0.642																																																1	Substitution - Missense(1)	ovary(1)	11											33.0	37.0	36.0					11																	66082550		2199	4290	6489	65839126	SO:0001583	missense	57124			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1949G>T	11.37:g.66082550C>A	ENSP00000308117:p.Gly650Val	Unknown		x	x	x	65839126	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	CCDS8134.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	2.967	-0.213385	0.06140	.	.	ENSG00000174807	ENST00000311330	D	0.87887	-2.31	3.46	-1.57	0.08506	.	27.615500	0.00751	N	0.001063	T	0.71745	0.3376	N	0.03608	-0.345	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.61936	-0.6960	10	0.28530	T	0.3	1.3133	7.1728	0.25728	0.118:0.4595:0.4226:0.0	.	650	Q9HCU0	CD248_HUMAN	V	650	ENSP00000308117:G650V	ENSP00000308117:G650V	G	-	2	0	CD248	65839126	0.000000	0.05858	0.001000	0.08648	0.423000	0.31445	-0.246000	0.08878	-0.144000	0.11314	0.467000	0.42956	GGC		0.642	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404		Missense_Mutation
CACNA2D4	93589	broad.mit.edu	37	12	1910775	1910775	+	Silent	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:1910775G>C	ENST00000382722.5	-	30	3119	c.2757C>G	c.(2755-2757)gtC>gtG	p.V919V	CACNA2D4_ENST00000586184.1_Silent_p.V919V|CACNA2D4_ENST00000585708.1_Silent_p.V855V|CACNA2D4_ENST00000538027.2_Silent_p.V64V|CACNA2D4_ENST00000587995.1_Silent_p.V894V|CACNA2D4_ENST00000588077.1_Silent_p.V855V|CACNA2D4_ENST00000538450.1_Silent_p.V49V	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	919					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.V919V(1)		endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GCTGGGTCAGGACAGCACCAT	0.587																																					Colon(2;101 179 21030 23310 28141)											1	Substitution - coding silent(1)	ovary(1)	12											59.0	62.0	61.0					12																	1910775		2035	4176	6211	1781036	SO:0001819	synonymous_variant	93589			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2757C>G	12.37:g.1910775G>C		Unknown		x	x	x	1781036	Q7Z3S8|Q86XZ5|Q8IZS9	Silent	SNP	ENST00000382722.5	37	CCDS44785.1	SNP	41	Broad																																																																																				0.587	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398230.2			Silent
ANO6	196527	broad.mit.edu	37	12	45797240	45797240	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:45797240C>T	ENST00000320560.8	+	15	2003	c.1801C>T	c.(1801-1803)Ctt>Ttt	p.L601F	ANO6_ENST00000425752.2_Missense_Mutation_p.L601F|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000423947.3_Missense_Mutation_p.L622F|ANO6_ENST00000435642.1_Missense_Mutation_p.L601F|ANO6_ENST00000441606.2_Missense_Mutation_p.L583F	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	601					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)	p.L601F(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AGGTGGCTGTCTTCTTGAACT	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											105.0	105.0	105.0					12																	45797240		2203	4300	6503	44083507	SO:0001583	missense	196527			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.1801C>T	12.37:g.45797240C>T	ENSP00000320087:p.Leu601Phe	Unknown		x	x	x	44083507	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	37	CCDS31782.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154402	0.78114	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.81786	0.4896	M	0.82193	2.58	0.80722	D	1	D;P;D;D	0.89917	1.0;0.933;1.0;0.999	D;P;D;D	0.97110	1.0;0.838;0.996;0.991	T	0.82356	-0.0498	10	0.54805	T	0.06	.	19.916	0.97063	0.0:1.0:0.0:0.0	.	583;622;601;601	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	F	601;622;601;601;583	ENSP00000391417:L601F;ENSP00000409126:L622F;ENSP00000413840:L601F;ENSP00000320087:L601F;ENSP00000413137:L583F	ENSP00000320087:L601F	L	+	1	0	ANO6	44083507	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.037000	0.70956	2.882000	0.98803	0.655000	0.94253	CTT		0.343	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743		Missense_Mutation
NUP37	79023	broad.mit.edu	37	12	102512173	102512173	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1494-01	TCGA-13-1494-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:102512173T>C	ENST00000552283.1	-	2	263	c.124A>G	c.(124-126)Aat>Gat	p.N42D	PARPBP_ENST00000537257.1_5'Flank|PARPBP_ENST00000543784.1_5'Flank|PARPBP_ENST00000327680.2_5'Flank|PARPBP_ENST00000378128.3_5'Flank|PARPBP_ENST00000541394.1_5'Flank|PARPBP_ENST00000358383.5_5'Flank|PARPBP_ENST00000392911.2_5'Flank|NUP37_ENST00000251074.1_Missense_Mutation_p.N42D|NUP37_ENST00000543021.1_5'UTR			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	42					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)		p.N42D(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						ACCACATAATTATTGCCACCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											243.0	217.0	226.0					12																	102512173		2203	4300	6503	101036303	SO:0001583	missense	79023			AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.124A>G	12.37:g.102512173T>C	ENSP00000448054:p.Asn42Asp	Somatic		x	x	x	101036303	Q9H644	Missense_Mutation	SNP	ENST00000552283.1	37	CCDS9089.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	14.58	2.576517	0.45902	.	.	ENSG00000075188	ENST00000552283;ENST00000251074;ENST00000551744;ENST00000550459	T;T;T	0.30448	1.53;1.53;2.72	5.55	4.38	0.52667	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.186148	0.56097	D	0.000022	T	0.16854	0.0405	L	0.34521	1.04	0.33733	D	0.618423	P;B	0.38922	0.651;0.055	B;B	0.30401	0.115;0.021	T	0.18209	-1.0344	10	0.02654	T	1	-18.2959	11.9148	0.52759	0.0:0.0:0.2755:0.7245	.	42;42	B4DKV8;Q8NFH4	.;NUP37_HUMAN	D	42	ENSP00000448054:N42D;ENSP00000251074:N42D;ENSP00000448086:N42D	ENSP00000251074:N42D	N	-	1	0	NUP37	101036303	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.786000	0.47790	0.900000	0.36469	0.528000	0.53228	AAT		0.398	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409330.1	NM_024057		Missense_Mutation
PAH	5053	broad.mit.edu	37	12	103238138	103238138	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:103238138G>A	ENST00000553106.1	-	10	1513	c.1041C>T	c.(1039-1041)ctC>ctT	p.L347L	PAH_ENST00000307000.2_Silent_p.L342L	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	347			L -> F (in PKU).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.L347L(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	AGGATGACAGGAGCCCAGCAC	0.423																																																1	Substitution - coding silent(1)	ovary(1)	12											108.0	95.0	99.0					12																	103238138		2203	4300	6503	101762268	SO:0001819	synonymous_variant	5053			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1041C>T	12.37:g.103238138G>A		Unknown		x	x	x	101762268	Q16717|Q8TC14	Silent	SNP	ENST00000553106.1	37	CCDS9092.1	SNP	41	Broad																																																																																				0.423	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1			Silent
ACAD10	80724	broad.mit.edu	37	12	112184010	112184010	+	Silent	SNP	A	A	G			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:112184010A>G	ENST00000313698.4	+	14	2333	c.2178A>G	c.(2176-2178)aaA>aaG	p.K726K	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Silent_p.K328K|ACAD10_ENST00000455480.2_Silent_p.K757K	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	726						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.K726K(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						ATCCCGAGAAAAAATACGGAG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	12											112.0	111.0	111.0					12																	112184010		2203	4300	6503	110668393	SO:0001819	synonymous_variant	80724			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2178A>G	12.37:g.112184010A>G		Unknown		x	x	x	110668393	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	ENST00000313698.4	37	CCDS31903.1	SNP	1	Broad																																																																																				0.473	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		Silent
