#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PRAMEF1	65121	broad.mit.edu	37	1	12854535	12854535	+	Silent	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:12854535A>T	ENST00000332296.7	+	3	862	c.759A>T	c.(757-759)ggA>ggT	p.G253G	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	253					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.G253G(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACTCCAAGGACGGTTAGTTG	0.438																																																2	Substitution - coding silent(2)	ovary(2)	1											158.0	158.0	158.0					1																	12854535		2203	4299	6502	12777122	SO:0001819	synonymous_variant	65121			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.759A>T	1.37:g.12854535A>T		Unknown		x	x	x	12777122	Q9UQP2	Silent	SNP	ENST00000332296.7	37	CCDS148.1	SNP	10	Broad																																																																																				0.438	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013		Silent
FABP3	2170	broad.mit.edu	37	1	31845845	31845845	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1510-01	TCGA-13-1510-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:31845845A>C	ENST00000373713.2	-	1	78	c.17T>G	c.(16-18)cTg>cGg	p.L6R		NM_004102.3	NP_004093.1	P05413	FABPH_HUMAN	fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)	6					cholesterol homeostasis (GO:0042632)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid import (GO:0044539)|negative regulation of cell proliferation (GO:0008285)|phospholipid homeostasis (GO:0055091)|positive regulation of phospholipid biosynthetic process (GO:0071073)|regulation of fatty acid oxidation (GO:0046320)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasm (GO:0016528)	cytoskeletal protein binding (GO:0008092)|icosatetraenoic acid binding (GO:0050543)|long-chain fatty acid binding (GO:0036041)|long-chain fatty acid transporter activity (GO:0005324)|oleic acid binding (GO:0070538)	p.L6R(1)		large_intestine(1)|lung(2)|ovary(2)	5		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)		CCAGGTGCCCAGGAAAGCGTC	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											86.0	74.0	78.0					1																	31845845		2203	4300	6503	31618432	SO:0001583	missense	2170			U57623	CCDS342.1	1p33-p32	2013-03-01	2003-09-10		ENSG00000121769	ENSG00000121769		"""Fatty acid binding protein family"""	3557	protein-coding gene	gene with protein product		134651	"""fatty acid binding protein 11"""	MDGI, FABP11		8661024	Standard	NM_004102		Approved	H-FABP, O-FABP	uc001bss.1	P05413	OTTHUMG00000003797	ENST00000373713.2:c.17T>G	1.37:g.31845845A>C	ENSP00000362817:p.Leu6Arg	Somatic		x	x	x	31618432	B2RAB6|Q5VV93|Q99957	Missense_Mutation	SNP	ENST00000373713.2	37	CCDS342.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429239	0.43122	.	.	ENSG00000121769	ENST00000373713	T	0.46451	0.87	4.71	-0.0626	0.13780	Calycin-like (1);Cytosolic fatty-acid binding (1);Calycin (1);	0.634934	0.15892	N	0.239524	T	0.43299	0.1241	M	0.67397	2.05	0.09310	N	1	B	0.29212	0.237	B	0.38755	0.281	T	0.48875	-0.8996	10	0.72032	D	0.01	.	7.9016	0.29738	0.5094:0.0:0.4906:0.0	.	6	P05413	FABPH_HUMAN	R	6	ENSP00000362817:L6R	ENSP00000362817:L6R	L	-	2	0	FABP3	31618432	0.000000	0.05858	0.246000	0.24233	0.937000	0.57800	-0.525000	0.06214	0.092000	0.17331	0.529000	0.55759	CTG		0.612	FABP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010683.1	NM_004102		Missense_Mutation
FAM46C	54855	broad.mit.edu	37	1	118165807	118165807	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:118165807A>T	ENST00000369448.3	+	2	564	c.317A>T	c.(316-318)cAg>cTg	p.Q106L		NM_017709.3	NP_060179.2	Q5VWP2	FA46C_HUMAN	family with sequence similarity 46, member C	106								p.Q106L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	15	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		GCAGAATTTCAGCTGGTTAGA	0.507			"""Mis, F, O"""		MM					Multiple Myeloma(3;1.13e-06)																													Rec	yes		1	1p12	54855	"""family with sequence similarity 46, member C"""		L	1	Substitution - Missense(1)	ovary(1)	1											112.0	117.0	115.0					1																	118165807		2203	4300	6503	117967330	SO:0001583	missense	54855			BC036516	CCDS896.1	1p12	2008-02-05			ENSG00000183508	ENSG00000183508			24712	protein-coding gene	gene with protein product		613952				12477932	Standard	NM_017709		Approved	FLJ20202	uc001ehe.3	Q5VWP2	OTTHUMG00000013703	ENST00000369448.3:c.317A>T	1.37:g.118165807A>T	ENSP00000358458:p.Gln106Leu	Unknown		x	x	x	117967330	A3KMG2|Q8NE25|Q9NXK0	Missense_Mutation	SNP	ENST00000369448.3	37	CCDS896.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	12.30	1.895961	0.33442	.	.	ENSG00000183508	ENST00000369448	T	0.23950	1.88	5.75	5.75	0.90469	Domain of unknown function DUF1693 (1);	0.086237	0.49916	D	0.000135	T	0.21881	0.0527	M	0.80183	2.485	0.52099	D	0.999949	P	0.37914	0.611	B	0.34652	0.187	T	0.08493	-1.0719	10	0.56958	D	0.05	-21.4511	15.2299	0.73378	1.0:0.0:0.0:0.0	.	106	Q5VWP2	FA46C_HUMAN	L	106	ENSP00000358458:Q106L	ENSP00000358458:Q106L	Q	+	2	0	FAM46C	117967330	1.000000	0.71417	0.997000	0.53966	0.835000	0.47333	5.198000	0.65147	2.189000	0.69895	0.533000	0.62120	CAG		0.507	FAM46C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038424.1	NM_017709		Missense_Mutation
GON4L	54856	broad.mit.edu	37	1	155721913	155721913	+	Nonsense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:155721913G>C	ENST00000368331.1	-	30	6359	c.6311C>G	c.(6310-6312)tCa>tGa	p.S2104*	GON4L_ENST00000437809.1_Nonsense_Mutation_p.S2103*|GON4L_ENST00000271883.5_Nonsense_Mutation_p.S2103*	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	2104					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S2104*(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGAAGTCTCTGAGGTGTCAAT	0.567																																																1	Substitution - Nonsense(1)	ovary(1)	1											62.0	58.0	59.0					1																	155721913		1835	4081	5916	153988537	SO:0001587	stop_gained	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.6311C>G	1.37:g.155721913G>C	ENSP00000357315:p.Ser2104*	Unknown		x	x	x	153988537	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Nonsense_Mutation	SNP	ENST00000368331.1	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	47	12.972963	0.99710	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	.	.	.	4.66	4.66	0.58398	.	0.726277	0.11959	N	0.512887	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	10.2551	0.43392	0.0:0.0:0.8028:0.1972	.	.	.	.	X	2103;2104;2103	.	ENSP00000271883:S2103X	S	-	2	0	GON4L	153988537	0.997000	0.39634	0.598000	0.28837	0.348000	0.29142	2.415000	0.44635	2.439000	0.82584	0.644000	0.83932	TCA		0.567	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292		Nonsense_Mutation
C1orf112	55732	broad.mit.edu	37	1	169816937	169816937	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:169816937C>G	ENST00000286031.6	+	20	2751	c.2051C>G	c.(2050-2052)gCt>gGt	p.A684G	C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Missense_Mutation_p.A684G	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	684								p.A684G(1)		breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					ATACCTGAAGCTATCCAGGTA	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	126.0	128.0					1																	169816937		2202	4300	6502	168083561	SO:0001583	missense	55732			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.2051C>G	1.37:g.169816937C>G	ENSP00000286031:p.Ala684Gly	Unknown		x	x	x	168083561	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	CCDS1285.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	9.320	1.057878	0.19987	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.44083	0.93;0.93	5.76	2.66	0.31614	.	0.452265	0.26421	N	0.024464	T	0.13457	0.0326	L	0.51422	1.61	0.28401	N	0.918649	B;B	0.16166	0.016;0.009	B;B	0.15484	0.013;0.013	T	0.21143	-1.0254	10	0.18710	T	0.47	-2.2297	6.4198	0.21738	0.4163:0.4992:0.0:0.0844	.	626;684	B4DGF2;Q9NSG2	.;CA112_HUMAN	G	684	ENSP00000352276:A684G;ENSP00000286031:A684G	ENSP00000286031:A684G	A	+	2	0	C1orf112	168083561	0.725000	0.28048	0.058000	0.19502	0.973000	0.67179	1.590000	0.36654	0.747000	0.32809	0.655000	0.94253	GCT		0.318	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186		Missense_Mutation
