#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
IGSF21	84966	broad.mit.edu	37	1	18703371	18703371	+	Silent	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:18703371C>T	ENST00000251296.1	+	8	1562	c.1179C>T	c.(1177-1179)gaC>gaT	p.D393D	IGSF21_ENST00000473951.1_3'UTR	NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	393	Ig-like 2.					extracellular region (GO:0005576)		p.D393D(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CTGAGTTCGACGGGAAGGAGC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1											44.0	45.0	45.0					1																	18703371		2203	4300	6503	18575958	SO:0001819	synonymous_variant	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1179C>T	1.37:g.18703371C>T		Unknown		x	x	x	18575958	Q8NBR8	Silent	SNP	ENST00000251296.1	37	CCDS184.1	SNP	19	Broad																																																																																				0.657	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880		Silent
NBL1	4681	broad.mit.edu	37	1	19981646	19981646	+	Silent	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:19981646C>T	ENST00000375136.3	+	2	426	c.123C>T	c.(121-123)acC>acT	p.T41T	NBL1_ENST00000548815.1_Silent_p.T40T|NBL1_ENST00000289749.2_Silent_p.T76T|MINOS1-NBL1_ENST00000602662.1_Silent_p.T41T	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	41	CTCK.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)	p.T40T(1)		lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGAACATCACCCAGATCGTGG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	1											40.0	32.0	34.0					1																	19981646		2203	4300	6503	19854233	SO:0001819	synonymous_variant	4681				CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.123C>T	1.37:g.19981646C>T		Unknown		x	x	x	19854233	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Silent	SNP	ENST00000375136.3	37	CCDS196.2	SNP	22	Broad																																																																																				0.632	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007681.4	NM_005380		Silent
RLF	6018	broad.mit.edu	37	1	40703591	40703591	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:40703591A>G	ENST00000372771.4	+	8	3244	c.3217A>G	c.(3217-3219)Aaa>Gaa	p.K1073E		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1073					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.K1073E(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTTAAGCTTGAAAAACTCAAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											103.0	101.0	102.0					1																	40703591		2203	4300	6503	40476178	SO:0001583	missense	6018				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.3217A>G	1.37:g.40703591A>G	ENSP00000361857:p.Lys1073Glu	Unknown		x	x	x	40476178	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	3.623	-0.077194	0.07184	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.13901	2.55	5.85	4.67	0.58626	.	0.086877	0.85682	D	0.000000	T	0.10337	0.0253	L	0.38531	1.155	0.38988	D	0.95909	P;B	0.38597	0.639;0.172	B;B	0.30029	0.11;0.038	T	0.13899	-1.0492	10	0.44086	T	0.13	-20.8119	12.7504	0.57306	0.8632:0.1368:0.0:0.0	.	766;1073	F5H2M5;Q13129	.;RLF_HUMAN	E	1073;766	ENSP00000361857:K1073E	ENSP00000361857:K1073E	K	+	1	0	RLF	40476178	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.849000	0.39318	2.234000	0.73211	0.533000	0.62120	AAA		0.418	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421		Missense_Mutation
ERI3	79033	broad.mit.edu	37	1	44804760	44804760	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:44804760A>G	ENST00000372257.2	-	3	627	c.446T>C	c.(445-447)cTg>cCg	p.L149P	ERI3_ENST00000495828.1_5'UTR|ERI3_ENST00000537474.1_Intron	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	149	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L149P(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CTCAAAGTCCAGCACTAAAAA	0.552																																																1	Substitution - Missense(1)	ovary(1)	1											163.0	173.0	170.0					1																	44804760		2203	4300	6503	44577347	SO:0001583	missense	79033			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.446T>C	1.37:g.44804760A>G	ENSP00000361331:p.Leu149Pro	Unknown		x	x	x	44577347	B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Missense_Mutation	SNP	ENST00000372257.2	37	CCDS30696.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259056	0.80246	.	.	ENSG00000117419	ENST00000372257;ENST00000372253;ENST00000457571	T;T	0.28454	1.61;1.61	6.17	6.17	0.99709	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.201673	0.34676	N	0.003780	T	0.65616	0.2708	M	0.91717	3.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.73742	-0.3887	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	147;71;149	F6UGJ8;B4DN03;O43414	.;.;ERI3_HUMAN	P	149;15;147	ENSP00000361331:L149P;ENSP00000412291:L147P	ENSP00000361327:L15P	L	-	2	0	ERI3	44577347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.063000	0.71162	2.371000	0.80710	0.533000	0.62120	CTG		0.552	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066		Missense_Mutation
DAB1	1600	broad.mit.edu	37	1	57476834	57476834	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1496-01	TCGA-13-1496-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:57476834C>A	ENST00000371231.1	-	14	1689	c.1655G>T	c.(1654-1656)aGc>aTc	p.S552I	DAB1_ENST00000414851.2_Missense_Mutation_p.S501I|DAB1_ENST00000439789.2_Missense_Mutation_p.S433I|DAB1_ENST00000371236.2_Missense_Mutation_p.S519I|DAB1_ENST00000420954.2_Missense_Mutation_p.S517I|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.S519I			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	552					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.S519I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TTGCTCTTCGCTTTTGCTGGG	0.433																																																1	Substitution - Missense(1)	ovary(1)	1											133.0	136.0	135.0					1																	57476834		2203	4300	6503	57249422	SO:0001583	missense	1600			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1655G>T	1.37:g.57476834C>A	ENSP00000360275:p.Ser552Ile	Somatic		x	x	x	57249422	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	ENST00000371231.1	37		SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675828	0.67928	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.56941	0.45;0.45;0.44;0.43;1.46;0.49	4.96	4.96	0.65561	.	0.397394	0.17838	U	0.160313	T	0.69984	0.3172	L	0.55481	1.735	0.49130	D	0.999754	D;D;D;P;D	0.89917	1.0;0.999;1.0;0.784;1.0	D;D;D;B;D	0.76575	0.966;0.972;0.982;0.319;0.988	T	0.71666	-0.4524	10	0.87932	D	0	-33.8659	18.7462	0.91794	0.0:1.0:0.0:0.0	.	501;552;519;433;517	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	I	519;519;519;517;501;433;552	ENSP00000360280:S519I;ENSP00000360278:S519I;ENSP00000395296:S517I;ENSP00000387581:S501I;ENSP00000409328:S433I;ENSP00000360275:S552I	ENSP00000360275:S552I	S	-	2	0	DAB1	57249422	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	4.409000	0.59768	2.724000	0.93272	0.555000	0.69702	AGC		0.433	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080		Missense_Mutation
DCST2	127579	broad.mit.edu	37	1	155005607	155005607	+	Silent	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:155005607G>A	ENST00000368424.3	-	2	460	c.402C>T	c.(400-402)acC>acT	p.T134T	DCST1_ENST00000423025.2_5'Flank|DCST1_ENST00000368419.2_5'Flank|DCST1_ENST00000295542.1_5'Flank|DCST1_ENST00000392480.1_5'Flank|DCST2_ENST00000295536.5_Silent_p.T134T	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	134						integral component of membrane (GO:0016021)		p.T134T(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCACTTCGGCGGTCTGGTTCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											51.0	44.0	46.0					1																	155005607		2201	4299	6500	153272231	SO:0001819	synonymous_variant	127579			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.402C>T	1.37:g.155005607G>A		Unknown		x	x	x	153272231	Q2M2R2|Q8N810|Q96M03	Silent	SNP	ENST00000368424.3	37	CCDS1082.2	SNP	39	Broad																																																																																				0.627	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622		Silent
PPP1R12B	4660	broad.mit.edu	37	1	202464598	202464598	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1496-01	TCGA-13-1496-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:202464598A>T	ENST00000608999.1	+	16	2476	c.2323A>T	c.(2323-2325)Atg>Ttg	p.M775L	PPP1R12B_ENST00000367270.4_Start_Codon_SNP_p.M1L|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.M775L|PPP1R12B_ENST00000290419.5_3'UTR|PPP1R12B_ENST00000391959.3_Start_Codon_SNP_p.M1L	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	775					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)	p.M775L(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TGCAAAGGAAATGGACAAAAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											66.0	63.0	64.0					1																	202464598		2203	4300	6503	200731221	SO:0001583	missense	4660			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.2323A>T	1.37:g.202464598A>T	ENSP00000476755:p.Met775Leu	Somatic		x	x	x	200731221	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	CCDS1426.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284381	0.80803	.	.	ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000391959;ENST00000367270	T;T;T;T	0.42131	4.12;4.12;0.98;0.98	5.67	5.67	0.87782	.	0.405893	0.26241	N	0.025501	T	0.60038	0.2238	M	0.72479	2.2	0.80722	D	1	P;P;B	0.48407	0.91;0.838;0.066	D;B;B	0.62955	0.909;0.321;0.093	T	0.56068	-0.8040	10	0.25751	T	0.34	.	13.7212	0.62728	1.0:0.0:0.0:0.0	.	1;775;775	O60237-3;O60237;F8W8M3	.;MYPT2_HUMAN;.	L	775;775;1;1	ENSP00000384496:M775L;ENSP00000337897:M775L;ENSP00000375821:M1L;ENSP00000356239:M1L	ENSP00000337897:M775L	M	+	1	0	PPP1R12B	200731221	0.999000	0.42202	0.997000	0.53966	0.992000	0.81027	4.257000	0.58816	2.281000	0.76405	0.533000	0.62120	ATG		0.423	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		Missense_Mutation
MIA3	375056	broad.mit.edu	37	1	222801726	222801726	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr1:222801726C>G	ENST00000344922.5	+	4	1189	c.1164C>G	c.(1162-1164)ttC>ttG	p.F388L	MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344441.6_Missense_Mutation_p.F388L|MIA3_ENST00000344507.1_Missense_Mutation_p.F388L	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	388					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.F388L(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		ACACTATCTTCTCTATTGTCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	72.0	73.0					1																	222801726		1853	4097	5950	220868349	SO:0001583	missense	375056				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.1164C>G	1.37:g.222801726C>G	ENSP00000340900:p.Phe388Leu	Unknown		x	x	x	220868349	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	9.433	1.085934	0.20390	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000344507	T;T;T	0.40756	1.11;1.11;1.02	4.27	-1.26	0.09376	.	.	.	.	.	T	0.27349	0.0671	L	0.39147	1.195	0.24276	N	0.99523	B;B	0.26602	0.154;0.058	B;B	0.20955	0.032;0.028	T	0.17653	-1.0362	9	0.34782	T	0.22	.	4.6841	0.12750	0.0:0.3407:0.1671:0.4922	.	388;388	Q5JRA6-2;Q5JRA6	.;MIA3_HUMAN	L	388	ENSP00000340900:F388L;ENSP00000340587:F388L;ENSP00000341348:F388L	ENSP00000325973:F388L	F	+	3	2	MIA3	220868349	0.068000	0.21057	0.128000	0.21923	0.497000	0.33675	-0.043000	0.12043	-0.219000	0.10003	-0.680000	0.03767	TTC		0.408	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		Missense_Mutation