RASAL1	8437	broad.mit.edu	37	12	113552608	113552608	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr12:113552608G>A	ENST00000261729.5	-	13	1493	c.1178C>T	c.(1177-1179)aCc>aTc	p.T393I	RASAL1_ENST00000446861.3_Missense_Mutation_p.T393I|RASAL1_ENST00000546530.1_Missense_Mutation_p.T393I|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.T393I			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	393	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						TGCTCACCGGGTGCGGCCCAG	0.612																																																0			12											228.0	230.0	229.0					12																	113552608		2203	4300	6503	112036991	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1178C>T	12.37:g.113552608G>A	ENSP00000261729:p.Thr393Ile	Unknown		x	x	x	112036991	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371679	0.61624	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	4.43	4.43	0.53597	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.435795	0.23250	N	0.050246	T	0.78253	0.4254	L	0.43152	1.355	0.26618	N	0.972701	P;P;P;P;B;B;P	0.49307	0.922;0.824;0.905;0.922;0.257;0.302;0.905	P;P;P;P;B;B;P	0.53360	0.511;0.529;0.48;0.724;0.139;0.219;0.48	T	0.71237	-0.4652	10	0.49607	T	0.09	.	11.8157	0.52209	0.0:0.178:0.822:0.0	.	393;393;393;405;393;393;393	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	I	393	ENSP00000450244:T393I;ENSP00000261729:T393I;ENSP00000395920:T393I;ENSP00000448510:T393I	ENSP00000261729:T393I	T	-	2	0	RASAL1	112036991	0.185000	0.23213	0.568000	0.28447	0.912000	0.54170	2.368000	0.44222	2.014000	0.59158	0.313000	0.20887	ACC		0.612	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Missense_Mutation
AMER2	219287	broad.mit.edu	37	13	25744713	25744713	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr13:25744713C>A	ENST00000515384.1	-	1	1712	c.1045G>T	c.(1045-1047)Gcc>Tcc	p.A349S	AMER2_ENST00000381853.3_Intron|AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000357816.2_Intron			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	349					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										TCGACAGAGGCAGGGTCTggg	0.617																																																0			13											22.0	26.0	25.0					13																	25744713		1050	2137	3187	24642713	SO:0001583	missense	219287			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1045G>T	13.37:g.25744713C>A	ENSP00000426528:p.Ala349Ser	Unknown		x	x	x	24642713	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	37	CCDS53859.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.080996	0.00371	.	.	ENSG00000165566	ENST00000515384	T	0.14144	2.53	3.71	-2.39	0.06602	.	.	.	.	.	T	0.02342	0.0072	N	0.00308	-1.67	0.50632	D	0.999881	B	0.06786	0.001	B	0.06405	0.002	T	0.49881	-0.8892	9	0.05525	T	0.97	.	8.9091	0.35541	0.2668:0.6126:0.0:0.1206	.	349	Q8N7J2	F123A_HUMAN	S	349	ENSP00000426528:A349S	ENSP00000426528:A349S	A	-	1	0	FAM123A	24642713	0.993000	0.37304	0.361000	0.25849	0.259000	0.26198	0.336000	0.19823	-0.540000	0.06265	-0.521000	0.04368	GCC		0.617	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704		Missense_Mutation
EVL	51466	broad.mit.edu	37	14	100594935	100594935	+	Silent	SNP	A	A	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr14:100594935A>C	ENST00000402714.2	+	6	1165	c.561A>C	c.(559-561)ccA>ccC	p.P187P	EVL_ENST00000392920.3_Silent_p.P189P|EVL_ENST00000544450.2_Silent_p.P193P			Q9UI08	EVL_HUMAN	Enah/Vasp-like	187	Pro-rich.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.P189P(2)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				cgccccccccacccccagtcc	0.682																																																2	Substitution - coding silent(2)	ovary(2)	14											7.0	8.0	7.0					14																	100594935		2148	4137	6285	99664688	SO:0001819	synonymous_variant	51466			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.561A>C	14.37:g.100594935A>C		Unknown		x	x	x	99664688	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Silent	SNP	ENST00000402714.2	37		SNP	6	Broad																																																																																				0.682	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000413958.1			Silent
TP53	7157	broad.mit.edu	37	17	7579374	7579374	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr17:7579374C>A	ENST00000269305.4	-	4	502	c.313G>T	c.(313-315)Ggc>Tgc	p.G105C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G105C|TP53_ENST00000445888.2_Missense_Mutation_p.G105C|TP53_ENST00000420246.2_Missense_Mutation_p.G105C|TP53_ENST00000359597.4_Missense_Mutation_p.G105C|TP53_ENST00000413465.2_Missense_Mutation_p.G105C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	105	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in a sporadic cancer; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G105C(5)|p.Q100fs*37(3)|p.G59fs*23(3)|p.G105R(2)|p.G105fs*18(1)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G105S(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y103_L111>L(1)|p.Y103fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTAGCTGCCCTGGTAGGTT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Deletion - Frameshift(12)|Substitution - Missense(8)|Whole gene deletion(8)|Complex - deletion inframe(2)|Deletion - In frame(1)	ovary(6)|lung(5)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|central_nervous_system(3)|liver(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	17	GRCh37	CM043949	TP53	M							55.0	55.0	55.0					17																	7579374		2203	4300	6503	7520099	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.313G>T	17.37:g.7579374C>A	ENSP00000269305:p.Gly105Cys	Unknown		x	x	x	7520099	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500135	0.64298	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99901	-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65;-7.65	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	M	0.90870	3.155	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.995;0.998;1.0;1.0;0.999;1.0	D	0.96097	0.9066	10	0.87932	D	0	-24.4789	15.6419	0.77012	0.0:1.0:0.0:0.0	.	66;105;105;105;105;105;105	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	105	ENSP00000410739:G105C;ENSP00000352610:G105C;ENSP00000269305:G105C;ENSP00000398846:G105C;ENSP00000391127:G105C;ENSP00000391478:G105C;ENSP00000424104:G105C;ENSP00000426252:G105C	ENSP00000269305:G105C	G	-	1	0	TP53	7520099	1.000000	0.71417	0.206000	0.23566	0.368000	0.29767	6.208000	0.72165	2.630000	0.89119	0.655000	0.94253	GGC		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
RNF43	54894	broad.mit.edu	37	17	56440900	56440900	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr17:56440900G>C	ENST00000584437.1	-	3	2392	c.437C>G	c.(436-438)gCt>gGt	p.A146G	BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000500597.2_Missense_Mutation_p.A105G|RNF43_ENST00000407977.2_Missense_Mutation_p.A146G|RNF43_ENST00000577625.1_Missense_Mutation_p.A19G|RNF43_ENST00000583753.1_Missense_Mutation_p.A105G|RNF43_ENST00000577716.1_Missense_Mutation_p.A146G|RNF43_ENST00000581868.1_Missense_Mutation_p.A19G			Q68DV7	RNF43_HUMAN	ring finger protein 43	146					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A146G(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCAGCAGCAGCTCGATCCTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	17											131.0	127.0	128.0					17																	56440900		2203	4300	6503	53795899	SO:0001583	missense	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.437C>G	17.37:g.56440900G>C	ENSP00000463069:p.Ala146Gly	Unknown		x	x	x	53795899	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.79	2.641501	0.47153	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.08634	3.22;3.07	5.4	5.4	0.78164	.	0.486358	0.21159	N	0.079182	T	0.04679	0.0127	N	0.08118	0	0.26548	N	0.973957	B;B;B	0.24823	0.016;0.112;0.022	B;B;B	0.17722	0.013;0.019;0.006	T	0.39099	-0.9630	10	0.19590	T	0.45	-23.8096	12.9115	0.58182	0.0:0.2691:0.7308:0.0	.	105;146;146	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	G	146;105	ENSP00000385328:A146G;ENSP00000441969:A105G	ENSP00000385328:A146G	A	-	2	0	RNF43	53795899	0.912000	0.30974	1.000000	0.80357	0.988000	0.76386	1.418000	0.34782	2.531000	0.85337	0.591000	0.81541	GCT		0.597	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763		Missense_Mutation
CYP2A7	1549	broad.mit.edu	37	19	41384841	41384841	+	Splice_Site	SNP	G	G	T	rs145739973		TCGA-13-1494-01	TCGA-13-1494-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr19:41384841G>T	ENST00000301146.4	-	5	1196	c.655C>A	c.(655-657)Ctc>Atc	p.L219I	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Splice_Site_p.L168I	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	219						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.L219I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ATCTCATAGAGCTGGGGTTGC	0.517													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18757	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19						G	ILE/LEU,ILE/LEU	1,4405		0,1,2202	26.0	25.0	25.0		655,502	1.1	0.9	19	dbSNP_134	25	0,8586		0,0,4293	no	missense-near-splice,missense-near-splice	CYP2A7	NM_000764.2,NM_030589.2	5,5	0,1,6495	TT,TG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	219/495,168/444	41384841	1,12991	2203	4293	6496	46076681	SO:0001630	splice_region_variant	1549			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.655-1C>A	19.37:g.41384841G>T		Somatic		x	x	x	46076681	Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	CCDS12569.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964916	0.53507	2.27E-4	0.0	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.70516	-0.49;-0.49	2.18	1.11	0.20524	.	0.216882	0.36740	N	0.002435	T	0.59649	0.2209	L	0.28192	0.835	0.24891	N	0.992161	B;P;P	0.48998	0.392;0.918;0.811	B;B;P	0.50896	0.359;0.382;0.653	T	0.50021	-0.8876	10	0.42905	T	0.14	.	5.5435	0.17051	0.2879:0.0:0.7121:0.0	.	219;168;219	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	I	219;168	ENSP00000301146:L219I;ENSP00000291764:L168I	ENSP00000291764:L168I	L	-	1	0	CYP2A7	46076681	0.998000	0.40836	0.939000	0.37840	0.495000	0.33615	0.359000	0.20233	1.215000	0.43411	0.184000	0.17185	CTC		0.517	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	Missense_Mutation	Missense_Mutation