FLVCR1	28982	broad.mit.edu	37	1	213037125	213037125	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:213037125A>C	ENST00000366971.4	+	2	995	c.797A>C	c.(796-798)gAc>gCc	p.D266A		NM_014053.3	NP_054772.1	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular receptor 1	266					blood vessel development (GO:0001568)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|head morphogenesis (GO:0060323)|heme export (GO:0097037)|heme transport (GO:0015886)|in utero embryonic development (GO:0001701)|mitochondrial transport (GO:0006839)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|regulation of organ growth (GO:0046620)|spleen development (GO:0048536)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	heme transporter activity (GO:0015232)|transporter activity (GO:0005215)	p.D266A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(2)	12				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		ACACAGAATGACACAAATCTC	0.373																																					Esophageal Squamous(199;2235 2952 19233 26256)											1	Substitution - Missense(1)	ovary(1)	1											162.0	149.0	154.0					1																	213037125		2203	4300	6503	211103748	SO:0001583	missense	28982			AF118637	CCDS1510.1	1q32.3	2014-05-30			ENSG00000162769	ENSG00000162769		"""Solute carriers"""	24682	protein-coding gene	gene with protein product		609144	"""ataxia, posterior column 1, with retinitis pigmentosa"""	AXPC1		10400745, 10648427, 21070897	Standard	NM_014053		Approved	FLVCR, MFSD7B, PCA	uc001hjt.3	Q9Y5Y0	OTTHUMG00000036924	ENST00000366971.4:c.797A>C	1.37:g.213037125A>C	ENSP00000355938:p.Asp266Ala	Unknown		x	x	x	211103748	Q1HE16|Q86XY9|Q9NVR9	Missense_Mutation	SNP	ENST00000366971.4	37	CCDS1510.1	SNP	10	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.61|14.61	2.585867|2.585867	0.46110|0.46110	.|.	.|.	ENSG00000162769|ENSG00000162769	ENST00000366971|ENST00000419102	T|.	0.63744|.	-0.06|.	5.5|5.5	4.3|4.3	0.51218|0.51218	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.376195|.	0.31636|.	N|.	0.007310|.	T|T	0.71634|0.71634	0.3363|0.3363	M|M	0.73598|0.73598	2.24|2.24	0.45250|0.45250	D|D	0.99825|0.99825	B|.	0.15719|.	0.014|.	B|.	0.23419|.	0.046|.	T|T	0.72440|0.72440	-0.4293|-0.4293	10|5	0.08837|.	T|.	0.75|.	-43.2457|-43.2457	11.485|11.485	0.50348|0.50348	0.8498:0.1502:0.0:0.0|0.8498:0.1502:0.0:0.0	.|.	266|.	Q9Y5Y0|.	FLVC1_HUMAN|.	A|P	266|112	ENSP00000355938:D266A|.	ENSP00000355938:D266A|.	D|T	+|+	2|1	0|0	FLVCR1|FLVCR1	211103748|211103748	0.767000|0.767000	0.28508|0.28508	0.982000|0.982000	0.44146|0.44146	0.806000|0.806000	0.45545|0.45545	3.442000|3.442000	0.52900|0.52900	2.080000|2.080000	0.62538|0.62538	0.455000|0.455000	0.32223|0.32223	GAC|ACA		0.373	FLVCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089678.2	NM_014053		Missense_Mutation
EDARADD	128178	broad.mit.edu	37	1	236645683	236645683	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr1:236645683A>C	ENST00000334232.4	+	6	549	c.382A>C	c.(382-384)Aag>Cag	p.K128Q	EDARADD_ENST00000359362.5_Missense_Mutation_p.K118Q	NM_145861.2	NP_665860.2	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain	128	Death.				cell differentiation (GO:0030154)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	cytoplasm (GO:0005737)		p.K128Q(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|stomach(1)	12	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATCAGGATAAAGCTGGATCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											98.0	93.0	95.0					1																	236645683		2203	4300	6503	234712306	SO:0001583	missense	128178			AY028914	CCDS1610.1, CCDS31065.1	1q42.3	2013-05-22			ENSG00000186197	ENSG00000186197			14341	protein-coding gene	gene with protein product		606603				11780064	Standard	NM_145861		Approved		uc001hxu.1	Q8WWZ3	OTTHUMG00000039954	ENST00000334232.4:c.382A>C	1.37:g.236645683A>C	ENSP00000335076:p.Lys128Gln	Unknown		x	x	x	234712306	A2VCK5|A8K7B5|B1AL54|B9ZVW5|Q5VYJ7	Missense_Mutation	SNP	ENST00000334232.4	37	CCDS1610.1	SNP	1	Broad	.	.	.	.	.	.	.	.	.	.	A	28.8	4.947732	0.92593	.	.	ENSG00000186197	ENST00000334232;ENST00000359362	T;T	0.58940	0.3;0.3	5.22	5.22	0.72569	DEATH-like (2);	0.000000	0.64402	U	0.000001	T	0.65883	0.2734	L	0.32530	0.975	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64002	-0.6509	9	.	.	.	.	15.2696	0.73689	1.0:0.0:0.0:0.0	.	118;128	A8K7B5;Q8WWZ3	.;EDAD_HUMAN	Q	128;118	ENSP00000335076:K128Q;ENSP00000352320:K118Q	.	K	+	1	0	EDARADD	234712306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.753000	0.91637	2.196000	0.70406	0.533000	0.62120	AAG		0.498	EDARADD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096368.1	NM_145861		Missense_Mutation
NEURL1	9148	broad.mit.edu	37	10	105330762	105330762	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr10:105330762G>C	ENST00000369780.4	+	2	628	c.219G>C	c.(217-219)caG>caC	p.Q73H	NEURL_ENST00000369777.2_Missense_Mutation_p.Q56H	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		73	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q73H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AGGGCTCCCAGATCCTCATGG	0.637																																																1	Substitution - Missense(1)	ovary(1)	10											74.0	72.0	73.0					10																	105330762		2203	4300	6503	105320752	SO:0001583	missense	9148																														ENST00000369780.4:c.219G>C	10.37:g.105330762G>C	ENSP00000358795:p.Gln73His	Unknown		x	x	x	105320752	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	37	CCDS7551.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806852	0.70797	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777	.	.	.	5.23	4.31	0.51392	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.66268	0.2772	L	0.41236	1.265	0.58432	D	0.999999	D	0.76494	0.999	D	0.79108	0.992	T	0.66559	-0.5893	9	0.49607	T	0.09	-25.4738	13.1891	0.59700	0.0768:0.0:0.9232:0.0	.	73	O76050	NEU1A_HUMAN	H	73;56;56	.	ENSP00000358792:Q56H	Q	+	3	2	NEURL	105320752	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.724000	0.54962	2.417000	0.82017	0.561000	0.74099	CAG		0.637	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1			Missense_Mutation
PIK3C2A	5286	broad.mit.edu	37	11	17158079	17158079	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:17158079C>T	ENST00000265970.7	-	8	1797	c.1798G>A	c.(1798-1800)Gta>Ata	p.V600I	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.V220I	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	600					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.V600I(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						AGCTTCTTTACTGATTCTGTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	11											126.0	118.0	121.0					11																	17158079		2199	4293	6492	17114655	SO:0001583	missense	5286			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1798G>A	11.37:g.17158079C>T	ENSP00000265970:p.Val600Ile	Unknown		x	x	x	17114655	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291743	0.40594	.	.	ENSG00000011405	ENST00000265970;ENST00000540361;ENST00000544896	T;T	0.66638	-0.22;0.26	5.5	4.58	0.56647	.	0.116052	0.56097	N	0.000022	T	0.64864	0.2637	M	0.68952	2.095	0.58432	D	0.99999	B	0.10296	0.003	B	0.08055	0.003	T	0.62770	-0.6784	10	0.41790	T	0.15	-10.4635	14.3484	0.66682	0.0:0.9289:0.0:0.0711	.	600	O00443	P3C2A_HUMAN	I	600;220;600	ENSP00000265970:V600I;ENSP00000438687:V220I	ENSP00000265970:V600I	V	-	1	0	PIK3C2A	17114655	0.949000	0.32298	1.000000	0.80357	0.995000	0.86356	2.101000	0.41787	1.463000	0.47967	0.561000	0.74099	GTA		0.343	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645		Missense_Mutation