ZSWIM8	23053	broad.mit.edu	37	10	75557149	75557149	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr10:75557149G>C	ENST00000605216.1	+	18	3650	c.3433G>C	c.(3433-3435)Gac>Cac	p.D1145H	ZSWIM8_ENST00000604524.1_Missense_Mutation_p.D1145H|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.D1112H|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.D1150H|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.D1150H	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1145	Ser-rich.						zinc ion binding (GO:0008270)										GGCCAGCATTGACAGCAGTGC	0.562																																																0			10											63.0	64.0	64.0					10																	75557149		2011	4183	6194	75227155	SO:0001583	missense	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3433G>C	10.37:g.75557149G>C	ENSP00000474748:p.Asp1145His	Unknown		x	x	x	75227155	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	ENST00000605216.1	37		SNP	45	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.39|18.39|18.39	3.614095|3.614095|3.614095	0.66672|0.66672|0.66672	.|.|.	.|.|.	ENSG00000214655|ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000412198|ENST00000433366	T|.|.	0.51325|.|.	0.71|.|.	4.92|4.92|4.92	4.92|4.92|4.92	0.64577|0.64577|0.64577	.|.|.	0.000000|.|.	0.64402|.|.	U|.|.	0.000002|.|.	T|T|.	0.74107|0.74107|.	0.3673|0.3673|.	M|M|M	0.66939|0.66939|0.66939	2.045|2.045|2.045	0.58432|0.58432|0.58432	D|D|D	0.999997|0.999997|0.999997	D;D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0;1.0|.|.	D;D;D;D|.|.	0.85130|.|.	0.997;0.971;0.997;0.997|.|.	T|T|.	0.73122|0.73122|.	-0.4082|-0.4082|.	10|5|.	0.72032|.|.	D|.|.	0.01|.|.	-9.2164|-9.2164|-9.2164	18.3155|18.3155|18.3155	0.90220|0.90220|0.90220	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	1145;1157;1145;1150|.|.	A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4|.|.	K0913_HUMAN;.;.;.|.|.	H|F|S	1150|419|860	ENSP00000381693:D1150H|.|.	ENSP00000381693:D1150H|.|.	D|L|X	+|+|+	1|3|2	0|2|2	KIAA0913|KIAA0913|KIAA0913	75227155|75227155|75227155	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.993000|0.993000|0.993000	0.82548|0.82548|0.82548	9.051000|9.051000|9.051000	0.93849|0.93849|0.93849	2.563000|2.563000|2.563000	0.86464|0.86464|0.86464	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAC|TTG|TGA		0.562	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487		Missense_Mutation
ECHS1	1892	broad.mit.edu	37	10	135180499	135180499	+	Splice_Site	SNP	T	T	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr10:135180499T>A	ENST00000368547.3	-	5	870		c.e5-2			NM_004092.3	NP_004083.3	P30084	ECHM_HUMAN	enoyl CoA hydratase, short chain, 1, mitochondrial						cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)	p.?(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	10		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		CGCCCGCACCTGCAGGGAGGG	0.607																																					GBM(132;1720 1771 5373 10277 21402)											1	Unknown(1)	ovary(1)	10											44.0	34.0	37.0					10																	135180499		2202	4299	6501	135030489	SO:0001630	splice_region_variant	1892				CCDS7681.1	10q26.2-q26.3	2010-05-04	2010-04-30		ENSG00000127884	ENSG00000127884	4.2.1.17		3151	protein-coding gene	gene with protein product		602292	"""enoyl Coenzyme A hydratase, short chain, 1, mitochondrial"""			8012501	Standard	NM_004092		Approved	SCEH	uc001lmu.3	P30084	OTTHUMG00000019320	ENST00000368547.3:c.515-2A>T	10.37:g.135180499T>A		Unknown		x	x	x	135030489	O00739|Q5VWY1|Q96H54	Splice_Site_SNP	SNP	ENST00000368547.3	37	CCDS7681.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	t	12.46	1.944504	0.34283	.	.	ENSG00000127884	ENST00000368547	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6191	0.56594	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ECHS1	135030489	1.000000	0.71417	0.988000	0.46212	0.015000	0.08874	6.421000	0.73353	2.229000	0.72834	0.529000	0.55759	.		0.607	ECHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051156.1		Intron	Splice_Site_SNP
PTPRJ	5795	broad.mit.edu	37	11	48146657	48146657	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr11:48146657G>A	ENST00000418331.2	+	6	1364	c.1012G>A	c.(1012-1014)Ggc>Agc	p.G338S	PTPRJ_ENST00000440289.2_Missense_Mutation_p.G338S	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	338	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.G338S(1)		breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTTAGAGCCTGGCACCCGATA	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											88.0	93.0	91.0					11																	48146657		2201	4298	6499	48103233	SO:0001583	missense	5795			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1012G>A	11.37:g.48146657G>A	ENSP00000400010:p.Gly338Ser	Somatic		x	x	x	48103233	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607781	0.66558	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.07327	3.2;3.2	5.38	-0.821	0.10822	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.08582	0.0213	L	0.34521	1.04	0.09310	N	1	B;P	0.42010	0.354;0.768	B;P	0.45232	0.156;0.474	T	0.31223	-0.9951	9	0.49607	T	0.09	.	8.3638	0.32374	0.5251:0.0:0.4749:0.0	.	338;338	Q12913;Q6P4H4	PTPRJ_HUMAN;.	S	338	ENSP00000400010:G338S;ENSP00000409733:G338S	ENSP00000278456:G338S	G	+	1	0	PTPRJ	48103233	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	0.341000	0.19909	-0.197000	0.10350	0.563000	0.77884	GGC		0.572	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1			Missense_Mutation
MYO7A	4647	broad.mit.edu	37	11	76869377	76869377	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr11:76869377C>T	ENST00000409709.3	+	9	1176	c.904C>T	c.(904-906)Cgc>Tgc	p.R302C	MYO7A_ENST00000409893.1_Missense_Mutation_p.R302C|MYO7A_ENST00000409619.2_Missense_Mutation_p.R291C|MYO7A_ENST00000458637.2_Missense_Mutation_p.R302C	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	302	Myosin motor.		R -> H (in USH1B; uncertain pathological significance; dbSNP:rs41298135). {ECO:0000269|PubMed:8900236}.		actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)	p.R302C(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CGCCAACATCCGCTCCGCCAT	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											46.0	52.0	50.0					11																	76869377		2146	4246	6392	76547025	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.904C>T	11.37:g.76869377C>T	ENSP00000386331:p.Arg302Cys	Unknown		x	x	x	76547025	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981624	0.74474	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000343419	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.72	4.81	0.61882	Myosin head, motor domain (2);	0.061993	0.64402	N	0.000003	D	0.92554	0.7635	M	0.67517	2.055	0.80722	D	1	D;B;D	0.89917	1.0;0.356;0.999	D;B;D	0.70016	0.967;0.099;0.956	D	0.92700	0.6174	10	0.87932	D	0	.	10.2621	0.43434	0.1358:0.794:0.0:0.0702	.	302;302;302	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	C	302;302;302;291;301;301;301	ENSP00000386331:R302C;ENSP00000386689:R302C;ENSP00000392185:R302C;ENSP00000386635:R291C	ENSP00000340325:R301C	R	+	1	0	MYO7A	76547025	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.232000	0.51302	1.419000	0.47118	0.655000	0.94253	CGC		0.602	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260		Missense_Mutation
KIAA1377	57562	broad.mit.edu	37	11	101815106	101815106	+	Missense_Mutation	SNP	G	G	A	rs148228595		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr11:101815106G>A	ENST00000263468.8	+	3	629	c.359G>A	c.(358-360)cGt>cAt	p.R120H		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	120								p.R120H(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAATTCCAGCGTGCCCATGTT	0.358																																																1	Substitution - Missense(1)	ovary(1)	11						G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	80.0	79.0	80.0		359	6.0	1.0	11	dbSNP_134	80	4,8594	3.0+/-9.4	0,4,4295	yes	missense	KIAA1377	NM_020802.2	29	0,5,6497	AA,AG,GG		0.0465,0.0227,0.0384	probably-damaging	120/1118	101815106	5,12999	2203	4299	6502	101320316	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.359G>A	11.37:g.101815106G>A	ENSP00000263468:p.Arg120His	Unknown		x	x	x	101320316	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897420	0.91962	2.27E-4	4.65E-4	ENSG00000110318	ENST00000263468	T	0.30182	1.54	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.59197	0.2176	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58601	-0.7608	10	0.66056	D	0.02	-13.3359	19.3185	0.94226	0.0:0.0:1.0:0.0	.	120	Q9P2H0	K1377_HUMAN	H	120	ENSP00000263468:R120H	ENSP00000263468:R120H	R	+	2	0	KIAA1377	101320316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.444000	0.73452	2.850000	0.98022	0.650000	0.86243	CGT		0.358	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802		Missense_Mutation
HOXC6	3223	broad.mit.edu	37	12	54423477	54423477	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr12:54423477A>C	ENST00000243108.4	+	2	603	c.439A>C	c.(439-441)Atc>Ctc	p.I147L	RP11-834C11.14_ENST00000512206.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC4_ENST00000303406.4_Intron|HOXC6_ENST00000394331.3_Missense_Mutation_p.I65L	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	147					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.I147L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGGCCGCCAGATCTACTCGCG	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											71.0	77.0	75.0					12																	54423477		2203	4300	6503	52709744	SO:0001583	missense	3223				CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.439A>C	12.37:g.54423477A>C	ENSP00000243108:p.Ile147Leu	Unknown		x	x	x	52709744	B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	37	CCDS8871.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	17.81	3.479702	0.63849	.	.	ENSG00000197757	ENST00000394331;ENST00000243108	D;D	0.96041	-3.89;-3.89	4.69	4.69	0.59074	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.89715	0.6795	N	0.12471	0.22	0.80722	D	1	B	0.29936	0.262	B	0.29440	0.102	D	0.89243	0.3585	10	0.87932	D	0	.	13.2733	0.60175	1.0:0.0:0.0:0.0	.	147	P09630	HXC6_HUMAN	L	65;147	ENSP00000377864:I65L;ENSP00000243108:I147L	ENSP00000243108:I147L	I	+	1	0	HOXC6	52709744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.242000	0.78210	1.971000	0.57363	0.459000	0.35465	ATC		0.582	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2			Missense_Mutation
XRCC6BP1	91419	broad.mit.edu	37	12	58340808	58340808	+	Silent	SNP	C	C	T	rs201097826		TCGA-13-1496-01	TCGA-13-1496-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr12:58340808C>T	ENST00000300145.3	+	3	389	c.264C>T	c.(262-264)tgC>tgT	p.C88C		NM_033276.2	NP_150592.1	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	88					double-strand break repair via nonhomologous end joining (GO:0006303)|protein phosphorylation (GO:0006468)	DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)	DNA-dependent protein kinase activity (GO:0004677)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.C88C(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	11						ACTTTTCTTGCGAAGACTGTA	0.423													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19714	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						C		4,3780		0,4,1888	200.0	186.0	190.0		264	-0.8	1.0	12		190	0,8246		0,0,4123	yes	coding-synonymous	XRCC6BP1	NM_033276.2		0,4,6011	TT,TC,CC		0.0,0.1057,0.0333		88/247	58340808	4,12026	1892	4123	6015	56627075	SO:0001819	synonymous_variant	91419			AF078164	CCDS41802.1	12q14.1	2006-01-09				ENSG00000166896			29452	protein-coding gene	gene with protein product	"""Ku70 binding protein 3"""					10219089	Standard	XM_005269223		Approved	KUB3	uc001sqp.3	Q9Y6H3	OTTHUMG00000170493	ENST00000300145.3:c.264C>T	12.37:g.58340808C>T		Somatic		x	x	x	56627075	Q1RLM4|Q96E81	Silent	SNP	ENST00000300145.3	37	CCDS41802.1	SNP	27	Broad																																																																																				0.423	XRCC6BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409390.1	NM_033276		Silent