PTOV1	53635	broad.mit.edu	37	19	50357716	50357716	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr19:50357716G>A	ENST00000601675.1	+	2	329	c.225G>A	c.(223-225)ggG>ggA	p.G75G	PTOV1-AS1_ENST00000596521.1_RNA|PTOV1_ENST00000391842.1_Silent_p.G75G|AC018766.5_ENST00000593654.1_RNA|MIR4749_ENST00000578197.1_RNA|PTOV1_ENST00000600603.1_Silent_p.G43G|PTOV1_ENST00000221557.9_Silent_p.G43G|PTOV1_ENST00000599732.1_Silent_p.G75G|PTOV1_ENST00000601638.1_Silent_p.G43G|AC018766.6_ENST00000601211.1_RNA|PTOV1_ENST00000598325.1_3'UTR			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.G75G(1)		endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CCTCACCTGGGCTCACCCTCG	0.672																																																1	Substitution - coding silent(1)	ovary(1)	19											74.0	83.0	80.0					19																	50357716		2203	4300	6503	55049528	SO:0001819	synonymous_variant	53635			AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.225G>A	19.37:g.50357716G>A		Unknown		x	x	x	55049528	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Silent	SNP	ENST00000601675.1	37	CCDS12782.1	SNP	42	Broad																																																																																				0.672	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465347.1	NM_017432		Silent
EPS8L1	54869	broad.mit.edu	37	19	55597530	55597530	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr19:55597530G>A	ENST00000201647.6	+	16	1676	c.1620G>A	c.(1618-1620)ctG>ctA	p.L540L	EPS8L1_ENST00000245618.5_Silent_p.L413L|EPS8L1_ENST00000540810.1_Silent_p.L476L|EPS8L1_ENST00000586329.1_Intron|EPS8L1_ENST00000588359.1_Silent_p.L226L	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	540	Pro-rich.				positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)	p.L540L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GACCCCGGCTGCACCACAGCC	0.642																																					Ovarian(149;255 1863 3636 27051 29647)											1	Substitution - coding silent(1)	ovary(1)	19											53.0	59.0	57.0					19																	55597530		2203	4300	6503	60289342	SO:0001819	synonymous_variant	54869			AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.1620G>A	19.37:g.55597530G>A		Unknown		x	x	x	60289342	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Silent	SNP	ENST00000201647.6	37	CCDS12914.1	SNP	46	Broad																																																																																				0.642	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729		Silent
WDR35	57539	broad.mit.edu	37	2	20114036	20114036	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr2:20114036G>C	ENST00000345530.3	-	27	3272	c.3157C>G	c.(3157-3159)Ctt>Gtt	p.L1053V	WDR35_ENST00000416055.2_Intron|WDR35_ENST00000281405.4_Missense_Mutation_p.L1042V	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	1053					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.L1053V(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAGGTGAAGAGCTAAGAAA	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											61.0	64.0	63.0					2																	20114036		2203	4300	6503	19977517	SO:0001583	missense	57539			AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.3157C>G	2.37:g.20114036G>C	ENSP00000314444:p.Leu1053Val	Unknown		x	x	x	19977517	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222244	0.39300	.	.	ENSG00000118965	ENST00000345530;ENST00000281405	T;T	0.66099	-0.19;-0.19	5.53	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.63780	0.2540	L	0.58428	1.81	0.80722	D	1	P;B	0.45044	0.849;0.01	P;B	0.47251	0.542;0.035	T	0.61491	-0.7052	10	0.25751	T	0.34	-18.1536	13.994	0.64386	0.073:0.0:0.927:0.0	.	1042;1053	Q9P2L0-2;Q9P2L0	.;WDR35_HUMAN	V	1053;1042	ENSP00000314444:L1053V;ENSP00000281405:L1042V	ENSP00000281405:L1042V	L	-	1	0	WDR35	19977517	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	6.392000	0.73213	1.480000	0.48289	-0.137000	0.14449	CTT		0.393	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779		Missense_Mutation
MPHOSPH10	10199	broad.mit.edu	37	2	71357836	71357836	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr2:71357836G>C	ENST00000244230.2	+	1	393	c.41G>C	c.(40-42)tGt>tCt	p.C14S	MCEE_ENST00000244217.5_5'Flank|MPHOSPH10_ENST00000468427.1_3'UTR|MPHOSPH10_ENST00000498451.2_Missense_Mutation_p.C14S	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	14					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.C14S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CTGGAGCGGTGTCTGACGGAA	0.677																																																1	Substitution - Missense(1)	ovary(1)	2											24.0	24.0	24.0					2																	71357836		2203	4297	6500	71211344	SO:0001583	missense	10199			X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.41G>C	2.37:g.71357836G>C	ENSP00000244230:p.Cys14Ser	Unknown		x	x	x	71211344	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630345	0.46944	.	.	ENSG00000124383	ENST00000244230	T	0.10382	2.88	3.75	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.25494	0.0620	L	0.55481	1.735	0.80722	D	1	D;D	0.76494	0.982;0.999	P;D	0.80764	0.814;0.994	T	0.00553	-1.1674	10	0.72032	D	0.01	.	11.3654	0.49668	0.0:0.0:1.0:0.0	.	14;14	B3KPV5;O00566	.;MPP10_HUMAN	S	14	ENSP00000244230:C14S	ENSP00000244230:C14S	C	+	2	0	MPHOSPH10	71211344	0.989000	0.36119	0.994000	0.49952	0.034000	0.12701	4.590000	0.61013	2.366000	0.80165	0.557000	0.71058	TGT		0.677	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791		Missense_Mutation
TRAK2	66008	broad.mit.edu	37	2	202245678	202245678	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr2:202245678G>A	ENST00000332624.3	-	16	2761	c.2333C>T	c.(2332-2334)cCa>cTa	p.P778L		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	778					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)	p.P778L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						TGGTGAATTTGGTGGTGTGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											151.0	144.0	146.0					2																	202245678		2203	4300	6503	201953923	SO:0001583	missense	66008			AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.2333C>T	2.37:g.202245678G>A	ENSP00000328875:p.Pro778Leu	Unknown		x	x	x	201953923	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	ENST00000332624.3	37	CCDS2347.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.212216	0.95069	.	.	ENSG00000115993	ENST00000332624;ENST00000542292	T	0.53423	0.62	6.03	6.03	0.97812	Trafficking kinesin-binding protein domain (1);	0.063750	0.64402	D	0.000005	T	0.69269	0.3092	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68911	-0.5284	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	778	O60296	TRAK2_HUMAN	L	778;684	ENSP00000328875:P778L	ENSP00000328875:P778L	P	-	2	0	TRAK2	201953923	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.721000	0.84768	2.861000	0.98227	0.655000	0.94253	CCA		0.512	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049		Missense_Mutation
BMPR2	659	broad.mit.edu	37	2	203421039	203421039	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1494-01	TCGA-13-1494-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr2:203421039T>C	ENST00000374580.4	+	12	3190	c.2651T>C	c.(2650-2652)cTg>cCg	p.L884P	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	884					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.L884P(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GAAGGTGTTCTGGATCGTCTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	2											123.0	120.0	121.0					2																	203421039		2203	4300	6503	203129284	SO:0001583	missense	659			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.2651T>C	2.37:g.203421039T>C	ENSP00000363708:p.Leu884Pro	Somatic		x	x	x	203129284	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	16.21	3.057808	0.55325	.	.	ENSG00000204217	ENST00000374580	D	0.90133	-2.62	6.08	6.08	0.98989	.	0.095855	0.44902	D	0.000415	D	0.90542	0.7036	N	0.24115	0.695	0.80722	D	1	D	0.65815	0.995	P	0.59221	0.854	D	0.90774	0.4674	10	0.42905	T	0.14	.	16.6512	0.85203	0.0:0.0:0.0:1.0	.	884	Q13873	BMPR2_HUMAN	P	884	ENSP00000363708:L884P	ENSP00000363708:L884P	L	+	2	0	BMPR2	203129284	1.000000	0.71417	0.992000	0.48379	0.757000	0.42996	6.193000	0.72075	2.333000	0.79357	0.482000	0.46254	CTG		0.468	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204		Missense_Mutation
