#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
CROCC	9696	broad.mit.edu	37	1	17250890	17250890	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr1:17250890G>C	ENST00000375541.5	+	3	336	c.267G>C	c.(265-267)gaG>gaC	p.E89D	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.E89D(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGCAGCAGGAGCTGTCCCGCG	0.662																																																1	Substitution - Missense(1)	ovary(1)	1											42.0	34.0	37.0					1																	17250890		2203	4300	6503	17123477	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.267G>C	1.37:g.17250890G>C	ENSP00000364691:p.Glu89Asp	Unknown		x	x	x	17123477		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865932	0.51588	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.19806	2.12	4.88	0.203	0.15195	.	.	.	.	.	T	0.40015	0.1100	M	0.72118	2.19	0.32026	N	0.600187	D	0.71674	0.998	D	0.77557	0.99	T	0.48328	-0.9045	9	0.87932	D	0	.	8.0977	0.30837	0.4257:0.0:0.5743:0.0	.	89	Q5TZA2	CROCC_HUMAN	D	89;60	ENSP00000364691:E89D	ENSP00000364691:E89D	E	+	3	2	CROCC	17123477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.791000	0.38744	0.210000	0.20664	0.591000	0.81541	GAG		0.662	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		Missense_Mutation
FPGT-TNNI3K	100526835	broad.mit.edu	37	1	74819687	74819687	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr1:74819687G>A	ENST00000370899.3	+	13	1391	c.1354G>A	c.(1354-1356)Ggt>Agt	p.G452S	TNNI3K_ENST00000370891.2_Missense_Mutation_p.G452S|TNNI3K_ENST00000326637.3_Missense_Mutation_p.G351S|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.G465S|RP11-439H8.4_ENST00000415549.2_RNA|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.G452S	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.G351S(1)									TTGCTACCACGGTCACATTCG	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											145.0	127.0	133.0					1																	74819687		2203	4300	6503	74592275	SO:0001583	missense	51086					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1354G>A	1.37:g.74819687G>A	ENSP00000359936:p.Gly452Ser	Somatic		x	x	x	74592275		Missense_Mutation	SNP	ENST00000370899.3	37		SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.336618	0.95758	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.84032	0.5383	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.993;0.99;0.999	D	0.85754	0.1345	10	0.87932	D	0	.	18.9705	0.92713	0.0:0.0:1.0:0.0	.	351;452;452;452	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	S	452;452;452;452;351	ENSP00000359936:G452S;ENSP00000359932:G452S;ENSP00000450895:G452S;ENSP00000359928:G452S;ENSP00000322251:G351S	ENSP00000322251:G351S	G	+	1	0	RP11-653A5.2;AC093158.1	74592275	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.202000	0.95026	2.715000	0.92844	0.655000	0.94253	GGT		0.408	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3			Missense_Mutation
CR1	1378	broad.mit.edu	37	1	207790003	207790003	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr1:207790003A>G	ENST00000367049.4	+	41	6745	c.6745A>G	c.(6745-6747)Ata>Gta	p.I2249V	CR1_ENST00000400960.2_Missense_Mutation_p.I1799V|CR1_ENST00000367052.1_Missense_Mutation_p.I1799V|CR1_ENST00000367053.1_Missense_Mutation_p.I1799V|CR1_ENST00000367051.1_Missense_Mutation_p.I1799V	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1799					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.I1804V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TGGAAAAGAAATATCTTACGC	0.473																																																1	Substitution - Missense(1)	ovary(1)	1											135.0	130.0	131.0					1																	207790003		1891	4111	6002	205856626	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6745A>G	1.37:g.207790003A>G	ENSP00000356016:p.Ile2249Val	Unknown		x	x	x	205856626	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.958013	0.00049	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	4.15	-8.3	0.01005	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.24470	0.0593	N	0.00801	-1.175	0.09310	N	1	B;B	0.12630	0.0;0.006	B;B	0.17098	0.001;0.017	T	0.50759	-0.8790	9	0.02654	T	1	.	23.1927	0.99980	0.1514:0.0:0.8486:0.0	rs55770942	1799;2249	P17927;E9PDY4	CR1_HUMAN;.	V	1799;1799;1799;1799;2249	ENSP00000356019:I1799V;ENSP00000356018:I1799V;ENSP00000356020:I1799V;ENSP00000383744:I1799V;ENSP00000356016:I2249V	ENSP00000356016:I2249V	I	+	1	0	CR1	205856626	0.000000	0.05858	0.000000	0.03702	0.137000	0.21094	-2.738000	0.00800	-2.855000	0.00329	-1.192000	0.01694	ATA		0.473	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573		Missense_Mutation
TSPAN32	10077	broad.mit.edu	37	11	2339102	2339103	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:2339102_2339103GC>TG	ENST00000182290.4	+	10	1048_1049	c.911_912GC>TG	c.(910-912)gGC>gTG	p.G304V	TSPAN32_ENST00000381121.3_Missense_Mutation_p.Q244E|TSPAN32_ENST00000451520.2_Missense_Mutation_p.G293V	NM_139022.2	NP_620591.3	Q96QS1	TSN32_HUMAN	tetraspanin 32	304					cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|defense response to protozoan (GO:0042832)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|platelet aggregation (GO:0070527)|regulation of defense response to virus (GO:0050688)	cell surface (GO:0009986)|integrin alphaIIb-beta3 complex (GO:0070442)|intracellular (GO:0005622)		p.G304V(1)		breast(1)|central_nervous_system(1)|lung(4)|ovary(1)|skin(1)	8		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		gctctccagggcagaagtcgcg	0.589																																																1	Substitution - Missense(1)	ovary(1)	11																																								2295679	SO:0001583	missense	10077			AF176070	CCDS7733.1	11p15	2013-02-14	2005-08-16	2005-08-16	ENSG00000064201	ENSG00000064201		"""Tetraspanins"""	13410	protein-coding gene	gene with protein product		603853	"""pan-hematopoietic expression"""	TSSC6, PHEMX		10072438, 10950922	Standard	NM_139022		Approved		uc001lvy.1	Q96QS1	OTTHUMG00000009762	Exception_encountered	11.37:g.2339102_2339103delinsTG	ENSP00000182290:p.Gly304Val	Unknown		x	x	x	2295678	Q96KX4|Q9HC50|Q9HC51|Q9Y5U1	Missense_Mutation	DNP	ENST00000182290.4	37	CCDS7733.1	DNP	42	Broad																																																																																				0.589	TSPAN32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026912.2	NM_139024		Missense_Mutation
EIF4G2	1982	broad.mit.edu	37	11	10821215	10821215	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:10821215T>G	ENST00000526148.1	-	19	2718	c.2208A>C	c.(2206-2208)gaA>gaC	p.E736D	EIF4G2_ENST00000339995.5_Missense_Mutation_p.E736D|EIF4G2_ENST00000525681.1_Missense_Mutation_p.E736D|RP11-685M7.5_ENST00000532365.1_RNA|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000396525.2_Missense_Mutation_p.E698D	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2									p.E736D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GCTTCAACAGTTCCTTCTCCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	11											148.0	143.0	144.0					11																	10821215		2201	4294	6495	10777791	SO:0001583	missense	1982			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.2208A>C	11.37:g.10821215T>G	ENSP00000433664:p.Glu736Asp	Unknown		x	x	x	10777791		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	17.34	3.365672	0.61513	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000379653	T;T;T;T	0.20598	2.06;2.06;2.06;2.08	5.52	4.4	0.53042	eIF4-gamma/eIF5/eIF2-epsilon (1);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	L	0.39514	1.22	0.54753	D	0.999984	B;B	0.21452	0.056;0.056	B;B	0.18561	0.012;0.022	T	0.13683	-1.0500	9	0.14252	T	0.57	-11.2686	7.2544	0.26168	0.0:0.2189:0.0:0.7811	.	736;809	P78344;B4DZF2	IF4G2_HUMAN;.	D	736;736;736;698;809;118	ENSP00000433664:E736D;ENSP00000433371:E736D;ENSP00000340281:E736D;ENSP00000379778:E698D	ENSP00000340281:E736D	E	-	3	2	EIF4G2	10777791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.584000	0.53936	2.101000	0.63845	0.460000	0.39030	GAA		0.373	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418		Missense_Mutation
CD82	3732	broad.mit.edu	37	11	44626655	44626655	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:44626655G>A	ENST00000227155.4	+	5	432	c.184G>A	c.(184-186)Gtg>Atg	p.V62M	CD82_ENST00000530931.1_3'UTR|CD82_ENST00000342935.3_Missense_Mutation_p.V62M|RP11-58K22.4_ENST00000532524.1_RNA|RP11-58K22.5_ENST00000533814.1_RNA	NM_002231.3	NP_002222.1	P27701	CD82_HUMAN	CD82 molecule	62						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.V62M(1)		large_intestine(1)|ovary(1)	2						CTTCATCGGCGTGGGGGCAGT	0.597																																																1	Substitution - Missense(1)	ovary(1)	11											92.0	89.0	90.0					11																	44626655		2203	4299	6502	44583231	SO:0001583	missense	3732			U20770	CCDS7909.1, CCDS31469.1	11p11.2	2013-02-14	2006-03-28	2005-03-03		ENSG00000085117		"""CD molecules"", ""Tetraspanins"""	6210	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 6"", ""R2 leukocyte antigen"""	600623	"""kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4))"", ""CD82 antigen"""	ST6, KAI1			Standard	XM_006718222		Approved	R2, IA4, TSPAN27	uc001myc.3	P27701		ENST00000227155.4:c.184G>A	11.37:g.44626655G>A	ENSP00000227155:p.Val62Met	Unknown		x	x	x	44583231	D3DQN6|E9PC70|Q7Z2D4|Q7Z5N2	Missense_Mutation	SNP	ENST00000227155.4	37	CCDS7909.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791824	0.70452	.	.	ENSG00000085117	ENST00000526958;ENST00000227155;ENST00000342935;ENST00000532544;ENST00000527737;ENST00000524704;ENST00000525813;ENST00000530601	D;D;D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	4.64	3.71	0.42584	.	0.062767	0.64402	D	0.000005	D	0.88588	0.6477	M	0.80422	2.495	0.54753	D	0.999984	D;D	0.89917	0.999;1.0	D;D	0.78314	0.975;0.991	D	0.89619	0.3847	10	0.66056	D	0.02	.	12.0988	0.53772	0.0882:0.0:0.9118:0.0	.	62;62	E9PC70;P27701	.;CD82_HUMAN	M	103;62;62;62;126;62;62;43	ENSP00000435682:V103M;ENSP00000227155:V62M;ENSP00000339686:V62M;ENSP00000431767:V62M;ENSP00000433151:V126M;ENSP00000436403:V62M;ENSP00000433804:V62M;ENSP00000433788:V43M	ENSP00000227155:V62M	V	+	1	0	CD82	44583231	1.000000	0.71417	0.860000	0.33809	0.865000	0.49528	4.941000	0.63540	2.132000	0.65825	0.561000	0.74099	GTG		0.597	CD82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389886.1			Missense_Mutation
OR5D13	390142	broad.mit.edu	37	11	55540921	55540921	+	Missense_Mutation	SNP	C	C	A	rs577141873		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:55540921C>A	ENST00000361760.1	+	1	8	c.8C>A	c.(7-9)gCa>gAa	p.A3E		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A3E(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				ATCATGATGGCATCTGAAAGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	11											83.0	85.0	85.0					11																	55540921		2200	4296	6496	55297497	SO:0001583	missense	390142			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.8C>A	11.37:g.55540921C>A	ENSP00000354800:p.Ala3Glu	Unknown		x	x	x	55297497	Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	CCDS31507.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	3.459	-0.110389	0.06924	.	.	ENSG00000198877	ENST00000361760	T	0.00630	6.1	3.15	-4.76	0.03229	.	.	.	.	.	T	0.00384	0.0012	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.20184	0.028	T	0.47222	-0.9134	9	0.62326	D	0.03	0.3227	1.0174	0.01510	0.2411:0.3652:0.1522:0.2415	.	3	Q8NGL4	OR5DD_HUMAN	E	3	ENSP00000354800:A3E	ENSP00000354800:A3E	A	+	2	0	OR5D13	55297497	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.335000	0.02662	-0.360000	0.08138	-0.482000	0.04802	GCA		0.373	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		Missense_Mutation