LRP4	4038	broad.mit.edu	37	11	46890610	46890610	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:46890610T>C	ENST00000378623.1	-	32	5008	c.4766A>G	c.(4765-4767)aAc>aGc	p.N1589S	LRP4-AS1_ENST00000531719.1_RNA|LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1589					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)	p.N1589S(1)		breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TGTCTCCTTGTTCCGGCCTGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											223.0	178.0	193.0					11																	46890610		2201	4299	6500	46847186	SO:0001583	missense	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.4766A>G	11.37:g.46890610T>C	ENSP00000367888:p.Asn1589Ser	Unknown		x	x	x	46847186	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	.	17.56	3.420716	0.62622	.	.	ENSG00000134569	ENST00000378623	D	0.91180	-2.8	6.06	1.11	0.20524	Six-bladed beta-propeller, TolB-like (1);	0.100619	0.64402	N	0.000003	D	0.84732	0.5537	L	0.45228	1.405	0.48288	D	0.999627	B	0.19200	0.034	B	0.19148	0.024	T	0.74633	-0.3600	10	0.40728	T	0.16	.	9.8473	0.41034	0.0:0.2551:0.0:0.7449	.	1589	O75096	LRP4_HUMAN	S	1589	ENSP00000367888:N1589S	ENSP00000367888:N1589S	N	-	2	0	LRP4	46847186	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.081000	0.30791	-0.049000	0.13379	0.533000	0.62120	AAC		0.542	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334		Missense_Mutation
FNBP4	23360	broad.mit.edu	37	11	47746282	47746282	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:47746282A>G	ENST00000263773.5	-	13	2069	c.2057T>C	c.(2056-2058)cTc>cCc	p.L686P	Y_RNA_ENST00000363220.1_RNA|snoU13_ENST00000516638.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	686						nucleus (GO:0005634)		p.L686P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						AAGTGGCATGAGTGATGAAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											84.0	83.0	83.0					11																	47746282		1912	4125	6037	47702858	SO:0001583	missense	23360			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2057T>C	11.37:g.47746282A>G	ENSP00000263773:p.Leu686Pro	Unknown		x	x	x	47702858	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584881	0.65992	.	.	ENSG00000109920	ENST00000263773	T	0.15834	2.39	5.25	5.25	0.73442	.	0.244160	0.36066	N	0.002817	T	0.18087	0.0434	L	0.54323	1.7	0.80722	D	1	B	0.18610	0.029	B	0.18871	0.023	T	0.03043	-1.1079	10	0.87932	D	0	-6.8854	9.9098	0.41399	0.9235:0.0:0.0765:0.0	.	686	Q8N3X1	FNBP4_HUMAN	P	686	ENSP00000263773:L686P	ENSP00000263773:L686P	L	-	2	0	FNBP4	47702858	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.155000	0.64900	2.128000	0.65567	0.402000	0.26972	CTC		0.453	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3			Missense_Mutation
MS4A6A	64231	broad.mit.edu	37	11	59945777	59945777	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:59945777C>T	ENST00000530839.1	-	5	787	c.295G>A	c.(295-297)Ggc>Agc	p.G99S	MS4A6A_ENST00000420732.2_Missense_Mutation_p.G99S|MS4A6A_ENST00000323961.3_Missense_Mutation_p.G99S|MS4A6A_ENST00000412309.2_Missense_Mutation_p.G127S|MS4A6A_ENST00000529906.1_5'UTR|MS4A6A_ENST00000533023.1_Intron|MS4A6A_ENST00000528851.1_Missense_Mutation_p.G99S|MS4A6A_ENST00000426738.2_Missense_Mutation_p.G54S|MS4A6A_ENST00000529054.1_Missense_Mutation_p.G127S	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	99						integral component of membrane (GO:0016021)		p.G99S(1)		endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GATAGAGAGCCAGAGATGATA	0.383																																																1	Substitution - Missense(1)	ovary(1)	11											123.0	120.0	121.0					11																	59945777		2201	4295	6496	59702353	SO:0001583	missense	64231			AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.295G>A	11.37:g.59945777C>T	ENSP00000436979:p.Gly99Ser	Unknown		x	x	x	59702353	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Missense_Mutation	SNP	ENST00000530839.1	37	CCDS7981.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141618	0.77775	.	.	ENSG00000110077	ENST00000323961;ENST00000528851;ENST00000420732;ENST00000530839;ENST00000529054;ENST00000426738;ENST00000412309	T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09	4.73	4.73	0.59995	.	0.126390	0.52532	D	0.000066	T	0.52757	0.1754	M	0.91510	3.215	0.33839	D	0.631217	D;D;D;D;D	0.71674	0.993;0.991;0.993;0.998;0.991	D;D;D;D;D	0.70227	0.968;0.947;0.968;0.968;0.947	T	0.71852	-0.4467	10	0.87932	D	0	.	13.3857	0.60795	0.0:1.0:0.0:0.0	.	54;127;127;99;99	E7EMT7;F8W9K1;E9PSA9;Q9H2W1;Q9H2W1-3	.;.;.;M4A6A_HUMAN;.	S	99;99;99;99;127;54;127	ENSP00000315878:G99S;ENSP00000431901:G99S;ENSP00000392921:G99S;ENSP00000436979:G99S;ENSP00000435844:G127S;ENSP00000392770:G54S;ENSP00000403212:G127S	ENSP00000315878:G99S	G	-	1	0	MS4A6A	59702353	0.999000	0.42202	0.419000	0.26584	0.003000	0.03518	3.091000	0.50199	2.606000	0.88127	0.655000	0.94253	GGC		0.383	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1			Missense_Mutation
C11orf80	79703	broad.mit.edu	37	11	66581446	66581446	+	Silent	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:66581446T>C	ENST00000360962.4	+	10	1156	c.1149T>C	c.(1147-1149)caT>caC	p.H383H	C11orf80_ENST00000525449.2_Silent_p.H228H|C11orf80_ENST00000527634.1_Silent_p.H166H|C11orf80_ENST00000540737.1_Silent_p.H218H|C11orf80_ENST00000346672.4_Silent_p.H229H|C11orf80_ENST00000532565.2_Silent_p.H165H	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	383								p.H383H(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						AAAAATACCATTTGTGTATGA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	11											84.0	77.0	79.0					11																	66581446		1828	4078	5906	66338022	SO:0001819	synonymous_variant	79703					11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.1149T>C	11.37:g.66581446T>C		Unknown		x	x	x	66338022	Q9H677	Silent	SNP	ENST00000360962.4	37	CCDS53664.1	SNP	52	Broad																																																																																				0.373	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650		Silent
PGM2L1	283209	broad.mit.edu	37	11	74047745	74047745	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:74047745C>G	ENST00000298198.4	-	14	2132	c.1821G>C	c.(1819-1821)gaG>gaC	p.E607D		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	607					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)	p.E607D(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					GAAGAAAATTCTCTATCAGAG	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											127.0	110.0	116.0					11																	74047745		2200	4293	6493	73725393	SO:0001583	missense	283209			AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.1821G>C	11.37:g.74047745C>G	ENSP00000298198:p.Glu607Asp	Unknown		x	x	x	73725393	Q96MQ7|Q9UIK3	Missense_Mutation	SNP	ENST00000298198.4	37	CCDS8231.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076431	0.36662	.	.	ENSG00000165434	ENST00000298198	T	0.19105	2.17	5.74	0.659	0.17861	.	0.171789	0.49916	D	0.000127	T	0.12050	0.0293	L	0.28344	0.845	0.44579	D	0.997541	B	0.09022	0.002	B	0.10450	0.005	T	0.12426	-1.0548	10	0.36615	T	0.2	-6.8171	6.2687	0.20943	0.0:0.5916:0.1232:0.2852	.	607	Q6PCE3	PGM2L_HUMAN	D	607	ENSP00000298198:E607D	ENSP00000298198:E607D	E	-	3	2	PGM2L1	73725393	1.000000	0.71417	0.995000	0.50966	0.777000	0.43975	1.605000	0.36815	-0.048000	0.13401	-0.253000	0.11424	GAG		0.408	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1	NM_173582		Missense_Mutation