COL6A3	1293	broad.mit.edu	37	2	238275648	238275648	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr2:238275648C>A	ENST00000295550.4	-	11	5634	c.5182G>T	c.(5182-5184)Gta>Tta	p.V1728L	COL6A3_ENST00000347401.3_Missense_Mutation_p.V1527L|COL6A3_ENST00000472056.1_Missense_Mutation_p.V1121L|COL6A3_ENST00000409809.1_Missense_Mutation_p.V1522L|COL6A3_ENST00000353578.4_Missense_Mutation_p.V1522L|COL6A3_ENST00000346358.4_Missense_Mutation_p.V1528L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1728	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V1728L(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AAGTGGTTTACCCGCAGGTGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											75.0	67.0	69.0					2																	238275648		2203	4300	6503	237940387	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5182G>T	2.37:g.238275648C>A	ENSP00000295550:p.Val1728Leu	Unknown		x	x	x	237940387	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	2.719	-0.266948	0.05754	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	5.56	-4.04	0.04010	von Willebrand factor, type A (3);	2.425220	0.01647	N	0.024372	T	0.56187	0.1968	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.16396	0.017;0.002;0.0	B;B;B	0.18871	0.023;0.006;0.0	T	0.48885	-0.8995	10	0.28530	T	0.3	.	10.3032	0.43665	0.0:0.2695:0.2549:0.4757	.	1121;1522;1728	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	L	1728;1527;1522;1121;1522;1528	ENSP00000295550:V1728L;ENSP00000315609:V1527L;ENSP00000315873:V1522L;ENSP00000418285:V1121L;ENSP00000386844:V1522L;ENSP00000295546:V1528L	ENSP00000295550:V1728L	V	-	1	0	COL6A3	237940387	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-0.790000	0.04604	-0.543000	0.06240	-0.929000	0.02709	GTA		0.557	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Missense_Mutation
BCL2L13	23786	broad.mit.edu	37	22	18209790	18209790	+	Silent	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr22:18209790C>T	ENST00000317582.5	+	7	1295	c.948C>T	c.(946-948)ccC>ccT	p.P316P	BCL2L13_ENST00000538149.1_Silent_p.P192P|BCL2L13_ENST00000485631.1_3'UTR|BCL2L13_ENST00000337612.5_Silent_p.P154P|BCL2L13_ENST00000418951.2_3'UTR|BCL2L13_ENST00000543133.1_Silent_p.P154P|BCL2L13_ENST00000355028.3_3'UTR	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	316	Glu-rich.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)	p.P316P(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		AAGAGGTGCCCGAGGGCATGG	0.537																																																1	Substitution - coding silent(1)	ovary(1)	22											51.0	50.0	50.0					22																	18209790		2203	4300	6503	16589790	SO:0001819	synonymous_variant	23786			AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.948C>T	22.37:g.18209790C>T		Somatic		x	x	x	16589790	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Silent	SNP	ENST00000317582.5	37	CCDS13746.1	SNP	23	Broad																																																																																				0.537	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1	NM_015367		Silent
SULT4A1	25830	broad.mit.edu	37	22	44258238	44258239	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr22:44258238_44258239GG>CT	ENST00000330884.4	-	1	144_145	c.24_25CC>AG	c.(22-27)acCCcc>acAGcc	p.P9A	SULT4A1_ENST00000540422.1_Missense_Mutation_p.P9A|SULT4A1_ENST00000249130.5_Missense_Mutation_p.P9A	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	9					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.P9A(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		GGGGTGCTGGGGGTCTCGGCCT	0.762																																																1	Substitution - Missense(1)	ovary(1)	22																																								42589572	SO:0001583	missense	25830			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.24_25delinsCT	22.37:g.44258238_44258239delinsCT	ENSP00000332565:p.Pro9Ala	Unknown		x	x	x	42589571	B2R7N3|O43728	Missense_Mutation	DNP	ENST00000330884.4	37	CCDS14051.1	DNP	43	Broad																																																																																				0.762	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280660.2	NM_014351		Missense_Mutation
TTLL8	164714	broad.mit.edu	37	22	50483713	50483713	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr22:50483713G>T	ENST00000266182.6	-	6	613	c.614C>A	c.(613-615)gCc>gAc	p.A205D	TTLL8_ENST00000440475.1_Missense_Mutation_p.A205D|TTLL8_ENST00000477219.1_5'Flank			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	241					cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)	p.A205D(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		GCTGCTCCCGGCCTCCTCCCT	0.701																																																1	Substitution - Missense(1)	ovary(1)	22											32.0	36.0	34.0					22																	50483713		2172	4271	6443	48825840	SO:0001583	missense	164714					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.614C>A	22.37:g.50483713G>T	ENSP00000266182:p.Ala205Asp	Unknown		x	x	x	48825840	B5MDV0	Missense_Mutation	SNP	ENST00000266182.6	37		SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	7.765	0.706172	0.15239	.	.	ENSG00000138892	ENST00000266182;ENST00000440475;ENST00000433387	T;T;T	0.50548	3.56;0.74;0.74	4.29	0.65	0.17812	.	1.953450	0.02892	N	0.134261	T	0.31167	0.0788	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.11155	-1.0599	10	0.15499	T	0.54	.	4.4233	0.11492	0.11:0.0:0.4931:0.3969	.	205	B5MDV0	.	D	205;205;241	ENSP00000266182:A205D;ENSP00000387509:A205D;ENSP00000392252:A241D	ENSP00000266182:A205D	A	-	2	0	TTLL8	48825840	0.030000	0.19436	0.043000	0.18650	0.025000	0.11179	1.005000	0.29834	0.526000	0.28541	0.394000	0.25966	GCC		0.701	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001080447		Missense_Mutation
ATP2B2	491	broad.mit.edu	37	3	10417222	10417222	+	Silent	SNP	G	G	A	rs371159930		TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr3:10417222G>A	ENST00000352432.4	-	10	1377	c.1308C>T	c.(1306-1308)taC>taT	p.Y436Y	ATP2B2_ENST00000397077.1_Silent_p.Y391Y|ATP2B2_ENST00000383800.4_Silent_p.Y391Y|ATP2B2_ENST00000360273.2_Silent_p.Y436Y|ATP2B2_ENST00000343816.4_Silent_p.Y422Y			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	436					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.Y391Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AGTACTGCACGTAGACGGGCG	0.577																																					Ovarian(125;1619 1709 15675 19819 38835)											1	Substitution - coding silent(1)	ovary(1)	3						G	,	0,4406		0,0,2203	93.0	83.0	86.0		1308,1173	-0.6	1.0	3		86	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	ATP2B2	NM_001001331.2,NM_001683.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	436/1244,391/1199	10417222	1,13005	2203	4300	6503	10392222	SO:0001819	synonymous_variant	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1308C>T	3.37:g.10417222G>A		Unknown		x	x	x	10392222	O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	37	CCDS33701.1	SNP	40	Broad																																																																																				0.577	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		Silent
GOLGB1	2804	broad.mit.edu	37	3	121416861	121416861	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr3:121416861G>C	ENST00000340645.5	-	13	2619	c.2494C>G	c.(2494-2496)Ctg>Gtg	p.L832V	GOLGB1_ENST00000393667.3_Missense_Mutation_p.L837V	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	832					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.L832V(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CTTCTTATCAGGGTACTCTGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	3											109.0	115.0	113.0					3																	121416861		2203	4300	6503	122899551	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.2494C>G	3.37:g.121416861G>C	ENSP00000341848:p.Leu832Val	Unknown		x	x	x	122899551	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448882	0.26074	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	T;T;T	0.23552	2.49;2.49;1.9	4.81	1.85	0.25348	.	0.314743	0.23053	N	0.052479	T	0.25606	0.0623	L	0.56769	1.78	0.09310	N	1	P;P;P;P;P	0.51653	0.933;0.933;0.933;0.729;0.947	B;B;B;B;P	0.47299	0.413;0.413;0.413;0.288;0.543	T	0.10291	-1.0636	10	0.30078	T	0.28	.	5.6768	0.17753	0.2001:0.1576:0.6423:0.0	.	757;796;837;837;832	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	V	832;837;796;644	ENSP00000341848:L832V;ENSP00000377275:L837V;ENSP00000418231:L796V	ENSP00000341848:L832V	L	-	1	2	GOLGB1	122899551	0.048000	0.20356	0.084000	0.20598	0.888000	0.51559	1.101000	0.31037	0.171000	0.19730	0.655000	0.94253	CTG		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		Missense_Mutation