OR5M11	219487	broad.mit.edu	37	11	56310489	56310489	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:56310489G>A	ENST00000528616.2	-	1	268	c.245C>T	c.(244-246)tCg>tTg	p.S82L		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						GATATTAGTCGACATCTGCGG	0.443																																																0			11											115.0	115.0	115.0					11																	56310489		2165	4269	6434	56067065	SO:0001583	missense	219487			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.245C>T	11.37:g.56310489G>A	ENSP00000432417:p.Ser82Leu	Unknown		x	x	x	56067065	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	37	CCDS53629.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	A	0.103	-1.148653	0.01714	.	.	ENSG00000255223	ENST00000528616	T	0.00433	7.43	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.00002	-3.505	0.19575	N	0.999966	B	0.02656	0.0	B	0.01281	0.0	T	0.36286	-0.9754	9	0.02654	T	1	.	10.1261	0.42649	0.9206:0.0:0.0794:0.0	.	82	Q96RB7	OR5MB_HUMAN	L	82	ENSP00000432417:S82L	ENSP00000432417:S82L	S	-	2	0	OR5M11	56067065	0.548000	0.26473	0.018000	0.16275	0.028000	0.11728	5.565000	0.67365	0.991000	0.38814	-0.285000	0.09966	TCG		0.443	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245		Missense_Mutation
SRSF8	10929	broad.mit.edu	37	11	94801044	94801044	+	RNA	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:94801044C>T	ENST00000529911.1	+	0	684					NM_032102.3	NP_115285.1	Q9BRL6	SRSF8_HUMAN	serine/arginine-rich splicing factor 8						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CACTAGCTCTCGCTCTGCATC	0.572																																																0			11											96.0	105.0	102.0					11																	94801044		2169	4285	6454	94440692			10929			AF031166	CCDS73370.1	11q21	2014-05-06	2010-06-22	2010-06-22	ENSG00000180771	ENSG00000263465		"""Serine/arginine-rich splicing factors"""	16988	protein-coding gene	gene with protein product	"""SR splicing factor 8"""	603269	"""splicing factor, arginine/serine-rich 2B"""	SFRS2B		9671500, 20516191	Standard	NM_032102		Approved	SRP46	uc001pff.3	Q9BRL6	OTTHUMG00000188534		11.37:g.94801044C>T		Unknown		x	x	x	94440692	B2R6B8|Q6PF01|Q96TA3	Silent	SNP	ENST00000529911.1	37		SNP	31	Broad																																																																																				0.572	SRSF8-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000390962.3	NM_032102		Silent
CEP164	22897	broad.mit.edu	37	11	117282856	117282856	+	Missense_Mutation	SNP	A	A	C	rs370039438		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:117282856A>C	ENST00000278935.3	+	33	4502	c.4355A>C	c.(4354-4356)cAc>cCc	p.H1452P	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1452					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.H1452P(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CTTGATGAGCACAACAGAGTG	0.592																																																1	Substitution - Missense(1)	ovary(1)	11											84.0	73.0	77.0					11																	117282856		2201	4296	6497	116788066	SO:0001583	missense	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.4355A>C	11.37:g.117282856A>C	ENSP00000278935:p.His1452Pro	Unknown		x	x	x	116788066	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002203	0.35320	.	.	ENSG00000110274	ENST00000278935	T	0.57595	0.39	5.24	1.35	0.21983	.	1.167540	0.06178	N	0.678987	T	0.43897	0.1268	L	0.36672	1.1	0.23653	N	0.9972	B;B	0.24882	0.113;0.113	B;B	0.28638	0.092;0.092	T	0.42310	-0.9459	10	0.56958	D	0.05	-1.8245	6.2661	0.20928	0.6132:0.3063:0.0805:0.0	.	1452;1447	Q9UPV0;Q9UPV0-2	CE164_HUMAN;.	P	1452	ENSP00000278935:H1452P	ENSP00000278935:H1452P	H	+	2	0	CEP164	116788066	0.987000	0.35691	0.340000	0.25575	0.014000	0.08584	2.662000	0.46766	0.302000	0.22762	-0.250000	0.11733	CAC		0.592	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956		Missense_Mutation
EI24	9538	broad.mit.edu	37	11	125447464	125447464	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr11:125447464T>C	ENST00000278903.6	+	5	556	c.314T>C	c.(313-315)aTc>aCc	p.I105T	STT3A-AS1_ENST00000532714.1_RNA|RNU6-1156P_ENST00000410365.1_RNA|EI24_ENST00000530985.1_3'UTR|EI24_ENST00000343678.4_Missense_Mutation_p.I105T|STT3A-AS1_ENST00000530526.1_RNA	NM_004879.3	NP_004870.3	O14681	EI24_HUMAN	etoposide induced 2.4	105					apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.I105T(1)		large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		GCCCGAATTATCGGTAAGTGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											284.0	239.0	253.0					11																	125447464		1917	4122	6039	124952674	SO:0001583	missense	9538			AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000278903.6:c.314T>C	11.37:g.125447464T>C	ENSP00000278903:p.Ile105Thr	Unknown		x	x	x	124952674	A8K7D6|B4DKL6|Q9BUQ1	Missense_Mutation	SNP	ENST00000278903.6	37		SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182918	0.78677	.	.	ENSG00000149547	ENST00000278903;ENST00000343678;ENST00000524723;ENST00000527842;ENST00000527520;ENST00000527131	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	L	0.51422	1.61	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.991;0.999	D;D;D;D	0.85130	0.997;0.997;0.991;0.997	T	0.65450	-0.6165	9	0.23302	T	0.38	.	15.481	0.75528	0.0:0.0:0.0:1.0	.	91;105;105;105	B4DKL6;E9PM05;A6NES3;O14681	.;.;.;EI24_HUMAN	T	105;105;148;105;91;105	.	ENSP00000278903:I105T	I	+	2	0	EI24	124952674	1.000000	0.71417	0.996000	0.52242	0.654000	0.38779	7.244000	0.78228	2.147000	0.66899	0.533000	0.62120	ATC		0.433	EI24-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_004879		Missense_Mutation
FAM90A1	55138	broad.mit.edu	37	12	8377408	8377408	+	Silent	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr12:8377408G>C	ENST00000538603.1	-	4	579	c.21C>G	c.(19-21)ccC>ccG	p.P7P	FAM90A1_ENST00000307435.6_Silent_p.P7P	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	7							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.P7P(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		CCCCAGGTTTGGGGTCACGAC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	12											47.0	53.0	51.0					12																	8377408		2203	4299	6502	8268675	SO:0001819	synonymous_variant	55138			AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.21C>G	12.37:g.8377408G>C		Unknown		x	x	x	8268675	D3DUU9|Q9NVZ6	Silent	SNP	ENST00000538603.1	37	CCDS31738.1	SNP	47	Broad																																																																																				0.582	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088		Silent
TPH2	121278	broad.mit.edu	37	12	72388224	72388224	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1505-01	TCGA-13-1505-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr12:72388224C>G	ENST00000333850.3	+	8	1088	c.947C>G	c.(946-948)aCa>aGa	p.T316R		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	316					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.T316R(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GTCAGAGACACATGCCATGAA	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											149.0	145.0	147.0					12																	72388224		2203	4300	6503	70674491	SO:0001583	missense	121278			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.947C>G	12.37:g.72388224C>G	ENSP00000329093:p.Thr316Arg	Somatic		x	x	x	70674491	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623103	0.87460	.	.	ENSG00000139287	ENST00000333850	D	0.99527	-6.09	5.91	5.91	0.95273	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99441	0.9802	M	0.76574	2.34	0.80722	D	1	D	0.69078	0.997	P	0.62813	0.907	D	0.99357	1.0916	10	0.87932	D	0	-8.5326	20.2985	0.98592	0.0:1.0:0.0:0.0	.	316	Q8IWU9	TPH2_HUMAN	R	316	ENSP00000329093:T316R	ENSP00000329093:T316R	T	+	2	0	TPH2	70674491	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	ACA		0.398	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353		Missense_Mutation
SLC17A8	246213	broad.mit.edu	37	12	100796167	100796167	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr12:100796167G>T	ENST00000323346.5	+	7	1126	c.813G>T	c.(811-813)gaG>gaT	p.E271D	SLC17A8_ENST00000392989.3_Missense_Mutation_p.E271D|snoU13_ENST00000459038.1_RNA	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	271					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.E271D(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						AGGCCTATGAGTGCCCAGCAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	93.0	94.0					12																	100796167		2203	4300	6503	99320298	SO:0001583	missense	246213			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.813G>T	12.37:g.100796167G>T	ENSP00000316909:p.Glu271Asp	Unknown		x	x	x	99320298	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643144	0.47153	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.63744	-0.06;-0.06	5.67	2.85	0.33270	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.169866	0.52532	D	0.000064	T	0.43010	0.1228	N	0.16368	0.405	0.47584	D	0.999461	B;B	0.31413	0.02;0.322	B;B	0.33568	0.068;0.166	T	0.14839	-1.0458	10	0.15499	T	0.54	.	11.3359	0.49503	0.1998:0.0:0.8002:0.0	.	271;271	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	D	271	ENSP00000316909:E271D;ENSP00000376715:E271D	ENSP00000316909:E271D	E	+	3	2	SLC17A8	99320298	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	1.279000	0.33191	0.758000	0.33059	0.557000	0.71058	GAG		0.428	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319		Missense_Mutation
RSRC2	65117	broad.mit.edu	37	12	123006786	123006786	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr12:123006786T>A	ENST00000331738.7	-	2	212	c.67A>T	c.(67-69)Aaa>Taa	p.K23*	RSRC2_ENST00000354654.2_5'UTR	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	23							poly(A) RNA binding (GO:0044822)	p.K23*(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TGCTCTTTTTTCTTATCTCTA	0.353																																																1	Substitution - Nonsense(1)	ovary(1)	12											156.0	144.0	148.0					12																	123006786		2203	4300	6503	121572739	SO:0001587	stop_gained	65117			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.67A>T	12.37:g.123006786T>A	ENSP00000330188:p.Lys23*	Unknown		x	x	x	121572739	Q6N040|Q6NW16|Q9H864	Nonsense_Mutation	SNP	ENST00000331738.7	37	CCDS31920.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	37	6.038897	0.97226	.	.	ENSG00000111011	ENST00000331738;ENST00000418773	.	.	.	5.35	5.35	0.76521	.	0.092524	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.603	0.51015	0.0:0.0:0.1488:0.8512	.	.	.	.	X	23	.	ENSP00000330188:K23X	K	-	1	0	RSRC2	121572739	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.644000	0.54381	2.160000	0.67779	0.528000	0.53228	AAA		0.353	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	NM_023012		Nonsense_Mutation
FREM2	341640	broad.mit.edu	37	13	39262686	39262686	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr13:39262686C>T	ENST00000280481.7	+	1	1421	c.1205C>T	c.(1204-1206)tCt>tTt	p.S402F		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	402					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S402F(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCTGAAGACTCTGACCAGGAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	13											65.0	71.0	69.0					13																	39262686		2203	4300	6503	38160686	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1205C>T	13.37:g.39262686C>T	ENSP00000280481:p.Ser402Phe	Unknown		x	x	x	38160686	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748855	0.49257	.	.	ENSG00000150893	ENST00000280481	T	0.21031	2.03	5.94	5.94	0.96194	.	0.062581	0.64402	D	0.000003	T	0.51398	0.1672	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.42068	-0.9473	10	0.41790	T	0.15	.	20.3633	0.98874	0.0:1.0:0.0:0.0	.	402	Q5SZK8	FREM2_HUMAN	F	402	ENSP00000280481:S402F	ENSP00000280481:S402F	S	+	2	0	FREM2	38160686	1.000000	0.71417	0.940000	0.37924	0.156000	0.22039	7.780000	0.85658	2.826000	0.97356	0.561000	0.74099	TCT		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		Missense_Mutation
