#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PDPN	10630	broad.mit.edu	37	1	13936939	13936939	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr1:13936939G>C	ENST00000509009.1	+	3	288	c.244G>C	c.(244-246)Gaa>Caa	p.E82Q	PDPN_ENST00000376057.4_Missense_Mutation_p.E163Q|PDPN_ENST00000475043.1_Missense_Mutation_p.E45Q|PDPN_ENST00000376061.4_Missense_Mutation_p.E45Q|PDPN_ENST00000513143.1_Missense_Mutation_p.E45Q|PDPN_ENST00000294489.6_Missense_Mutation_p.E163Q|PDPN_ENST00000487038.1_Missense_Mutation_p.E45Q					podoplanin									p.E163Q(1)		endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		GCCAACTTCAGAAAGCACAGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	117.0	121.0					1																	13936939		2203	4300	6503	13809526	SO:0001583	missense	10630			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.244G>C	1.37:g.13936939G>C	ENSP00000422977:p.Glu82Gln	Unknown		x	x	x	13809526		Missense_Mutation	SNP	ENST00000509009.1	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.04	2.116999	0.37339	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35	4.38	1.45	0.22620	.	0.809568	0.10667	N	0.648002	T	0.46521	0.1397	L	0.58101	1.795	0.09310	N	1	D;D;D;D	0.63880	0.986;0.993;0.991;0.981	P;P;P;P	0.61070	0.801;0.883;0.858;0.858	T	0.24657	-1.0154	10	0.49607	T	0.09	-20.2713	4.714	0.12886	0.1966:0.1784:0.625:0.0	.	87;45;163;163	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	Q	163;163;154;82;45;45;45;45	ENSP00000294489:E163Q;ENSP00000365225:E163Q;ENSP00000426302:E154Q;ENSP00000422977:E82Q;ENSP00000365229:E45Q;ENSP00000425304:E45Q;ENSP00000427537:E45Q;ENSP00000426063:E45Q	ENSP00000294489:E163Q	E	+	1	0	PDPN	13809526	0.002000	0.14202	0.001000	0.08648	0.105000	0.19272	1.170000	0.31883	0.359000	0.24239	0.650000	0.86243	GAA		0.507	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367736.1	NM_006474		Missense_Mutation
FMO5	2330	broad.mit.edu	37	1	146672824	146672824	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr1:146672824T>G	ENST00000254090.4	-	7	1481	c.1093A>C	c.(1093-1095)Act>Cct	p.T365P	RP11-337C18.8_ENST00000606757.1_RNA|RP11-337C18.10_ENST00000606856.1_RNA|FMO5_ENST00000369272.3_Intron|FMO5_ENST00000441068.2_Missense_Mutation_p.T365P|RP11-337C18.8_ENST00000607149.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5	365						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.T365P(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					ATTGCAAGAGTTGGCCTTTCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											120.0	118.0	119.0					1																	146672824		2203	4300	6503	145139448	SO:0001583	missense	2330			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607	ENST00000254090.4:c.1093A>C	1.37:g.146672824T>G	ENSP00000254090:p.Thr365Pro	Unknown		x	x	x	145139448	B2RBG1|C9JJD1|Q8IV22	Missense_Mutation	SNP	ENST00000254090.4	37	CCDS926.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	.	26.5	4.740133	0.89573	.	.	ENSG00000131781	ENST00000441068;ENST00000254090	T;T	0.58797	0.31;0.31	6.17	6.17	0.99709	.	0.045428	0.85682	D	0.000000	T	0.81612	0.4859	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87739	0.2584	10	0.87932	D	0	-26.6292	14.7743	0.69713	0.0:0.0:0.0:1.0	.	365;365	P49326;C9JJD1	FMO5_HUMAN;.	P	365	ENSP00000416011:T365P;ENSP00000254090:T365P	ENSP00000254090:T365P	T	-	1	0	FMO5	145139448	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.024000	0.88770	2.371000	0.80710	0.533000	0.62120	ACT		0.453	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040373.2	NM_001461		Missense_Mutation
FCRL2	79368	broad.mit.edu	37	1	157718737	157718737	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr1:157718737G>A	ENST00000361516.3	-	9	1369	c.1321C>T	c.(1321-1323)Cca>Tca	p.P441S	FCRL2_ENST00000368181.4_Missense_Mutation_p.P157S|FCRL2_ENST00000392274.3_Intron	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	441					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.P441S(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGAGGATTTGGCCTGGAAGCC	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											88.0	88.0	88.0					1																	157718737		2203	4300	6503	155985361	SO:0001583	missense	79368			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1321C>T	1.37:g.157718737G>A	ENSP00000355157:p.Pro441Ser	Unknown		x	x	x	155985361	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	CCDS1168.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.560	0.877472	0.17395	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181	T;T	0.21191	2.02;3.55	4.03	-3.45	0.04781	.	.	.	.	.	T	0.02418	0.0074	L	0.28504	0.86	0.09310	N	1	B;B;B	0.24823	0.0;0.0;0.112	B;B;B	0.20384	0.005;0.003;0.029	T	0.43829	-0.9367	9	0.10111	T	0.7	.	1.0584	0.01595	0.2851:0.2847:0.2911:0.139	.	157;441;188	Q96LA5-5;Q96LA5;Q96LA5-2	.;FCRL2_HUMAN;.	S	157;441;157	ENSP00000355157:P441S;ENSP00000357163:P157S	ENSP00000292389:P157S	P	-	1	0	FCRL2	155985361	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.430000	0.06973	-0.862000	0.04089	-0.126000	0.14955	CCA		0.527	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		Missense_Mutation
AKR1C1	1645	broad.mit.edu	37	10	5008131	5008131	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr10:5008131C>A	ENST00000380872.4	+	2	302	c.110C>A	c.(109-111)gCc>gAc	p.A37D	AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Missense_Mutation_p.A37D|AKR1C1_ENST00000380859.1_Missense_Mutation_p.A39D	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	37					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.A37D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	GCTTTAGAGGCCACCAAATTG	0.448																																					Colon(130;2054 2316 13360 15380)											1	Substitution - Missense(1)	ovary(1)	10											88.0	81.0	83.0					10																	5008131		2203	4300	6503	4998131	SO:0001583	missense	1645			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.110C>A	10.37:g.5008131C>A	ENSP00000370254:p.Ala37Asp	Unknown		x	x	x	4998131	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	37	CCDS7061.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417112	0.42918	.	.	ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859	T;T;T	0.26518	1.73;1.73;1.73	2.48	1.5	0.22942	NADP-dependent oxidoreductase domain (3);	0.662303	0.13413	N	0.389753	T	0.59418	0.2192	H	0.94222	3.51	0.25844	N	0.98402	B;B;B	0.32543	0.375;0.019;0.032	P;P;P	0.57009	0.811;0.513;0.639	T	0.56950	-0.7894	10	0.72032	D	0.01	.	8.7136	0.34397	0.0:0.7628:0.2372:0.0	.	37;37;37	B4E0M1;Q2XPP3;Q04828	.;.;AK1C1_HUMAN	D	37;37;39	ENSP00000412248:A37D;ENSP00000370254:A37D;ENSP00000370240:A39D	ENSP00000370240:A39D	A	+	2	0	AKR1C1	4998131	0.008000	0.16893	0.198000	0.23420	0.037000	0.13140	1.501000	0.35693	0.325000	0.23359	0.305000	0.20034	GCC		0.448	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353		Missense_Mutation
ZNF33A	7581	broad.mit.edu	37	10	38344561	38344561	+	Silent	SNP	G	G	C			TCGA-13-1495-01	TCGA-13-1495-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr10:38344561G>C	ENST00000458705.2	+	5	1664	c.1506G>C	c.(1504-1506)ggG>ggC	p.G502G	ZNF33A_ENST00000432900.2_Silent_p.G509G|ZNF33A_ENST00000307441.9_Silent_p.G502G|ZNF33A_ENST00000374618.3_Silent_p.G503G|ZNF33A_ENST00000469037.2_Intron			Q06730	ZN33A_HUMAN	zinc finger protein 33A	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G502G(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						ATGCATGTGGGAAAACTTTCT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	10											76.0	75.0	75.0					10																	38344561		2203	4300	6503	38384567	SO:0001819	synonymous_variant	7581			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.1506G>C	10.37:g.38344561G>C		Somatic		x	x	x	38384567	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	ENST00000458705.2	37	CCDS31182.1	SNP	41	Broad																																																																																				0.368	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974		Silent