IGSF10	285313	broad.mit.edu	37	3	151161562	151161562	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr3:151161562C>T	ENST00000282466.3	-	5	5172	c.5173G>A	c.(5173-5175)Gca>Aca	p.A1725T		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1725	Ig-like C2-type 3.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.A1725T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGATTGGATGCGGAACACAAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	96.0	101.0					3																	151161562		2203	4300	6503	152644252	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5173G>A	3.37:g.151161562C>T	ENSP00000282466:p.Ala1725Thr	Unknown		x	x	x	152644252	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092039	0.76756	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.76448	-1.02	5.25	5.25	0.73442	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000219	D	0.91143	0.7211	M	0.92412	3.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92953	0.6382	9	.	.	.	.	18.8313	0.92141	0.0:1.0:0.0:0.0	.	1725	Q6WRI0	IGS10_HUMAN	T	1725;352	ENSP00000282466:A1725T	.	A	-	1	0	IGSF10	152644252	1.000000	0.71417	0.921000	0.36526	0.318000	0.28184	7.760000	0.85248	2.458000	0.83093	0.585000	0.79938	GCA		0.507	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		Missense_Mutation
MSX1	4487	broad.mit.edu	37	4	4864494	4864494	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr4:4864494T>G	ENST00000382723.4	+	2	770	c.536T>G	c.(535-537)tTc>tGc	p.F179C	MSX1_ENST00000468421.1_3'UTR	NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	179					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.F179C(1)		endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CGGACGCCCTTCACCACCGCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	4											53.0	65.0	61.0					4																	4864494		2199	4294	6493	4915395	SO:0001583	missense	4487			M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.536T>G	4.37:g.4864494T>G	ENSP00000372170:p.Phe179Cys	Unknown		x	x	x	4915395	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	23.0	4.356458	0.82243	.	.	ENSG00000163132	ENST00000382723	D	0.97352	-4.35	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98770	0.9586	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99761	1.1021	10	0.87932	D	0	-12.3835	14.7291	0.69368	0.0:0.0:0.0:1.0	.	173	P28360	MSX1_HUMAN	C	179	ENSP00000372170:F179C	ENSP00000372170:F179C	F	+	2	0	MSX1	4915395	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	7.856000	0.86956	1.937000	0.56155	0.379000	0.24179	TTC		0.637	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3			Missense_Mutation
KLKB1	3818	broad.mit.edu	37	4	187153389	187153389	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr4:187153389G>A	ENST00000264690.6	+	3	354	c.167G>A	c.(166-168)aGg>aAg	p.R56K	KLKB1_ENST00000513864.1_Missense_Mutation_p.R56K	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	56	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.R56K(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TTCCACCCAAGGTGTTTGCTA	0.418																																																1	Substitution - Missense(1)	ovary(1)	4											150.0	130.0	136.0					4																	187153389		2203	4300	6503	187390383	SO:0001583	missense	3818			M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.167G>A	4.37:g.187153389G>A	ENSP00000264690:p.Arg56Lys	Unknown		x	x	x	187390383	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	37	CCDS34120.1	SNP	35	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.52|15.52	2.857855|2.857855	0.51376|0.51376	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000511608|ENST00000428196;ENST00000264690;ENST00000446598;ENST00000414291;ENST00000513864;ENST00000418715	.|D;D;D;D;D	.|0.88741	.|-2.42;-2.42;-2.42;-2.42;-2.42	5.25|5.25	3.53|3.53	0.40419|0.40419	.|Apple domain (2);PAN-1 domain (1);Apple-like (1);	.|0.189176	.|0.36234	.|N	.|0.002715	D|D	0.92146|0.92146	0.7510|0.7510	M|M	0.67953|0.67953	2.075|2.075	0.24187|0.24187	N|N	0.995562|0.995562	.|D;D	.|0.69078	.|0.996;0.997	.|D;D	.|0.87578	.|0.998;0.992	D|D	0.84119|0.84119	0.0405|0.0405	5|10	.|0.48119	.|T	.|0.1	.|.	8.5253|8.5253	0.33302|0.33302	0.0827:0.1538:0.7634:0.0|0.0827:0.1538:0.7634:0.0	.|.	.|18;56	.|E7EQA8;P03952	.|.;KLKB1_HUMAN	S|K	104|56;56;18;18;56;18	.|ENSP00000412366:R56K;ENSP00000264690:R56K;ENSP00000415563:R18K;ENSP00000392231:R18K;ENSP00000424469:R56K	.|ENSP00000264690:R56K	G|R	+|+	1|2	0|0	KLKB1|KLKB1	187390383|187390383	0.989000|0.989000	0.36119|0.36119	0.665000|0.665000	0.29768|0.29768	0.315000|0.315000	0.28087|0.28087	2.119000|2.119000	0.41958|0.41958	0.794000|0.794000	0.33899|0.33899	-0.253000|-0.253000	0.11424|0.11424	GGT|AGG		0.418	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892		Missense_Mutation
SLC6A3	6531	broad.mit.edu	37	5	1432744	1432744	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr5:1432744G>A	ENST00000270349.9	-	4	615	c.488C>T	c.(487-489)gCg>gTg	p.A163V	SLC6A3_ENST00000453492.2_Missense_Mutation_p.A163V	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	163					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.A163V(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ATAGTGCAGCGCCCAGGCGAT	0.592																																																1	Substitution - Missense(1)	ovary(1)	5											150.0	134.0	140.0					5																	1432744		2203	4300	6503	1485744	SO:0001583	missense	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.488C>T	5.37:g.1432744G>A	ENSP00000270349:p.Ala163Val	Unknown		x	x	x	1485744	A2RUN4|Q14996	Missense_Mutation	SNP	ENST00000270349.9	37	CCDS3863.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908828	0.92107	.	.	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	T;T;T	0.77750	-1.12;-1.12;-1.12	4.34	4.34	0.51931	.	0.119767	0.56097	D	0.000034	D	0.83064	0.5173	L	0.48218	1.51	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	D	0.84812	0.0791	10	0.66056	D	0.02	.	14.4007	0.67044	0.0:0.0:1.0:0.0	.	163	Q01959	SC6A3_HUMAN	V	163;163;89	ENSP00000270349:A163V;ENSP00000399806:A163V;ENSP00000429101:A89V	ENSP00000270349:A163V	A	-	2	0	SLC6A3	1485744	1.000000	0.71417	0.963000	0.40424	0.968000	0.65278	7.048000	0.76606	2.237000	0.73441	0.591000	0.81541	GCG		0.592	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044		Missense_Mutation
IL13	3596	broad.mit.edu	37	5	131993883	131993883	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr5:131993883A>G	ENST00000304506.3	+	1	19	c.5A>G	c.(4-6)cAt>cGt	p.H2R	IL13_ENST00000468334.1_Intron|AC004041.2_ENST00000435042.1_RNA|AC004041.2_ENST00000458509.1_RNA|AC004041.2_ENST00000417516.1_RNA	NM_002188.2	NP_002179.2	P35225	IL13_HUMAN	interleukin 13	2					cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cellular response to cytokine stimulus (GO:0071345)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of lung ciliated cell differentiation (GO:1901247)|negative regulation of transforming growth factor beta production (GO:0071635)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of connective tissue growth factor production (GO:0032723)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of lung goblet cell differentiation (GO:1901251)|positive regulation of macrophage activation (GO:0043032)|positive regulation of pancreatic stellate cell proliferation (GO:2000231)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat6 protein (GO:0042526)|regulation of proton transport (GO:0010155)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)|ovary(1)|skin(3)	6		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGCCTATGCATCCGCTCCTC	0.572											OREG0003464	type=REGULATORY REGION|Gene=IL13|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			5											113.0	88.0	96.0					5																	131993883		2203	4300	6503	132021782	SO:0001583	missense	3596			U31120	CCDS4157.1	5q31	2011-07-14			ENSG00000169194	ENSG00000169194		"""Interleukins and interleukin receptors"""	5973	protein-coding gene	gene with protein product	"""allergic rhinitis"", ""Bronchial hyperresponsiveness-1 (bronchial asthma)"""	147683					Standard	NM_002188		Approved	P600, IL-13, ALRH, BHR1, MGC116786, MGC116788, MGC116789	uc003kxj.1	P35225	OTTHUMG00000059723	ENST00000304506.3:c.5A>G	5.37:g.131993883A>G	ENSP00000304915:p.His2Arg	Unknown	1592	x	x	x	132021782	O43644|Q4VB52|Q9UDC7	Missense_Mutation	SNP	ENST00000304506.3	37	CCDS4157.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	G	11.93	1.786030	0.31593	.	.	ENSG00000169194	ENST00000304506	T	0.46451	0.87	5.13	-5.23	0.02798	.	1.392810	0.04752	N	0.424624	T	0.14700	0.0355	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15037	-1.0451	10	0.87932	D	0	0.869	1.4627	0.02399	0.4134:0.1978:0.2527:0.1361	.	2	P35225	IL13_HUMAN	R	2	ENSP00000304915:H2R	ENSP00000304915:H2R	H	+	2	0	IL13	132021782	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.881000	0.01626	-1.207000	0.02637	-1.569000	0.00873	CAT		0.572	IL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132782.1	NM_002188		Missense_Mutation