EXOC3L4	91828	broad.mit.edu	37	14	103574825	103574825	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr14:103574825G>C	ENST00000380069.3	+	10	2023	c.1947G>C	c.(1945-1947)gaG>gaC	p.E649D		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	649					exocytosis (GO:0006887)	exocyst (GO:0000145)		p.E649D(1)		cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GGCACCTGGAGACTCTTATCC	0.587																																																1	Substitution - Missense(1)	ovary(1)	14											194.0	170.0	178.0					14																	103574825		2203	4300	6503	102644578	SO:0001583	missense	91828			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1947G>C	14.37:g.103574825G>C	ENSP00000369409:p.Glu649Asp	Unknown		x	x	x	102644578	Q14CR2	Missense_Mutation	SNP	ENST00000380069.3	37	CCDS32163.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505991	0.44558	.	.	ENSG00000205436	ENST00000380069	T	0.07800	3.16	4.14	0.135	0.14775	.	0.415608	0.23189	N	0.050937	T	0.12433	0.0302	M	0.65975	2.015	0.09310	N	1	P	0.47484	0.896	P	0.50754	0.649	T	0.09164	-1.0687	10	0.56958	D	0.05	-8.2095	3.0055	0.06027	0.3781:0.2284:0.3935:0.0	.	649	Q17RC7	EX3L4_HUMAN	D	649	ENSP00000369409:E649D	ENSP00000369409:E649D	E	+	3	2	EXOC3L4	102644578	0.988000	0.35896	0.221000	0.23827	0.618000	0.37518	1.513000	0.35823	0.157000	0.19338	0.462000	0.41574	GAG		0.587	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093		Missense_Mutation
KLHL25	64410	broad.mit.edu	37	15	86312927	86312927	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr15:86312927G>A	ENST00000337975.5	-	2	389	c.115C>T	c.(115-117)Ctt>Ttt	p.L39F	KLHL25_ENST00000536947.1_Missense_Mutation_p.L39F|MIR1276_ENST00000408707.1_RNA|KLHL25_ENST00000559131.1_Intron	NM_022480.3	NP_071925.2	Q9H0H3	KLH25_HUMAN	kelch-like family member 25	39					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of translational initiation (GO:0006446)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)		p.L39F(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	25						TGCTTGCGAAGCGTGTTGAGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	71.0	72.0					15																	86312927		2202	4299	6501	84113931	SO:0001583	missense	64410				CCDS10339.1	15q25.3	2013-02-22	2013-02-22		ENSG00000183655	ENSG00000183655		"""Kelch-like"", ""BTB/POZ domain containing"""	25732	protein-coding gene	gene with protein product	"""ectodermal-neural cortex 2"""		"""kelch-like 25 (Drosophila)"""				Standard	XM_006720635		Approved	FLJ12587, ENC2, ENC-2	uc002bly.3	Q9H0H3	OTTHUMG00000148672	ENST00000337975.5:c.115C>T	15.37:g.86312927G>A	ENSP00000336800:p.Leu39Phe	Unknown		x	x	x	84113931	B2RDH2|B3KRT7	Missense_Mutation	SNP	ENST00000337975.5	37	CCDS10339.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	14.69	2.610833	0.46527	.	.	ENSG00000183655	ENST00000337975;ENST00000536947	T;T	0.74209	-0.82;-0.82	4.85	3.93	0.45458	BTB/POZ (1);BTB/POZ fold (2);	0.167364	0.40818	N	0.001015	T	0.72653	0.3487	L	0.58583	1.82	0.42362	D	0.992416	P	0.39352	0.669	P	0.46320	0.512	T	0.69371	-0.5163	10	0.35671	T	0.21	.	7.2402	0.26092	0.0863:0.0:0.7459:0.1678	.	39	Q9H0H3	ENC2_HUMAN	F	39	ENSP00000336800:L39F;ENSP00000444739:L39F	ENSP00000336800:L39F	L	-	1	0	KLHL25	84113931	1.000000	0.71417	0.963000	0.40424	0.786000	0.44442	3.297000	0.51810	1.047000	0.40274	0.462000	0.41574	CTT		0.642	KLHL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309023.1	NM_022480		Missense_Mutation
ATP2A1	487	broad.mit.edu	37	16	28909649	28909649	+	Silent	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr16:28909649G>A	ENST00000357084.3	+	14	1908	c.1641G>A	c.(1639-1641)gcG>gcA	p.A547A	ATP2A1_ENST00000395503.4_Silent_p.A547A|ATP2A1_ENST00000536376.1_Silent_p.A422A	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	547					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.A547A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						AGATCATGGCGGTGATCAAGG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	16											55.0	61.0	59.0					16																	28909649		2197	4300	6497	28817150	SO:0001819	synonymous_variant	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1641G>A	16.37:g.28909649G>A		Unknown		x	x	x	28817150	A8K5J9|B3KY17|O14984	Silent	SNP	ENST00000357084.3	37	CCDS10643.1	SNP	39	Broad																																																																																				0.652	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320		Silent
FHOD1	29109	broad.mit.edu	37	16	67281166	67281166	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr16:67281166G>C	ENST00000258201.4	-	1	395	c.148C>G	c.(148-150)Ccc>Gcc	p.P50A	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	50					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.P50A(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GCGCCCAAGGGCAGCGCCCCG	0.706																																																1	Substitution - Missense(1)	ovary(1)	16											18.0	20.0	19.0					16																	67281166		2191	4293	6484	65838667	SO:0001583	missense	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.148C>G	16.37:g.67281166G>C	ENSP00000258201:p.Pro50Ala	Unknown		x	x	x	65838667	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	CCDS10834.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906614	0.52333	.	.	ENSG00000135723	ENST00000258201	T	0.25414	1.8	5.39	5.39	0.77823	.	0.065791	0.64402	D	0.000011	T	0.19127	0.0459	N	0.25992	0.78	0.80722	D	1	B	0.24721	0.11	B	0.14578	0.011	T	0.02885	-1.1098	10	0.37606	T	0.19	.	14.5255	0.67884	0.0:0.1578:0.8422:0.0	.	50	Q9Y613	FHOD1_HUMAN	A	50	ENSP00000258201:P50A	ENSP00000258201:P50A	P	-	1	0	FHOD1	65838667	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	1.899000	0.39818	2.536000	0.85505	0.561000	0.74099	CCC		0.706	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			Missense_Mutation
PARD6A	50855	broad.mit.edu	37	16	67696293	67696293	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr16:67696293C>T	ENST00000219255.3	+	3	864	c.784C>T	c.(784-786)Cgt>Tgt	p.R262C	ENKD1_ENST00000602409.1_5'Flank|ACD_ENST00000219251.8_5'Flank|PARD6A_ENST00000602551.1_Missense_Mutation_p.R232C|PARD6A_ENST00000458121.2_Missense_Mutation_p.R261C|ACD_ENST00000393919.4_5'Flank			Q9NPB6	PAR6A_HUMAN	par-6 family cell polarity regulator alpha	262					cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction maintenance (GO:0045217)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	GTP-dependent protein binding (GO:0030742)|Rho GTPase binding (GO:0017048)|transcription factor binding (GO:0008134)	p.R262C(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GGCATCTGGGCGTTTGACAGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	16											100.0	80.0	87.0					16																	67696293		2198	4300	6498	66253794	SO:0001583	missense	50855				CCDS10843.1, CCDS45514.1	16q22.1-q22.3	2013-08-28	2013-08-28		ENSG00000102981	ENSG00000102981			15943	protein-coding gene	gene with protein product		607484	"""par-6 (partitioning defective 6, C.elegans) homolog alpha"", ""par-6 partitioning defective 6 homolog alpha (C. elegans)"""			9482110, 11260256	Standard	XM_005255977		Approved	PAR-6, PAR-6A, TAX40, PAR6alpha, TIP-40	uc002ett.3	Q9NPB6	OTTHUMG00000137534	ENST00000219255.3:c.784C>T	16.37:g.67696293C>T	ENSP00000219255:p.Arg262Cys	Somatic		x	x	x	66253794	O14911|Q9NPJ7	Missense_Mutation	SNP	ENST00000219255.3	37	CCDS10843.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.52	3.147687	0.57151	.	.	ENSG00000102981	ENST00000458121;ENST00000219255	T;T	0.40225	1.05;1.04	5.01	5.01	0.66863	.	0.398167	0.25566	N	0.029791	T	0.50103	0.1596	L	0.43923	1.385	0.54753	D	0.999982	D;D	0.76494	0.996;0.999	P;P	0.59221	0.719;0.854	T	0.50775	-0.8788	10	0.62326	D	0.03	-6.6792	11.4889	0.50369	0.305:0.695:0.0:0.0	.	262;261	Q9NPB6;Q9NPB6-2	PAR6A_HUMAN;.	C	261;262	ENSP00000392388:R261C;ENSP00000219255:R262C	ENSP00000219255:R262C	R	+	1	0	PARD6A	66253794	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	2.051000	0.41307	2.311000	0.77944	0.563000	0.77884	CGT		0.587	PARD6A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268863.2	NM_016948		Missense_Mutation
SCARF1	8578	broad.mit.edu	37	17	1549751	1549751	+	5'Flank	SNP	G	G	A	rs368151611		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:1549751G>A	ENST00000263071.4	-	0	0				SCARF1_ENST00000348987.3_5'Flank|RILP_ENST00000301336.6_Silent_p.A397A|SCARF1_ENST00000574545.1_5'Flank|SCARF1_ENST00000571272.1_5'Flank	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1						cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.A397A(1)		cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTCTGGGGCGGCTGAGGCCC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	17											68.0	69.0	68.0					17																	1549751		2203	4300	6503	1496501	SO:0001631	upstream_gene_variant	83547			D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555		17.37:g.1549751G>A	Exception_encountered	Unknown		x	x	x	1496501	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Silent	SNP	ENST00000263071.4	37	CCDS11007.1	SNP	39	Broad																																																																																				0.647	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693		Silent
C1QBP	708	broad.mit.edu	37	17	5341451	5341451	+	Silent	SNP	G	G	C	rs565317994		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:5341451G>C	ENST00000225698.4	-	2	456	c.375C>G	c.(373-375)gcC>gcG	p.A125A	C1QBP_ENST00000574444.1_Silent_p.A21A	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	125					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.A125A(1)		lung(2)|ovary(1)	3					Hyaluronan(DB08818)	ACTTTTCCCCGGCAACTTTCC	0.507																																																1	Substitution - coding silent(1)	ovary(1)	17											119.0	120.0	119.0					17																	5341451		2203	4300	6503	5282175	SO:0001819	synonymous_variant	708			X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.375C>G	17.37:g.5341451G>C		Unknown		x	x	x	5282175	Q2HXR8|Q9NNY8	Silent	SNP	ENST00000225698.4	37	CCDS11071.1	SNP	39	Broad																																																																																				0.507	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439388.1	NM_001212		Silent
RNF112	7732	broad.mit.edu	37	17	19318109	19318109	+	Silent	SNP	G	G	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:19318109G>T	ENST00000461366.1	+	10	1250	c.1035G>T	c.(1033-1035)gtG>gtT	p.V345V	CTB-187M2.2_ENST00000579897.1_RNA	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	345	GB1/RHD3-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)	p.V345V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						ACCCCAAGGTGCAGGAGCTGC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	17											37.0	46.0	43.0					17																	19318109		2151	4258	6409	19258701	SO:0001819	synonymous_variant	7732			AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.1035G>T	17.37:g.19318109G>T		Unknown		x	x	x	19258701	O60633|Q7Z5V9	Silent	SNP	ENST00000461366.1	37	CCDS58529.1	SNP	46	Broad																																																																																				0.632	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148		Silent