HSPA12A	259217	broad.mit.edu	37	10	118434748	118434748	+	Silent	SNP	G	G	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr10:118434748G>A	ENST00000369209.3	-	12	1676	c.1572C>T	c.(1570-1572)gaC>gaT	p.D524D	RP11-498B4.5_ENST00000433600.1_RNA	NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	524						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.D1145D(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		TGACCGCGGGGTCCAGGCCAA	0.662																																																1	Substitution - coding silent(1)	ovary(1)	10											36.0	42.0	40.0					10																	118434748		2052	4184	6236	118424738	SO:0001819	synonymous_variant	259217			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1572C>T	10.37:g.118434748G>A		Unknown		x	x	x	118424738		Silent	SNP	ENST00000369209.3	37	CCDS41569.1	SNP	44	Broad																																																																																				0.662	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015		Silent
AHNAK	79026	broad.mit.edu	37	11	62298690	62298690	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr11:62298690T>C	ENST00000378024.4	-	5	3473	c.3199A>G	c.(3199-3201)Atg>Gtg	p.M1067V	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1067					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.M1067V(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGCAAAGACATCTTAGGAGCT	0.443																																																1	Substitution - Missense(1)	ovary(1)	11											116.0	113.0	114.0					11																	62298690		2202	4299	6501	62055266	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3199A>G	11.37:g.62298690T>C	ENSP00000367263:p.Met1067Val	Unknown		x	x	x	62055266	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	t	1.325	-0.598442	0.03744	.	.	ENSG00000124942	ENST00000378024	T	0.00664	5.92	4.76	3.59	0.41128	.	0.747725	0.12874	N	0.432019	T	0.00412	0.0013	N	0.00972	-1.085	0.21933	N	0.999469	B	0.16166	0.016	B	0.14023	0.01	T	0.45731	-0.9241	10	0.22706	T	0.39	-8.7555	9.0086	0.36127	0.0:0.0875:0.0:0.9125	.	1067	Q09666	AHNK_HUMAN	V	1067	ENSP00000367263:M1067V	ENSP00000367263:M1067V	M	-	1	0	AHNAK	62055266	0.211000	0.23529	0.997000	0.53966	0.500000	0.33767	0.121000	0.15667	0.637000	0.30526	0.454000	0.30748	ATG		0.443	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		Missense_Mutation
KCNA1	3736	broad.mit.edu	37	12	5021549	5021549	+	Silent	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr12:5021549C>T	ENST00000382545.3	+	2	2112	c.1005C>T	c.(1003-1005)atC>atT	p.I335I	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	335					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.I335I(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TCCTCTTCATCGGGGTCATCC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	12											112.0	117.0	115.0					12																	5021549		2203	4300	6503	4891810	SO:0001819	synonymous_variant	3736			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1005C>T	12.37:g.5021549C>T		Somatic		x	x	x	4891810	A6NM83|Q3MIQ9	Silent	SNP	ENST00000382545.3	37	CCDS8535.1	SNP	31	Broad																																																																																				0.547	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217		Silent
MAPKAPK5	8550	broad.mit.edu	37	12	112318333	112318333	+	Splice_Site	SNP	T	T	A			TCGA-13-1495-01	TCGA-13-1495-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr12:112318333T>A	ENST00000551404.2	+	8	768		c.e8+2		MAPKAPK5_ENST00000550735.2_Splice_Site			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5						activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		endometrium(1)|lung(11)|ovary(1)	13						TACAACAAGGTACAGGAAGAG	0.502																																																1	Unknown(1)	ovary(1)	12											126.0	116.0	119.0					12																	112318333		1961	4144	6105	110802716	SO:0001630	splice_region_variant	8550			AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.660+2T>A	12.37:g.112318333T>A		Somatic		x	x	x	110802716	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Splice_Site_SNP	SNP	ENST00000551404.2	37	CCDS44975.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	4.009017	0.75046	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAPKAPK5	110802716	1.000000	0.71417	0.992000	0.48379	0.724000	0.41520	5.970000	0.70431	2.302000	0.77476	0.533000	0.62120	.		0.502	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	Intron	Splice_Site_SNP
SKA3	221150	broad.mit.edu	37	13	21750551	21750551	+	Silent	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr13:21750551C>T	ENST00000314759.5	-	1	190	c.66G>A	c.(64-66)acG>acA	p.T22T	SKA3_ENST00000400018.3_Silent_p.T22T|MRP63_ENST00000309594.4_5'Flank	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	22					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)		p.T22T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GCAGCCGGGCCGTCTCGCAGT	0.731																																																1	Substitution - coding silent(1)	ovary(1)	13											7.0	8.0	8.0					13																	21750551		2140	4233	6373	20648551	SO:0001819	synonymous_variant	221150			AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.66G>A	13.37:g.21750551C>T		Unknown		x	x	x	20648551	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Silent	SNP	ENST00000314759.5	37	CCDS31946.1	SNP	23	Broad																																																																																				0.731	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061		Silent
POTEB2	100287399	broad.mit.edu	37	15	21071473	21071473	+	Silent	SNP	A	A	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr15:21071473A>T	ENST00000454856.4	-	1	170	c.138T>A	c.(136-138)tcT>tcA	p.S46S		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	46																	CATGGTCTCCAGAAGTGCCCA	0.587																																																0			15											1.0	1.0	1.0					15																	21071473		17	94	111	19336052	SO:0001819	synonymous_variant	339010				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.138T>A	15.37:g.21071473A>T		Unknown		x	x	x	19336052		Silent	SNP	ENST00000454856.4	37	CCDS59248.1	SNP	7	Broad																																																																																				0.587	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1			Silent
HERC2	8924	broad.mit.edu	37	15	28459027	28459027	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr15:28459027C>T	ENST00000261609.7	-	42	6755	c.6647G>A	c.(6646-6648)cGc>cAc	p.R2216H		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R2216H(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAGGCGCAGGCGACCATCGAT	0.577																																																1	Substitution - Missense(1)	ovary(1)	15											79.0	70.0	73.0					15																	28459027		2203	4300	6503	26132622	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6647G>A	15.37:g.28459027C>T	ENSP00000261609:p.Arg2216His	Somatic		x	x	x	26132622		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566452	0.86439	.	.	ENSG00000128731	ENST00000261609	T	0.62105	0.05	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.79258	2.445	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.81972	-0.0688	10	0.72032	D	0.01	.	19.1711	0.93578	0.0:1.0:0.0:0.0	.	2216	O95714	HERC2_HUMAN	H	2216	ENSP00000261609:R2216H	ENSP00000261609:R2216H	R	-	2	0	HERC2	26132622	1.000000	0.71417	0.933000	0.37362	0.314000	0.28054	7.312000	0.78968	2.774000	0.95407	0.484000	0.47621	CGC		0.577	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667		Missense_Mutation