ITK	3702	broad.mit.edu	37	5	156672999	156672999	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr5:156672999G>A	ENST00000422843.3	+	15	1775	c.1623G>A	c.(1621-1623)gtG>gtA	p.V541V	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.V541V(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	AGTCCGATGTGTGGTCATTTG	0.527			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - coding silent(1)	ovary(1)	5											188.0	177.0	181.0					5																	156672999		2203	4300	6503	156605577	SO:0001819	synonymous_variant	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1623G>A	5.37:g.156672999G>A		Somatic		x	x	x	156605577	B2R752|Q32ML7	Silent	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	48	Broad																																																																																				0.527	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Silent
CDHR2	54825	broad.mit.edu	37	5	176013008	176013008	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr5:176013008C>T	ENST00000510636.1	+	20	3062	c.2788C>T	c.(2788-2790)Cct>Tct	p.P930S	CDHR2_ENST00000261944.5_Missense_Mutation_p.P930S|CDHR2_ENST00000506348.1_Missense_Mutation_p.P930S	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	930	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P930T(2)|p.P930S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CTATTTTCTGCCTGAGAATAA	0.522																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	5											127.0	113.0	118.0					5																	176013008		2203	4300	6503	175945614	SO:0001583	missense	54825			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2788C>T	5.37:g.176013008C>T	ENSP00000424565:p.Pro930Ser	Unknown		x	x	x	175945614	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	3.259	-0.151660	0.06585	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.37235	1.21;1.21;1.21	4.72	3.78	0.43462	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.40423	0.1116	M	0.66939	2.045	0.09310	N	1	D	0.57899	0.981	P	0.52109	0.69	T	0.23226	-1.0194	9	0.08837	T	0.75	-7.7258	7.1394	0.25548	0.2667:0.4652:0.2681:0.0	.	930	Q9BYE9	CDHR2_HUMAN	S	930	ENSP00000424565:P930S;ENSP00000261944:P930S;ENSP00000421078:P930S	ENSP00000261944:P930S	P	+	1	0	CDHR2	175945614	0.735000	0.28153	0.797000	0.32132	0.168000	0.22595	0.968000	0.29357	2.170000	0.68504	0.478000	0.44815	CCT		0.522	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675		Missense_Mutation
EXOC2	55770	broad.mit.edu	37	6	553866	553866	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr6:553866G>A	ENST00000230449.4	-	21	2244	c.2109C>T	c.(2107-2109)ttC>ttT	p.F703F	EXOC2_ENST00000448181.3_Silent_p.F298F	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	703					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.F703F(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		AGGTCAAGCTGAAGTCTTCAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	6											131.0	118.0	123.0					6																	553866		2203	4300	6503	498866	SO:0001819	synonymous_variant	55770			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.2109C>T	6.37:g.553866G>A		Unknown		x	x	x	498866	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Silent	SNP	ENST00000230449.4	37	CCDS34327.1	SNP	45	Broad																																																																																				0.373	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303		Silent
WRNIP1	56897	broad.mit.edu	37	6	2785293	2785293	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr6:2785293A>T	ENST00000380773.4	+	7	1984	c.1775A>T	c.(1774-1776)gAg>gTg	p.E592V	WRNIP1_ENST00000380769.4_Missense_Mutation_p.E372V|WRNIP1_ENST00000380771.4_Missense_Mutation_p.E567V|WRNIP1_ENST00000380764.1_Missense_Mutation_p.E208V	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1									p.E592V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				AAGTCCATTGAGGTGTACAGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											86.0	80.0	82.0					6																	2785293		2203	4300	6503	2730292	SO:0001583	missense	56897			AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1775A>T	6.37:g.2785293A>T	ENSP00000370150:p.Glu592Val	Unknown		x	x	x	2730292		Missense_Mutation	SNP	ENST00000380773.4	37	CCDS4475.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	20.1	3.940996	0.73557	.	.	ENSG00000124535	ENST00000380773;ENST00000380771;ENST00000380769;ENST00000380764	T;T;T	0.47177	0.85;0.9;0.89	5.8	5.8	0.92144	MgsA AAA+ ATPase C-terminal (1);	0.140285	0.64402	D	0.000005	T	0.48786	0.1519	L	0.55834	1.745	0.54753	D	0.999986	D;P	0.63880	0.993;0.599	P;B	0.59288	0.855;0.356	T	0.55515	-0.8129	10	0.66056	D	0.02	-26.4272	11.3569	0.49621	0.8485:0.1515:0.0:0.0	.	567;592	Q96S55-2;Q96S55	.;WRIP1_HUMAN	V	592;567;372;208	ENSP00000370150:E592V;ENSP00000370148:E567V;ENSP00000370146:E372V	ENSP00000370141:E208V	E	+	2	0	WRNIP1	2730292	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.839000	0.69395	2.213000	0.71641	0.477000	0.44152	GAG		0.577	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039641.1	NM_130395		Missense_Mutation
MICAL1	64780	broad.mit.edu	37	6	109768384	109768384	+	Silent	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr6:109768384G>A	ENST00000358807.3	-	17	2430	c.2119C>T	c.(2119-2121)Ctg>Ttg	p.L707L	MICAL1_ENST00000368952.4_Silent_p.L726L|MICAL1_ENST00000358577.3_Silent_p.L621L	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	707	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.L707L(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AGGCGTTCCAGGACATAGAGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	6											124.0	124.0	124.0					6																	109768384		2203	4300	6503	109875077	SO:0001819	synonymous_variant	64780			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2119C>T	6.37:g.109768384G>A		Unknown		x	x	x	109875077	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Silent	SNP	ENST00000358807.3	37	CCDS5076.1	SNP	35	Broad																																																																																				0.627	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765		Silent
CHMP7	91782	broad.mit.edu	37	8	23118058	23118058	+	Silent	SNP	C	C	T			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr8:23118058C>T	ENST00000397677.1	+	11	1956	c.1308C>T	c.(1306-1308)gtC>gtT	p.V436V	CHMP7_ENST00000313219.7_Silent_p.V436V	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	436					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)	p.V436V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CAGGTTTGGTCCCAAGCAGTA	0.418																																																1	Substitution - coding silent(1)	ovary(1)	8											132.0	132.0	132.0					8																	23118058		2203	4300	6503	23174003	SO:0001819	synonymous_variant	91782			BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.1308C>T	8.37:g.23118058C>T		Unknown		x	x	x	23174003	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Silent	SNP	ENST00000397677.1	37	CCDS6040.1	SNP	30	Broad																																																																																				0.418	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254717.1	NM_152272		Silent
LRP12	29967	broad.mit.edu	37	8	105521276	105521276	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr8:105521276G>C	ENST00000276654.5	-	3	271	c.163C>G	c.(163-165)Cga>Gga	p.R55G	LRP12_ENST00000424843.2_Missense_Mutation_p.R36G	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	55	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R55G(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGGTGCTCGTATTTGCTCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	8											144.0	138.0	140.0					8																	105521276		2203	4300	6503	105590452	SO:0001583	missense	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.163C>G	8.37:g.105521276G>C	ENSP00000276654:p.Arg55Gly	Unknown		x	x	x	105590452	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936726	0.52972	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523830	T;T	0.18338	2.22;2.22	5.44	4.45	0.53987	CUB (5);	0.062565	0.64402	D	0.000009	T	0.19927	0.0479	L	0.35341	1.055	0.80722	D	1	P;B;B	0.43169	0.8;0.095;0.116	P;B;B	0.48304	0.573;0.084;0.137	T	0.00624	-1.1639	10	0.40728	T	0.16	-9.7109	13.7976	0.63180	0.0:0.0:0.737:0.263	.	36;36;55	Q68DE8;Q9Y561-2;Q9Y561	.;.;LRP12_HUMAN	G	36;55;55	ENSP00000399148:R36G;ENSP00000276654:R55G	ENSP00000276654:R55G	R	-	1	2	LRP12	105590452	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	2.439000	0.44846	2.711000	0.92665	0.561000	0.74099	CGA		0.408	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		Missense_Mutation