USP15	9958	broad.mit.edu	37	12	62785021	62785021	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr12:62785021A>C	ENST00000280377.5	+	16	2103	c.2045A>C	c.(2044-2046)gAt>gCt	p.D682A	USP15_ENST00000353364.3_Missense_Mutation_p.D653A|USP15_ENST00000393654.3_Missense_Mutation_p.D657A	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	682	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D653A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CAGTCTGAAGATTCAGTTGGA	0.383																																					Melanoma(181;615 2041 39364 49691 50001)											1	Substitution - Missense(1)	ovary(1)	12											82.0	81.0	81.0					12																	62785021		2203	4300	6503	61071288	SO:0001583	missense	9958			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.2045A>C	12.37:g.62785021A>C	ENSP00000280377:p.Asp682Ala	Unknown		x	x	x	61071288	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	13.98	2.400268	0.42613	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.19250	2.17;2.16;2.16	5.59	5.59	0.84812	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	L	0.37507	1.11	0.80722	D	1	D;B	0.56287	0.975;0.029	P;B	0.52957	0.714;0.017	T	0.01071	-1.1461	9	.	.	.	-18.8791	15.7764	0.78224	1.0:0.0:0.0:0.0	.	682;653	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	A	653;682;657	ENSP00000258123:D653A;ENSP00000280377:D682A;ENSP00000377264:D657A	.	D	+	2	0	USP15	61071288	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.669000	0.91163	2.135000	0.66039	0.460000	0.39030	GAT		0.383	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313		Missense_Mutation
ANO4	121601	broad.mit.edu	37	12	101490398	101490398	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr12:101490398C>T	ENST00000392977.3	+	19	2033	c.1823C>T	c.(1822-1824)aCa>aTa	p.T608I	ANO4_ENST00000299222.9_Missense_Mutation_p.T128I|ANO4_ENST00000392979.3_Missense_Mutation_p.T573I|ANO4_ENST00000550015.1_Missense_Mutation_p.T128I			Q32M45	ANO4_HUMAN	anoctamin 4	608					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.T573I(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AACAGCTCCACATTTTACATC	0.493										HNSCC(74;0.22)																																						1	Substitution - Missense(1)	ovary(1)	12											126.0	114.0	118.0					12																	101490398		2203	4300	6503	100014529	SO:0001583	missense	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1823C>T	12.37:g.101490398C>T	ENSP00000376703:p.Thr608Ile	Unknown		x	x	x	100014529	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	4.424	0.078500	0.08533	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	5.78	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.23289	0.0563	N	0.00422	-1.515	0.49915	D	0.999839	B;B;B	0.21225	0.007;0.053;0.015	B;B;B	0.28011	0.013;0.085;0.03	T	0.40572	-0.9556	10	0.02654	T	1	.	14.5594	0.68126	0.0:0.9292:0.0:0.0708	.	128;608;573	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	I	573;128;608;128	ENSP00000376705:T573I;ENSP00000299222:T128I;ENSP00000376703:T608I;ENSP00000450192:T128I	ENSP00000299222:T128I	T	+	2	0	ANO4	100014529	0.996000	0.38824	0.962000	0.40283	0.926000	0.56050	3.356000	0.52269	1.458000	0.47871	0.563000	0.77884	ACA		0.493	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826		Missense_Mutation
MYL2	4633	broad.mit.edu	37	12	111356989	111356989	+	Silent	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr12:111356989C>T	ENST00000228841.8	-	2	59	c.12G>A	c.(10-12)aaG>aaA	p.K4K	MYL2_ENST00000548438.1_Silent_p.K4K	NM_000432.3	NP_000423.2	P10916	MLRV_HUMAN	myosin, light chain 2, regulatory, cardiac, slow	4					cardiac muscle contraction (GO:0060048)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle cell fate specification (GO:0042694)|muscle fiber development (GO:0048747)|muscle filament sliding (GO:0030049)|negative regulation of cell growth (GO:0030308)|post-embryonic development (GO:0009791)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|myofibril (GO:0030016)|myosin complex (GO:0016459)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)	p.K4K(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	12						TCTTTGCTTTCTTAGGTGCCT	0.498																																					GBM(14;268 426 18829 21617 25540)											1	Substitution - coding silent(1)	ovary(1)	12											64.0	62.0	63.0					12																	111356989		2203	4300	6503	109841372	SO:0001819	synonymous_variant	4633				CCDS31901.1	12q24.11	2014-09-17	2006-09-29		ENSG00000111245	ENSG00000111245		"""Myosins / Light chain"", ""EF-hand domain containing"""	7583	protein-coding gene	gene with protein product	"""cardiac ventricular myosin light chain 2"""	160781	"""myosin, light polypeptide 2, regulatory, cardiac, slow"""			1386340	Standard	NM_000432		Approved	CMH10	uc001try.4	P10916	OTTHUMG00000169535	ENST00000228841.8:c.12G>A	12.37:g.111356989C>T		Unknown		x	x	x	109841372	Q16123	Silent	SNP	ENST00000228841.8	37	CCDS31901.1	SNP	32	Broad																																																																																				0.498	MYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404677.2	NM_000432		Silent
SERPINA3	12	broad.mit.edu	37	14	95085792	95085792	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr14:95085792T>C	ENST00000467132.1	+	3	2052	c.904T>C	c.(904-906)Tct>Cct	p.S302P	SERPINA3_ENST00000482740.1_Missense_Mutation_p.S84P|SERPINA3_ENST00000393078.3_Missense_Mutation_p.S302P|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393080.4_Missense_Mutation_p.S302P			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	302					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S302P(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		GTGGAGAGACTCTCTGGAGTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	14											60.0	55.0	57.0					14																	95085792		2203	4300	6503	94155545	SO:0001583	missense	12			K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.904T>C	14.37:g.95085792T>C	ENSP00000450540:p.Ser302Pro	Unknown		x	x	x	94155545	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	37	CCDS32150.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	11.34	1.608636	0.28623	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132;ENST00000482740	D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96	4.79	3.64	0.41730	Serpin domain (3);	0.395926	0.21005	N	0.081788	T	0.80649	0.4663	L	0.41027	1.25	0.09310	N	1	B;B	0.27791	0.133;0.189	B;B	0.38616	0.129;0.277	T	0.71889	-0.4456	10	0.54805	T	0.06	.	5.988	0.19444	0.0:0.209:0.0:0.791	.	302;327	P01011;G3V5I3	AACT_HUMAN;.	P	327;302;302;302;302;84	ENSP00000452367:S327P;ENSP00000376793:S302P;ENSP00000376795:S302P;ENSP00000450540:S302P;ENSP00000451119:S84P	ENSP00000376793:S302P	S	+	1	0	SERPINA3	94155545	0.000000	0.05858	0.013000	0.15412	0.010000	0.07245	0.112000	0.15479	0.840000	0.34995	0.459000	0.35465	TCT		0.567	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085		Missense_Mutation
BDKRB2	624	broad.mit.edu	37	14	96707252	96707252	+	Missense_Mutation	SNP	G	G	A	rs201760673		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr14:96707252G>A	ENST00000306005.3	+	3	783	c.587G>A	c.(586-588)cGg>cAg	p.R196Q	RP11-404P21.8_ENST00000553811.1_Intron|BDKRB2_ENST00000539359.1_Missense_Mutation_p.R169Q|BDKRB2_ENST00000554311.1_Missense_Mutation_p.R196Q|BDKRB2_ENST00000542454.2_Missense_Mutation_p.R169Q	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	196					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)	p.R196Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	CTGGTGTTCCGGACCATGAAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	14											111.0	93.0	99.0					14																	96707252		2203	4300	6503	95777005	SO:0001583	missense	624			S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.587G>A	14.37:g.96707252G>A	ENSP00000307713:p.Arg196Gln	Unknown		x	x	x	95777005		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.167607	0.94768	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	4.72	4.72	0.59763	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61776	0.2374	M	0.75264	2.295	0.51767	D	0.999931	D	0.89917	1.0	D	0.97110	1.0	T	0.65829	-0.6073	10	0.56958	D	0.05	-39.987	18.0446	0.89328	0.0:0.0:1.0:0.0	.	196	P30411	BKRB2_HUMAN	Q	169;196;196;169	ENSP00000439459:R169Q;ENSP00000450482:R196Q;ENSP00000307713:R196Q;ENSP00000438376:R169Q	ENSP00000307713:R196Q	R	+	2	0	BDKRB2	95777005	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.695000	0.98691	2.332000	0.79248	0.561000	0.74099	CGG		0.587	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1			Missense_Mutation
FANCI	55215	broad.mit.edu	37	15	89833454	89833454	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr15:89833454A>G	ENST00000310775.7	+	19	1918	c.1832A>G	c.(1831-1833)gAt>gGt	p.D611G	FANCI_ENST00000300027.8_Missense_Mutation_p.D611G	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	611					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.D611G(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GGGTTTTATGATGTTCTTCGA	0.343								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							1	Substitution - Missense(1)	ovary(1)	15											127.0	128.0	128.0					15																	89833454		2200	4299	6499	87634458	SO:0001583	missense	55215	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.1832A>G	15.37:g.89833454A>G	ENSP00000310842:p.Asp611Gly	Unknown		x	x	x	87634458	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413782	0.83449	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.34472	1.36;1.36;1.36	5.18	5.18	0.71444	.	0.046594	0.85682	D	0.000000	T	0.58850	0.2151	M	0.73598	2.24	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.71184	0.97;0.972;0.972	T	0.62877	-0.6761	10	0.62326	D	0.03	-19.064	13.7668	0.62999	1.0:0.0:0.0:0.0	.	611;611;611	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	G	611	ENSP00000300027:D611G;ENSP00000310842:D611G;ENSP00000413249:D611G	ENSP00000300027:D611G	D	+	2	0	FANCI	87634458	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.353000	0.73032	2.172000	0.68678	0.533000	0.62120	GAT		0.343	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193		Missense_Mutation
ZSCAN10	84891	broad.mit.edu	37	16	3139670	3139670	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr16:3139670G>A	ENST00000252463.2	-	5	1687	c.1600C>T	c.(1600-1602)Cgc>Tgc	p.R534C	ZSCAN10_ENST00000538082.2_Missense_Mutation_p.R452C|ZSCAN10_ENST00000575108.1_Missense_Mutation_p.R195C|RP11-473M20.9_ENST00000571404.1_lincRNA	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	534					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R534C(1)		breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						CTGGCCCGGCGCACAAAGCGC	0.701																																																1	Substitution - Missense(1)	ovary(1)	16											9.0	9.0	9.0					16																	3139670		2167	4240	6407	3079671	SO:0001583	missense	84891			AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1600C>T	16.37:g.3139670G>A	ENSP00000252463:p.Arg534Cys	Unknown		x	x	x	3079671	B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	CCDS10493.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579701	0.28180	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T;T	0.20463	2.07;2.36	5.34	3.28	0.37604	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000218	T	0.34629	0.0904	L	0.42744	1.35	0.20764	N	0.99985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.989;0.994	T	0.08617	-1.0713	10	0.40728	T	0.16	-37.0409	11.2914	0.49252	0.0:0.0:0.5032:0.4968	.	195;467;534	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	C	467;534	ENSP00000440047:R467C;ENSP00000252463:R534C	ENSP00000252463:R534C	R	-	1	0	ZSCAN10	3079671	0.000000	0.05858	0.178000	0.23040	0.309000	0.27889	-0.084000	0.11268	0.555000	0.29079	0.561000	0.74099	CGC		0.701	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805		Missense_Mutation