FHOD1	29109	broad.mit.edu	37	16	67281301	67281301	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr16:67281301C>A	ENST00000258201.4	-	1	260	c.13G>T	c.(13-15)Gaa>Taa	p.E5*	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	5					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.E5*(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCGCGGTCTTCCCCGCCCGCC	0.677																																																1	Substitution - Nonsense(1)	ovary(1)	16											32.0	31.0	31.0					16																	67281301		2198	4300	6498	65838802	SO:0001587	stop_gained	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.13G>T	16.37:g.67281301C>A	ENSP00000258201:p.Glu5*	Unknown		x	x	x	65838802	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Nonsense_Mutation	SNP	ENST00000258201.4	37	CCDS10834.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692676	0.88735	.	.	ENSG00000135723	ENST00000258201	.	.	.	5.63	4.64	0.57946	.	0.436360	0.19470	N	0.113475	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	15.0691	0.72021	0.142:0.858:0.0:0.0	.	.	.	.	X	5	.	ENSP00000258201:E5X	E	-	1	0	FHOD1	65838802	0.933000	0.31639	0.991000	0.47740	0.345000	0.29048	2.221000	0.42917	2.652000	0.90054	0.561000	0.74099	GAA		0.677	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			Nonsense_Mutation
PKD1L2	114780	broad.mit.edu	37	16	81187943	81187943	+	RNA	SNP	C	C	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr16:81187943C>A	ENST00000525539.1	-	0	4125				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.V1376L(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GTGACCTTCACCTGAAGAGAA	0.517																																																1	Substitution - Missense(1)	ovary(1)	16											86.0	83.0	84.0					16																	81187943		2037	4204	6241	79745444			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81187943C>A		Unknown		x	x	x	79745444	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		SNP	18	Broad																																																																																				0.517	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2			Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7578266	7578266	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr17:7578266T>A	ENST00000269305.4	-	6	772	c.583A>T	c.(583-585)Atc>Ttc	p.I195F	TP53_ENST00000359597.4_Missense_Mutation_p.I195F|TP53_ENST00000445888.2_Missense_Mutation_p.I195F|TP53_ENST00000455263.2_Missense_Mutation_p.I195F|TP53_ENST00000413465.2_Missense_Mutation_p.I195F|TP53_ENST00000420246.2_Missense_Mutation_p.I195F|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195F(20)|p.0?(8)|p.?(6)|p.I195fs*14(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102F(1)|p.I195fs*52(1)|p.L194fs*52(1)|p.I63fs*14(1)|p.I195fs*50(1)|p.I102fs*14(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.I195L(1)|p.P98_E105>Q(1)|p.I63F(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCACTCGGATAAGATGCTGA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(23)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - Frameshift(4)|Complex - frameshift(1)	upper_aerodigestive_tract(8)|breast(8)|large_intestine(6)|biliary_tract(5)|skin(5)|lung(5)|oesophagus(4)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|urinary_tract(2)|liver(2)|stomach(1)|soft_tissue(1)	17											99.0	89.0	92.0					17																	7578266		2203	4300	6503	7518991	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.583A>T	17.37:g.7578266T>A	ENSP00000269305:p.Ile195Phe	Unknown		x	x	x	7518991	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493726	0.64186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	D	0.000004	D	0.99802	0.9915	M	0.85099	2.735	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.998;0.998;0.997;0.998;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.989;0.955;0.972;0.988;0.99;0.992	D	0.96806	0.9593	10	0.87932	D	0	-18.4587	13.709	0.62656	0.0:0.0:0.0:1.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195F;ENSP00000352610:I195F;ENSP00000269305:I195F;ENSP00000398846:I195F;ENSP00000391127:I195F;ENSP00000391478:I195F;ENSP00000425104:I63F;ENSP00000423862:I102F	ENSP00000269305:I195F	I	-	1	0	TP53	7518991	1.000000	0.71417	0.895000	0.35142	0.030000	0.12068	6.159000	0.71856	2.183000	0.69458	0.533000	0.62120	ATC		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
CDK12	51755	broad.mit.edu	37	17	37627889	37627889	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr17:37627889C>T	ENST00000447079.4	+	2	1837	c.1804C>T	c.(1804-1806)Cag>Tag	p.Q602*	CDK12_ENST00000430627.2_Nonsense_Mutation_p.Q602*	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	602					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.Q602*(1)		NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GGCAAATTCTCAGCCCCCTGT	0.488			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																													Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	1	Substitution - Nonsense(1)	ovary(1)	17											133.0	131.0	132.0					17																	37627889		2203	4300	6503	34881415	SO:0001587	stop_gained	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1804C>T	17.37:g.37627889C>T	ENSP00000398880:p.Gln602*	Somatic		x	x	x	34881415	A7E2B2|B4DYX4|B9EIQ6|O94978	Nonsense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	38	7.242650	0.98157	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	.	.	.	5.79	5.79	0.91817	.	0.000000	0.46758	D	0.000271	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-9.9659	19.0299	0.92952	0.0:1.0:0.0:0.0	.	.	.	.	X	602	.	ENSP00000407720:Q602X	Q	+	1	0	CDK12	34881415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.146000	0.64845	2.736000	0.93811	0.655000	0.94253	CAG		0.488	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507		Nonsense_Mutation
WDR7	23335	broad.mit.edu	37	18	54363571	54363571	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr18:54363571A>C	ENST00000254442.3	+	12	1667	c.1456A>C	c.(1456-1458)Ata>Cta	p.I486L	WDR7_ENST00000357574.3_Missense_Mutation_p.I486L|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	486					hematopoietic progenitor cell differentiation (GO:0002244)			p.I486L(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		AAGATACCTGATATCTGGAGG	0.418																																																1	Substitution - Missense(1)	ovary(1)	18											148.0	132.0	138.0					18																	54363571		2203	4300	6503	52514569	SO:0001583	missense	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1456A>C	18.37:g.54363571A>C	ENSP00000254442:p.Ile486Leu	Unknown		x	x	x	52514569	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	37	CCDS11962.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959630	0.34565	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.59638	0.25;0.25	5.73	3.35	0.38373	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.166503	0.53938	D	0.000042	T	0.30572	0.0769	N	0.03948	-0.315	0.44104	D	0.996878	B;B	0.23377	0.003;0.084	B;B	0.26416	0.008;0.069	T	0.04041	-1.0982	10	0.18710	T	0.47	.	8.9599	0.35840	0.7866:0.0:0.2134:0.0	.	486;486	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	L	486	ENSP00000254442:I486L;ENSP00000350187:I486L	ENSP00000254442:I486L	I	+	1	0	WDR7	52514569	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.582000	0.36568	0.533000	0.28675	0.533000	0.62120	ATA		0.418	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1			Missense_Mutation
ZSWIM4	65249	broad.mit.edu	37	19	13915878	13915878	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:13915878G>T	ENST00000254323.2	+	3	817	c.628G>T	c.(628-630)Gcc>Tcc	p.A210S	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	210							zinc ion binding (GO:0008270)	p.A210S(1)		central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CCTCATCAGCGCCCATCACAC	0.627											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											48.0	42.0	44.0					19																	13915878		2203	4300	6503	13776878	SO:0001583	missense	65249			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.628G>T	19.37:g.13915878G>T	ENSP00000254323:p.Ala210Ser	Unknown	691	x	x	x	13776878		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538283	0.45176	.	.	ENSG00000132003	ENST00000254323	T	0.21361	2.01	4.81	4.81	0.61882	.	0.117157	0.37809	N	0.001939	T	0.19725	0.0474	L	0.38531	1.155	0.80722	D	1	P	0.46064	0.872	B	0.43155	0.41	T	0.02625	-1.1132	10	0.21540	T	0.41	-22.4923	15.3756	0.74602	0.0:0.0:1.0:0.0	.	210	Q9H7M6	ZSWM4_HUMAN	S	210	ENSP00000254323:A210S	ENSP00000254323:A210S	A	+	1	0	ZSWIM4	13776878	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	7.646000	0.83445	2.226000	0.72624	0.561000	0.74099	GCC		0.627	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342		Missense_Mutation