MRE11A	4361	broad.mit.edu	37	11	94209517	94209517	+	Silent	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:94209517T>A	ENST00000323929.3	-	7	819	c.597A>T	c.(595-597)acA>acT	p.T199T	MRE11A_ENST00000407439.3_Silent_p.T202T|MRE11A_ENST00000393241.4_Silent_p.T199T|MRE11A_ENST00000540013.1_Silent_p.T199T|MRE11A_ENST00000323977.3_Silent_p.T199T|RP11-685N10.1_ENST00000541092.1_RNA	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	199					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.T199T(1)		breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				GTCTCAACATTGTTACTTTTT	0.333								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																																							1	Substitution - coding silent(1)	ovary(1)	11											114.0	114.0	114.0					11																	94209517		2200	4297	6497	93849165	SO:0001819	synonymous_variant	4361	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.597A>T	11.37:g.94209517T>A		Somatic		x	x	x	93849165	O43475	Silent	SNP	ENST00000323929.3	37	CCDS8299.1	SNP	63	Broad																																																																																				0.333	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591		Silent
IL10RA	3587	broad.mit.edu	37	11	117864092	117864092	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr11:117864092G>C	ENST00000227752.3	+	4	624	c.504G>C	c.(502-504)gaG>gaC	p.E168D	IL10RA_ENST00000541785.1_Missense_Mutation_p.E148D|IL10RA_ENST00000545409.1_Missense_Mutation_p.E19D|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	168					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.E168D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GAGAGTATGAGATTGCCATTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	80.0	83.0					11																	117864092		2200	4296	6496	117369302	SO:0001583	missense	3587			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.504G>C	11.37:g.117864092G>C	ENSP00000227752:p.Glu168Asp	Unknown		x	x	x	117369302	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634834	0.47049	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.46451	0.87;0.87;0.87	5.73	2.71	0.32032	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.683253	0.15548	N	0.256594	T	0.32071	0.0817	L	0.56769	1.78	0.09310	N	1	B;B	0.34061	0.436;0.309	B;B	0.29598	0.104;0.048	T	0.12116	-1.0560	10	0.28530	T	0.3	-4.2488	5.9238	0.19096	0.1701:0.0:0.6738:0.1561	.	148;168	F5GYV8;Q13651	.;I10R1_HUMAN	D	168;148;19;148	ENSP00000227752:E168D;ENSP00000441397:E148D;ENSP00000443019:E19D	ENSP00000227752:E168D	E	+	3	2	IL10RA	117369302	0.015000	0.18098	0.031000	0.17742	0.985000	0.73830	0.903000	0.28475	1.420000	0.47138	0.655000	0.94253	GAG		0.562	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1			Missense_Mutation
AICDA	57379	broad.mit.edu	37	12	8757516	8757516	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:8757516A>G	ENST00000229335.6	-	4	533	c.430T>C	c.(430-432)Tat>Cat	p.Y144H	AICDA_ENST00000537228.1_Intron	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	144					B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y144H(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					CAGTAAAAATAATCTTCAAAA	0.423																																					GBM(62;896 1067 5527 26594 30137)											1	Substitution - Missense(1)	ovary(1)	12											40.0	38.0	38.0					12																	8757516		1792	4059	5851	8648783	SO:0001583	missense	57379			AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.430T>C	12.37:g.8757516A>G	ENSP00000229335:p.Tyr144His	Unknown		x	x	x	8648783	Q6QJ81|Q8NFC1	Missense_Mutation	SNP	ENST00000229335.6	37	CCDS41747.1	SNP	13	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163532	0.78226	.	.	ENSG00000111732	ENST00000229335	T	0.66280	-0.2	5.44	5.44	0.79542	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	0.367274	0.31566	N	0.007423	T	0.73697	0.3620	M	0.76170	2.325	0.80722	D	1	P	0.47484	0.896	P	0.54210	0.745	T	0.77739	-0.2475	10	0.87932	D	0	-14.7489	14.3199	0.66479	1.0:0.0:0.0:0.0	.	144	Q9GZX7	AICDA_HUMAN	H	144	ENSP00000229335:Y144H	ENSP00000229335:Y144H	Y	-	1	0	AICDA	8648783	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	8.906000	0.92626	2.059000	0.61396	0.533000	0.62120	TAT		0.423	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661		Missense_Mutation
GRIN2B	2904	broad.mit.edu	37	12	14018753	14018753	+	Silent	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:14018753G>T	ENST00000609686.1	-	2	599	c.390C>A	c.(388-390)tcC>tcA	p.S130S		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	130					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S130S(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTATCATAGAGGAGCCCCCGT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											107.0	123.0	118.0					12																	14018753		2203	4300	6503	13910020	SO:0001819	synonymous_variant	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.390C>A	12.37:g.14018753G>T		Unknown		x	x	x	13910020	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	CCDS8662.1	SNP	35	Broad																																																																																				0.507	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			Silent
LRMP	4033	broad.mit.edu	37	12	25255168	25255168	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:25255168A>T	ENST00000354454.3	+	16	1755	c.926A>T	c.(925-927)aAc>aTc	p.N309I	RP11-713N11.4_ENST00000555862.1_RNA|LRMP_ENST00000547044.1_Missense_Mutation_p.N309I|LRMP_ENST00000548766.1_Missense_Mutation_p.N309I	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	365					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N309I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GCTTCTCTAAACTCCAAGGTA	0.303																																																1	Substitution - Missense(1)	ovary(1)	12											102.0	96.0	98.0					12																	25255168		2202	4297	6499	25146435	SO:0001583	missense	4033				CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.926A>T	12.37:g.25255168A>T	ENSP00000346442:p.Asn309Ile	Unknown		x	x	x	25146435	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	14.51	2.556000	0.45487	.	.	ENSG00000118308	ENST00000354454;ENST00000536173;ENST00000548766;ENST00000547044	T;T;T;T	0.23348	2.22;1.91;2.22;2.22	5.13	5.13	0.70059	.	0.115676	0.56097	D	0.000026	T	0.42832	0.1220	L	0.56769	1.78	0.37046	D	0.897384	D	0.67145	0.996	D	0.67900	0.954	T	0.45056	-0.9287	10	0.37606	T	0.19	-21.876	11.2565	0.49056	1.0:0.0:0.0:0.0	.	365	Q12912	LRMP_HUMAN	I	309;256;309;309	ENSP00000346442:N309I;ENSP00000444056:N256I;ENSP00000446496:N309I;ENSP00000450246:N309I	ENSP00000346442:N309I	N	+	2	0	LRMP	25146435	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	3.900000	0.56295	2.153000	0.67306	0.459000	0.35465	AAC		0.303	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152		Missense_Mutation