SLC6A2	6530	broad.mit.edu	37	16	55690634	55690634	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr16:55690634G>T	ENST00000379906.2	+	1	283	c.28G>T	c.(28-30)Gtg>Ttg	p.V10L	SLC6A2_ENST00000561820.1_Missense_Mutation_p.V10L|SLC6A2_ENST00000219833.8_Missense_Mutation_p.V10L|SLC6A2_ENST00000568943.1_Missense_Mutation_p.V10L|SLC6A2_ENST00000414754.3_Missense_Mutation_p.V10L|SLC6A2_ENST00000566163.1_Missense_Mutation_p.V10L	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	10					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)	p.V10L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GAACCCGCAGGTGCAGCCCGA	0.647																																																1	Substitution - Missense(1)	ovary(1)	16											28.0	32.0	31.0					16																	55690634		2196	4293	6489	54248135	SO:0001583	missense	6530				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.28G>T	16.37:g.55690634G>T	ENSP00000369237:p.Val10Leu	Unknown		x	x	x	54248135	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900136	0.52227	.	.	ENSG00000103546	ENST00000414754;ENST00000379906;ENST00000219833	T;T;T	0.74526	-0.85;-0.78;-0.79	5.27	5.27	0.74061	.	1.492680	0.03288	N	0.187108	T	0.66426	0.2788	N	0.19112	0.55	0.44918	D	0.997938	B;B	0.27013	0.166;0.049	B;B	0.26770	0.073;0.053	T	0.17018	-1.0383	10	0.27785	T	0.31	.	13.6449	0.62275	0.0774:0.0:0.9226:0.0	.	10;10	Q96KH8;P23975	.;SC6A2_HUMAN	L	10	ENSP00000394956:V10L;ENSP00000369237:V10L;ENSP00000219833:V10L	ENSP00000219833:V10L	V	+	1	0	SLC6A2	54248135	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.619000	0.46401	2.620000	0.88729	0.563000	0.77884	GTG		0.647	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2			Missense_Mutation
HYDIN	54768	broad.mit.edu	37	16	71004449	71004449	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr16:71004449C>G	ENST00000393567.2	-	36	5743	c.5593G>C	c.(5593-5595)Gat>Cat	p.D1865H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1865					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.D1816H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TACTGCTGATCAAATTCTAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	16											37.0	37.0	37.0					16																	71004449		1803	4051	5854	69561950	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.5593G>C	16.37:g.71004449C>G	ENSP00000377197:p.Asp1865His	Unknown		x	x	x	69561950	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	23.8	4.456800	0.84317	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.43688	0.94	4.65	4.65	0.58169	.	0.000000	0.34411	U	0.003995	T	0.68247	0.2980	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74867	-0.3518	10	0.87932	D	0	.	17.4637	0.87626	0.0:1.0:0.0:0.0	.	1864	F8WD23	.	H	1865;1864	ENSP00000377197:D1865H	ENSP00000310485:D156H	D	-	1	0	HYDIN	69561950	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.484000	0.81180	2.311000	0.77944	0.505000	0.49811	GAT		0.443	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			Missense_Mutation
LIG3	3980	broad.mit.edu	37	17	33326340	33326340	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr17:33326340A>G	ENST00000378526.4	+	15	2261	c.2128A>G	c.(2128-2130)Atc>Gtc	p.I710V	LIG3_ENST00000262327.5_Missense_Mutation_p.I710V	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	710					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)	p.I623V(1)		endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	CATGATGTCAATCTTCCTCAT	0.612								Other BER factors																																								1	Substitution - Missense(1)	ovary(1)	17											71.0	52.0	58.0					17																	33326340		2203	4300	6503	30350453	SO:0001583	missense	3980				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.2128A>G	17.37:g.33326340A>G	ENSP00000367787:p.Ile710Val	Somatic		x	x	x	30350453	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	CCDS11284.2	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	8.896	0.955088	0.18507	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.62639	0.01;0.01	5.65	5.65	0.86999	DNA ligase, ATP-dependent, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);DNA ligase, ATP-dependent, central (1);Nucleic acid-binding, OB-fold (1);	0.043847	0.85682	D	0.000000	T	0.40909	0.1136	N	0.02736	-0.51	0.53688	D	0.999977	B;B	0.23806	0.091;0.033	B;B	0.27887	0.084;0.07	T	0.38023	-0.9680	10	0.36615	T	0.2	-20.4204	15.2098	0.73214	1.0:0.0:0.0:0.0	.	710;710	P49916;E5KLB6	DNLI3_HUMAN;.	V	710	ENSP00000367787:I710V;ENSP00000262327:I710V	ENSP00000262327:I710V	I	+	1	0	LIG3	30350453	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.914000	0.92735	2.371000	0.80710	0.533000	0.62120	ATC		0.612	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975		Missense_Mutation
NAGLU	4669	broad.mit.edu	37	17	40695488	40695488	+	Silent	SNP	G	G	A	rs140956564	byFrequency	TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr17:40695488G>A	ENST00000225927.2	+	6	1565	c.1464G>A	c.(1462-1464)ccG>ccA	p.P488P	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	488					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)	p.P488P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	TCTCCCACCCGGACGCAGGGG	0.672													G|||	4	0.000798722	0.003	0.0	5008	,	,		17252	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						G		1,4399		0,1,2199	16.0	15.0	15.0		1464	-7.6	0.0	17	dbSNP_134	15	0,8596		0,0,4298	no	coding-synonymous	NAGLU	NM_000263.3		0,1,6497	AA,AG,GG		0.0,0.0227,0.0077		488/744	40695488	1,12995	2200	4298	6498	37949014	SO:0001819	synonymous_variant	4669				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1464G>A	17.37:g.40695488G>A		Unknown		x	x	x	37949014		Silent	SNP	ENST00000225927.2	37	CCDS11427.1	SNP	39	Broad																																																																																				0.672	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263		Silent
DNAI2	64446	broad.mit.edu	37	17	72301457	72301457	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr17:72301457C>T	ENST00000311014.6	+	9	1154	c.1087C>T	c.(1087-1089)Cat>Tat	p.H363Y	DNAI2_ENST00000579490.1_Missense_Mutation_p.H420Y|DNAI2_ENST00000307504.5_Missense_Mutation_p.H220Y|DNAI2_ENST00000582036.1_Missense_Mutation_p.H363Y|DNAI2_ENST00000446837.2_Missense_Mutation_p.H363Y|AC103809.1_ENST00000516976.1_RNA|RP11-647F2.2_ENST00000585167.1_RNA			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	363					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.H363Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CTTCCCGGGCCATCATGGCCC	0.592									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	17											91.0	79.0	83.0					17																	72301457		2203	4300	6503	69813052	SO:0001583	missense	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1087C>T	17.37:g.72301457C>T	ENSP00000308312:p.His363Tyr	Unknown		x	x	x	69813052	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	CCDS11697.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	27.9	4.868635	0.91587	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.15487	2.42;2.42;2.42	4.96	4.96	0.65561	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.52075	0.1712	M	0.93150	3.385	0.80722	D	1	P	0.50617	0.937	P	0.61940	0.896	T	0.65915	-0.6052	10	0.62326	D	0.03	-43.5835	18.2776	0.90088	0.0:1.0:0.0:0.0	.	363	Q9GZS0	DNAI2_HUMAN	Y	363;220;363	ENSP00000308312:H363Y;ENSP00000302929:H220Y;ENSP00000400252:H363Y	ENSP00000302929:H220Y	H	+	1	0	DNAI2	69813052	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.465000	0.80898	2.315000	0.78130	0.556000	0.70494	CAT		0.592	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036		Missense_Mutation
SMCHD1	23347	broad.mit.edu	37	18	2697985	2697985	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr18:2697985C>T	ENST00000320876.6	+	10	1626	c.1288C>T	c.(1288-1290)Cat>Tat	p.H430Y	SMCHD1_ENST00000261598.8_Missense_Mutation_p.H430Y|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	430					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)	p.H430Y(2)		NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TATCCGTTATCATCCATTCTT	0.348																																																2	Substitution - Missense(2)	ovary(2)	18											163.0	146.0	151.0					18																	2697985		1891	4123	6014	2687985	SO:0001583	missense	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.1288C>T	18.37:g.2697985C>T	ENSP00000326603:p.His430Tyr	Unknown		x	x	x	2687985	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	15.74	2.921384	0.52653	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.26660	1.72;1.74	5.14	5.14	0.70334	.	.	.	.	.	T	0.37679	0.1012	N	0.19112	0.55	0.44508	D	0.997457	D	0.69078	0.997	D	0.75484	0.986	T	0.19257	-1.0311	9	0.39692	T	0.17	.	18.973	0.92722	0.0:1.0:0.0:0.0	.	430	A6NHR9	SMHD1_HUMAN	Y	430	ENSP00000326603:H430Y;ENSP00000261598:H430Y	ENSP00000261598:H430Y	H	+	1	0	SMCHD1	2687985	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.127000	0.77210	2.528000	0.85240	0.561000	0.74099	CAT		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2			Missense_Mutation
FHOD3	80206	broad.mit.edu	37	18	34340641	34340641	+	Missense_Mutation	SNP	C	C	T	rs141169952		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr18:34340641C>T	ENST00000359247.4	+	22	3920	c.3920C>T	c.(3919-3921)gCg>gTg	p.A1307V	FHOD3_ENST00000591635.1_Missense_Mutation_p.A520V|FHOD3_ENST00000592128.1_Missense_Mutation_p.A303V|FHOD3_ENST00000445677.1_Missense_Mutation_p.A1286V|FHOD3_ENST00000590592.1_Missense_Mutation_p.A1507V|FHOD3_ENST00000257209.4_Missense_Mutation_p.A1324V	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1307					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.A1324V(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCGGAGGACGCGGCTGAGCAC	0.652																																																1	Substitution - Missense(1)	ovary(1)	18						C	VAL/ALA	1,4405		0,1,2202	46.0	47.0	47.0		3971	5.0	1.0	18	dbSNP_134	47	0,8596		0,0,4298	yes	missense	FHOD3	NM_025135.2	64	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	1324/1440	34340641	1,13001	2203	4298	6501	32594639	SO:0001583	missense	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3920C>T	18.37:g.34340641C>T	ENSP00000352186:p.Ala1307Val	Unknown		x	x	x	32594639	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649802	0.67358	2.27E-4	0.0	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.33865	1.41;1.39;1.4	5.04	5.04	0.67666	Actin-binding FH2/DRF autoregulatory (1);	0.047947	0.85682	D	0.000000	T	0.50718	0.1632	L	0.43554	1.36	0.51482	D	0.999921	D;D;P	0.89917	1.0;1.0;0.744	D;D;B	0.69307	0.963;0.918;0.167	T	0.47812	-0.9088	10	0.48119	T	0.1	.	15.1009	0.72276	0.0:1.0:0.0:0.0	.	1286;1307;1324	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	V	1324;1307;1286	ENSP00000257209:A1324V;ENSP00000352186:A1307V;ENSP00000411430:A1286V	ENSP00000257209:A1324V	A	+	2	0	FHOD3	32594639	1.000000	0.71417	0.983000	0.44433	0.648000	0.38561	4.356000	0.59430	2.345000	0.79718	0.462000	0.41574	GCG		0.652	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		Missense_Mutation