ATP13A1	57130	broad.mit.edu	37	19	19767522	19767522	+	Missense_Mutation	SNP	G	G	A	rs371113170		TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:19767522G>A	ENST00000357324.6	-	7	1056	c.1030C>T	c.(1030-1032)Cgc>Tgc	p.R344C	ATP13A1_ENST00000496082.1_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.R226C	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	344						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.R344C(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ACGATGCAGCGGCCTCGCAGC	0.637																																					Esophageal Squamous(142;920 1789 9047 14684 24777)											1	Substitution - Missense(1)	ovary(1)	19						G	CYS/ARG	0,4406		0,0,2203	57.0	51.0	53.0		1030	4.9	1.0	19		53	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP13A1	NM_020410.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	344/1205	19767522	1,13005	2203	4300	6503	19628522	SO:0001583	missense	57130			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1030C>T	19.37:g.19767522G>A	ENSP00000349877:p.Arg344Cys	Unknown		x	x	x	19628522	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	37	CCDS32970.2	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	27.2	4.809027	0.90707	0.0	1.16E-4	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.90732	-2.72;-2.72	4.89	4.89	0.63831	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.93654	0.7973	L	0.58583	1.82	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.65443	0.935;0.666	D	0.94222	0.7468	10	0.72032	D	0.01	-33.9359	15.9147	0.79503	0.0:0.0:1.0:0.0	.	344;226	Q9HD20;Q9HD20-2	AT131_HUMAN;.	C	226;344	ENSP00000291503:R226C;ENSP00000349877:R344C	ENSP00000291503:R226C	R	-	1	0	ATP13A1	19628522	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.054000	0.64275	2.413000	0.81919	0.563000	0.77884	CGC		0.637	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410		Missense_Mutation
ZNF43	7594	broad.mit.edu	37	19	21990499	21990499	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:21990499A>C	ENST00000354959.4	-	4	2509	c.2340T>G	c.(2338-2340)caT>caG	p.H780Q	ZNF43_ENST00000595461.1_Missense_Mutation_p.H774Q|ZNF43_ENST00000598381.1_Missense_Mutation_p.H774Q|ZNF43_ENST00000594012.1_Missense_Mutation_p.H774Q	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	780					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H780Q(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		GAATTTTGTTATGTGTAGTAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	19											59.0	61.0	60.0					19																	21990499		2203	4300	6503	21782339	SO:0001583	missense	7594			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2340T>G	19.37:g.21990499A>C	ENSP00000347045:p.His780Gln	Unknown		x	x	x	21782339	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	13.67	2.305194	0.40795	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.60797	0.16	1.76	-3.53	0.04667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68054	0.2959	M	0.84846	2.72	0.09310	N	1	D	0.76494	0.999	D	0.68039	0.955	T	0.59139	-0.7510	9	0.66056	D	0.02	.	0.5032	0.00583	0.3759:0.1805:0.2658:0.1778	.	780	P17038	ZNF43_HUMAN	Q	779;780	ENSP00000347045:H780Q	ENSP00000347045:H780Q	H	-	3	2	ZNF43	21782339	0.065000	0.20965	0.000000	0.03702	0.882000	0.50991	0.131000	0.15870	-1.402000	0.02056	0.254000	0.18369	CAT		0.323	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423		Missense_Mutation
ZNF473	25888	broad.mit.edu	37	19	50549780	50549780	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:50549780C>T	ENST00000595661.1	+	6	2575	c.2080C>T	c.(2080-2082)Cga>Tga	p.R694*	CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000391821.2_Nonsense_Mutation_p.R694*|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000270617.3_Nonsense_Mutation_p.R694*|ZNF473_ENST00000445728.3_Nonsense_Mutation_p.R682*|ZNF473_ENST00000601364.1_Intron			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	694					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R694*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCAGCATGAGCGAACTCATGC	0.453																																																1	Substitution - Nonsense(1)	ovary(1)	19											78.0	81.0	80.0					19																	50549780		2203	4300	6503	55241592	SO:0001587	stop_gained	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2080C>T	19.37:g.50549780C>T	ENSP00000472808:p.Arg694*	Unknown		x	x	x	55241592	A8K8T7|Q9ULS9|Q9Y4Q7	Nonsense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.831686	0.97003	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	.	.	.	4.21	0.966	0.19667	.	0.679345	0.12907	N	0.429279	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.416	4.1994	0.10458	0.6041:0.1829:0.213:0.0	.	.	.	.	X	694;694;682	.	ENSP00000270617:R694X	R	+	1	2	ZNF473	55241592	0.000000	0.05858	0.140000	0.22221	0.027000	0.11550	-0.447000	0.06828	0.111000	0.17947	-0.347000	0.07816	CGA		0.453	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390		Nonsense_Mutation
SYT3	84258	broad.mit.edu	37	19	51135643	51135643	+	Missense_Mutation	SNP	C	C	A	rs376869372		TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:51135643C>A	ENST00000338916.4	-	2	1207	c.574G>T	c.(574-576)Ggg>Tgg	p.G192W	SYT3_ENST00000544769.1_Missense_Mutation_p.G192W|SYT3_ENST00000600079.1_Missense_Mutation_p.G192W|SYT3_ENST00000593901.1_Missense_Mutation_p.G192W	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	192					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.G192W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CCTGCTCCCCCCTCAGAGGGC	0.647																																																1	Substitution - Missense(1)	ovary(1)	19											39.0	42.0	41.0					19																	51135643		2203	4300	6503	55827455	SO:0001583	missense	84258			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.574G>T	19.37:g.51135643C>A	ENSP00000340914:p.Gly192Trp	Unknown		x	x	x	55827455	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047467	0.36085	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.59906	0.23;0.23	5.24	0.431	0.16523	.	0.298737	0.26041	U	0.026700	T	0.37945	0.1022	N	0.08118	0	0.09310	N	1	D	0.54047	0.964	P	0.49853	0.624	T	0.27020	-1.0086	10	0.66056	D	0.02	.	4.7068	0.12853	0.1509:0.5971:0.0:0.2519	.	192	Q9BQG1	SYT3_HUMAN	W	192	ENSP00000340914:G192W;ENSP00000438883:G192W	ENSP00000340914:G192W	G	-	1	0	SYT3	55827455	0.018000	0.18449	0.292000	0.24919	0.504000	0.33889	1.050000	0.30404	0.314000	0.23086	0.655000	0.94253	GGG		0.647	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298		Missense_Mutation
ZNF665	79788	broad.mit.edu	37	19	53668970	53668970	+	Missense_Mutation	SNP	C	C	A	rs147129840	byFrequency	TCGA-13-1495-01	TCGA-13-1495-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr19:53668970C>A	ENST00000600412.1	-	2	693	c.578G>T	c.(577-579)gGa>gTa	p.G193V	ZNF665_ENST00000396424.3_Missense_Mutation_p.G258V|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G193V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		AGGTTTCTCTCCAGTATGAAT	0.393																																																1	Substitution - Missense(1)	ovary(1)	19											103.0	113.0	110.0					19																	53668970		2203	4300	6503	58360782	SO:0001583	missense	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.578G>T	19.37:g.53668970C>A	ENSP00000469154:p.Gly193Val	Somatic		x	x	x	58360782	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.84	2.953335	0.53293	.	.	ENSG00000197497	ENST00000396424	T	0.01599	4.74	2.44	2.44	0.29823	.	.	.	.	.	T	0.08714	0.0216	M	0.76727	2.345	0.52501	D	0.999952	D	0.89917	1.0	D	0.97110	1.0	T	0.04242	-1.0966	9	0.72032	D	0.01	.	11.9849	0.53142	0.0:1.0:0.0:0.0	.	258	Q9H7R5-2	.	V	258	ENSP00000379702:G258V	ENSP00000379702:G258V	G	-	2	0	ZNF665	58360782	0.000000	0.05858	0.596000	0.28811	0.630000	0.37929	0.257000	0.18369	1.357000	0.45904	0.543000	0.68304	GGA		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733		Missense_Mutation