GAS2L2	246176	broad.mit.edu	37	17	34076160	34076160	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:34076160A>T	ENST00000254466.6	-	3	731	c.704T>A	c.(703-705)gTg>gAg	p.V235E	GAS2L2_ENST00000587565.1_Missense_Mutation_p.V219E	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	235	GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.V235E(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGAGTCACCCACACGGTACTT	0.592																																																1	Substitution - Missense(1)	ovary(1)	17											71.0	61.0	64.0					17																	34076160		2203	4300	6503	31100273	SO:0001583	missense	246176			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.704T>A	17.37:g.34076160A>T	ENSP00000254466:p.Val235Glu	Unknown		x	x	x	31100273	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485458	0.84854	.	.	ENSG00000132139	ENST00000254466	T	0.24538	1.85	5.21	5.21	0.72293	Growth-arrest-specific protein 2 domain (4);	0.000000	0.64402	D	0.000001	T	0.52354	0.1729	M	0.78801	2.425	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.57676	-0.7770	10	0.87932	D	0	-23.3553	14.4193	0.67173	1.0:0.0:0.0:0.0	.	235	Q8NHY3	GA2L2_HUMAN	E	235	ENSP00000254466:V235E	ENSP00000254466:V235E	V	-	2	0	GAS2L2	31100273	1.000000	0.71417	0.993000	0.49108	0.773000	0.43773	9.025000	0.93694	2.193000	0.70182	0.402000	0.26972	GTG		0.592	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		Missense_Mutation
PLEKHH3	79990	broad.mit.edu	37	17	40826400	40826400	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:40826400G>C	ENST00000591022.1	-	2	577	c.190C>G	c.(190-192)Cca>Gca	p.P64A	PLEKHH3_ENST00000293349.6_Missense_Mutation_p.P64A|PLEKHH3_ENST00000456950.2_5'UTR|PLEKHH3_ENST00000412503.1_Missense_Mutation_p.P64A	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	64					signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)		p.P64A(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		CTCCTCACTGGCTGAGTCAGC	0.652																																																1	Substitution - Missense(1)	ovary(1)	17											68.0	60.0	63.0					17																	40826400		2203	4300	6503	38079926	SO:0001583	missense	79990			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.190C>G	17.37:g.40826400G>C	ENSP00000468678:p.Pro64Ala	Unknown		x	x	x	38079926	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	ENST00000591022.1	37	CCDS11434.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343800	0.24339	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	T;T	0.32753	1.44;1.44	4.49	3.49	0.39957	.	0.345913	0.21021	N	0.081502	T	0.16811	0.0404	N	0.22421	0.69	0.28061	N	0.932957	B;B	0.12013	0.005;0.0	B;B	0.08055	0.003;0.001	T	0.23940	-1.0174	10	0.02654	T	1	-16.3888	11.3786	0.49743	0.0:0.1838:0.8162:0.0	.	64;64	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	A	64	ENSP00000293349:P64A;ENSP00000411885:P64A	ENSP00000293349:P64A	P	-	1	0	PLEKHH3	38079926	1.000000	0.71417	0.924000	0.36721	0.016000	0.09150	2.391000	0.44424	1.053000	0.40415	0.491000	0.48974	CCA		0.652	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	NM_024927		Missense_Mutation
PYY	5697	broad.mit.edu	37	17	42030480	42030481	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:42030480_42030481GA>TG	ENST00000360085.2	-	6	805_806	c.265_266TC>CA	c.(265-267)TCg>CAg	p.S89Q	PYY_ENST00000592796.1_Missense_Mutation_p.S89Q	NM_004160.4	NP_004151	P10082	PYY_HUMAN	peptide YY	89					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|digestion (GO:0007586)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)	p.S89Q(1)		endometrium(1)|ovary(1)	2		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CTTTTACCGCGACCTGACGGGG	0.644																																																1	Substitution - Missense(1)	ovary(1)	17																																								39386007	SO:0001583	missense	5697				CCDS32662.1	17q21.1	2013-02-28				ENSG00000131096		"""Endogenous ligands"""	9748	protein-coding gene	gene with protein product	"""prepro-PYY"""	600781				7782089	Standard	NM_004160		Approved	PYY1	uc002ieq.3	P10082		ENST00000360085.2:c.265_266delinsTG	17.37:g.42030480_42030481delinsTG	ENSP00000353198:p.Ser89Gln	Unknown		x	x	x	39386006	Q5U5Q6|Q6FGH8	Missense_Mutation	DNP	ENST00000360085.2	37	CCDS32662.1	DNP	37	Broad																																																																																				0.644	PYY-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000457658.1	NM_004160		Missense_Mutation
MYCBPAP	84073	broad.mit.edu	37	17	48596043	48596043	+	Missense_Mutation	SNP	C	C	T	rs138709333		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:48596043C>T	ENST00000323776.5	+	5	901	c.739C>T	c.(739-741)Cgt>Tgt	p.R247C	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.R210C	NM_032133.4	NP_115509.4			MYCBP associated protein									p.R210C(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			AAACTGGCAGCGTAACACAGC	0.587																																																1	Substitution - Missense(1)	ovary(1)	17						C	CYS/ARG	0,4406		0,0,2203	82.0	96.0	91.0		739	3.3	0.8	17	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	no	missense	MYCBPAP	NM_032133.4	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	247/985	48596043	2,13004	2203	4300	6503	45951042	SO:0001583	missense	84073			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.739C>T	17.37:g.48596043C>T	ENSP00000323184:p.Arg247Cys	Unknown		x	x	x	45951042		Missense_Mutation	SNP	ENST00000323776.5	37	CCDS32680.2	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733515	0.69189	0.0	2.33E-4	ENSG00000136449	ENST00000323776;ENST00000452039;ENST00000436259	T;T;T	0.48836	0.8;0.8;0.8	5.37	3.27	0.37495	.	0.189431	0.46442	D	0.000286	T	0.66597	0.2805	M	0.77616	2.38	0.23425	N	0.99771	D;D	0.89917	1.0;1.0	D;D	0.66196	0.942;0.916	T	0.62709	-0.6797	10	0.72032	D	0.01	-10.4604	14.0516	0.64739	0.2756:0.7244:0.0:0.0	.	210;247	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	C	247;262;210	ENSP00000323184:R247C;ENSP00000407145:R262C;ENSP00000397209:R210C	ENSP00000323184:R247C	R	+	1	0	MYCBPAP	45951042	0.046000	0.20272	0.788000	0.31933	0.967000	0.64934	2.557000	0.45871	0.575000	0.29434	0.563000	0.77884	CGT		0.587	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133		Missense_Mutation
MC2R	4158	broad.mit.edu	37	18	13885322	13885322	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr18:13885322A>T	ENST00000327606.3	-	2	376	c.196T>A	c.(196-198)Ttg>Atg	p.L66M		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	66					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)	p.L66M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	GATATGGCCAAGCTACAGATG	0.423																																					Colon(141;1584 1782 35999 48227 48692)											1	Substitution - Missense(1)	ovary(1)	18											79.0	78.0	78.0					18																	13885322		2203	4300	6503	13875322	SO:0001583	missense	4158				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.196T>A	18.37:g.13885322A>T	ENSP00000333821:p.Leu66Met	Unknown		x	x	x	13875322	A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	37	CCDS11869.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935794	0.52972	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	D;D	0.91124	-2.79;-2.79	4.13	-2.92	0.05615	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000004	D	0.94922	0.8358	M	0.92923	3.36	0.38384	D	0.945212	D	0.89917	1.0	D	0.97110	1.0	D	0.93023	0.6442	10	0.87932	D	0	.	9.5495	0.39301	0.6134:0.0:0.3866:0.0	.	66	Q01718	ACTHR_HUMAN	M	66	ENSP00000333821:L66M;ENSP00000382718:L66M	ENSP00000333821:L66M	L	-	1	2	MC2R	13875322	0.997000	0.39634	0.927000	0.36925	0.687000	0.40016	0.949000	0.29109	-0.811000	0.04369	0.528000	0.53228	TTG		0.423	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2			Missense_Mutation
CEACAM5	1048	broad.mit.edu	37	19	42224002	42224002	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr19:42224002T>A	ENST00000221992.6	+	7	1760	c.1646T>A	c.(1645-1647)cTg>cAg	p.L549Q	CEACAM5_ENST00000405816.1_Missense_Mutation_p.L549Q|CEACAM5_ENST00000398599.4_Missense_Mutation_p.L548Q|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	549	Ig-like 6.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.L549Q(1)		breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		AGGCTGCAGCTGTCCAATGGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	19											183.0	162.0	169.0					19																	42224002		2203	4300	6503	46915842	SO:0001583	missense	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1646T>A	19.37:g.42224002T>A	ENSP00000221992:p.Leu549Gln	Unknown		x	x	x	46915842	H9KVA7	Missense_Mutation	SNP	ENST00000221992.6	37	CCDS12584.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	13.18	2.158929	0.38119	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.03212	4.01;4.01	2.31	2.31	0.28768	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.17408	0.0418	M	0.87456	2.885	0.09310	N	0.999999	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.996	T	0.02805	-1.1108	9	0.66056	D	0.02	.	6.5461	0.22406	0.0:0.0:0.0:1.0	.	549;549	P06731;Q53G30	CEAM5_HUMAN;.	Q	549;549;267	ENSP00000221992:L549Q;ENSP00000385072:L549Q	ENSP00000221992:L549Q	L	+	2	0	CEACAM5	46915842	0.192000	0.23301	0.280000	0.24747	0.040000	0.13550	2.959000	0.49153	1.290000	0.44636	0.332000	0.21555	CTG		0.517	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363		Missense_Mutation
ARHGAP35	2909	broad.mit.edu	37	19	47425365	47425365	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr19:47425365C>T	ENST00000404338.3	+	1	3433	c.3433C>T	c.(3433-3435)Cga>Tga	p.R1145*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1145					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.R1145*(4)									CTCTCTAGAGCGAGGGCGCAA	0.562																																																4	Substitution - Nonsense(4)	endometrium(2)|ovary(1)|large_intestine(1)	19											52.0	52.0	52.0					19																	47425365		2045	4201	6246	52117205	SO:0001587	stop_gained	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3433C>T	19.37:g.47425365C>T	ENSP00000385720:p.Arg1145*	Unknown		x	x	x	52117205	A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	42	9.427396	0.99167	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.0671	18.7132	0.91666	0.0:1.0:0.0:0.0	.	.	.	.	X	1145	.	ENSP00000324820:R1145X	R	+	1	2	ARHGAP35	52117205	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.925000	0.48884	2.720000	0.93068	0.655000	0.94253	CGA		0.562	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		Nonsense_Mutation
MYADM	91663	broad.mit.edu	37	19	54377273	54377273	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr19:54377273G>A	ENST00000391769.2	+	3	770	c.490G>A	c.(490-492)Gag>Aag	p.E164K	MYADM_ENST00000391771.1_Missense_Mutation_p.E164K|MYADM_ENST00000391768.2_Missense_Mutation_p.E164K|MYADM_ENST00000336967.3_Missense_Mutation_p.E164K|MYADM_ENST00000391770.4_Missense_Mutation_p.E164K|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	164					establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.E164K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CCGGCCCGGCGAGATCACTGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	50.0	50.0					19																	54377273		2203	4300	6503	59069085	SO:0001583	missense	91663			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.490G>A	19.37:g.54377273G>A	ENSP00000375649:p.Glu164Lys	Unknown		x	x	x	59069085	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	37	CCDS12866.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630838	0.46944	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	.	.	.	4.0	4.0	0.46444	.	0.066592	0.56097	D	0.000026	T	0.62356	0.2421	M	0.79926	2.475	0.58432	D	0.999994	B	0.25312	0.123	B	0.15484	0.013	T	0.64136	-0.6478	9	0.36615	T	0.2	-13.5126	14.0001	0.64429	0.0:0.0:1.0:0.0	.	164	Q96S97	MYADM_HUMAN	K	164;164;164;164;164;164;127;164;164	.	ENSP00000337222:E164K	E	+	1	0	MYADM	59069085	1.000000	0.71417	0.226000	0.23910	0.665000	0.39181	4.705000	0.61838	1.967000	0.57214	0.313000	0.20887	GAG		0.652	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373		Missense_Mutation