PDCD5	9141	broad.mit.edu	37	19	33076810	33076810	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr19:33076810G>C	ENST00000590247.2	+	4	449	c.255G>C	c.(253-255)gaG>gaC	p.E85D	PDCD5_ENST00000586035.1_Missense_Mutation_p.E47D|PDCD5_ENST00000419343.3_Missense_Mutation_p.E85D|PDCD5_ENST00000592786.1_Intron|PDCD5_ENST00000379316.3_Intron	NM_004708.3	NP_004699.1	O14737	PDCD5_HUMAN	programmed cell death 5	85					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E85D(1)		breast(1)|large_intestine(2)|lung(1)|ovary(1)	5	Esophageal squamous(110;0.137)					AACTAAGTGAGAAGGTAAGCT	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											104.0	108.0	106.0					19																	33076810		2203	4300	6503	37768650	SO:0001583	missense	9141			AF014955	CCDS12423.1	19q13.11	2012-10-15			ENSG00000105185	ENSG00000105185			8764	protein-coding gene	gene with protein product	"""TFAR19 novel apoptosis-related"", ""TF1 cell apoptosis-related gene 19"""	604583				9920759	Standard	NM_004708		Approved	TFAR19, MGC9294	uc002ntm.3	O14737	OTTHUMG00000180224	ENST00000590247.2:c.255G>C	19.37:g.33076810G>C	ENSP00000466214:p.Glu85Asp	Unknown		x	x	x	37768650	B4DE64|Q53YC9|Q6IB70	Missense_Mutation	SNP	ENST00000590247.2	37	CCDS12423.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223894	0.39300	.	.	ENSG00000105185	ENST00000419343;ENST00000221784	.	.	.	5.6	4.56	0.56223	.	0.148836	0.64402	D	0.000011	T	0.30166	0.0756	L	0.43598	1.365	0.26512	N	0.974579	B;B	0.26708	0.003;0.157	B;B	0.25987	0.042;0.065	T	0.09707	-1.0662	9	0.19147	T	0.46	-14.8081	7.0422	0.25027	0.1417:0.1502:0.7081:0.0	.	85;85	O14737;B4DE64	PDCD5_HUMAN;.	D	85	.	ENSP00000221784:E85D	E	+	3	2	PDCD5	37768650	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	0.762000	0.26503	2.618000	0.88619	0.563000	0.77884	GAG		0.363	PDCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450320.2	NM_004708		Missense_Mutation
ZNF586	54807	broad.mit.edu	37	19	58291154	58291154	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr19:58291154C>T	ENST00000396154.2	+	3	1372	c.1199C>T	c.(1198-1200)cCt>cTt	p.P400L	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000396150.4_3'UTR|ZNF586_ENST00000391702.3_Missense_Mutation_p.P357L	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P400L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGAATGAGGCCTTATAAGTGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	19											65.0	63.0	64.0					19																	58291154		2107	4249	6356	62982966	SO:0001583	missense	54807			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.1199C>T	19.37:g.58291154C>T	ENSP00000379458:p.Pro400Leu	Somatic		x	x	x	62982966	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093696	0.36952	.	.	ENSG00000083828	ENST00000449441;ENST00000391702;ENST00000396154	T;T	0.12569	2.67;2.69	1.53	0.344	0.16006	Zinc finger, C2H2 (1);	.	.	.	.	T	0.25644	0.0624	L	0.41961	1.31	0.31783	N	0.630633	D	0.89917	1.0	D	0.97110	1.0	T	0.16660	-1.0395	9	0.59425	D	0.04	.	9.6334	0.39793	0.0:0.857:0.0:0.143	.	400	Q9NXT0	ZN586_HUMAN	L	400;357;400	ENSP00000375583:P357L;ENSP00000379458:P400L	ENSP00000375583:P357L	P	+	2	0	ZNF586	62982966	0.812000	0.29077	0.005000	0.12908	0.001000	0.01503	1.471000	0.35365	-0.524000	0.06400	-1.119000	0.02030	CCT		0.438	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652		Missense_Mutation
APOB	338	broad.mit.edu	37	2	21225496	21225496	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:21225496G>C	ENST00000233242.1	-	29	12925	c.12798C>G	c.(12796-12798)atC>atG	p.I4266M	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4266					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.I4266M(1)|p.I4266I(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATACATCGAGATTACATCTA	0.368																																																2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)	2											124.0	136.0	132.0					2																	21225496		2203	4300	6503	21079001	SO:0001583	missense	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12798C>G	2.37:g.21225496G>C	ENSP00000233242:p.Ile4266Met	Unknown		x	x	x	21079001	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869893	0.33069	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00824	5.65	5.23	-3.73	0.04398	.	1.221940	0.05854	N	0.621757	T	0.01029	0.0034	L	0.43923	1.385	0.09310	N	0.999997	P	0.45902	0.868	B	0.39805	0.31	T	0.46707	-0.9172	10	0.62326	D	0.03	.	5.6292	0.17501	0.4638:0.0:0.3239:0.2123	.	4266	P04114	APOB_HUMAN	M	4266	ENSP00000233242:I4266M	ENSP00000233242:I4266M	I	-	3	3	APOB	21079001	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.149000	0.10204	-0.316000	0.08690	-0.133000	0.14855	ATC		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			Missense_Mutation
DRC1	92749	broad.mit.edu	37	2	26647253	26647253	+	Silent	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:26647253C>T	ENST00000288710.2	+	4	545	c.471C>T	c.(469-471)ctC>ctT	p.L157L		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	157					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.L157L(1)									GGGAAATGCTCAATACCCAAC	0.502																																																1	Substitution - coding silent(1)	ovary(1)	2											100.0	96.0	97.0					2																	26647253		2203	4300	6503	26500757	SO:0001819	synonymous_variant	92749			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.471C>T	2.37:g.26647253C>T		Unknown		x	x	x	26500757	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	37	CCDS1723.1	SNP	29	Broad																																																																																				0.502	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038		Silent
AGBL5	60509	broad.mit.edu	37	2	27282174	27282174	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:27282174C>T	ENST00000360131.4	+	11	2150	c.1991C>T	c.(1990-1992)tCc>tTc	p.S664F	AGBL5-IT1_ENST00000411862.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.S664F	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	664					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.S664F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGAAGAATTCCCCCAGCTTT	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											72.0	79.0	76.0					2																	27282174		2203	4300	6503	27135678	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1991C>T	2.37:g.27282174C>T	ENSP00000353249:p.Ser664Phe	Unknown		x	x	x	27135678	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	ENST00000360131.4	37	CCDS1732.3	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527883	0.85706	.	.	ENSG00000084693	ENST00000323064;ENST00000360131;ENST00000441931	T;T	0.28666	1.84;1.6	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.53249	1.67	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.53063	-0.8491	10	0.87932	D	0	-18.2101	19.571	0.95419	0.0:1.0:0.0:0.0	.	664;664	Q8NDL9;Q8NDL9-3	CBPC5_HUMAN;.	F	664;664;14	ENSP00000323681:S664F;ENSP00000353249:S664F	ENSP00000323681:S664F	S	+	2	0	AGBL5	27135678	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.350000	0.73017	2.713000	0.92767	0.655000	0.94253	TCC		0.582	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831		Missense_Mutation
PSD4	23550	broad.mit.edu	37	2	113950108	113950108	+	Missense_Mutation	SNP	C	C	T	rs117870995	byFrequency	TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:113950108C>T	ENST00000245796.6	+	6	1975	c.1780C>T	c.(1780-1782)Cgc>Tgc	p.R594C	PSD4_ENST00000441564.3_Missense_Mutation_p.R566C	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	594	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.R594C(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTTGGCCTCACGCCTCTATCG	0.597													c|||	10	0.00199681	0.0	0.0	5008	,	,		20368	0.0089		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	2											117.0	115.0	116.0					2																	113950108		2203	4300	6503	113666579	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1780C>T	2.37:g.113950108C>T	ENSP00000245796:p.Arg594Cys	Unknown		x	x	x	113666579	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	SNP	19	Broad	8	0.003663003663003663	0	0.0	0	0.0	8	0.013986013986013986	0	0.0	c	20.1	3.938747	0.73557	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.54071	0.59;0.59	5.55	4.64	0.57946	SEC7-like (4);	0.123933	0.53938	D	0.000056	T	0.62792	0.2457	M	0.73430	2.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.987;0.983;0.99	T	0.70299	-0.4910	10	0.87932	D	0	.	11.6083	0.51045	0.3082:0.6918:0.0:0.0	.	252;566;594	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	C	594;566	ENSP00000245796:R594C;ENSP00000413997:R566C	ENSP00000245796:R594C	R	+	1	0	PSD4	113666579	0.103000	0.21917	0.970000	0.41538	0.938000	0.57974	0.466000	0.22019	2.623000	0.88846	0.558000	0.71614	CGC		0.597	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179584151	179584151	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:179584151C>T	ENST00000591111.1	-	81	23239	c.23015G>A	c.(23014-23016)cGc>cAc	p.R7672H	TTN_ENST00000589042.1_Missense_Mutation_p.R7989H|TTN_ENST00000342992.6_Missense_Mutation_p.R6745H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13216	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R6745H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCAGCTTGCGGATGAAGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											79.0	81.0	80.0					2																	179584151		1909	4124	6033	179292396	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23015G>A	2.37:g.179584151C>T	ENSP00000465570:p.Arg7672His	Somatic		x	x	x	179292396	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023540	0.35701	.	.	ENSG00000155657	ENST00000342992	T	0.68331	-0.32	6.08	6.08	0.98989	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);	.	.	.	.	T	0.81959	0.4933	M	0.73217	2.22	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	T	0.82049	-0.0650	9	0.87932	D	0	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	7672	Q8WZ42	TITIN_HUMAN	H	6745	ENSP00000343764:R6745H	ENSP00000343764:R6745H	R	-	2	0	TTN	179292396	0.947000	0.32204	1.000000	0.80357	0.989000	0.77384	1.414000	0.34736	2.894000	0.99253	0.655000	0.94253	CGC		0.512	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
PRR21	643905	broad.mit.edu	37	2	240982349	240982349	+	Silent	SNP	G	G	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr2:240982349G>C	ENST00000408934.1	-	1	50	c.51C>G	c.(49-51)ggC>ggG	p.G17G		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	17								p.G17G(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						TGAATGAAAAGCCGTGGATGA	0.572																																																2	Substitution - coding silent(2)	ovary(2)	2											93.0	81.0	85.0					2																	240982349		2201	4297	6498	240631022	SO:0001819	synonymous_variant	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.51C>G	2.37:g.240982349G>C		Unknown		x	x	x	240631022		Silent	SNP	ENST00000408934.1	37	CCDS33417.1	SNP	34	Broad																																																																																				0.572	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835		Silent
ZNF334	55713	broad.mit.edu	37	20	45130463	45130463	+	Silent	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr20:45130463A>G	ENST00000347606.4	-	5	1697	c.1515T>C	c.(1513-1515)agT>agC	p.S505S	ZNF334_ENST00000457685.2_Silent_p.S467S|ZNF334_ENST00000593880.1_Silent_p.S528S	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	505					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S505S(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TCTTACACTGACTGCAGTTTG	0.393																																																1	Substitution - coding silent(1)	ovary(1)	20											166.0	154.0	158.0					20																	45130463		2203	4299	6502	44563870	SO:0001819	synonymous_variant	55713			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1515T>C	20.37:g.45130463A>G		Unknown		x	x	x	44563870	Q5T6U2|Q9NVW4	Silent	SNP	ENST00000347606.4	37	CCDS33480.1	SNP	10	Broad																																																																																				0.393	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1			Silent