GPR113	165082	broad.mit.edu	37	2	26533688	26533688	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr2:26533688C>G	ENST00000311519.1	-	11	2907	c.2908G>C	c.(2908-2910)Ggg>Cgg	p.G970R	GPR113_ENST00000541401.1_Missense_Mutation_p.G573R|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.G771R|GPR113_ENST00000421160.2_Missense_Mutation_p.G901R	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	970					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G771R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGATCACCCCCAGCAGAGCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											34.0	34.0	34.0					2																	26533688		2203	4300	6503	26387192	SO:0001583	missense	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2908G>C	2.37:g.26533688C>G	ENSP00000307831:p.Gly970Arg	Unknown		x	x	x	26387192	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456671	0.43634	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.78	4.9	0.64082	GPCR, family 2-like (1);	.	.	.	.	T	0.20577	0.0495	N	0.13235	0.315	0.80722	D	1	B;B;B;B	0.16396	0.002;0.003;0.0;0.017	B;B;B;B	0.24541	0.02;0.054;0.007;0.03	T	0.04537	-1.0944	9	0.54805	T	0.06	-15.8916	11.8628	0.52476	0.0:0.9164:0.0:0.0836	.	901;771;970;573	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	R	573;771;901;970	ENSP00000445729:G573R;ENSP00000327396:G771R;ENSP00000388537:G901R;ENSP00000307831:G970R	ENSP00000307831:G970R	G	-	1	0	GPR113	26387192	0.000000	0.05858	1.000000	0.80357	0.979000	0.70002	0.796000	0.26986	2.734000	0.93682	0.650000	0.86243	GGG		0.582	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835		Missense_Mutation
CRNKL1	51340	broad.mit.edu	37	20	20031249	20031249	+	Silent	SNP	C	C	T	rs367820186		TCGA-13-1495-01	TCGA-13-1495-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr20:20031249C>T	ENST00000377340.2	-	3	583	c.552G>A	c.(550-552)ccG>ccA	p.P184P	C20orf26_ENST00000245957.5_5'Flank|CRNKL1_ENST00000536226.1_Silent_p.P23P|C20orf26_ENST00000377309.2_5'Flank|C20orf26_ENST00000377306.1_5'Flank|C20orf26_ENST00000389656.3_5'Flank|CRNKL1_ENST00000377327.4_Silent_p.P172P	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	184					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P184P(1)		breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						GTACCTCAGCCGGGGCTTTGT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	20						C		1,4405	2.1+/-5.4	0,1,2202	112.0	109.0	110.0		552	-10.8	0.3	20		110	0,8600		0,0,4300	no	coding-synonymous	CRNKL1	NM_016652.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		184/849	20031249	1,13005	2203	4300	6503	19979249	SO:0001819	synonymous_variant	51340			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.552G>A	20.37:g.20031249C>T		Somatic		x	x	x	19979249	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Silent	SNP	ENST00000377340.2	37	CCDS33446.1	SNP	23	Broad																																																																																				0.378	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1			Silent
COMT	1312	broad.mit.edu	37	22	19951093	19951093	+	Silent	SNP	G	G	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr22:19951093G>A	ENST00000361682.6	+	4	676	c.294G>A	c.(292-294)aaG>aaA	p.K98K	COMT_ENST00000449653.1_Silent_p.K48K|COMT_ENST00000406520.3_Silent_p.K98K|COMT_ENST00000493893.1_3'UTR|COMT_ENST00000407537.1_Silent_p.K48K|MIR4761_ENST00000585066.1_RNA|COMT_ENST00000403710.1_Silent_p.K98K|COMT_ENST00000403184.1_Silent_p.K98K	NM_000754.3	NP_000745.1	P21964	COMT_HUMAN	catechol-O-methyltransferase	98					cellular response to phosphate starvation (GO:0016036)|dopamine catabolic process (GO:0042420)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|learning (GO:0007612)|methylation (GO:0032259)|multicellular organismal reproductive process (GO:0048609)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of smooth muscle cell proliferation (GO:0048662)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|positive regulation of homocysteine metabolic process (GO:0050668)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	catechol O-methyltransferase activity (GO:0016206)|magnesium ion binding (GO:0000287)|O-methyltransferase activity (GO:0008171)	p.K98K(1)		kidney(1)|lung(1)|ovary(1)|prostate(1)|stomach(1)	5	Colorectal(54;0.0993)				Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Methyldopa(DB00968)|Micafungin(DB01141)|S-Adenosylmethionine(DB00118)|Testosterone Propionate(DB01420)|Tolcapone(DB00323)	GCACAGGCAAGATCGTGGACG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	22											45.0	40.0	42.0					22																	19951093		2203	4300	6503	18331093	SO:0001819	synonymous_variant	1312				CCDS13770.1, CCDS46663.1	22q11.21	2012-10-02			ENSG00000093010	ENSG00000093010	2.1.1.6		2228	protein-coding gene	gene with protein product		116790				1572656	Standard	NM_000754		Approved		uc002zqu.3	P21964	OTTHUMG00000150529	ENST00000361682.6:c.294G>A	22.37:g.19951093G>A		Unknown		x	x	x	18331093	A8MPV9|Q6IB07|Q6ICE6|Q9BWC7	Silent	SNP	ENST00000361682.6	37	CCDS13770.1	SNP	33	Broad																																																																																				0.657	COMT-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318936.2	NM_000754		Silent
SETMAR	6419	broad.mit.edu	37	3	4354990	4354990	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr3:4354990G>A	ENST00000358065.4	+	2	632	c.565G>A	c.(565-567)Gac>Aac	p.D189N	SETMAR_ENST00000425863.1_Intron|SETMAR_ENST00000430981.1_Missense_Mutation_p.D189N|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	189	Histone-lysine N-methyltransferase.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)	p.D176N(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		AACAAAATCCGACTCCAATTA	0.363								Chromatin Structure																																								1	Substitution - Missense(1)	ovary(1)	3											63.0	67.0	65.0					3																	4354990		2203	4300	6503	4329990	SO:0001583	missense	6419			U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.565G>A	3.37:g.4354990G>A	ENSP00000373354:p.Asp189Asn	Unknown		x	x	x	4329990	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	37	CCDS2563.2	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	8.868	0.948610	0.18356	.	.	ENSG00000170364	ENST00000358065;ENST00000430981	T;T	0.80994	-1.44;-1.44	4.91	4.91	0.64330	SET domain (3);	.	.	.	.	T	0.81536	0.4843	L	0.46670	1.46	0.27400	N	0.95486	D;D	0.61697	0.99;0.969	P;P	0.53809	0.735;0.559	T	0.74987	-0.3476	9	0.87932	D	0	.	9.9868	0.41846	0.0779:0.1398:0.7823:0.0	.	176;189	Q53H47;C9JHK2	SETMR_HUMAN;.	N	189	ENSP00000373354:D189N;ENSP00000403000:D189N	ENSP00000373354:D189N	D	+	1	0	SETMAR	4329990	1.000000	0.71417	0.027000	0.17364	0.003000	0.03518	5.172000	0.65003	2.259000	0.74868	0.460000	0.39030	GAC		0.363	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515		Missense_Mutation
LRRC3B	116135	broad.mit.edu	37	3	26751758	26751758	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr3:26751758A>G	ENST00000396641.2	+	2	1187	c.595A>G	c.(595-597)Aaa>Gaa	p.K199E	LRRC3B_ENST00000417744.1_Missense_Mutation_p.K199E|LRRC3B_ENST00000456208.2_Missense_Mutation_p.K199E|AC114877.3_ENST00000446601.1_lincRNA	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	199						integral component of membrane (GO:0016021)		p.K199E(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TAACCTCCCTAAAAAAACTAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	68.0	69.0					3																	26751758		2203	4300	6503	26726762	SO:0001583	missense	116135			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.595A>G	3.37:g.26751758A>G	ENSP00000379880:p.Lys199Glu	Unknown		x	x	x	26726762	Q5M8T0	Missense_Mutation	SNP	ENST00000396641.2	37	CCDS2644.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118388	0.56505	.	.	ENSG00000179796	ENST00000396641;ENST00000417744;ENST00000456208	T;T;T	0.59083	0.29;0.29;0.29	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	L	0.54323	1.7	0.80722	D	1	P	0.37781	0.608	B	0.39339	0.297	T	0.60865	-0.7178	10	0.59425	D	0.04	-18.4784	16.0034	0.80327	1.0:0.0:0.0:0.0	.	199	Q96PB8	LRC3B_HUMAN	E	199	ENSP00000379880:K199E;ENSP00000406370:K199E;ENSP00000394940:K199E	ENSP00000379880:K199E	K	+	1	0	LRRC3B	26726762	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	5.790000	0.69038	2.371000	0.80710	0.533000	0.62120	AAA		0.468	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953		Missense_Mutation