KIF21A	55605	broad.mit.edu	37	12	39711962	39711962	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:39711962G>A	ENST00000361418.5	-	29	3836	c.3821C>T	c.(3820-3822)tCt>tTt	p.S1274F	KIF21A_ENST00000541463.2_Missense_Mutation_p.S1238F|KIF21A_ENST00000361961.3_Missense_Mutation_p.S1261F|KIF21A_ENST00000544797.2_Missense_Mutation_p.S1254F|KIF21A_ENST00000395670.3_Missense_Mutation_p.S1274F|KIF21A_ENST00000547745.1_Intron			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1274					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S1261F(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TGGTGGGGAAGAAGGAGGTGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	81.0	78.0					12																	39711962		2203	4300	6503	37998229	SO:0001583	missense	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.3821C>T	12.37:g.39711962G>A	ENSP00000354878:p.Ser1274Phe	Unknown		x	x	x	37998229	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700687	0.68501	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000544797;ENST00000361418;ENST00000541463	T;T;T;T;T	0.71461	-0.57;-0.56;-0.56;-0.46;-0.54	5.83	5.83	0.93111	.	0.259515	0.27591	N	0.018699	T	0.76579	0.4007	M	0.66939	2.045	0.44956	D	0.997971	P;P;P;P	0.41710	0.729;0.729;0.76;0.729	B;P;B;B	0.45138	0.371;0.471;0.344;0.206	T	0.77887	-0.2420	10	0.62326	D	0.03	.	20.114	0.97919	0.0:0.0:1.0:0.0	.	1254;1238;1274;1261	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;KI21A_HUMAN;.	F	1261;1274;1254;1274;1238	ENSP00000354851:S1261F;ENSP00000379029:S1274F;ENSP00000445606:S1254F;ENSP00000354878:S1274F;ENSP00000438075:S1238F	ENSP00000354878:S1274F	S	-	2	0	KIF21A	37998229	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.335000	0.79234	2.763000	0.94921	0.585000	0.79938	TCT		0.393	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641		Missense_Mutation
TIMELESS	8914	broad.mit.edu	37	12	56824745	56824745	+	Silent	SNP	G	G	T	rs267603584		TCGA-13-1510-01	TCGA-13-1510-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:56824745G>T	ENST00000553532.1	-	9	979	c.829C>A	c.(829-831)Cga>Aga	p.R277R	TIMELESS_ENST00000229201.4_Silent_p.R276R|TIMELESS_ENST00000554616.1_Silent_p.R277R					timeless circadian clock									p.R277R(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CCCCCAAATCGAGAATGCCTG	0.438																																																1	Substitution - coding silent(1)	ovary(1)	12											101.0	104.0	103.0					12																	56824745		2203	4300	6503	55111012	SO:0001819	synonymous_variant	8914			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.829C>A	12.37:g.56824745G>T		Somatic		x	x	x	55111012		Silent	SNP	ENST00000553532.1	37	CCDS8918.1	SNP	37	Broad																																																																																				0.438	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920		Silent
GLI1	2735	broad.mit.edu	37	12	57864464	57864464	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:57864464C>A	ENST00000228682.2	+	12	2032	c.1941C>A	c.(1939-1941)gaC>gaA	p.D647E	GLI1_ENST00000546141.1_Missense_Mutation_p.D606E|GLI1_ENST00000543426.1_Missense_Mutation_p.D519E	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	647					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.D647E(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			AGGCTGCTGACCGTCCTGCTC	0.612																																					Pancreas(157;841 1936 10503 41495 50368)											1	Substitution - Missense(1)	ovary(1)	12											37.0	38.0	38.0					12																	57864464		2203	4300	6503	56150731	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1941C>A	12.37:g.57864464C>A	ENSP00000228682:p.Asp647Glu	Somatic		x	x	x	56150731	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865067	0.17250	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.15017	2.54;2.46;2.48;2.48	4.39	-0.324	0.12706	.	0.000000	0.48767	D	0.000170	T	0.07413	0.0187	L	0.31294	0.92	0.43652	D	0.996061	P	0.43788	0.817	B	0.35182	0.197	T	0.34279	-0.9835	10	0.39692	T	0.17	.	1.3056	0.02087	0.1488:0.3816:0.1465:0.3231	.	647	P08151	GLI1_HUMAN	E	519;647;606;606	ENSP00000437607:D519E;ENSP00000228682:D647E;ENSP00000441006:D606E;ENSP00000434408:D606E	ENSP00000228682:D647E	D	+	3	2	GLI1	56150731	0.016000	0.18221	0.749000	0.31150	0.773000	0.43773	-0.567000	0.05916	0.119000	0.18210	0.491000	0.48974	GAC		0.612	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		Missense_Mutation
XPOT	11260	broad.mit.edu	37	12	64824051	64824051	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:64824051G>A	ENST00000332707.5	+	17	2489	c.1960G>A	c.(1960-1962)Gct>Act	p.A654T		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	654	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.A654T(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TCTTAACCATGCTGTTGGATT	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											63.0	59.0	60.0					12																	64824051		2203	4300	6503	63110318	SO:0001583	missense	11260			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.1960G>A	12.37:g.64824051G>A	ENSP00000327821:p.Ala654Thr	Unknown		x	x	x	63110318	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	16.50	3.140483	0.56936	.	.	ENSG00000184575	ENST00000332707;ENST00000538086	T;T	0.67523	-0.27;-0.27	5.48	5.48	0.80851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62036	0.2395	L	0.47716	1.5	0.80722	D	1	B	0.26744	0.158	B	0.24006	0.05	T	0.56450	-0.7977	9	.	.	.	.	19.7244	0.96157	0.0:0.0:1.0:0.0	.	654	O43592	XPOT_HUMAN	T	654;176	ENSP00000327821:A654T;ENSP00000444345:A176T	.	A	+	1	0	XPOT	63110318	1.000000	0.71417	0.996000	0.52242	0.043000	0.13939	9.331000	0.96430	2.752000	0.94435	0.650000	0.86243	GCT		0.398	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235		Missense_Mutation
GLIPR1L2	144321	broad.mit.edu	37	12	75804241	75804241	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:75804241G>C	ENST00000550916.1	+	2	309	c.262G>C	c.(262-264)Gct>Cct	p.A88P	GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.A23P|GLIPR1L2_ENST00000547164.1_Missense_Mutation_p.A88P|GLIPR1L2_ENST00000435775.1_Missense_Mutation_p.A88P|GLIPR1L2_ENST00000378692.3_5'UTR|GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.A88P	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	88	SCP.					integral component of membrane (GO:0016021)		p.A88P(1)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						ATCACGGACTGCTAGAGCATG	0.289																																																1	Substitution - Missense(1)	ovary(1)	12											80.0	81.0	81.0					12																	75804241		2201	4299	6500	74090508	SO:0001583	missense	144321			BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.262G>C	12.37:g.75804241G>C	ENSP00000448248:p.Ala88Pro	Unknown		x	x	x	74090508	Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	ENST00000550916.1	37	CCDS58258.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281115	0.80692	.	.	ENSG00000180481	ENST00000550916;ENST00000435775;ENST00000320460;ENST00000547164;ENST00000441218	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	5.04	5.04	0.67666	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.71039	0.3293	H	0.95079	3.62	0.49483	D	0.999794	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80306	-0.1438	10	0.87932	D	0	.	15.4145	0.74956	0.0:0.0:1.0:0.0	.	88;88	Q4G1C9;Q4G1C9-2	GRPL2_HUMAN;.	P	88;88;88;88;23	ENSP00000448248:A88P;ENSP00000398328:A88P;ENSP00000317385:A88P;ENSP00000447980:A88P;ENSP00000405273:A23P	ENSP00000317385:A88P	A	+	1	0	GLIPR1L2	74090508	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.119000	0.71590	2.607000	0.88179	0.585000	0.79938	GCT		0.289	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1	NM_152436		Missense_Mutation