MYO18B	84700	broad.mit.edu	37	22	26243605	26243605	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr22:26243605G>T	ENST00000407587.2	+	20	3933	c.3764G>T	c.(3763-3765)cGt>cTt	p.R1255L	MYO18B_ENST00000536101.1_Missense_Mutation_p.R1254L|MYO18B_ENST00000335473.7_Missense_Mutation_p.R1254L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1254	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1255L(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GAGGCTCTGCGTCTGCATAGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	22											21.0	25.0	24.0					22																	26243605		2131	4237	6368	24573605	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3764G>T	22.37:g.26243605G>T	ENSP00000386096:p.Arg1255Leu	Unknown		x	x	x	24573605	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078899	0.36662	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	T;T;T	0.77750	-1.12;-1.12;-1.12	4.42	4.42	0.53409	Myosin head, motor domain (2);	0.061993	0.64402	D	0.000005	D	0.86686	0.5992	M	0.92738	3.34	0.40944	D	0.98449	B;P;D;P	0.60160	0.077;0.72;0.987;0.673	B;B;P;B	0.51324	0.047;0.26;0.666;0.169	D	0.90882	0.4754	10	0.87932	D	0	.	14.5833	0.68308	0.0:0.0:1.0:0.0	.	767;1254;1255;1254	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	L	1254;1254;1255	ENSP00000441229:R1254L;ENSP00000334563:R1254L;ENSP00000386096:R1255L	ENSP00000334563:R1254L	R	+	2	0	MYO18B	24573605	1.000000	0.71417	0.970000	0.41538	0.471000	0.32888	5.357000	0.66058	2.303000	0.77524	0.561000	0.74099	CGT		0.607	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608		Missense_Mutation
OR5H2	79310	broad.mit.edu	37	3	98001888	98001888	+	Missense_Mutation	SNP	C	C	T	rs183927815		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr3:98001888C>T	ENST00000355273.2	+	1	157	c.157C>T	c.(157-159)Ctt>Ttt	p.L53F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L53F(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						TCTGATTGCTCTTATCTGGAA	0.428													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20901	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											354.0	327.0	336.0					3																	98001888		2203	4300	6503	99484578	SO:0001583	missense	79310				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.157C>T	3.37:g.98001888C>T	ENSP00000347418:p.Leu53Phe	Unknown		x	x	x	99484578	Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	SNP	32	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.223	1.033777	0.19590	.	.	ENSG00000197938	ENST00000355273	T	0.03035	4.07	3.2	2.32	0.28847	GPCR, rhodopsin-like superfamily (1);	0.228496	0.22387	U	0.060725	T	0.18551	0.0445	M	0.93898	3.47	0.18873	N	0.999987	D	0.58620	0.983	P	0.58820	0.846	T	0.05273	-1.0895	10	0.87932	D	0	.	9.454	0.38743	0.0:0.5734:0.4266:0.0	.	53	Q8NGV7	OR5H2_HUMAN	F	53	ENSP00000347418:L53F	ENSP00000347418:L53F	L	+	1	0	OR5H2	99484578	0.000000	0.05858	0.852000	0.33557	0.008000	0.06430	-1.253000	0.02877	0.682000	0.31407	-0.258000	0.10820	CTT		0.428	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2			Missense_Mutation
MYH15	22989	broad.mit.edu	37	3	108205362	108205362	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr3:108205362C>T	ENST00000273353.3	-	11	999	c.943G>A	c.(943-945)Gta>Ata	p.V315I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	315	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V315I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TTTGCAGATACCAGGAGCAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											82.0	82.0	82.0					3																	108205362		1876	4109	5985	109688052	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.943G>A	3.37:g.108205362C>T	ENSP00000273353:p.Val315Ile	Unknown		x	x	x	109688052		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	1.379	-0.583858	0.03827	.	.	ENSG00000144821	ENST00000273353	T	0.70986	-0.53	5.66	-0.84	0.10755	Myosin head, motor domain (2);	.	.	.	.	T	0.37293	0.0998	N	0.02708	-0.52	0.29221	N	0.873955	B	0.26445	0.149	B	0.33960	0.173	T	0.44329	-0.9335	9	0.02654	T	1	.	2.832	0.05503	0.1014:0.4627:0.1981:0.2378	.	315	Q9Y2K3	MYH15_HUMAN	I	315	ENSP00000273353:V315I	ENSP00000273353:V315I	V	-	1	0	MYH15	109688052	0.006000	0.16342	0.066000	0.19879	0.546000	0.35178	-0.102000	0.10956	0.044000	0.15775	0.467000	0.42956	GTA		0.438	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		Missense_Mutation
RNF13	11342	broad.mit.edu	37	3	149613278	149613278	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr3:149613278G>C	ENST00000344229.3	+	6	1042	c.340G>C	c.(340-342)Gca>Cca	p.A114P	RNF13_ENST00000361785.6_5'UTR|RNF13_ENST00000392894.3_Missense_Mutation_p.A114P	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	114	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A114P(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGCACAGAGAGCAGGATACAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	3											130.0	110.0	116.0					3																	149613278		2203	4300	6503	151095968	SO:0001583	missense	11342			AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.340G>C	3.37:g.149613278G>C	ENSP00000341361:p.Ala114Pro	Unknown		x	x	x	151095968	A6NC87|B3KR12|Q05D66|Q6IBJ9	Missense_Mutation	SNP	ENST00000344229.3	37	CCDS3146.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	29.6	5.024068	0.93462	.	.	ENSG00000082996	ENST00000392894;ENST00000344229;ENST00000543506;ENST00000468648;ENST00000459632;ENST00000466795;ENST00000490631	T;T;T;T;T;T	0.38560	2.8;2.8;1.13;2.8;2.8;2.8	5.57	5.57	0.84162	Protease-associated domain, PA (1);	0.203639	0.51477	D	0.000095	T	0.78336	0.4267	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.85349	0.1100	10	0.56958	D	0.05	-3.3091	19.6039	0.95574	0.0:0.0:1.0:0.0	.	114	O43567	RNF13_HUMAN	P	114	ENSP00000376628:A114P;ENSP00000341361:A114P;ENSP00000420067:A114P;ENSP00000419069:A114P;ENSP00000417655:A114P;ENSP00000417294:A114P	ENSP00000341361:A114P	A	+	1	0	RNF13	151095968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.400000	0.97290	2.627000	0.88993	0.644000	0.83932	GCA		0.343	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	NM_183384		Missense_Mutation
SI	6476	broad.mit.edu	37	3	164739171	164739171	+	Splice_Site	SNP	T	T	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr3:164739171T>A	ENST00000264382.3	-	27	3162	c.3100A>T	c.(3100-3102)Att>Ttt	p.I1034F		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1034	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.I1034F(1)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GGATCATAAATCTATTGCAGA	0.318										HNSCC(35;0.089)																																						1	Substitution - Missense(1)	ovary(1)	3											175.0	178.0	177.0					3																	164739171		2203	4300	6503	166221865	SO:0001630	splice_region_variant	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3100-1A>T	3.37:g.164739171T>A		Unknown		x	x	x	166221865	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934244	0.52866	.	.	ENSG00000090402	ENST00000264382	T	0.34472	1.36	4.58	4.58	0.56647	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.70791	-0.4776	10	0.59425	D	0.04	.	14.1202	0.65182	0.0:0.0:0.0:1.0	.	1034	P14410	SUIS_HUMAN	F	1034	ENSP00000264382:I1034F	ENSP00000264382:I1034F	I	-	1	0	SI	166221865	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	6.927000	0.75840	1.927000	0.55829	0.477000	0.44152	ATT		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	Missense_Mutation	Missense_Mutation
EVC2	132884	broad.mit.edu	37	4	5624324	5624324	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr4:5624324G>A	ENST00000344408.5	-	14	2494	c.2441C>T	c.(2440-2442)gCt>gTt	p.A814V	EVC2_ENST00000344938.1_Missense_Mutation_p.A814V|EVC2_ENST00000310917.2_Missense_Mutation_p.A734V	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	814					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A814V(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GGCCTCAGGAGCGTCATCCTT	0.642																																																1	Substitution - Missense(1)	ovary(1)	4											85.0	53.0	64.0					4																	5624324		2203	4300	6503	5675225	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2441C>T	4.37:g.5624324G>A	ENSP00000342144:p.Ala814Val	Unknown		x	x	x	5675225	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250795	0.22880	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.76186	-1.0;-1.0;-1.0	4.05	3.2	0.36748	.	0.000000	0.85682	D	0.000000	T	0.63260	0.2496	L	0.56769	1.78	0.09310	N	1	B	0.34103	0.437	B	0.34590	0.186	T	0.53215	-0.8470	10	0.02654	T	1	-3.7379	9.261	0.37612	0.0:0.0:0.7852:0.2148	.	814	Q86UK5	LBN_HUMAN	V	814;734;814	ENSP00000339954:A814V;ENSP00000311683:A734V;ENSP00000342144:A814V	ENSP00000311683:A734V	A	-	2	0	EVC2	5675225	0.001000	0.12720	0.002000	0.10522	0.006000	0.05464	0.615000	0.24329	1.268000	0.44264	0.462000	0.41574	GCT		0.642	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		Missense_Mutation
CDS1	1040	broad.mit.edu	37	4	85555073	85555073	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1496-01	TCGA-13-1496-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr4:85555073C>G	ENST00000295887.5	+	7	1126	c.703C>G	c.(703-705)Ctg>Gtg	p.L235V		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.L235V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		CATCCAAAATCTGTTTGAAGG	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											171.0	141.0	151.0					4																	85555073		2203	4300	6503	85774097	SO:0001583	missense	1040			U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.703C>G	4.37:g.85555073C>G	ENSP00000295887:p.Leu235Val	Somatic		x	x	x	85774097	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000295887.5	37	CCDS3608.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707291	0.89018	.	.	ENSG00000163624	ENST00000295887	T	0.43294	0.95	5.96	5.96	0.96718	.	0.073024	0.64402	D	0.000019	T	0.43166	0.1235	L	0.33668	1.02	0.80722	D	1	P	0.46395	0.877	P	0.46885	0.53	T	0.05649	-1.0872	10	0.27082	T	0.32	-9.2274	20.394	0.98981	0.0:1.0:0.0:0.0	.	235	Q92903	CDS1_HUMAN	V	235	ENSP00000295887:L235V	ENSP00000295887:L235V	L	+	1	2	CDS1	85774097	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.830000	0.97506	0.585000	0.79938	CTG		0.363	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2			Missense_Mutation
FABP2	2169	broad.mit.edu	37	4	120240727	120240727	+	Missense_Mutation	SNP	A	A	T	rs148746748		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr4:120240727A>T	ENST00000274024.3	-	3	599	c.312T>A	c.(310-312)aaT>aaA	p.N104K		NM_000134.3	NP_000125.2	P12104	FABPI_HUMAN	fatty acid binding protein 2, intestinal	104					digestion (GO:0007586)	cytoplasm (GO:0005737)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)	p.N104K(1)		breast(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	8					Estradiol(DB00783)|Ibuprofen(DB01050)|Sulfinpyrazone(DB01138)	CTCGGACAGTATTCAGTTCGT	0.308																																																1	Substitution - Missense(1)	ovary(1)	4											129.0	121.0	124.0					4																	120240727		2203	4300	6503	120460175	SO:0001583	missense	2169			J03465	CCDS3712.1	4q28-q31	2013-03-01			ENSG00000145384	ENSG00000145384		"""Fatty acid binding protein family"""	3556	protein-coding gene	gene with protein product		134640					Standard	NM_000134		Approved	I-FABP	uc003icw.3	P12104	OTTHUMG00000132972	ENST00000274024.3:c.312T>A	4.37:g.120240727A>T	ENSP00000274024:p.Asn104Lys	Unknown		x	x	x	120460175	Q2NKJ1	Missense_Mutation	SNP	ENST00000274024.3	37	CCDS3712.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	10.02	1.235250	0.22626	.	.	ENSG00000145384	ENST00000274024	T	0.08102	3.13	5.49	-0.298	0.12814	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.437376	0.28062	N	0.016744	T	0.02304	0.0071	N	0.03050	-0.425	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.38499	-0.9658	10	0.32370	T	0.25	.	0.0968	0.00045	0.2675:0.2511:0.2055:0.2758	.	104	P12104	FABPI_HUMAN	K	104	ENSP00000274024:N104K	ENSP00000274024:N104K	N	-	3	2	FABP2	120460175	0.005000	0.15991	0.029000	0.17559	0.865000	0.49528	-0.151000	0.10175	0.317000	0.23160	0.528000	0.53228	AAT		0.308	FABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256531.1	NM_000134		Missense_Mutation