SI	6476	broad.mit.edu	37	3	164741407	164741407	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr3:164741407G>T	ENST00000264382.3	-	26	3112	c.3050C>A	c.(3049-3051)aCt>aAt	p.T1017N		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1017	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.T1017N(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CACACGAAGAGTTGAGATGGG	0.398										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											132.0	125.0	127.0					3																	164741407		2203	4300	6503	166224101	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3050C>A	3.37:g.164741407G>T	ENSP00000264382:p.Thr1017Asn	Unknown		x	x	x	166224101	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701958	0.30232	.	.	ENSG00000090402	ENST00000264382	T	0.13538	2.58	5.19	2.25	0.28309	Glycoside hydrolase-type carbohydrate-binding (1);	0.541896	0.19106	N	0.122561	T	0.06050	0.0157	N	0.12569	0.235	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.41016	-0.9532	10	0.15066	T	0.55	.	6.1707	0.20416	0.1447:0.0:0.5897:0.2656	.	1017	P14410	SUIS_HUMAN	N	1017	ENSP00000264382:T1017N	ENSP00000264382:T1017N	T	-	2	0	SI	166224101	0.007000	0.16637	0.160000	0.22671	0.976000	0.68499	0.418000	0.21230	0.739000	0.32628	0.655000	0.94253	ACT		0.398	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		Missense_Mutation
MECOM	2122	broad.mit.edu	37	3	168834236	168834236	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1495-01	TCGA-13-1495-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr3:168834236T>A	ENST00000464456.1	-	7	2060	c.860A>T	c.(859-861)cAt>cTt	p.H287L	MECOM_ENST00000460814.1_Missense_Mutation_p.H287L|MECOM_ENST00000392736.3_Missense_Mutation_p.H287L|MECOM_ENST00000433243.2_Missense_Mutation_p.H288L|MECOM_ENST00000264674.3_Missense_Mutation_p.H352L|MECOM_ENST00000472280.1_Missense_Mutation_p.H288L|MECOM_ENST00000468789.1_Missense_Mutation_p.H287L|MECOM_ENST00000494292.1_Missense_Mutation_p.H475L	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H287L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						ACCAGCAGGATGCCTATTGGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	3											328.0	284.0	299.0					3																	168834236		2203	4300	6503	170316930	SO:0001583	missense	2122			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.860A>T	3.37:g.168834236T>A	ENSP00000419770:p.His287Leu	Somatic		x	x	x	170316930	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	37	CCDS54669.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	17.48	3.400489	0.62177	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.06449	3.36;3.34;3.31;3.45;3.31;3.34;3.3;3.45	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	T	0.23094	0.0558	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.83275	0.996;0.996;0.991;0.996;0.991	T	0.00090	-1.2087	10	0.66056	D	0.02	-13.3669	16.5582	0.84512	0.0:0.0:0.0:1.0	.	475;288;475;352;287	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	L	352;287;287;288;475;287;287;288	ENSP00000264674:H352L;ENSP00000376493:H287L;ENSP00000419770:H287L;ENSP00000420048:H288L;ENSP00000417899:H475L;ENSP00000419995:H287L;ENSP00000420466:H287L;ENSP00000394302:H288L	ENSP00000264674:H352L	H	-	2	0	MECOM	170316930	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.698000	0.84413	2.308000	0.77769	0.533000	0.62120	CAT		0.498	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991		Missense_Mutation
PPARGC1A	10891	broad.mit.edu	37	4	23816064	23816064	+	Missense_Mutation	SNP	C	C	T	rs146256421		TCGA-13-1495-01	TCGA-13-1495-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr4:23816064C>T	ENST00000264867.2	-	8	1161	c.1042G>A	c.(1042-1044)Ggg>Agg	p.G348R	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	348					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.G348R(1)		central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TGCTCCGGCCCTTTCTTGGTG	0.532																																					Esophageal Squamous(29;694 744 13796 34866 44181)											1	Substitution - Missense(1)	ovary(1)	4						C	ARG/GLY	0,4406		0,0,2203	138.0	140.0	139.0		1042	5.2	1.0	4	dbSNP_134	139	2,8598	1.2+/-3.3	0,2,4298	no	missense	PPARGC1A	NM_013261.3	125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	348/799	23816064	2,13004	2203	4300	6503	23425162	SO:0001583	missense	10891			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1042G>A	4.37:g.23816064C>T	ENSP00000264867:p.Gly348Arg	Somatic		x	x	x	23425162	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	CCDS3429.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840808	0.71488	0.0	2.33E-4	ENSG00000109819	ENST00000264867	T	0.23552	1.9	6.06	5.22	0.72569	.	0.088347	0.85682	D	0.000000	T	0.45558	0.1348	M	0.69823	2.125	0.80722	D	1	D	0.71674	0.998	P	0.62560	0.904	T	0.11743	-1.0575	10	0.27082	T	0.32	-10.5368	14.8026	0.69926	0.0:0.9316:0.0:0.0684	.	348	Q9UBK2	PRGC1_HUMAN	R	348	ENSP00000264867:G348R	ENSP00000264867:G348R	G	-	1	0	PPARGC1A	23425162	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.474000	0.60203	2.880000	0.98712	0.650000	0.86243	GGG		0.532	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261		Missense_Mutation
SEC31A	22872	broad.mit.edu	37	4	83770050	83770050	+	Silent	SNP	C	C	T	rs145039719	byFrequency	TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr4:83770050C>T	ENST00000395310.2	-	20	2591	c.2409G>A	c.(2407-2409)ccG>ccA	p.P803P	SEC31A_ENST00000326950.5_Silent_p.P764P|SEC31A_ENST00000508479.1_Silent_p.P803P|SEC31A_ENST00000509142.1_Silent_p.P803P|SEC31A_ENST00000443462.2_Silent_p.P798P|SEC31A_ENST00000348405.4_Silent_p.P764P|SEC31A_ENST00000505984.1_Silent_p.P764P|SEC31A_ENST00000355196.2_Silent_p.P803P|SEC31A_ENST00000505472.1_Silent_p.P803P|SEC31A_ENST00000513858.1_Silent_p.P764P|SEC31A_ENST00000508502.1_Silent_p.P803P|SEC31A_ENST00000500777.2_Silent_p.P764P|SEC31A_ENST00000432794.1_Silent_p.P803P|SEC31A_ENST00000448323.1_Silent_p.P803P|SEC31A_ENST00000264405.5_Silent_p.P536P|SEC31A_ENST00000311785.7_Silent_p.P803P	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	803	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)	p.P803P(1)	SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GTTTCTCGTACGGAATTTTAG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	4						C	,,,,,	2,4404	4.2+/-10.8	0,2,2201	133.0	123.0	127.0		2409,2409,2409,2394,2409,2292	-3.6	0.2	4	dbSNP_134	127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEC31A	NM_001077206.2,NM_001077207.2,NM_001077208.2,NM_001191049.1,NM_014933.3,NM_016211.3	,,,,,	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	,,,,,	803/1107,803/1221,803/1206,798/1201,803/1221,764/1182	83770050	3,13003	2203	4300	6503	83989074	SO:0001819	synonymous_variant	22872			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2409G>A	4.37:g.83770050C>T		Unknown		x	x	x	83989074	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Silent	SNP	ENST00000395310.2	37	CCDS3596.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.286091	0.01387	4.54E-4	1.16E-4	ENSG00000138674	ENST00000507828	.	.	.	5.48	-3.61	0.04556	.	.	.	.	.	T	0.36248	0.0960	.	.	.	0.39553	D	0.969001	.	.	.	.	.	.	T	0.36986	-0.9725	4	.	.	.	-11.1793	0.7779	0.01035	0.3696:0.101:0.215:0.3145	.	.	.	.	I	420	.	.	V	-	1	0	SEC31A	83989074	0.001000	0.12720	0.168000	0.22838	0.040000	0.13550	-2.069000	0.01381	-0.475000	0.06852	-2.017000	0.00434	GTA		0.478	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211		Silent