EXT1	2131	broad.mit.edu	37	8	118830689	118830689	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1494-01	TCGA-13-1494-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr8:118830689A>C	ENST00000378204.2	-	7	2423	c.1617T>G	c.(1615-1617)atT>atG	p.I539M		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	539					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.I539M(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TCTCTCCTTCAATGACGACGA	0.527			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	1	Substitution - Missense(1)	ovary(1)	8											152.0	147.0	148.0					8																	118830689		2203	4300	6503	118899870	SO:0001583	missense	2131	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1617T>G	8.37:g.118830689A>C	ENSP00000367446:p.Ile539Met	Somatic		x	x	x	118899870	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	a	17.51	3.407213	0.62399	.	.	ENSG00000182197	ENST00000378204	T	0.80738	-1.41	5.44	0.324	0.15898	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	M	0.81497	2.545	0.46774	D	0.999194	P	0.46142	0.873	P	0.51945	0.685	T	0.77895	-0.2417	10	0.56958	D	0.05	-11.809	4.3118	0.10974	0.5698:0.0:0.2022:0.228	.	539	Q16394	EXT1_HUMAN	M	539	ENSP00000367446:I539M	ENSP00000367446:I539M	I	-	3	3	EXT1	118899870	0.365000	0.25006	1.000000	0.80357	0.986000	0.74619	-0.210000	0.09345	0.115000	0.18071	-0.490000	0.04691	ATT		0.527	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127		Missense_Mutation
IKBKAP	8518	broad.mit.edu	37	9	111651666	111651666	+	Silent	SNP	C	C	G			TCGA-13-1494-01	TCGA-13-1494-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr9:111651666C>G	ENST00000374647.5	-	29	3475	c.3168G>C	c.(3166-3168)ctG>ctC	p.L1056L	IKBKAP_ENST00000467959.1_5'UTR|IKBKAP_ENST00000537196.1_Silent_p.L707L	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	1056					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)	p.L1056L(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TCTGCTCAACCAGCTTTCCTG	0.418																																																1	Substitution - coding silent(1)	ovary(1)	9											135.0	129.0	131.0					9																	111651666		2203	4300	6503	110691487	SO:0001819	synonymous_variant	8518			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.3168G>C	9.37:g.111651666C>G		Somatic		x	x	x	110691487	Q5JSV2|Q9H327|Q9UG87	Silent	SNP	ENST00000374647.5	37	CCDS6773.1	SNP	21	Broad																																																																																				0.418	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1			Silent
CCDC120	90060	broad.mit.edu	37	X	48925242	48925242	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chrX:48925242G>A	ENST00000376396.3	+	10	1706	c.1487G>A	c.(1486-1488)aGc>aAc	p.S496N	CCDC120_ENST00000496529.2_Missense_Mutation_p.S496N|CCDC120_ENST00000603986.1_Missense_Mutation_p.S531N|CCDC120_ENST00000536628.2_Missense_Mutation_p.S484N|CCDC120_ENST00000597275.1_Missense_Mutation_p.S496N|CCDC120_ENST00000422185.2_Missense_Mutation_p.S496N	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	496	Pro-rich.							p.S496N(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						GCAGCTGACAGCAACAGCCCC	0.701																																																1	Substitution - Missense(1)	ovary(1)	X											14.0	15.0	15.0					X																	48925242		2196	4285	6481	48812186	SO:0001583	missense	90060			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.1487G>A	X.37:g.48925242G>A	ENSP00000365577:p.Ser496Asn	Unknown		x	x	x	48812186	B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	CCDS14316.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	5.885	0.347435	0.11126	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	4.71	3.76	0.43208	.	0.361431	0.23964	N	0.042827	T	0.16557	0.0398	N	0.08118	0	0.09310	N	1	B;B;B;B	0.17667	0.023;0.023;0.023;0.023	B;B;B;B	0.18263	0.021;0.021;0.021;0.021	T	0.08229	-1.0732	9	0.30854	T	0.27	-17.31	6.0766	0.19919	0.0:0.1853:0.5872:0.2275	.	484;531;484;496	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	N	496;496;484	.	ENSP00000365577:S496N	S	+	2	0	CCDC120	48812186	0.041000	0.20044	0.868000	0.34077	0.376000	0.30014	1.490000	0.35573	2.175000	0.68902	0.529000	0.55759	AGC		0.701	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626		Missense_Mutation
STARD8	9754	broad.mit.edu	37	X	67937370	67937370	+	Missense_Mutation	SNP	G	G	A	rs140071140	byFrequency	TCGA-13-1494-01	TCGA-13-1494-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chrX:67937370G>A	ENST00000252336.6	+	5	746	c.374G>A	c.(373-375)cGt>cAt	p.R125H	STARD8_ENST00000374597.3_Missense_Mutation_p.R125H|STARD8_ENST00000374599.3_Missense_Mutation_p.R205H	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	125					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)	p.R125H(2)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AAGCGCCATCGTAACCGTAGC	0.622													g|||	1	0.000264901	0.0	0.0	3775	,	,		13945	0.0		0.001	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(2)	X							HIS/ARG,HIS/ARG,HIS/ARG	0,3835		0,0,1632,571	67.0	57.0	60.0		614,374,374	0.4	0.0	X	dbSNP_134	60	3,6725		0,3,2425,1872	yes	missense,missense,missense	STARD8	NM_001142503.2,NM_001142504.2,NM_014725.4	29,29,29	0,3,4057,2443	AA,AG,GG,G		0.0446,0.0,0.0284	benign,benign,benign	205/1104,125/1024,125/1024	67937370	3,10560	2203	4300	6503	67854095	SO:0001583	missense	9754			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.374G>A	X.37:g.67937370G>A	ENSP00000252336:p.Arg125His	Somatic		x	x	x	67854095	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	CCDS14390.1	SNP	40	Broad	2	0.0012055455093429777	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	g	6.479	0.456537	0.12283	0.0	4.46E-4	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.10860	2.83;2.89;2.83	4.39	0.403	0.16350	.	0.907784	0.09385	N	0.809409	T	0.09291	0.0229	L	0.37850	1.14	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.34304	-0.9834	10	0.62326	D	0.03	.	7.5428	0.27748	0.5995:0.0:0.4005:0.0	.	205;125	Q92502-2;Q92502	.;STAR8_HUMAN	H	125;205;125	ENSP00000252336:R125H;ENSP00000363727:R205H;ENSP00000363725:R125H	ENSP00000252336:R125H	R	+	2	0	STARD8	67854095	0.000000	0.05858	0.002000	0.10522	0.174000	0.22865	0.441000	0.21611	-0.267000	0.09325	0.597000	0.82753	CGT		0.622	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		Missense_Mutation
LPAR4	2846	broad.mit.edu	37	X	78010858	78010858	+	Silent	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chrX:78010858C>A	ENST00000435339.3	+	2	878	c.492C>A	c.(490-492)atC>atA	p.I164I		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	164					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.I164I(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						GTGTCTGGATCCTAGTCCTCA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	X											153.0	104.0	121.0					X																	78010858		2203	4300	6503	77897514	SO:0001819	synonymous_variant	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.492C>A	X.37:g.78010858C>A		Unknown		x	x	x	77897514	B2RAC7|O15132|Q502U9|Q6NSP5	Silent	SNP	ENST00000435339.3	37	CCDS14441.1	SNP	30	Broad																																																																																				0.468	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296		Silent
DCAF12L1	139170	broad.mit.edu	37	X	125685274	125685274	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chrX:125685274C>A	ENST00000371126.1	-	1	1560	c.1318G>T	c.(1318-1320)Gag>Tag	p.E440*		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	440								p.E440*(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						AGCTTCATCTCAGGCCAGTTG	0.552																																																1	Substitution - Nonsense(1)	ovary(1)	X											114.0	112.0	113.0					X																	125685274		2203	4300	6503	125512955	SO:0001587	stop_gained	139170			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1318G>T	X.37:g.125685274C>A	ENSP00000360167:p.Glu440*	Somatic		x	x	x	125512955	Q8IYK3	Nonsense_Mutation	SNP	ENST00000371126.1	37	CCDS14610.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.287261	0.95517	.	.	ENSG00000198889	ENST00000371126	.	.	.	4.0	2.21	0.28008	.	0.214040	0.23716	N	0.045265	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	6.1003	0.20043	0.1861:0.7069:0.0:0.1069	.	.	.	.	X	440	.	ENSP00000360167:E440X	E	-	1	0	DCAF12L1	125512955	1.000000	0.71417	0.049000	0.19019	0.298000	0.27526	5.116000	0.64661	0.462000	0.27095	0.513000	0.50165	GAG		0.552	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470		Nonsense_Mutation