PTPRH	5794	broad.mit.edu	37	19	55711817	55711817	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1505-01	TCGA-13-1505-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr19:55711817C>A	ENST00000376350.3	-	7	1229	c.1207G>T	c.(1207-1209)Gcc>Tcc	p.A403S	PTPRH_ENST00000263434.5_Missense_Mutation_p.A225S|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	403	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A403S(1)		breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CAGCATAGGGCGATGGAGCTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											121.0	107.0	112.0					19																	55711817		2203	4300	6503	60403629	SO:0001583	missense	5794				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.1207G>T	19.37:g.55711817C>A	ENSP00000365528:p.Ala403Ser	Somatic		x	x	x	60403629	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.477119	0.01035	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.55413	0.52;0.52	3.71	1.49	0.22878	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.150880	0.06831	N	0.794034	T	0.22085	0.0532	N	0.03948	-0.315	0.20074	N	0.999937	B;B;B	0.29590	0.25;0.211;0.062	B;B;B	0.26094	0.066;0.039;0.055	T	0.18967	-1.0320	10	0.06365	T	0.9	.	3.1955	0.06631	0.2042:0.1265:0.0:0.6693	.	225;225;403	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	S	403;225	ENSP00000365528:A403S;ENSP00000263434:A225S	ENSP00000263434:A225S	A	-	1	0	PTPRH	60403629	0.492000	0.26027	0.832000	0.32986	0.065000	0.16274	0.235000	0.17948	0.115000	0.18071	-1.226000	0.01582	GCC		0.537	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1			Missense_Mutation
GPR113	165082	broad.mit.edu	37	2	26534166	26534166	+	Silent	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr2:26534166G>A	ENST00000311519.1	-	11	2429	c.2430C>T	c.(2428-2430)gcC>gcT	p.A810A	GPR113_ENST00000333478.6_Silent_p.A611A|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000421160.2_Silent_p.A741A|GPR113_ENST00000541401.1_Silent_p.A413A	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	810					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A611A(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGCAGGGCGGCGTGGCGGA	0.622																																																1	Substitution - coding silent(1)	ovary(1)	2											67.0	53.0	57.0					2																	26534166		2203	4300	6503	26387670	SO:0001819	synonymous_variant	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2430C>T	2.37:g.26534166G>A		Unknown		x	x	x	26387670	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	ENST00000311519.1	37	CCDS46239.1	SNP	39	Broad																																																																																				0.622	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835		Silent
TTN	7273	broad.mit.edu	37	2	179397562	179397562	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr2:179397562G>A	ENST00000591111.1	-	308	99081	c.98857C>T	c.(98857-98859)Cgc>Tgc	p.R32953C	TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R25529C|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R34594C|TTN_ENST00000342992.6_Missense_Mutation_p.R32026C|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R25721C|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R25654C|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000591867.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32953			R -> H. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R25529C(1)|p.R32024C(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGCGGATGCGCTTGGGTCGT	0.448																																																2	Substitution - Missense(2)	ovary(2)	2											108.0	102.0	104.0					2																	179397562		1987	4166	6153	179105808	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98857C>T	2.37:g.179397562G>A	ENSP00000465570:p.Arg32953Cys	Unknown		x	x	x	179105808	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121421	0.77436	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.01;-0.03;-0.04	5.81	5.81	0.92471	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.73353	0.3576	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.76785	-0.2831	9	0.87932	D	0	.	19.6737	0.95921	0.0:0.0:1.0:0.0	.	25529;25654;25721;32953	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	32026;25529;25721;25654;25526	ENSP00000343764:R32026C;ENSP00000434586:R25529C;ENSP00000340554:R25721C;ENSP00000352154:R25654C	ENSP00000340554:R25721C	R	-	1	0	TTN	179105808	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.837000	0.99465	2.757000	0.94681	0.462000	0.41574	CGC		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179456052	179456052	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1505-01	TCGA-13-1505-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr2:179456052A>T	ENST00000591111.1	-	254	55701	c.55477T>A	c.(55477-55479)Tca>Aca	p.S18493T	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S11069T|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S20134T|TTN_ENST00000342992.6_Missense_Mutation_p.S17566T|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S11261T|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S11194T			Q8WZ42	TITIN_HUMAN	titin	18493	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S11069T(1)|p.S17564T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTAAGTACTGATGAGAAGTTG	0.428																																																2	Substitution - Missense(2)	ovary(2)	2											342.0	338.0	339.0					2																	179456052		1923	4135	6058	179164298	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55477T>A	2.37:g.179456052A>T	ENSP00000465570:p.Ser18493Thr	Somatic		x	x	x	179164298	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096242	0.56075	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	6.11	6.11	0.99139	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28433	0.0703	N	0.16266	0.395	0.39296	D	0.964827	B;B;B;B	0.13145	0.002;0.002;0.002;0.007	B;B;B;B	0.12837	0.008;0.008;0.008;0.008	T	0.13980	-1.0489	9	0.87932	D	0	.	10.0946	0.42466	0.7539:0.0:0.0:0.2461	.	11069;11194;11261;18493	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	17566;11069;11261;11194;11067	ENSP00000343764:S17566T;ENSP00000434586:S11069T;ENSP00000340554:S11261T;ENSP00000352154:S11194T	ENSP00000340554:S11261T	S	-	1	0	TTN	179164298	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.727000	0.74764	2.343000	0.79666	0.533000	0.62120	TCA		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
RQCD1	9125	broad.mit.edu	37	2	219447753	219447753	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr2:219447753C>A	ENST00000273064.6	+	3	639	c.264C>A	c.(262-264)aaC>aaA	p.N88K	RQCD1_ENST00000295701.5_Missense_Mutation_p.N88K|RQCD1_ENST00000509807.2_Missense_Mutation_p.N88K|RQCD1_ENST00000542068.1_Missense_Mutation_p.N88K	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	88					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N88K(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCAGTCTAACAGAGTTTGCA	0.393																																																1	Substitution - Missense(1)	ovary(1)	2											150.0	133.0	138.0					2																	219447753		2203	4300	6503	219155997	SO:0001583	missense	9125			D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.264C>A	2.37:g.219447753C>A	ENSP00000273064:p.Asn88Lys	Unknown		x	x	x	219155997	B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Missense_Mutation	SNP	ENST00000273064.6	37	CCDS33379.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308003	0.81247	.	.	ENSG00000144580	ENST00000273064;ENST00000509807;ENST00000542068;ENST00000295701	T;T;T;T	0.47528	0.84;0.89;0.84;0.84	6.08	4.27	0.50696	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76162	0.3949	H	0.95437	3.67	0.80722	D	1	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.73708	0.969;0.969;0.981	D	0.83365	0.0004	10	0.59425	D	0.04	-0.1165	13.604	0.62037	0.0:0.8724:0.0:0.1276	.	88;88;88	B7Z1E5;Q92600;B5MDQ4	.;RCD1_HUMAN;.	K	88	ENSP00000273064:N88K;ENSP00000441357:N88K;ENSP00000443687:N88K;ENSP00000295701:N88K	ENSP00000273064:N88K	N	+	3	2	RQCD1	219155997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.762000	0.38451	1.586000	0.49944	0.655000	0.94253	AAC		0.393	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336920.1	NM_005444		Missense_Mutation
HUNK	30811	broad.mit.edu	37	21	33368136	33368136	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr21:33368136C>T	ENST00000270112.2	+	10	1721	c.1361C>T	c.(1360-1362)tCc>tTc	p.S454F	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	454					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S454F(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CGACCATTCTCCAAGAAGTTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	21											74.0	75.0	74.0					21																	33368136		2203	4300	6503	32290007	SO:0001583	missense	30811			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1361C>T	21.37:g.33368136C>T	ENSP00000270112:p.Ser454Phe	Somatic		x	x	x	32290007		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	17.89	3.498862	0.64298	.	.	ENSG00000142149	ENST00000270112;ENST00000439107	T	0.69306	-0.39	4.34	3.46	0.39613	.	0.539167	0.18387	N	0.142780	T	0.56140	0.1965	N	0.19112	0.55	0.32268	N	0.569298	D	0.56521	0.976	P	0.47744	0.556	T	0.65903	-0.6055	10	0.72032	D	0.01	-12.0824	10.547	0.45066	0.0:0.9104:0.0:0.0896	.	454	P57058	HUNK_HUMAN	F	454;68	ENSP00000270112:S454F	ENSP00000270112:S454F	S	+	2	0	HUNK	32290007	1.000000	0.71417	0.965000	0.40720	0.987000	0.75469	4.592000	0.61027	1.044000	0.40200	0.655000	0.94253	TCC		0.458	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586		Missense_Mutation
GSTT1	2952	broad.mit.edu	37	22	24376834	24376834	+	Silent	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr22:24376834C>T	ENST00000248935.5	-	4	568	c.516G>A	c.(514-516)acG>acA	p.T172T	KB-226F1.1_ENST00000608619.1_RNA|GSTT1_ENST00000439996.2_Silent_p.T54T	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN		172	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)	p.T172T(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	GCATCAGCTCCGTGATGGCTA	0.572									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																																							1	Substitution - coding silent(1)	ovary(1)	22											85.0	58.0	67.0					22																	24376834		1706	3603	5309	22706834	SO:0001819	synonymous_variant	2952	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML																												ENST00000248935.5:c.516G>A	22.37:g.24376834C>T		Unknown		x	x	x	22706834	O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Silent	SNP	ENST00000248935.5	37	CCDS13822.1	SNP	23	Broad																																																																																				0.572	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320184.2			Silent