CDK17	5128	broad.mit.edu	37	12	96688840	96688840	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:96688840G>C	ENST00000261211.3	-	10	1537	c.934C>G	c.(934-936)Cga>Gga	p.R312G	CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000542666.1_Missense_Mutation_p.R259G|CDK17_ENST00000543119.2_Missense_Mutation_p.R312G	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	312	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.R312G(2)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TTCAAGTCTCGATGCAATACC	0.343																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	12											137.0	129.0	132.0					12																	96688840		2203	4300	6503	95212971	SO:0001583	missense	5128				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.934C>G	12.37:g.96688840G>C	ENSP00000261211:p.Arg312Gly	Somatic		x	x	x	95212971	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	CCDS9061.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573325	0.65765	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.64991	-0.13;-0.13;-0.13	5.09	4.19	0.49359	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052553	0.85682	D	0.000000	D	0.85071	0.5613	H	0.96633	3.855	0.52501	D	0.999952	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89383	0.3683	10	0.87932	D	0	-7.2266	13.0612	0.59008	0.0:0.0:0.7079:0.2921	.	312;312	A8K1U6;Q00537	.;CDK17_HUMAN	G	312;312;259	ENSP00000261211:R312G;ENSP00000444459:R312G;ENSP00000442926:R259G	ENSP00000261211:R312G	R	-	1	2	CDK17	95212971	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.936000	0.63506	1.267000	0.44247	0.491000	0.48974	CGA		0.343	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595		Missense_Mutation
HECTD4	283450	broad.mit.edu	37	12	112667666	112667666	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr12:112667666T>C	ENST00000430131.2	-	40	6234	c.5089A>G	c.(5089-5091)Atg>Gtg	p.M1697V	HECTD4_ENST00000550722.1_Missense_Mutation_p.M1973V|HECTD4_ENST00000377560.5_Missense_Mutation_p.M1947V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1697					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.M1697V(1)									GGAATGTACATCAGTGCTCTA	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											70.0	65.0	67.0					12																	112667666		1953	4130	6083	111152049	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.5089A>G	12.37:g.112667666T>C	ENSP00000404379:p.Met1697Val	Unknown		x	x	x	111152049	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	16.75	3.208522	0.58343	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.42513	0.97;0.97;0.97	5.96	4.8	0.61643	.	.	.	.	.	T	0.28830	0.0715	N	0.14661	0.345	0.46798	D	0.999206	B	0.13145	0.007	B	0.12156	0.007	T	0.05550	-1.0878	9	0.87932	D	0	.	13.3432	0.60557	0.0:0.0:0.1318:0.8682	.	1697	Q9Y4D8	K0614_HUMAN	V	1947;1697;1973	ENSP00000366783:M1947V;ENSP00000404379:M1697V;ENSP00000449784:M1973V	ENSP00000366783:M1947V	M	-	1	0	C12orf51	111152049	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.455000	0.80726	1.058000	0.40530	0.528000	0.53228	ATG		0.453	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		Missense_Mutation
SACS	26278	broad.mit.edu	37	13	23914961	23914961	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr13:23914961C>G	ENST00000382292.3	-	9	3327	c.3054G>C	c.(3052-3054)gaG>gaC	p.E1018D	SACS_ENST00000402364.1_Missense_Mutation_p.E268D|SACS_ENST00000382298.3_Missense_Mutation_p.E1018D			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1018					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E871D(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAGATAGATTCTCAAGGACCC	0.348																																																1	Substitution - Missense(1)	ovary(1)	13											119.0	123.0	122.0					13																	23914961		2203	4300	6503	22812961	SO:0001583	missense	26278			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.3054G>C	13.37:g.23914961C>G	ENSP00000371729:p.Glu1018Asp	Somatic		x	x	x	22812961	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380023	0.42207	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.86956	-2.04;-2.19;-2.04	6.05	1.86	0.25419	.	0.155386	0.56097	N	0.000022	T	0.74854	0.3771	L	0.29908	0.895	0.26316	N	0.97775	B	0.28233	0.204	B	0.23419	0.046	T	0.62353	-0.6872	10	0.37606	T	0.19	.	4.7565	0.13086	0.0:0.456:0.1594:0.3846	.	1018	Q9NZJ4	SACS_HUMAN	D	1018;268;1018	ENSP00000371729:E1018D;ENSP00000385844:E268D;ENSP00000371735:E1018D	ENSP00000371729:E1018D	E	-	3	2	SACS	22812961	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	0.616000	0.24344	0.433000	0.26313	0.650000	0.86243	GAG		0.348	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363		Missense_Mutation
SLITRK1	114798	broad.mit.edu	37	13	84454092	84454092	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr13:84454092C>A	ENST00000377084.2	-	1	2436	c.1551G>T	c.(1549-1551)caG>caT	p.Q517H		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	517					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.Q517H(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGGAGGTTAACTGGTCCAGCA	0.567																																																1	Substitution - Missense(1)	ovary(1)	13											52.0	54.0	53.0					13																	84454092		2203	4300	6503	83352093	SO:0001583	missense	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1551G>T	13.37:g.84454092C>A	ENSP00000366288:p.Gln517His	Unknown		x	x	x	83352093	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696265	0.30052	.	.	ENSG00000178235	ENST00000377084	T	0.51574	0.7	5.22	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.29945	0.0749	N	0.05510	-0.035	0.52501	D	0.999958	B	0.32040	0.353	B	0.36335	0.222	T	0.11690	-1.0577	10	0.25751	T	0.34	-11.1432	13.0818	0.59117	0.0:0.9212:0.0:0.0788	.	517	Q96PX8	SLIK1_HUMAN	H	517	ENSP00000366288:Q517H	ENSP00000366288:Q517H	Q	-	3	2	SLITRK1	83352093	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.632000	0.46511	1.355000	0.45865	-0.119000	0.15052	CAG		0.567	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		Missense_Mutation
KLHDC1	122773	broad.mit.edu	37	14	50196231	50196231	+	Silent	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr14:50196231C>T	ENST00000359332.2	+	8	765	c.675C>T	c.(673-675)caC>caT	p.H225H	KLHDC1_ENST00000554512.1_3'UTR	NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	225						cytoplasm (GO:0005737)		p.H225H(1)		kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					ATGATTTGCACTATCTAAACC	0.333																																																1	Substitution - coding silent(1)	ovary(1)	14											115.0	106.0	109.0					14																	50196231		2203	4300	6503	49265981	SO:0001819	synonymous_variant	122773			AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.675C>T	14.37:g.50196231C>T		Unknown		x	x	x	49265981	B3KXD9|Q8WYI1	Silent	SNP	ENST00000359332.2	37	CCDS9692.1	SNP	20	Broad																																																																																				0.333	KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276882.2	NM_172193		Silent