BCORL1	63035	broad.mit.edu	37	X	129162663	129162663	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chrX:129162663C>A	ENST00000218147.7	+	8	4329	c.4132C>A	c.(4132-4134)Ctc>Atc	p.L1378I	BCORL1_ENST00000540052.1_Missense_Mutation_p.L1378I|BCORL1_ENST00000303743.5_Missense_Mutation_p.L1378I|BCORL1_ENST00000359304.2_Missense_Mutation_p.L1248I			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1378					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L1378I(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GGAGCACCGCCTCAGGAACAG	0.498											OREG0019921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	X											125.0	131.0	129.0					X																	129162663		2203	4300	6503	128990344	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4132C>A	X.37:g.129162663C>A	ENSP00000218147:p.Leu1378Ile	Unknown	1570	x	x	x	128990344	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	SNP	24	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.886043|4.886043	0.91814|0.91814	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.46819|.	0.86;1.23;1.0;0.86;1.3|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.000000|.	0.33057|.	N|.	0.005325|.	T|T	0.55097|0.55097	0.1899|0.1899	N|N	0.24115|0.24115	0.695|0.695	0.48511|0.48511	D|D	0.999669|0.999669	D;D;D|.	0.71674|.	0.998;0.998;0.979|.	D;D;P|.	0.64042|.	0.921;0.915;0.628|.	T|T	0.50372|0.50372	-0.8836|-0.8836	10|5	0.35671|.	T|.	0.21|.	-15.9859|-15.9859	17.8106|17.8106	0.88614|0.88614	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1248;1378;1378|.	Q5H9F3-2;Q5H9F3-3;Q5H9F3|.	.;.;BCORL_HUMAN|.	I|H	1378;1378;1248;1378;978|683	ENSP00000218147:L1378I;ENSP00000307541:L1378I;ENSP00000352253:L1248I;ENSP00000437775:L1378I;ENSP00000399483:L978I|.	ENSP00000218147:L1378I|.	L|P	+|+	1|2	0|0	BCORL1|BCORL1	128990344|128990344	0.970000|0.970000	0.33590|0.33590	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	1.603000|1.603000	0.36794|0.36794	2.480000|2.480000	0.83734|0.83734	0.600000|0.600000	0.82982|0.82982	CTC|CCT		0.498	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		Missense_Mutation
NBPF10	100132406	broad.mit.edu	37	1	145327546	145327550	+	Frame_Shift_Del	DEL	TGAAT	TGAAT	-	rs202019968		TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:145327546_145327550delTGAAT	ENST00000342960.5	+	32	4138_4142	c.4103_4107delTGAAT	c.(4102-4107)ctgaatfs	p.LN1368fs	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	711						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGGACTCACTGAATAGATGTTATT	0.473																																																0			1																																								144038907	SO:0001589	frameshift_variant	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.4103_4107delTGAAT	1.37:g.145327546_145327550delTGAAT	ENSP00000345684:p.Leu1368fs	Unknown		Capture	Illumina GAIIx	Phase_I	144038903	Q5RHC0|Q9NWN6	Frame_Shift_Del	DEL	ENST00000342960.5	37	CCDS53355.1	DEL	55	Broad																																																																																				0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703		Frame_Shift_Del
SUSD4	55061	broad.mit.edu	37	1	223536702	223536703	+	In_Frame_Ins	INS	-	-	TGC	rs371162328|rs568360954|rs143929528	byFrequency	TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr1:223536702_223536703insTGC	ENST00000343846.3	-	1	698_699	c.65_66insGCA	c.(64-66)caa>caGCAa	p.22_22Q>QQ	SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000484758.2_In_Frame_Ins_p.22_22Q>QQ|SUSD4_ENST00000366878.4_In_Frame_Ins_p.22_22Q>QQ|SUSD4_ENST00000344029.6_In_Frame_Ins_p.22_22Q>QQ|SUSD4_ENST00000494793.2_In_Frame_Ins_p.22_22Q>QQ|SUSD4_ENST00000366877.3_In_Frame_Ins_p.22_22Q>QQ|SUSD4_ENST00000454695.2_5'UTR			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	22						integral component of membrane (GO:0016021)		p.Q22R(2)|p.Q22delQ(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GGGACTGAGGTtgctgctgctg	0.574																																																4	Substitution - Missense(2)|Deletion - In frame(2)	large_intestine(4)	1																																								221603326	SO:0001652	inframe_insertion	55061			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.63_65dupGCA	1.37:g.223536709_223536711dupTGC	ENSP00000344219:p.Gln22dup	Unknown		Capture	Illumina GAIIx	Phase_I	221603325	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	In_Frame_Ins	INS	ENST00000343846.3	37	CCDS41471.1	INS	60	Broad																																																																																				0.574	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982		In_Frame_Ins
RCOR2	283248	broad.mit.edu	37	11	63681914	63681934	+	In_Frame_Del	DEL	CCAGCCGCCGGGCCTGTCTGT	CCAGCCGCCGGGCCTGTCTGT	-	rs201796742		TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr11:63681914_63681934delCCAGCCGCCGGGCCTGTCTGT	ENST00000301459.4	-	6	947_967	c.560_580delACAGACAGGCCCGGCGGCTGG	c.(559-582)gacagacaggcccggcggctgggg>ggg	p.DRQARRL187del	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	187					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.D187_L193delDRQARRL(1)		kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TTGCGGCCCCCCAGCCGCCGGGCCTGTCTGTCCATCACACT	0.611																																																1	Deletion - In frame(1)	ovary(1)	11																																								63438510	SO:0001651	inframe_deletion	283248			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.560_580delACAGACAGGCCCGGCGGCTGG	11.37:g.63681914_63681934delCCAGCCGCCGGGCCTGTCTGT	ENSP00000301459:p.Asp187_Leu193del	Unknown		Capture	Illumina GAIIx	Phase_I	63438490	Q96FP3	In_Frame_Del	DEL	ENST00000301459.4	37	CCDS8052.1	DEL	22	Broad																																																																																				0.611	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587		In_Frame_Del
TGIF1	7050	broad.mit.edu	37	18	3452223	3452223	+	Frame_Shift_Del	DEL	T	T	-	rs11571510|rs557543525|rs202189171	byFrequency	TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr18:3452223delT	ENST00000330513.5	+	1	549	c.246delT	c.(244-246)cctfs	p.P85fs	TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000405385.3_Intron|TGIF1_ENST00000551402.1_Intron|TGIF1_ENST00000407501.2_Intron|TGIF1_ENST00000548489.2_Intron|TGIF1_ENST00000343820.5_Intron|TGIF1_ENST00000345133.5_Intron|TGIF1_ENST00000400167.2_5'Flank|TGIF1_ENST00000551541.1_Intron	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	85					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P83fs*51(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GCGCCCCCCCTCCTCCACCGG	0.766													T|T|-|deletion	1280	0.255591	0.3419	0.2349	5008	,	,		10884	0.0109		0.4304	False		,,,				2504	0.226															1	Deletion - Frameshift(1)	large_intestine(1)	18											10.0	11.0	10.0					18																	3452223		2031	3818	5849	3442223	SO:0001589	frameshift_variant	7050			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.246delT	18.37:g.3452223delT	ENSP00000327959:p.Pro85fs	Unknown		Capture	Illumina GAIIx	Phase_I	3442223	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Del	DEL	ENST00000330513.5	37	CCDS11834.1	DEL	54	Broad																																																																																				0.766	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695		Frame_Shift_Del
FAM86B2	653333	broad.mit.edu	37	8	12291593	12291595	+	In_Frame_Del	DEL	CTG	CTG	-	rs146321506		TCGA-13-1494-01	TCGA-13-1494-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1494-01	TCGA-13-1494-10	g.chr8:12291593_12291595delCTG	ENST00000262365.4	-	2	124_126	c.125_127delCAG	c.(124-129)tcagat>tat	p.42_43SD>Y	FAM86B2_ENST00000351291.4_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000309608.5_In_Frame_Del_p.42_43SD>Y|FAM86B2_ENST00000393715.3_Intron	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	42			D -> Y (in dbSNP:rs2684093).							endometrium(1)|kidney(2)	3						AGCTCAGAATCTGATGAGTCTCT	0.473																																																0			8																																								12335966	SO:0001651	inframe_deletion	653333				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.125_127delCAG	8.37:g.12291593_12291595delCTG	ENSP00000262365:p.Ser42_Asp43delinsTyr	Unknown		Capture	Illumina GAIIx	Phase_I	12335964		In_Frame_Del	DEL	ENST00000262365.4	37	CCDS59092.1	DEL	32	Broad																																																																																				0.473	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_928336		In_Frame_Del