C3orf20	84077	broad.mit.edu	37	3	14803007	14803007	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr3:14803007G>T	ENST00000253697.3	+	15	2832	c.2380G>T	c.(2380-2382)Ggg>Tgg	p.G794W	C3orf20_ENST00000435614.1_Missense_Mutation_p.G672W|C3orf20_ENST00000412910.1_Missense_Mutation_p.G672W	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	794						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.G794W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GCTCATTTTTGGGGGCCGTGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											67.0	70.0	69.0					3																	14803007		2203	4300	6503	14778011	SO:0001583	missense	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2380G>T	3.37:g.14803007G>T	ENSP00000253697:p.Gly794Trp	Unknown		x	x	x	14778011	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576304	0.65878	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.11063	3.09;2.81;2.81	4.64	4.64	0.57946	.	0.000000	0.49305	D	0.000156	T	0.31638	0.0803	M	0.72479	2.2	0.44417	D	0.997333	D;D	0.71674	0.998;0.998	D;D	0.72075	0.976;0.976	T	0.04440	-1.0951	10	0.87932	D	0	-19.1268	14.795	0.69870	0.0:0.0:1.0:0.0	.	672;794	Q8ND61-2;Q8ND61	.;CC020_HUMAN	W	794;672;672	ENSP00000253697:G794W;ENSP00000402933:G672W;ENSP00000396081:G672W	ENSP00000253697:G794W	G	+	1	0	C3orf20	14778011	1.000000	0.71417	0.997000	0.53966	0.841000	0.47740	5.433000	0.66520	2.280000	0.76307	0.591000	0.81541	GGG		0.502	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		Missense_Mutation
CADPS	8618	broad.mit.edu	37	3	62739418	62739419	+	Missense_Mutation	DNP	TG	TG	CA			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr3:62739418_62739419TG>CA	ENST00000383710.4	-	3	934_935	c.585_586CA>TG	c.(583-588)cgCAtg>cgTGtg	p.M196V	CADPS_ENST00000283269.9_Missense_Mutation_p.M196V|CADPS_ENST00000357948.3_Missense_Mutation_p.M196V|CADPS_ENST00000490353.2_Missense_Mutation_p.M196V	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	196					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.M196V(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CTCTGAACCATGCGGGCCACAC	0.574																																																1	Substitution - Missense(1)	ovary(1)	3																																								62714459	SO:0001583	missense	8618			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.585_586delinsCA	3.37:g.62739418_62739419delinsCA	ENSP00000373215:p.Met196Val	Unknown		x	x	x	62714458	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	DNP	ENST00000383710.4	37	CCDS46858.1	DNP	51	Broad																																																																																				0.574	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		Missense_Mutation
GBE1	2632	broad.mit.edu	37	3	81586152	81586152	+	Silent	SNP	G	G	A	rs373148836		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr3:81586152G>A	ENST00000429644.2	-	13	2356	c.1713C>T	c.(1711-1713)gaC>gaT	p.D571D	GBE1_ENST00000489715.1_Silent_p.D530D	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	571					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.D571D(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		GAAGGTCGTCGTCAGTTAAAT	0.408									Glycogen Storage Disease, type IV				G|||	1	0.000199681	0.0008	0.0	5008	,	,		16628	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						G		3,3675		0,3,1836	109.0	105.0	106.0		1713	1.5	1.0	3		106	0,8176		0,0,4088	no	coding-synonymous	GBE1	NM_000158.3		0,3,5924	AA,AG,GG		0.0,0.0816,0.0253		571/703	81586152	3,11851	1839	4088	5927	81668842	SO:0001819	synonymous_variant	2632	Familial Cancer Database	Andersen Disease, Brancher deficiency		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1713C>T	3.37:g.81586152G>A		Unknown		x	x	x	81668842	B3KWV3|Q96EN0	Silent	SNP	ENST00000429644.2	37	CCDS54612.1	SNP	40	Broad																																																																																				0.408	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352760.2			Silent
HTT	3064	broad.mit.edu	37	4	3208354	3208354	+	Silent	SNP	C	C	T	rs201305332		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr4:3208354C>T	ENST00000355072.5	+	43	5995	c.5850C>T	c.(5848-5850)agC>agT	p.S1950S		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1950					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.S1950S(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTGCTGCCAGCGGCCTGTTCA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	4						C		0,3920		0,0,1960	71.0	72.0	71.0		5850	-5.7	0.8	4		71	1,8291		0,1,4145	no	coding-synonymous	HTT	NM_002111.6		0,1,6105	TT,TC,CC		0.0121,0.0,0.0082		1950/3143	3208354	1,12211	1960	4146	6106	3178152	SO:0001819	synonymous_variant	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5850C>T	4.37:g.3208354C>T		Unknown		x	x	x	3178152	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1	SNP	27	Broad																																																																																				0.493	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111		Silent
FAT4	79633	broad.mit.edu	37	4	126240977	126240977	+	Silent	SNP	T	T	C			TCGA-13-1505-01	TCGA-13-1505-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr4:126240977T>C	ENST00000394329.3	+	1	3424	c.3411T>C	c.(3409-3411)taT>taC	p.Y1137Y		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1137	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y1137Y(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAGTAAGGTATTCTTTTGAAA	0.433																																																2	Substitution - coding silent(2)	ovary(2)	4											170.0	169.0	169.0					4																	126240977		1888	4123	6011	126460427	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3411T>C	4.37:g.126240977T>C		Somatic		x	x	x	126460427	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3	SNP	52	Broad																																																																																				0.433	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		Silent
FAT4	79633	broad.mit.edu	37	4	126372410	126372410	+	Silent	SNP	C	C	A			TCGA-13-1505-01	TCGA-13-1505-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr4:126372410C>A	ENST00000394329.3	+	9	10252	c.10239C>A	c.(10237-10239)atC>atA	p.I3413I	FAT4_ENST00000335110.5_Silent_p.I1711I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3413	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I3413I(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTGTGCAGATCAGTGAAGGGG	0.463																																																2	Substitution - coding silent(2)	ovary(2)	4											164.0	159.0	160.0					4																	126372410		2203	4300	6503	126591860	SO:0001819	synonymous_variant	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10239C>A	4.37:g.126372410C>A		Somatic		x	x	x	126591860	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3	SNP	29	Broad																																																																																				0.463	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		Silent
ARL15	54622	broad.mit.edu	37	5	53606279	53606279	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr5:53606279G>C	ENST00000504924.1	-	1	124	c.31C>G	c.(31-33)Ctg>Gtg	p.L11V	ARL15_ENST00000507646.2_Missense_Mutation_p.L11V|ARL15_ENST00000502271.1_5'UTR|ARL15_ENST00000510591.2_5'Flank	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	11					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)	p.L11V(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				TCCATGTAcagaaacgcctca	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											47.0	52.0	51.0					5																	53606279		1929	4141	6070	53642036	SO:0001583	missense	54622			BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.31C>G	5.37:g.53606279G>C	ENSP00000433427:p.Leu11Val	Unknown		x	x	x	53642036	Q6IAD0	Missense_Mutation	SNP	ENST00000504924.1	37	CCDS54850.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300902	0.40694	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;T	0.65732	0.19;-0.17	4.76	4.76	0.60689	.	.	.	.	.	T	0.54078	0.1836	L	0.38175	1.15	0.27162	N	0.961136	B	0.02656	0.0	B	0.01281	0.0	T	0.51450	-0.8704	9	0.72032	D	0.01	.	13.4452	0.61136	0.0:0.0:1.0:0.0	.	11	Q9NXU5	ARL15_HUMAN	V	11	ENSP00000433427:L11V;ENSP00000432680:L11V	ENSP00000433427:L11V	L	-	1	2	ARL15	53642036	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.276000	0.58933	2.609000	0.88269	0.655000	0.94253	CTG		0.582	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368432.2	NM_019087		Missense_Mutation
GRIA1	2890	broad.mit.edu	37	5	153078456	153078456	+	Silent	SNP	C	C	T	rs142814149		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr5:153078456C>T	ENST00000285900.5	+	10	1618	c.1275C>T	c.(1273-1275)aaC>aaT	p.N425N	GRIA1_ENST00000518142.1_Silent_p.N345N|GRIA1_ENST00000518783.1_Silent_p.N435N|GRIA1_ENST00000448073.4_Silent_p.N435N|GRIA1_ENST00000521843.2_Silent_p.N356N|GRIA1_ENST00000340592.5_Silent_p.N425N	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	425					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.N425N(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TCAAGAAGAACGCCAATCAGT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		20845	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	5						C	,	2,4404	4.2+/-10.8	0,2,2201	131.0	112.0	118.0		1275,1275	-1.8	1.0	5	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	,	425/907,425/907	153078456	3,13003	2203	4300	6503	153058649	SO:0001819	synonymous_variant	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1275C>T	5.37:g.153078456C>T		Unknown		x	x	x	153058649	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1	SNP	19	Broad																																																																																				0.517	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			Silent
ITK	3702	broad.mit.edu	37	5	156665131	156665131	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1505-01	TCGA-13-1505-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr5:156665131G>C	ENST00000422843.3	+	9	933	c.781G>C	c.(781-783)Gcc>Ccc	p.A261P	AC010609.1_ENST00000410154.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	261	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.A261P(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CAAAGAAGGAGCCTTCATGGT	0.488			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)	5											162.0	130.0	141.0					5																	156665131		2203	4300	6503	156597709	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.781G>C	5.37:g.156665131G>C	ENSP00000398655:p.Ala261Pro	Somatic		x	x	x	156597709	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548132	0.86022	.	.	ENSG00000113263	ENST00000422843	D	0.89196	-2.48	5.6	4.72	0.59763	SH2 motif (5);	0.103535	0.64402	D	0.000003	D	0.95023	0.8389	M	0.89601	3.045	0.53005	D	0.999965	D	0.76494	0.999	D	0.71656	0.974	D	0.95676	0.8728	10	0.72032	D	0.01	.	14.2097	0.65756	0.0717:0.0:0.9283:0.0	.	261	Q08881	ITK_HUMAN	P	261	ENSP00000398655:A261P	ENSP00000398655:A261P	A	+	1	0	ITK	156597709	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.603000	0.82811	1.360000	0.45960	0.561000	0.74099	GCC		0.488	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Missense_Mutation
NME8	51314	broad.mit.edu	37	7	37916520	37916520	+	Missense_Mutation	SNP	C	C	T	rs570286756		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr7:37916520C>T	ENST00000199447.4	+	12	1277	c.905C>T	c.(904-906)gCt>gTt	p.A302V	NME8_ENST00000440017.1_Missense_Mutation_p.A302V|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	302					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)	p.A302V(1)									TTCATGGATGCTTTCTTCCCC	0.358																																																1	Substitution - Missense(1)	ovary(1)	7											64.0	65.0	65.0					7																	37916520		2203	4299	6502	37883045	SO:0001583	missense	51314			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.905C>T	7.37:g.37916520C>T	ENSP00000199447:p.Ala302Val	Unknown		x	x	x	37883045	Q9NZH1	Missense_Mutation	SNP	ENST00000199447.4	37	CCDS5452.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	0	-2.740754	0.00088	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.41065	1.01;1.01	3.91	-0.122	0.13531	.	1.371750	0.04936	N	0.457791	T	0.19644	0.0472	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19128	-1.0315	10	0.16896	T	0.51	-1.5184	7.553	0.27808	0.0:0.1969:0.0:0.8031	.	302	Q8N427	TXND3_HUMAN	V	302	ENSP00000199447:A302V;ENSP00000397063:A302V	ENSP00000199447:A302V	A	+	2	0	TXNDC3	37883045	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.242000	0.18087	0.026000	0.15269	-1.891000	0.00535	GCT		0.358	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616		Missense_Mutation