BDKRB1	623	broad.mit.edu	37	14	96730165	96730165	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr14:96730165T>C	ENST00000216629.6	+	3	752	c.146T>C	c.(145-147)tTc>tCc	p.F49S	RP11-404P21.3_ENST00000553638.1_RNA|RP11-404P21.8_ENST00000555847.1_3'UTR|BDKRB1_ENST00000553356.1_Missense_Mutation_p.F49S|RP11-404P21.8_ENST00000553811.1_3'UTR	NM_000710.3	NP_000701.2	P46663	BKRB1_HUMAN	bradykinin receptor B1	49					cell migration (GO:0016477)|inflammatory response (GO:0006954)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell growth (GO:0030308)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|peptide binding (GO:0042277)	p.F49S(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|ovary(4)|skin(1)|urinary_tract(1)	16		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		TCCATCTGTTTCTTCGGCCTC	0.552																																																1	Substitution - Missense(1)	ovary(1)	14											98.0	79.0	86.0					14																	96730165		2203	4300	6503	95799918	SO:0001583	missense	623			L42383	CCDS9943.1	14q32.1-q32.2	2012-08-08				ENSG00000100739		"""GPCR / Class A : Bradykinin receptors"""	1029	protein-coding gene	gene with protein product		600337				8808279	Standard	NM_000710		Approved	BKR1, B1BKR, bradyb1	uc001yfh.3	P46663		ENST00000216629.6:c.146T>C	14.37:g.96730165T>C	ENSP00000216629:p.Phe49Ser	Unknown		x	x	x	95799918	A8K7F5|Q546S7|Q8N0Y8	Missense_Mutation	SNP	ENST00000216629.6	37	CCDS9943.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	11.24	1.580065	0.28180	.	.	ENSG00000100739	ENST00000216629;ENST00000553356	T;T	0.37752	1.18;1.18	5.37	-5.7	0.02421	.	0.664722	0.14284	N	0.329305	T	0.14227	0.0344	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.09015	-1.0694	10	0.44086	T	0.13	-0.0932	7.4291	0.27118	0.0:0.3028:0.1928:0.5043	.	49;49	G3V4Y2;P46663	.;BKRB1_HUMAN	S	49	ENSP00000216629:F49S;ENSP00000452064:F49S	ENSP00000216629:F49S	F	+	2	0	BDKRB1	95799918	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.420000	0.21263	-1.338000	0.02233	-1.477000	0.00996	TTC		0.552	BDKRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413300.1			Missense_Mutation
TRPM7	54822	broad.mit.edu	37	15	50884152	50884152	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr15:50884152G>C	ENST00000313478.7	-	26	4561	c.4280C>G	c.(4279-4281)tCt>tGt	p.S1427C	TRPM7_ENST00000560955.1_Missense_Mutation_p.S1427C	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1427					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.S1427C(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TGTAGCTTTAGAGCAAACAGT	0.358																																																1	Substitution - Missense(1)	ovary(1)	15											100.0	96.0	97.0					15																	50884152		1832	4074	5906	48671444	SO:0001583	missense	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4280C>G	15.37:g.50884152G>C	ENSP00000320239:p.Ser1427Cys	Somatic		x	x	x	48671444	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	8.986	0.976540	0.18736	.	.	ENSG00000092439	ENST00000313478	T	0.54675	0.56	5.91	1.78	0.24846	.	1.407100	0.03950	N	0.288352	T	0.37999	0.1024	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.22138	-1.0225	10	0.44086	T	0.13	0.0435	5.037	0.14440	0.0648:0.2328:0.4489:0.2535	.	1427	Q96QT4	TRPM7_HUMAN	C	1427	ENSP00000320239:S1427C	ENSP00000320239:S1427C	S	-	2	0	TRPM7	48671444	0.999000	0.42202	0.074000	0.20217	0.665000	0.39181	1.490000	0.35573	0.079000	0.16929	0.558000	0.71614	TCT		0.358	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672		Missense_Mutation
RORA	6095	broad.mit.edu	37	15	60824025	60824025	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr15:60824025C>G	ENST00000335670.6	-	3	322	c.222G>C	c.(220-222)aaG>aaC	p.K74N	RP11-219B17.1_ENST00000559203.1_RNA|RP11-219B17.1_ENST00000559902.1_RNA|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000560004.1_5'UTR|RP11-219B17.1_ENST00000558235.1_RNA|CTD-2501E16.2_ENST00000560280.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.K19N|RORA_ENST00000261523.5_Missense_Mutation_p.K107N|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000309157.4_Missense_Mutation_p.K99N	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	74					angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K107N(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						CTCCACAGATCTTGCATGGAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	15											119.0	109.0	112.0					15																	60824025		2203	4300	6503	58611317	SO:0001583	missense	6095			U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.222G>C	15.37:g.60824025C>G	ENSP00000335087:p.Lys74Asn	Unknown		x	x	x	58611317	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	ENST00000335670.6	37	CCDS10177.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125018	0.77436	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38	5.8	5.8	0.92144	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.042705	0.85682	D	0.000000	D	0.98595	0.9530	M	0.91354	3.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.995;1.0;1.0	D	0.98959	1.0797	10	0.66056	D	0.02	.	12.3669	0.55234	0.0:0.9238:0.0:0.0762	.	74;99;107;19	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	N	74;19;99;107	ENSP00000335087:K74N;ENSP00000402971:K19N;ENSP00000309753:K99N;ENSP00000261523:K107N	ENSP00000261523:K107N	K	-	3	2	RORA	58611317	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.975000	0.63777	2.732000	0.93576	0.650000	0.86243	AAG		0.348	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2			Missense_Mutation
KIAA1024	23251	broad.mit.edu	37	15	79750095	79750095	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr15:79750095G>T	ENST00000305428.3	+	2	1681	c.1606G>T	c.(1606-1608)Gtg>Ttg	p.V536L		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	536						integral component of membrane (GO:0016021)		p.V536L(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CTCCACGGGAGTGATACAGTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	15											88.0	72.0	77.0					15																	79750095		2196	4293	6489	77537150	SO:0001583	missense	23251			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1606G>T	15.37:g.79750095G>T	ENSP00000307461:p.Val536Leu	Unknown		x	x	x	77537150	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318284	0.23994	.	.	ENSG00000169330	ENST00000305428	T	0.42131	0.98	5.24	0.781	0.18561	.	0.198268	0.44285	N	0.000480	T	0.27900	0.0687	L	0.41824	1.3	0.19300	N	0.99998	B	0.02656	0.0	B	0.08055	0.003	T	0.15723	-1.0427	9	.	.	.	.	7.2747	0.26277	0.1484:0.4:0.4516:0.0	.	536	Q9UPX6	K1024_HUMAN	L	536	ENSP00000307461:V536L	.	V	+	1	0	KIAA1024	77537150	1.000000	0.71417	0.005000	0.12908	0.854000	0.48673	3.563000	0.53784	0.173000	0.19788	0.491000	0.48974	GTG		0.483	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206		Missense_Mutation
AP3B2	8120	broad.mit.edu	37	15	83330674	83330674	+	Splice_Site	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr15:83330674G>A	ENST00000261722.3	-	24	3069	c.2862C>T	c.(2860-2862)tgC>tgT	p.C954C	AP3B2_ENST00000535359.1_Splice_Site_p.C973C|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Splice_Site_p.C922C	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	954					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.C953C(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GGGTCTGGGTGCTGGGAGGGG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	15											46.0	49.0	48.0					15																	83330674		1976	4156	6132	81127729	SO:0001630	splice_region_variant	8120			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2862-1C>T	15.37:g.83330674G>A		Unknown		x	x	x	81127729	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	CCDS45331.1	SNP	46	Broad																																																																																				0.542	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		Silent	Silent