NIPBL	25836	broad.mit.edu	37	5	36985864	36985864	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr5:36985864C>A	ENST00000282516.8	+	10	3081	c.2582C>A	c.(2581-2583)tCa>tAa	p.S861*	NIPBL_ENST00000448238.2_Nonsense_Mutation_p.S861*|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	861					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.S861*(1)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTGATAGTTCAAAAACTGAT	0.433																																																1	Substitution - Nonsense(1)	ovary(1)	5											47.0	46.0	46.0					5																	36985864		2203	4300	6503	37021621	SO:0001587	stop_gained	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.2582C>A	5.37:g.36985864C>A	ENSP00000282516:p.Ser861*	Unknown		x	x	x	37021621	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Nonsense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	43	9.928989	0.99298	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.99	5.99	0.97316	.	0.209202	0.34435	N	0.003967	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-9.1772	20.4777	0.99188	0.0:1.0:0.0:0.0	.	.	.	.	X	861	.	ENSP00000282516:S861X	S	+	2	0	NIPBL	37021621	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.619000	0.46401	2.840000	0.97914	0.655000	0.94253	TCA		0.433	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384		Nonsense_Mutation
CYP39A1	51302	broad.mit.edu	37	6	46563850	46563850	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr6:46563850A>T	ENST00000275016.2	-	8	1142	c.939T>A	c.(937-939)gaT>gaA	p.D313E		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	313					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)	p.D313E(1)	EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						CTTTAATCTTATCTTTGCCTG	0.358																																																1	Substitution - Missense(1)	ovary(1)	6											51.0	56.0	55.0					6																	46563850		2202	4299	6501	46671809	SO:0001583	missense	51302			AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.939T>A	6.37:g.46563850A>T	ENSP00000275016:p.Asp313Glu	Unknown		x	x	x	46671809	Q5VTT0|Q96FW5	Missense_Mutation	SNP	ENST00000275016.2	37	CCDS4916.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	7.733	0.699731	0.15106	.	.	ENSG00000146233	ENST00000275016	T	0.76186	-1.0	5.64	-4.43	0.03568	.	0.574303	0.18355	N	0.143758	T	0.32615	0.0835	L	0.49350	1.555	0.25221	N	0.989906	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.004	T	0.20874	-1.0262	10	0.18276	T	0.48	-5.9476	0.9974	0.01470	0.2353:0.3568:0.1751:0.2328	.	293;313	B7Z786;Q9NYL5	.;CP39A_HUMAN	E	313	ENSP00000275016:D313E	ENSP00000275016:D313E	D	-	3	2	CYP39A1	46671809	0.749000	0.28305	0.968000	0.41197	0.049000	0.14656	-0.210000	0.09345	-0.580000	0.05944	0.455000	0.32223	GAT		0.358	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040787.1			Missense_Mutation
PKHD1	5314	broad.mit.edu	37	6	51524031	51524031	+	Silent	SNP	A	A	G			TCGA-13-1496-01	TCGA-13-1496-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr6:51524031A>G	ENST00000371117.3	-	61	11168	c.10893T>C	c.(10891-10893)taT>taC	p.Y3631Y		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3631					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.Y3631Y(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CAACTCTTCTATAATGACTAG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	6											122.0	121.0	121.0					6																	51524031		2203	4300	6503	51631990	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10893T>C	6.37:g.51524031A>G		Somatic		x	x	x	51631990	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1	SNP	16	Broad																																																																																				0.448	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694		Silent
FAM184A	79632	broad.mit.edu	37	6	119301436	119301436	+	Missense_Mutation	SNP	G	G	A	rs372303662		TCGA-13-1496-01	TCGA-13-1496-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr6:119301436G>A	ENST00000338891.7	-	10	2611	c.2168C>T	c.(2167-2169)aCg>aTg	p.T723M	FAM184A_ENST00000521531.1_Missense_Mutation_p.T723M|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Missense_Mutation_p.T603M|FAM184A_ENST00000368475.4_Missense_Mutation_p.T603M	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	723						extracellular space (GO:0005615)		p.T723R(1)|p.T723M(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TCGTTCTTGCGTAAACTGGGC	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15752	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|breast(1)	6						G	MET/THR,MET/THR	0,3804		0,0,1902	102.0	97.0	99.0		1808,2168	6.2	1.0	6		99	1,8243		0,1,4121	no	missense,missense	FAM184A	NM_001100411.1,NM_024581.4	81,81	0,1,6023	AA,AG,GG		0.0121,0.0,0.0083	possibly-damaging,possibly-damaging	603/972,723/1141	119301436	1,12047	1902	4122	6024	119343135	SO:0001583	missense	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2168C>T	6.37:g.119301436G>A	ENSP00000342604:p.Thr723Met	Somatic		x	x	x	119343135	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570526	0.86542	0.0	1.21E-4	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	6.17	6.17	0.99709	.	0.094566	0.64402	D	0.000001	T	0.37404	0.1002	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	P;P;D	0.63793	0.88;0.855;0.918	T	0.11767	-1.0574	10	0.56958	D	0.05	-15.6808	15.125	0.72475	0.0:0.2445:0.7555:0.0	.	723;603;723	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	M	723;603;603;723	ENSP00000342604:T723M;ENSP00000326608:T603M;ENSP00000357460:T603M;ENSP00000430442:T723M	ENSP00000342604:T723M	T	-	2	0	FAM184A	119343135	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	3.441000	0.52893	2.941000	0.99782	0.655000	0.94253	ACG		0.438	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581		Missense_Mutation
THBS2	7058	broad.mit.edu	37	6	169648555	169648555	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr6:169648555C>G	ENST00000366787.3	-	4	815	c.566G>C	c.(565-567)cGg>cCg	p.R189P		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	189	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R189P(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CACGTACATCCGGCTCTTTTC	0.612																																					Esophageal Squamous(91;219 1934 18562 44706)											1	Substitution - Missense(1)	ovary(1)	6											101.0	104.0	103.0					6																	169648555		2203	4300	6503	169390480	SO:0001583	missense	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.566G>C	6.37:g.169648555C>G	ENSP00000355751:p.Arg189Pro	Unknown		x	x	x	169390480	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036208	0.54896	.	.	ENSG00000186340	ENST00000366787	T	0.02197	4.4	4.5	3.6	0.41247	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.159155	0.28268	U	0.015970	T	0.02848	0.0085	M	0.68593	2.085	0.29727	N	0.838202	P	0.51057	0.941	P	0.52481	0.7	T	0.14952	-1.0454	10	0.62326	D	0.03	-39.3345	9.9005	0.41344	0.0:0.8357:0.0:0.1643	.	189	P35442	TSP2_HUMAN	P	189	ENSP00000355751:R189P	ENSP00000355751:R189P	R	-	2	0	THBS2	169390480	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	2.330000	0.43885	2.204000	0.70986	0.563000	0.77884	CGG		0.612	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		Missense_Mutation
PPP1R17	10842	broad.mit.edu	37	7	31736586	31736586	+	Silent	SNP	T	T	C			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr7:31736586T>C	ENST00000342032.3	+	4	871	c.243T>C	c.(241-243)ttT>ttC	p.F81F	PPP1R17_ENST00000498609.1_3'UTR|PPP1R17_ENST00000409146.3_Silent_p.F30F	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	81					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.F81F(1)									CAGGTGTGTTTTCAGAACATT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	7											88.0	86.0	87.0					7																	31736586		2203	4300	6503	31703111	SO:0001819	synonymous_variant	10842			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.243T>C	7.37:g.31736586T>C		Unknown		x	x	x	31703111	B4DE58|Q9UDQ0	Silent	SNP	ENST00000342032.3	37	CCDS5436.1	SNP	64	Broad																																																																																				0.373	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658		Silent
MAGI2	9863	broad.mit.edu	37	7	77789397	77789397	+	Silent	SNP	G	G	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr7:77789397G>T	ENST00000354212.4	-	16	3043	c.2790C>A	c.(2788-2790)ggC>ggA	p.G930G	MAGI2_ENST00000522391.1_Silent_p.G930G|MAGI2_ENST00000419488.1_Silent_p.G916G	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	930	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.G930G(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CAAAGCCGAAGCCCTCATTCT	0.522																																																1	Substitution - coding silent(1)	ovary(1)	7											103.0	95.0	98.0					7																	77789397		2203	4300	6503	77627333	SO:0001819	synonymous_variant	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2790C>A	7.37:g.77789397G>T		Unknown		x	x	x	77627333	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	37	CCDS5594.1	SNP	34	Broad																																																																																				0.522	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301		Silent
CALCR	799	broad.mit.edu	37	7	93108738	93108738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr7:93108738G>A	ENST00000394441.1	-	3	448	c.133C>T	c.(133-135)Cga>Tga	p.R45*	CALCR_ENST00000421592.1_Nonsense_Mutation_p.R45*|CALCR_ENST00000426151.1_Nonsense_Mutation_p.R45*|CALCR_ENST00000359558.2_Nonsense_Mutation_p.R63*|CALCR_ENST00000360249.4_Nonsense_Mutation_p.R45*	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	63					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.R45*(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	ATCTTCTTTCGTCCTACGACG	0.398																																																1	Substitution - Nonsense(1)	ovary(1)	7											242.0	224.0	230.0					7																	93108738		2203	4300	6503	92946674	SO:0001587	stop_gained	799			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.133C>T	7.37:g.93108738G>A	ENSP00000377959:p.Arg45*	Unknown		x	x	x	92946674	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Nonsense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.639469	0.96693	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	.	.	.	5.21	2.28	0.28536	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2636	0.54665	0.0:0.0:0.5273:0.4726	.	.	.	.	X	63;45;45;45;45;45	.	ENSP00000352561:R63X	R	-	1	2	CALCR	92946674	0.013000	0.17824	0.003000	0.11579	0.036000	0.12997	1.233000	0.32648	0.384000	0.24942	0.650000	0.86243	CGA		0.398	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742		Nonsense_Mutation
KCNS2	3788	broad.mit.edu	37	8	99441338	99441338	+	Silent	SNP	C	C	T	rs371574913		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr8:99441338C>T	ENST00000287042.4	+	2	1481	c.1131C>T	c.(1129-1131)taC>taT	p.Y377Y	KCNS2_ENST00000521839.1_Silent_p.Y377Y	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	377					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.Y377Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			CAGTGGGGTACGGGGATGTGG	0.612																																					Pancreas(138;844 2489 9202 24627)											1	Substitution - coding silent(1)	ovary(1)	8						C		0,4406		0,0,2203	89.0	84.0	86.0		1131	-5.5	0.8	8		86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNS2	NM_020697.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		377/478	99441338	1,13005	2203	4300	6503	99510514	SO:0001819	synonymous_variant	3788			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.1131C>T	8.37:g.99441338C>T		Unknown		x	x	x	99510514	A8KAN1	Silent	SNP	ENST00000287042.4	37	CCDS6279.1	SNP	19	Broad																																																																																				0.612	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103134.1	NM_020697		Silent