COL22A1	169044	broad.mit.edu	37	8	139688816	139688816	+	Silent	SNP	C	C	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr8:139688816C>A	ENST00000303045.6	-	41	3581	c.3135G>T	c.(3133-3135)ggG>ggT	p.G1045G	COL22A1_ENST00000435777.1_Silent_p.G1025G|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1045	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1045G(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGCCAGCAACCCCAATGCCTG	0.512										HNSCC(7;0.00092)																																						1	Substitution - coding silent(1)	ovary(1)	8											36.0	35.0	35.0					8																	139688816		2188	4280	6468	139757998	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3135G>T	8.37:g.139688816C>A		Unknown		x	x	x	139757998	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	22	Broad																																																																																				0.512	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Silent
KANK1	23189	broad.mit.edu	37	9	712652	712652	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr9:712652G>A	ENST00000382303.1	+	7	2538	c.1886G>A	c.(1885-1887)gGt>gAt	p.G629D	KANK1_ENST00000382297.2_Missense_Mutation_p.G629D|KANK1_ENST00000382293.3_Missense_Mutation_p.G471D|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	629					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)	p.G471D(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CGGTCTATCGGTTGTGGAGAT	0.547																																																1	Substitution - Missense(1)	ovary(1)	9											102.0	84.0	90.0					9																	712652		2203	4300	6503	702652	SO:0001583	missense	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1886G>A	9.37:g.712652G>A	ENSP00000371740:p.Gly629Asp	Unknown		x	x	x	702652	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	CCDS34976.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770091	0.69992	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.55760	0.5;0.5;0.54	5.97	5.05	0.67936	.	0.108055	0.41001	D	0.000963	T	0.71550	0.3353	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.985;0.965	T	0.74031	-0.3795	10	0.87932	D	0	-31.3317	16.9104	0.86139	0.0:0.1277:0.8723:0.0	.	629;629	Q5W0W1;Q14678	.;KANK1_HUMAN	D	629;629;629;471	ENSP00000371740:G629D;ENSP00000371734:G629D;ENSP00000371730:G471D	ENSP00000346479:G629D	G	+	2	0	KANK1	702652	1.000000	0.71417	0.715000	0.30552	0.968000	0.65278	5.290000	0.65661	2.836000	0.97738	0.655000	0.94253	GGT		0.547	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158		Missense_Mutation
COL27A1	85301	broad.mit.edu	37	9	117063983	117063983	+	Missense_Mutation	SNP	C	C	T	rs139690392		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr9:117063983C>T	ENST00000356083.3	+	55	5222	c.4831C>T	c.(4831-4833)Cgg>Tgg	p.R1611W		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1611	Collagen-like 16.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.R1611W(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CCCCAGAGGGCGGCCCGGCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	9											33.0	36.0	35.0					9																	117063983		2203	4299	6502	116103804	SO:0001583	missense	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4831C>T	9.37:g.117063983C>T	ENSP00000348385:p.Arg1611Trp	Unknown		x	x	x	116103804	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311561	0.40895	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.94376	-3.41	5.47	2.56	0.30785	.	.	.	.	.	D	0.91392	0.7284	L	0.46670	1.46	0.09310	N	1	D	0.61697	0.99	P	0.48114	0.567	T	0.83212	-0.0073	9	0.66056	D	0.02	.	9.0691	0.36482	0.0:0.6242:0.2964:0.0794	.	1611	Q8IZC6	CORA1_HUMAN	W	1611	ENSP00000348385:R1611W	ENSP00000348385:R1611W	R	+	1	2	COL27A1	116103804	0.980000	0.34600	0.245000	0.24217	0.867000	0.49689	2.915000	0.48805	0.249000	0.21456	0.462000	0.41574	CGG		0.617	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888		Missense_Mutation
ZNF41	7592	broad.mit.edu	37	X	47307087	47307087	+	Silent	SNP	A	A	G	rs147527536		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:47307087A>G	ENST00000377065.4	-	5	2721	c.2082T>C	c.(2080-2082)ggT>ggC	p.G694G	ZNF41_ENST00000313116.7_Silent_p.G694G|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Silent_p.G704G	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	736					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G694G(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				TCCCGCAGTCACCACATTCAT	0.428																																																1	Substitution - coding silent(1)	ovary(1)	X						A	,	0,3835		0,0,1632,571	108.0	97.0	101.0		2082,2082	3.7	1.0	X	dbSNP_134	101	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous	ZNF41	NM_007130.2,NM_153380.2	,	0,1,4059,2443	GG,GA,AA,A		0.0149,0.0,0.0095	,	694/780,694/780	47307087	1,10562	2203	4300	6503	47192031	SO:0001819	synonymous_variant	7592			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.2082T>C	X.37:g.47307087A>G		Unknown		x	x	x	47192031	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Silent	SNP	ENST00000377065.4	37	CCDS14279.1	SNP	6	Broad																																																																																				0.428	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380		Silent
UBQLN2	29978	broad.mit.edu	37	X	56590390	56590390	+	Silent	SNP	T	T	G			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:56590390T>G	ENST00000338222.5	+	1	365	c.84T>G	c.(82-84)gcT>gcG	p.A28A		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	28					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A28A(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						CTGCCCCGGCTGAGCCTAAAA	0.642																																					Esophageal Squamous(104;218 1492 6022 10838 28884)											1	Substitution - coding silent(1)	ovary(1)	X											5.0	5.0	5.0					X																	56590390		1999	3898	5897	56607115	SO:0001819	synonymous_variant	29978			AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.84T>G	X.37:g.56590390T>G		Unknown		x	x	x	56607115	O94798|Q5D027|Q9H3W6|Q9HAZ4	Silent	SNP	ENST00000338222.5	37	CCDS14374.1	SNP	55	Broad																																																																																				0.642	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444		Silent
ARMCX2	9823	broad.mit.edu	37	X	100911587	100911587	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:100911587C>T	ENST00000328766.5	-	5	1441	c.988G>A	c.(988-990)Gct>Act	p.A330T	ARMCX2_ENST00000330154.2_Missense_Mutation_p.A330T|ARMCX2_ENST00000356824.4_Missense_Mutation_p.A330T|ARMCX2_ENST00000467416.1_5'Flank	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	330						integral component of membrane (GO:0016021)		p.A330T(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						GCCAGGAAAGCCTGTCCGCCA	0.592																																																1	Substitution - Missense(1)	ovary(1)	X											59.0	65.0	63.0					X																	100911587		2203	4300	6503	100798243	SO:0001583	missense	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.988G>A	X.37:g.100911587C>T	ENSP00000331662:p.Ala330Thr	Somatic		x	x	x	100798243	O60267|Q5H9D9	Missense_Mutation	SNP	ENST00000328766.5	37	CCDS14490.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899650	0.52227	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.37235	1.21;1.21;1.21	3.66	3.66	0.41972	.	0.402017	0.22417	N	0.060330	T	0.26340	0.0643	N	0.19112	0.55	0.30208	N	0.797963	D	0.58268	0.982	P	0.49853	0.624	T	0.03017	-1.1082	10	0.10111	T	0.7	-10.7028	9.8985	0.41334	0.0:1.0:0.0:0.0	.	330	Q7L311	ARMX2_HUMAN	T	330	ENSP00000331662:A330T;ENSP00000328631:A330T;ENSP00000349281:A330T	ENSP00000331662:A330T	A	-	1	0	ARMCX2	100798243	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	3.808000	0.55598	2.086000	0.62901	0.422000	0.28245	GCT		0.592	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057586.1	NM_014782		Missense_Mutation
UPF3B	65109	broad.mit.edu	37	X	118971920	118971920	+	Missense_Mutation	SNP	G	G	A	rs374676402		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:118971920G>A	ENST00000276201.2	-	10	1171	c.1102C>T	c.(1102-1104)Cgg>Tgg	p.R368W	UPF3B_ENST00000478840.1_5'Flank|UPF3B_ENST00000345865.2_Missense_Mutation_p.R355W	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	368	Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R368W(2)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						TCTTCTTGCCGCTTCAGCCTC	0.468																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	X						G	TRP/ARG,TRP/ARG	0,3835		0,0,1632,571	149.0	127.0	135.0		1063,1102	5.6	1.0	X		135	1,6727		0,1,2427,1872	no	missense,missense	UPF3B	NM_023010.3,NM_080632.2	101,101	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging,probably-damaging	355/471,368/484	118971920	1,10562	2203	4300	6503	118855948	SO:0001583	missense	65109			AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.1102C>T	X.37:g.118971920G>A	ENSP00000276201:p.Arg368Trp	Unknown		x	x	x	118855948	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	37	CCDS14588.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493909	0.64186	0.0	1.49E-4	ENSG00000125351	ENST00000276201;ENST00000345865	T;T	0.79845	-1.24;-1.31	5.59	5.59	0.84812	.	0.215397	0.47852	D	0.000211	D	0.85725	0.5763	M	0.63843	1.955	0.51012	D	0.999902	D;D	0.89917	1.0;0.999	D;P	0.65233	0.933;0.858	D	0.84979	0.0887	10	0.40728	T	0.16	.	10.7285	0.46083	0.0892:0.0:0.9108:0.0	.	355;368	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	W	368;355	ENSP00000276201:R368W;ENSP00000245418:R355W	ENSP00000276201:R368W	R	-	1	2	UPF3B	118855948	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.458000	0.45014	2.360000	0.80028	0.526000	0.51066	CGG		0.468	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1			Missense_Mutation
ELF4	2000	broad.mit.edu	37	X	129203384	129203384	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:129203384G>A	ENST00000308167.5	-	8	1457	c.1078C>T	c.(1078-1080)Cca>Tca	p.P360S	ELF4_ENST00000335997.7_Missense_Mutation_p.P360S	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)									p.P360S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CTCGCAGATGGCTGGAGACCG	0.597			T	ERG	AML																																		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	1	Substitution - Missense(1)	ovary(1)	X											120.0	114.0	116.0					X																	129203384		2203	4300	6503	129031065	SO:0001583	missense	2000			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1078C>T	X.37:g.129203384G>A	ENSP00000311280:p.Pro360Ser	Somatic		x	x	x	129031065		Missense_Mutation	SNP	ENST00000308167.5	37	CCDS14617.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	8.692	0.907693	0.17833	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.20881	2.04;2.04	5.49	2.62	0.31277	.	0.436377	0.22869	N	0.054657	T	0.13372	0.0324	L	0.32530	0.975	0.36413	D	0.863822	B	0.12630	0.006	B	0.13407	0.009	T	0.12451	-1.0547	10	0.29301	T	0.29	.	5.699	0.17871	0.1926:0.1595:0.6479:0.0	.	360	Q99607	ELF4_HUMAN	S	360	ENSP00000338608:P360S;ENSP00000311280:P360S	ENSP00000311280:P360S	P	-	1	0	ELF4	129031065	1.000000	0.71417	0.849000	0.33467	0.215000	0.24574	1.798000	0.38814	0.607000	0.29982	-0.204000	0.12730	CCA		0.597	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058243.1	NM_001421		Missense_Mutation