DCHS2	54798	broad.mit.edu	37	4	155219030	155219030	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr4:155219030C>G	ENST00000357232.4	-	18	5070	c.5071G>C	c.(5071-5073)Ggg>Cgg	p.G1691R		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1691	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G1691R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTCACGAGCCCTTTATACAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	4											76.0	76.0	76.0					4																	155219030		2203	4300	6503	155438480	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5071G>C	4.37:g.155219030C>G	ENSP00000349768:p.Gly1691Arg	Unknown		x	x	x	155438480	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	13.60	2.284501	0.40394	.	.	ENSG00000197410	ENST00000357232	T	0.53206	0.63	5.82	4.91	0.64330	Cadherin (3);Cadherin-like (1);	0.264534	0.31233	N	0.008005	T	0.59891	0.2227	L	0.56124	1.755	0.80722	D	1	D	0.61080	0.989	P	0.60068	0.868	T	0.52124	-0.8617	10	0.25106	T	0.35	.	17.6482	0.88154	0.1313:0.8686:0.0:0.0	.	1691	Q6V1P9	PCD23_HUMAN	R	1691	ENSP00000349768:G1691R	ENSP00000349768:G1691R	G	-	1	0	DCHS2	155438480	0.057000	0.20700	0.063000	0.19743	0.069000	0.16628	3.113000	0.50376	2.765000	0.95021	0.650000	0.86243	GGG		0.438	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		Missense_Mutation
TRIM7	81786	broad.mit.edu	37	5	180627010	180627010	+	Silent	SNP	C	C	T	rs200756291		TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr5:180627010C>T	ENST00000274773.7	-	3	751	c.690G>A	c.(688-690)caG>caA	p.Q230Q	TRIM7_ENST00000393319.3_Silent_p.Q48Q|CTC-338M12.6_ENST00000419707.2_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'Flank|TRIM7_ENST00000393315.1_Silent_p.Q22Q|CTC-338M12.6_ENST00000514784.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000422067.2_Silent_p.Q22Q|CTC-338M12.6_ENST00000511517.1_RNA|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000361809.3_Silent_p.Q22Q	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	230						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.Q230Q(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		GCCGACCCTCCTGCTCCACCA	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19912	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(128;2258 2308 35507 48647)											1	Substitution - coding silent(1)	ovary(1)	5											77.0	71.0	73.0					5																	180627010		2203	4300	6503	180559616	SO:0001819	synonymous_variant	81786			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.690G>A	5.37:g.180627010C>T		Unknown		x	x	x	180559616	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	ENST00000274773.7	37	CCDS4462.1	SNP	24	Broad																																																																																				0.622	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253569.3	NM_203296		Silent
HLA-DPB1	3115	broad.mit.edu	37	6	33043849	33043849	+	Silent	SNP	C	C	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr6:33043849C>A	ENST00000418931.2	+	1	147	c.31C>A	c.(31-33)Cgg>Agg	p.R11R	HLA-DPA1_ENST00000463066.1_5'Flank|HLA-DPA1_ENST00000419277.1_Intron|HLA-DPA1_ENST00000428995.1_5'Flank|HLA-DPB1_ENST00000535465.1_Silent_p.R11R	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	11					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)	p.R11R(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						TGCGGCCCCCCGGACAGTGGC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	6											46.0	45.0	45.0					6																	33043849		1509	2709	4218	33151827	SO:0001819	synonymous_variant	3115				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.31C>A	6.37:g.33043849C>A		Unknown		x	x	x	33151827	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Silent	SNP	ENST00000418931.2	37	CCDS4765.1	SNP	23	Broad																																																																																				0.562	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121		Silent
T	6862	broad.mit.edu	37	6	166571861	166571861	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr6:166571861G>A	ENST00000296946.2	-	9	1718	c.1250C>T	c.(1249-1251)gCc>gTc	p.A417V	T_ENST00000366871.3_Missense_Mutation_p.A359V	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	417					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A417V(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		TTGGGCTGCGGCGTCGTACTG	0.632									Chordoma, Familial Clustering of																																							1	Substitution - Missense(1)	ovary(1)	6											113.0	118.0	116.0					6																	166571861		2203	4300	6503	166491851	SO:0001583	missense	6862	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1250C>T	6.37:g.166571861G>A	ENSP00000296946:p.Ala417Val	Unknown		x	x	x	166491851	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	37	CCDS5290.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	3.405	-0.121462	0.06838	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83673	-1.73;-1.75	4.64	4.64	0.57946	.	0.310182	0.25310	N	0.031587	T	0.55481	0.1923	N	0.25245	0.725	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.09377	0.003;0.004;0.002	T	0.42327	-0.9458	10	0.32370	T	0.25	.	10.5338	0.44992	0.0893:0.0:0.9107:0.0	.	359;417;359	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	V	417;417;359	ENSP00000296946:A417V;ENSP00000355836:A359V	ENSP00000296946:A417V	A	-	2	0	T	166491851	0.131000	0.22433	0.226000	0.23910	0.194000	0.23727	2.449000	0.44935	2.264000	0.75181	0.655000	0.94253	GCC		0.632	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181		Missense_Mutation
CHPF2	54480	broad.mit.edu	37	7	150934694	150934694	+	Missense_Mutation	SNP	C	C	T	rs375493278		TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr7:150934694C>T	ENST00000035307.2	+	4	2759	c.1246C>T	c.(1246-1248)Cgg>Tgg	p.R416W	CHPF2_ENST00000495645.1_Missense_Mutation_p.R408W|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	416					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.R416W(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GCAGCTCAATCGGCGCTATCA	0.647																																																1	Substitution - Missense(1)	ovary(1)	7						C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	48.0	54.0	52.0		1246	3.5	1.0	7		52	0,8600		0,0,4300	no	missense	CHPF2	NM_019015.1	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	416/773	150934694	1,13005	2203	4300	6503	150565627	SO:0001583	missense	54480			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1246C>T	7.37:g.150934694C>T	ENSP00000035307:p.Arg416Trp	Unknown		x	x	x	150565627	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500147	0.64298	2.27E-4	0.0	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.17691	2.26;2.26	5.5	3.47	0.39725	.	0.237399	0.43416	D	0.000571	T	0.32406	0.0828	L	0.50333	1.59	0.36091	D	0.843456	D;D	0.89917	1.0;0.999	D;P	0.71870	0.975;0.814	T	0.39418	-0.9615	10	0.72032	D	0.01	-26.6801	11.1852	0.48653	0.2941:0.6028:0.1031:0.0	.	416;408	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	W	408;416;416	ENSP00000418914:R408W;ENSP00000035307:R416W	ENSP00000035307:R416W	R	+	1	2	CHPF2	150565627	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.489000	0.35562	1.291000	0.44653	0.563000	0.77884	CGG		0.647	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015		Missense_Mutation