COL22A1	169044	broad.mit.edu	37	8	139815148	139815148	+	Silent	SNP	G	G	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr8:139815148G>A	ENST00000303045.6	-	11	1970	c.1524C>T	c.(1522-1524)ggC>ggT	p.G508G	COL22A1_ENST00000435777.1_Silent_p.G508G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	508	Collagen-like 1.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G508G(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTCCAGGAGCGCCAACCGGCC	0.602										HNSCC(7;0.00092)																																						1	Substitution - coding silent(1)	ovary(1)	8											143.0	120.0	128.0					8																	139815148		2203	4300	6503	139884330	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1524C>T	8.37:g.139815148G>A		Unknown		x	x	x	139884330	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	38	Broad																																																																																				0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Silent
PTGDS	5730	broad.mit.edu	37	9	139874450	139874450	+	Nonsense_Mutation	SNP	C	C	A	rs373555075		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr9:139874450C>A	ENST00000371625.3	+	4	458	c.384C>A	c.(382-384)taC>taA	p.Y128*	PTGDS_ENST00000224167.2_Nonsense_Mutation_p.Y162*|LCNL1_ENST00000408973.2_5'Flank	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)	128					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)	p.Y128*(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACGACCAGTACGCGCTGCTGT	0.657																																																1	Substitution - Nonsense(1)	ovary(1)	9											87.0	90.0	89.0					9																	139874450		2203	4300	6503	138994271	SO:0001587	stop_gained	5730			AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.384C>A	9.37:g.139874450C>A	ENSP00000360687:p.Tyr128*	Unknown		x	x	x	138994271	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Nonsense_Mutation	SNP	ENST00000371625.3	37	CCDS7019.1	SNP	19	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	18.37|18.37	3.610063|3.610063	0.66558|0.66558	.|.	.|.	ENSG00000107317|ENSG00000107317	ENST00000446677|ENST00000224167;ENST00000457950;ENST00000371625	.|.	.|.	.|.	4.83|4.83	-0.394|-0.394	0.12434|0.12434	.|.	.|0.209828	.|0.33327	.|N	.|0.005026	T|.	0.16041|.	0.0386|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42396|.	-0.9454|.	3|.	.|0.02654	.|T	.|1	-39.6894|-39.6894	7.854|7.854	0.29472|0.29472	0.0:0.5333:0.0:0.4667|0.0:0.5333:0.0:0.4667	.|.	.|.	.|.	.|.	S|X	151|162;162;128	.|.	.|ENSP00000224167:Y162X	R|Y	+|+	1|3	0|2	PTGDS|PTGDS	138994271|138994271	0.000000|0.000000	0.05858|0.05858	0.053000|0.053000	0.19242|0.19242	0.014000|0.014000	0.08584|0.08584	-2.334000|-2.334000	0.01107|0.01107	-0.290000|-0.290000	0.09025|0.09025	-0.141000|-0.141000	0.14075|0.14075	CGC|TAC		0.657	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055188.1	NM_000954		Nonsense_Mutation
MXRA5	25878	broad.mit.edu	37	X	3242751	3242751	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chrX:3242751C>A	ENST00000217939.6	-	5	1129	c.975G>T	c.(973-975)gaG>gaT	p.E325D		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	325						extracellular vesicular exosome (GO:0070062)		p.E325D(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGTTCCCGTGCTCGTCGGTCA	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											122.0	88.0	100.0					X																	3242751		2203	4300	6503	3252751	SO:0001583	missense	25878			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.975G>T	X.37:g.3242751C>A	ENSP00000217939:p.Glu325Asp	Unknown		x	x	x	3252751	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788968	0.31685	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.66815	-0.23	3.41	1.44	0.22558	.	0.000000	0.38492	U	0.001677	T	0.67795	0.2931	L	0.59436	1.845	0.22819	N	0.998697	D	0.61080	0.989	P	0.57152	0.814	T	0.57934	-0.7725	10	0.54805	T	0.06	.	4.4677	0.11698	0.0:0.6016:0.1865:0.212	.	325	Q9NR99	MXRA5_HUMAN	D	325	ENSP00000217939:E325D	ENSP00000217939:E325D	E	-	3	2	MXRA5	3252751	0.951000	0.32395	0.153000	0.22517	0.066000	0.16364	-0.031000	0.12287	0.282000	0.22254	0.425000	0.28330	GAG		0.473	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		Missense_Mutation
WDR45	11152	broad.mit.edu	37	X	48933303	48933303	+	Nonsense_Mutation	SNP	G	G	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chrX:48933303G>T	ENST00000376372.3	-	8	807	c.626C>A	c.(625-627)tCa>tAa	p.S209*	PRAF2_ENST00000376390.4_5'Flank|PRAF2_ENST00000376386.3_5'Flank|WDR45_ENST00000485908.1_Nonsense_Mutation_p.S174*|WDR45_ENST00000473974.1_Nonsense_Mutation_p.S209*|WDR45_ENST00000553851.1_Nonsense_Mutation_p.S107*|WDR45_ENST00000396681.4_Nonsense_Mutation_p.S209*|WDR45_ENST00000465431.1_5'Flank|WDR45_ENST00000322995.8_Nonsense_Mutation_p.S220*|PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000356463.3_Nonsense_Mutation_p.S210*|WDR45_ENST00000376368.2_Nonsense_Mutation_p.S210*|AF196779.12_ENST00000376358.3_Nonsense_Mutation_p.S107*	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	209					autophagy (GO:0006914)|cell death (GO:0008219)			p.S210*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						CTGGGAGGCTGAGGCCACTAC	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	X											55.0	45.0	48.0					X																	48933303		2203	4300	6503	48820247	SO:0001587	stop_gained	11152			BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.626C>A	X.37:g.48933303G>T	ENSP00000365551:p.Ser209*	Unknown		x	x	x	48820247	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Nonsense_Mutation	SNP	ENST00000376372.3	37	CCDS35250.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928291	0.92389	.	.	ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000250232	ENST00000553851;ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000475977;ENST00000471338;ENST00000376358	.	.	.	3.76	3.76	0.43208	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.0451	14.37	0.66833	0.0:0.0:1.0:0.0	.	.	.	.	X	107;209;220;210;174;209;210;209;37;142;107	.	.	S	-	2	0	AF196779.12;WDR45	48820247	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	9.154000	0.94694	1.814000	0.52955	0.409000	0.27619	TCA		0.557	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075		Nonsense_Mutation
WNK3	65267	broad.mit.edu	37	X	54275418	54275418	+	Silent	SNP	G	G	T			TCGA-13-1496-01	TCGA-13-1496-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chrX:54275418G>T	ENST00000375159.2	-	16	3362	c.3363C>A	c.(3361-3363)ctC>ctA	p.L1121L	WNK3_ENST00000375169.3_Silent_p.L1121L|WNK3_ENST00000354646.2_Silent_p.L1121L			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1121					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1121L(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GCTCCTGATAGAGCAAGTTTC	0.438																																																1	Substitution - coding silent(1)	ovary(1)	X											118.0	114.0	115.0					X																	54275418		2203	4300	6503	54292143	SO:0001819	synonymous_variant	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3363C>A	X.37:g.54275418G>T		Somatic		x	x	x	54292143	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	CCDS14357.1	SNP	33	Broad																																																																																				0.438	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		Silent
ARMCX1	51309	broad.mit.edu	37	X	100808744	100808744	+	Silent	SNP	C	C	T			TCGA-13-1496-01	TCGA-13-1496-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chrX:100808744C>T	ENST00000372829.3	+	4	1202	c.831C>T	c.(829-831)aaC>aaT	p.N277N		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	277						integral component of membrane (GO:0016021)		p.N277N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						TGAGTGTGAACGCAGAAAATC	0.433													C|||	1	0.000264901	0.0008	0.0	3775	,	,		15038	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	X											111.0	88.0	96.0					X																	100808744		2203	4300	6503	100695400	SO:0001819	synonymous_variant	51309			AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.831C>T	X.37:g.100808744C>T		Somatic		x	x	x	100695400	Q53HK2|Q9H2Q0	Silent	SNP	ENST00000372829.3	37	CCDS14487.1	SNP	19	Broad																																																																																				0.433	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608		Silent
PAK3	5063	broad.mit.edu	37	X	110388130	110388130	+	Intron	SNP	A	A	T			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chrX:110388130A>T	ENST00000372010.1	+	7	718				PAK3_ENST00000519681.1_Missense_Mutation_p.S107C|PAK3_ENST00000262836.4_Intron|PAK3_ENST00000372007.5_Intron|PAK3_ENST00000518291.1_Missense_Mutation_p.S107C|PAK3_ENST00000360648.4_Missense_Mutation_p.S107C|PAK3_ENST00000446737.1_Intron|PAK3_ENST00000417227.1_Missense_Mutation_p.S107C|PAK3_ENST00000425146.1_Intron			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3						activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						GGTCGCTTCAAGTCAATCAGA	0.388										TSP Lung(19;0.15)																																						0			X											62.0	44.0	50.0					X																	110388130		1568	3574	5142	110274786	SO:0001627	intron_variant	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.277-1619A>T	X.37:g.110388130A>T		Unknown		x	x	x	110274786	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	12.93	2.084312	0.36758	.	.	ENSG00000077264	ENST00000519681;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227	T;D;D;D;T	0.86694	-0.64;-2.16;-2.16;-2.16;-0.64	4.35	4.35	0.52113	.	1.758090	0.02541	N	0.094630	D	0.90535	0.7034	L	0.32530	0.975	0.80722	D	1	P;P	0.49696	0.927;0.927	D;D	0.69654	0.965;0.965	T	0.80558	-0.1329	10	0.56958	D	0.05	.	8.8909	0.35432	1.0:0.0:0.0:0.0	.	107;107	O75914-4;O75914-3	.;.	C	107	ENSP00000429113:S107C;ENSP00000428921:S107C;ENSP00000405642:S107C;ENSP00000353864:S107C;ENSP00000389172:S107C	ENSP00000353864:S107C	S	+	1	0	PAK3	110274786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.612000	0.54142	1.920000	0.55613	0.412000	0.27726	AGT		0.388	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	17	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln	Unknown		Capture	Illumina GAIIx	Phase_I	7518263	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
RB1CC1	9821	broad.mit.edu	37	8	53555083	53555085	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-13-1496-01	TCGA-13-1496-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1496-01	TCGA-13-1496-10	g.chr8:53555083_53555085delCTT	ENST00000025008.5	-	18	4686_4688	c.4163_4165delAAG	c.(4162-4167)gaagtc>gtc	p.E1388del	RB1CC1_ENST00000435644.2_In_Frame_Del_p.E1388del|RB1CC1_ENST00000539297.1_In_Frame_Del_p.E1388del|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1388					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.E1388del(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AACTTACTGACTTCTTCTTCAAG	0.409																																					GBM(180;1701 2102 13475 42023 52570)											1	Deletion - In frame(1)	ovary(1)	8																																								53717638	SO:0001651	inframe_deletion	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4163_4165delAAG	8.37:g.53555089_53555091delCTT	ENSP00000025008:p.Glu1388del	Unknown		Capture	Illumina GAIIx	Phase_I	53717636	Q86YR4|Q8WVU9|Q92601	In_Frame_Del	DEL	ENST00000025008.5	37	CCDS34892.1	DEL	20	Broad																																																																																				0.409	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781		In_Frame_Del