FMR1	2332	broad.mit.edu	37	X	147024700	147024700	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:147024700G>A	ENST00000370475.4	+	14	1453	c.1325G>A	c.(1324-1326)cGa>cAa	p.R442Q	FMR1_ENST00000370477.1_Missense_Mutation_p.R421Q|FMR1_ENST00000439526.2_Missense_Mutation_p.R419Q|FMR1_ENST00000370470.1_Missense_Mutation_p.R442Q|FMR1_ENST00000440235.2_Missense_Mutation_p.R89Q|FMR1_ENST00000218200.8_Missense_Mutation_p.R421Q|FMR1_ENST00000492846.1_3'UTR|FMR1_ENST00000370471.3_Intron	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	442	Interaction with RANBP9.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R442Q(1)		NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCAGTTGCGACAGATTGGA	0.368									Fragile X syndrome																																							1	Substitution - Missense(1)	ovary(1)	X											175.0	153.0	160.0					X																	147024700		2203	4300	6503	146832392	SO:0001583	missense	2332	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1325G>A	X.37:g.147024700G>A	ENSP00000359506:p.Arg442Gln	Unknown		x	x	x	146832392	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	CCDS14682.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425004	0.83667	.	.	ENSG00000102081	ENST00000218200;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470;ENST00000440235	T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34	5.73	5.73	0.89815	.	0.118192	0.56097	D	0.000027	T	0.70404	0.3220	L	0.58810	1.83	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.996;1.0;0.999	D;D;D;D;D	0.91635	0.99;0.999;0.957;0.998;0.993	T	0.71606	-0.4542	10	0.59425	D	0.04	-10.4141	17.7241	0.88360	0.0:0.0:1.0:0.0	.	89;442;337;421;419	F8W871;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	Q	421;421;442;419;442;89	ENSP00000218200:R421Q;ENSP00000359508:R421Q;ENSP00000359506:R442Q;ENSP00000395923:R419Q;ENSP00000359501:R442Q;ENSP00000413764:R89Q	ENSP00000218200:R421Q	R	+	2	0	FMR1	146832392	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.866000	0.92307	2.404000	0.81709	0.600000	0.82982	CGA		0.368	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024		Missense_Mutation
L1CAM	3897	broad.mit.edu	37	X	153130812	153130812	+	Silent	SNP	G	G	T			TCGA-13-1505-01	TCGA-13-1505-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:153130812G>T	ENST00000370060.1	-	21	2880	c.2691C>A	c.(2689-2691)gcC>gcA	p.A897A	L1CAM_ENST00000370057.3_Silent_p.A897A|L1CAM_ENST00000370055.1_Silent_p.A892A|L1CAM_ENST00000543994.1_Silent_p.A899A|L1CAM_ENST00000361981.3_Silent_p.A892A|L1CAM_ENST00000538883.1_Silent_p.A899A|L1CAM_ENST00000361699.4_Silent_p.A897A	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	897	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.A897A(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCCGTTAAAGGCCTGCACCT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	X											96.0	82.0	87.0					X																	153130812		2203	4300	6503	152784006	SO:0001819	synonymous_variant	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2691C>A	X.37:g.153130812G>T		Somatic		x	x	x	152784006	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	ENST00000370060.1	37	CCDS14733.1	SNP	35	Broad																																																																																				0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		Silent
GAB3	139716	broad.mit.edu	37	X	153944597	153944597	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chrX:153944597C>T	ENST00000369575.3	-	2	111	c.80G>A	c.(79-81)cGc>cAc	p.R27H	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.R27H	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	27	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				macrophage differentiation (GO:0030225)			p.R27H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCAGCGCTTGCGCCAGGCCTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											31.0	30.0	30.0					X																	153944597		2203	4300	6503	153597791	SO:0001583	missense	139716			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.80G>A	X.37:g.153944597C>T	ENSP00000358588:p.Arg27His	Unknown		x	x	x	153597791	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206403	0.79127	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.74106	-0.81;-0.81;-0.81	5.04	5.04	0.67666	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	L	0.53561	1.675	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.85050	0.0928	10	0.87932	D	0	3.8438	14.8115	0.70000	0.0:1.0:0.0:0.0	.	27;27;27	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	H	27	ENSP00000358588:R27H;ENSP00000358581:R27H;ENSP00000399588:R27H	ENSP00000358581:R27H	R	-	2	0	GAB3	153597791	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.831000	0.55776	2.079000	0.62486	0.529000	0.55759	CGC		0.542	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573		Missense_Mutation
KRT6C	286887	broad.mit.edu	37	12	52867342	52867342	+	Frame_Shift_Del	DEL	A	A	-	rs556681459|rs33998545	byFrequency	TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr12:52867342delA	ENST00000252250.6	-	1	227	c.180delT	c.(178-180)agtfs	p.S60fs		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	60	Head.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.L61fs*85(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		GGCCATACAGACTGCGGCTGC	0.652																																																1	Deletion - Frameshift(1)	ovary(1)	12								154,2504		43,68,1218	3.0	4.0	3.0			2.1	0.4	12	dbSNP_126	3	1853,3993		542,769,1612	no	frameshift	KRT6C	NM_173086.4		585,837,2830	A1A1,A1R,RR		31.6969,5.7938,23.6007			52867342	2007,6497	1511	3227	4738	51153609	SO:0001589	frameshift_variant	286887			L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.180delT	12.37:g.52867342delA	ENSP00000252250:p.Ser60fs	Unknown		Capture	Illumina GAIIx	Phase_I	51153609	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Frame_Shift_Del	DEL	ENST00000252250.6	37	CCDS8829.1	DEL	10	Broad																																																																																				0.652	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404976.1	NM_173086		Frame_Shift_Del
MAP3K9	4293	broad.mit.edu	37	14	71275774	71275776	+	In_Frame_Del	DEL	CCT	CCT	-	rs397840789|rs201322413		TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr14:71275774_71275776delCCT	ENST00000554752.2	-	1	112_114	c.113_115delAGG	c.(112-117)gaggcg>gcg	p.E38del	RP6-65G23.3_ENST00000557691.1_lincRNA|MAP3K9_ENST00000555993.2_In_Frame_Del_p.E38del|MAP3K9_ENST00000381250.4_In_Frame_Del_p.E38del	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	38	Ala-rich.|Poly-Glu.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.E38delE(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GCCGCCGCCGcctcctcctcctc	0.773																																					GBM(114;411 1587 13539 28235 50070)											1	Deletion - In frame(1)	ovary(1)	14																																								70345529	SO:0001651	inframe_deletion	4293			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.113_115delAGG	14.37:g.71275783_71275785delCCT	ENSP00000451612:p.Glu38del	Unknown		Capture	Illumina GAIIx	Phase_I	70345527	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	In_Frame_Del	DEL	ENST00000554752.2	37		DEL	26	Broad																																																																																				0.773	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2			In_Frame_Del
PLD2	5338	broad.mit.edu	37	17	4720262	4720263	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-13-1505-01	TCGA-13-1505-10			-	TG	TG	TG	Unknown	Valid	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:4720262_4720263delTG	ENST00000263088.6	+	16	1744_1745	c.1613_1614delTG	c.(1612-1614)atgfs	p.M538fs	PLD2_ENST00000572940.1_Frame_Shift_Del_p.M538fs	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	538	Catalytic.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.M538fs*102(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	ACCCCTCGGATGCCATGGCGGG	0.624																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								4667229	SO:0001589	frameshift_variant	5338			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1613_1614delTG	17.37:g.4720262_4720263delTG	ENSP00000263088:p.Met538fs	Somatic		Capture	Illumina GAIIx	Phase_I	4667228	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Frame_Shift_Del	DEL	ENST00000263088.6	37	CCDS11057.1	DEL	51	Broad																																																																																				0.624	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663		Frame_Shift_Del
TP53	7157	broad.mit.edu	37	17	7579462	7579462	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-1505-01	TCGA-13-1505-10			-	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:7579462delA	ENST00000269305.4	-	4	414	c.225delT	c.(223-225)cctfs	p.P75fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.P75fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.P75fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P75fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P75fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P75fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	75	Interaction with HRMT1L2.|Interaction with WWOX.		P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.V73fs*9(1)|p.R65fs*38(1)|p.A76fs*47(1)|p.A76fs*73(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)|p.A74fs*71(1)|p.A74fs*47(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTGGTGCAGGGGCCACGG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	21	Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(1)|Insertion - Frameshift(1)	bone(5)|upper_aerodigestive_tract(3)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|prostate(1)|liver(1)	17											73.0	81.0	78.0					17																	7579462		2202	4299	6501	7520187	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.225delT	17.37:g.7579462delA	ENSP00000269305:p.Pro75fs	Somatic		Capture	Illumina GAIIx	Phase_I	7520187	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	7	Broad																																																																																				0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Del
C17orf70	80233	broad.mit.edu	37	17	79512899	79512899	+	Frame_Shift_Del	DEL	A	A	-			TCGA-13-1505-01	TCGA-13-1505-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1505-01	TCGA-13-1505-10	g.chr17:79512899delA	ENST00000327787.8	-	6	2229	c.2183delT	c.(2182-2184)ctgfs	p.L728fs	C17orf70_ENST00000425898.2_Frame_Shift_Del_p.L377fs|C17orf70_ENST00000537152.1_Frame_Shift_Del_p.L577fs			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	728					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L577fs*19(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GGCACAGCACAGGGGCACGCC	0.642																																																1	Deletion - Frameshift(1)	ovary(1)	17											42.0	33.0	36.0					17																	79512899		2199	4300	6499	77123352	SO:0001589	frameshift_variant	80233			BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.2183delT	17.37:g.79512899delA	ENSP00000333283:p.Leu728fs	Unknown		Capture	Illumina GAIIx	Phase_I	77123352	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Frame_Shift_Del	DEL	ENST00000327787.8	37	CCDS32765.2	DEL	7	Broad																																																																																				0.642	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161		Frame_Shift_Del