PEX2	5828	broad.mit.edu	37	8	77896009	77896009	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr8:77896009T>A	ENST00000419564.2	-	4	870	c.406A>T	c.(406-408)Aag>Tag	p.K136*	PEX2_ENST00000522527.1_Nonsense_Mutation_p.K136*|PEX2_ENST00000357039.4_Nonsense_Mutation_p.K136*|PEX2_ENST00000520103.1_Nonsense_Mutation_p.K136*	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	136					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)	p.K136*(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ACACACTGCTTGACTTTCCCA	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	8											98.0	95.0	96.0					8																	77896009		2203	4300	6503	78058564	SO:0001587	stop_gained	5828			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.406A>T	8.37:g.77896009T>A	ENSP00000400984:p.Lys136*	Unknown		x	x	x	78058564	Q567S6|Q9BW41	Nonsense_Mutation	SNP	ENST00000419564.2	37	CCDS6221.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	39	7.555792	0.98355	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527;ENST00000518986	.	.	.	5.18	5.18	0.71444	.	0.115856	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.6691	15.2557	0.73582	0.0:0.0:0.0:1.0	.	.	.	.	X	136	.	ENSP00000349543:K136X	K	-	1	0	PEX2	78058564	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.361000	0.44160	2.185000	0.69588	0.456000	0.33151	AAG		0.373	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318		Nonsense_Mutation
FRMD3	257019	broad.mit.edu	37	9	85958175	85958175	+	Silent	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr9:85958175C>T	ENST00000304195.3	-	5	608	c.402G>A	c.(400-402)agG>agA	p.R134R	FRMD3_ENST00000376438.1_Silent_p.R134R	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	134	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)		p.R134R(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						GAAAAATGTCCCTTTTAATCT	0.458																																																1	Substitution - coding silent(1)	ovary(1)	9											90.0	95.0	94.0					9																	85958175		1997	4176	6173	85147995	SO:0001819	synonymous_variant	257019			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.402G>A	9.37:g.85958175C>T		Unknown		x	x	x	85147995	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Silent	SNP	ENST00000304195.3	37	CCDS43840.1	SNP	22	Broad																																																																																				0.458	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938		Silent
AMER1	139285	broad.mit.edu	37	X	63411597	63411597	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1495-01	TCGA-13-1495-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chrX:63411597A>T	ENST00000330258.3	-	2	1842	c.1570T>A	c.(1570-1572)Tgc>Agc	p.C524S	AMER1_ENST00000374869.3_Missense_Mutation_p.C524S|AMER1_ENST00000403336.1_Missense_Mutation_p.C524S	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	524					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.C524S(1)									TCATAAAGGCAGTCATCTCCA	0.522																																																68	Whole gene deletion(67)|Substitution - Missense(1)	kidney(65)|ovary(2)|large_intestine(1)	X											44.0	43.0	43.0					X																	63411597		2203	4300	6503	63328322	SO:0001583	missense	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1570T>A	X.37:g.63411597A>T	ENSP00000329117:p.Cys524Ser	Somatic		x	x	x	63328322	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	8.863	0.947417	0.18356	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.17528	2.27;2.27;2.27	5.21	2.64	0.31445	.	0.194110	0.37715	N	0.001973	T	0.10895	0.0266	L	0.41236	1.265	0.32025	N	0.600345	B	0.18610	0.029	B	0.21151	0.033	T	0.25710	-1.0124	10	0.07175	T	0.84	-9.424	7.161	0.25664	0.7078:0.1473:0.0:0.1449	.	524	Q5JTC6	F123B_HUMAN	S	524	ENSP00000364003:C524S;ENSP00000329117:C524S;ENSP00000384722:C524S	ENSP00000329117:C524S	C	-	1	0	FAM123B	63328322	0.999000	0.42202	1.000000	0.80357	0.927000	0.56198	1.235000	0.32671	0.873000	0.35799	0.486000	0.48141	TGC		0.522	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		Missense_Mutation
CPXCR1	53336	broad.mit.edu	37	X	88008812	88008812	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chrX:88008812C>T	ENST00000276127.4	+	3	656	c.397C>T	c.(397-399)Cga>Tga	p.R133*	CPXCR1_ENST00000373111.1_Nonsense_Mutation_p.R133*	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	133							metal ion binding (GO:0046872)	p.R133*(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AACTCGTTTTCGACTTTCAAC	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	X											52.0	47.0	49.0					X																	88008812		2203	4300	6503	87895468	SO:0001587	stop_gained	53336			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.397C>T	X.37:g.88008812C>T	ENSP00000276127:p.Arg133*	Unknown		x	x	x	87895468	B2R9F9|D3DTE7|Q96RS3	Nonsense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	19.23	3.786788	0.70337	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	.	.	.	3.06	3.06	0.35304	.	0.969776	0.08359	N	0.958027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.6039	8.8048	0.34932	0.0:1.0:0.0:0.0	.	.	.	.	X	133	.	.	R	+	1	2	CPXCR1	87895468	0.009000	0.17119	0.004000	0.12327	0.005000	0.04900	1.704000	0.37857	1.807000	0.52817	0.594000	0.82650	CGA		0.388	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		Nonsense_Mutation
RBMX2	51634	broad.mit.edu	37	X	129543288	129543288	+	Silent	SNP	A	A	G			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chrX:129543288A>G	ENST00000305536.6	+	4	295	c.231A>G	c.(229-231)aaA>aaG	p.K77K	RBMX2_ENST00000469953.1_3'UTR	NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	77	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K77K(1)		breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						GGAAATCCAAAGGATTCTGTT	0.393																																																1	Substitution - coding silent(1)	ovary(1)	X											88.0	84.0	85.0					X																	129543288		1830	4077	5907	129370969	SO:0001819	synonymous_variant	51634			AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.231A>G	X.37:g.129543288A>G		Unknown		x	x	x	129370969	A8K9Z0|Q5JY82|Q9Y3I8	Silent	SNP	ENST00000305536.6	37	CCDS43993.1	SNP	3	Broad																																																																																				0.393	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058265.1	NM_016024		Silent
LRIT2	340745	broad.mit.edu	37	10	85982066	85982067	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr10:85982066_85982067insCC	ENST00000372113.4	-	3	1267_1268	c.1262_1263insGG	c.(1261-1263)gatfs	p.D421fs	LRIT2_ENST00000538192.1_Frame_Shift_Ins_p.D431fs	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	421	Fibronectin type-III.					integral component of membrane (GO:0016021)		p.D421fs*16(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GAAGGAGGTCATCCACAGCATA	0.535																																																1	Insertion - Frameshift(1)	ovary(1)	10																																								85972047	SO:0001589	frameshift_variant	340745				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1262_1263insGG	10.37:g.85982066_85982067insCC	ENSP00000361185:p.Asp421fs	Unknown		Capture	Illumina GAIIx	Phase_I	85972046	B7ZME6	Frame_Shift_Ins	INS	ENST00000372113.4	37	CCDS31234.1	INS	8	Broad																																																																																				0.535	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697		Frame_Shift_Ins
BCDIN3D	144233	broad.mit.edu	37	12	50232433	50232433	+	Frame_Shift_Del	DEL	C	C	-			TCGA-13-1495-01	TCGA-13-1495-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1495-01	TCGA-13-1495-10	g.chr12:50232433delC	ENST00000333924.4	-	2	641	c.600delG	c.(598-600)tggfs	p.W200fs	BCDIN3D-AS1_ENST00000549124.1_RNA|BCDIN3D-AS1_ENST00000548872.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	200	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)	p.W200fs*1(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						GGTAACACTTCCAGGGTTGGG	0.557																																																1	Deletion - Frameshift(1)	ovary(1)	12											67.0	63.0	64.0					12																	50232433		2203	4300	6503	48518700	SO:0001589	frameshift_variant	144233				CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.600delG	12.37:g.50232433delC	ENSP00000335201:p.Trp200fs	Unknown		Capture	Illumina GAIIx	Phase_I	48518700	A8K829	Frame_Shift_Del	DEL	ENST00000333924.4	37	CCDS8790.1	DEL	30	Broad																																																																																				0.557	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405982.1	NM_181708		Frame_Shift_Del