TICRR	90381	broad.mit.edu	37	15	90167091	90167091	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr15:90167091G>A	ENST00000268138.7	+	20	3655	c.3550G>A	c.(3550-3552)Gaa>Aaa	p.E1184K	TICRR_ENST00000560985.1_Missense_Mutation_p.E1183K|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1184					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.E1184K(1)									CCAGGCAGGAGAAGGTACCTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	15											103.0	108.0	107.0					15																	90167091		1976	4174	6150	87968095	SO:0001583	missense	90381			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.3550G>A	15.37:g.90167091G>A	ENSP00000268138:p.Glu1184Lys	Unknown		x	x	x	87968095	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	3.351	-0.132454	0.06753	.	.	ENSG00000140534	ENST00000268138	T	0.08193	3.12	4.54	3.62	0.41486	.	1.082070	0.07070	N	0.835218	T	0.05686	0.0149	N	0.24115	0.695	0.09310	N	0.999992	B	0.20671	0.047	B	0.15484	0.013	T	0.40440	-0.9563	10	0.06236	T	0.91	3.7845	7.9504	0.30012	0.2463:0.0:0.7537:0.0	.	1184	Q7Z2Z1	TICRR_HUMAN	K	1184	ENSP00000268138:E1184K	ENSP00000268138:E1184K	E	+	1	0	C15orf42	87968095	0.000000	0.05858	0.006000	0.13384	0.160000	0.22226	0.476000	0.22180	0.878000	0.35920	0.563000	0.77884	GAA		0.483	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259		Missense_Mutation
SRRM2	23524	broad.mit.edu	37	16	2812191	2812191	+	Silent	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:2812191T>A	ENST00000301740.8	+	11	2211	c.1662T>A	c.(1660-1662)tcT>tcA	p.S554S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	554	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.S554S(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GAGGCAGGTCTAGGTCAGCAA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	16											38.0	41.0	40.0					16																	2812191		2198	4300	6498	2752192	SO:0001819	synonymous_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1662T>A	16.37:g.2812191T>A		Unknown		x	x	x	2752192	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1	SNP	53	Broad																																																																																				0.612	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			Silent
TBC1D10B	26000	broad.mit.edu	37	16	30380578	30380578	+	Silent	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:30380578G>A	ENST00000409939.3	-	1	1007	c.927C>T	c.(925-927)ttC>ttT	p.F309F		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	309					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)	p.F34F(1)		endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			TGCCCCCAAGGAAGCCATACT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	16											33.0	22.0	26.0					16																	30380578		2194	4295	6489	30288079	SO:0001819	synonymous_variant	26000			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.927C>T	16.37:g.30380578G>A		Unknown		x	x	x	30288079	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Silent	SNP	ENST00000409939.3	37	CCDS10676.2	SNP	41	Broad																																																																																				0.612	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527		Silent
NLRC5	84166	broad.mit.edu	37	16	57101303	57101303	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:57101303G>C	ENST00000262510.6	+	35	4552	c.4327G>C	c.(4327-4329)Gct>Cct	p.A1443P	NLRC5_ENST00000436936.1_Missense_Mutation_p.A1443P|NLRC5_ENST00000539144.1_Missense_Mutation_p.A1414P|NLRC5_ENST00000308149.7_Missense_Mutation_p.A1414P	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1443					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.A1443P(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTCCAGGTTGGCTCACTGTGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	16											154.0	141.0	146.0					16																	57101303		2198	4300	6498	55658804	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4327G>C	16.37:g.57101303G>C	ENSP00000262510:p.Ala1443Pro	Unknown		x	x	x	55658804	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165047	0.57476	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	T;T;T;T	0.75154	2.29;-0.67;-0.91;-0.67	4.53	1.38	0.22167	.	0.247982	0.21158	N	0.079203	T	0.76227	0.3958	M	0.72894	2.215	0.26474	N	0.975235	D	0.67145	0.996	P	0.56788	0.806	T	0.64097	-0.6487	10	0.30078	T	0.28	.	4.8139	0.13356	0.102:0.0:0.5135:0.3844	.	1443	Q86WI3	NLRC5_HUMAN	P	1443;1414;1443;1414	ENSP00000262510:A1443P;ENSP00000308886:A1414P;ENSP00000389739:A1443P;ENSP00000441727:A1414P	ENSP00000262510:A1443P	A	+	1	0	NLRC5	55658804	0.981000	0.34729	1.000000	0.80357	0.931000	0.56810	0.122000	0.15687	0.592000	0.29728	0.448000	0.29417	GCT		0.542	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206		Missense_Mutation
ACD	65057	broad.mit.edu	37	16	67694099	67694099	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:67694099G>C	ENST00000393919.4	-	1	547	c.283C>G	c.(283-285)Cta>Gta	p.L95V	PARD6A_ENST00000219255.3_5'Flank|PARD6A_ENST00000602551.1_5'Flank|PARD6A_ENST00000458121.2_5'Flank|ACD_ENST00000219251.8_Missense_Mutation_p.L95V			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	95					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)	p.L95V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CAGGGCCGTAGGACCAGCCTC	0.687																																																1	Substitution - Missense(1)	ovary(1)	16											30.0	40.0	37.0					16																	67694099		2189	4296	6485	66251600	SO:0001583	missense	65057			AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.283C>G	16.37:g.67694099G>C	ENSP00000377496:p.Leu95Val	Unknown		x	x	x	66251600	Q562H5|Q9H8F9	Missense_Mutation	SNP	ENST00000393919.4	37	CCDS42181.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265418	0.40095	.	.	ENSG00000102977	ENST00000219251;ENST00000393919	T;T	0.55413	0.52;0.53	4.46	-1.01	0.10169	.	0.000000	0.38778	N	0.001570	T	0.53433	0.1796	L	0.29908	0.895	0.18873	N	0.999985	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.85130	0.986;0.997;0.995	T	0.47018	-0.9149	10	0.87932	D	0	-11.9843	7.6772	0.28492	0.4938:0.0:0.5062:0.0	.	9;95;95	B4DVI0;Q96AP0;Q96AP0-2	.;ACD_HUMAN;.	V	95	ENSP00000219251:L95V;ENSP00000377496:L95V	ENSP00000219251:L95V	L	-	1	2	ACD	66251600	0.197000	0.23362	0.019000	0.16419	0.190000	0.23558	0.786000	0.26844	-0.061000	0.13110	-0.244000	0.11960	CTA		0.687	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268880.1	NM_022914		Missense_Mutation
RANBP10	57610	broad.mit.edu	37	16	67778293	67778293	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:67778293C>T	ENST00000317506.3	-	4	581	c.466G>A	c.(466-468)Ggc>Agc	p.G156S	RANBP10_ENST00000425512.2_Missense_Mutation_p.G24S|RANBP10_ENST00000448631.2_Intron|RANBP10_ENST00000536251.1_5'UTR|RANBP10_ENST00000602677.1_Missense_Mutation_p.G156S|RANBP10_ENST00000602887.1_5'UTR|RANBP10_ENST00000411657.2_Missense_Mutation_p.G39S	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	156	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.G156S(1)		endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		TAGGGCTGGCCAGTCCCCGAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											210.0	137.0	162.0					16																	67778293		2198	4300	6498	66335794	SO:0001583	missense	57610			AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.466G>A	16.37:g.67778293C>T	ENSP00000316589:p.Gly156Ser	Unknown		x	x	x	66335794	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	37	6.031002	0.97221	.	.	ENSG00000141084	ENST00000317506;ENST00000411657;ENST00000425512	T;T;T	0.61859	0.07;0.07;0.07	6.08	6.08	0.98989	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.76499	0.3996	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;1.0	T	0.74861	-0.3520	10	0.54805	T	0.06	-32.6126	20.2672	0.98462	0.0:1.0:0.0:0.0	.	24;156;39;156	B4DHL9;B4E1Y2;B4DID0;Q6VN20	.;.;.;RBP10_HUMAN	S	156;39;24	ENSP00000316589:G156S;ENSP00000416460:G39S;ENSP00000410617:G24S	ENSP00000316589:G156S	G	-	1	0	RANBP10	66335794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGC		0.537	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850		Missense_Mutation
CNTNAP4	85445	broad.mit.edu	37	16	76528870	76528870	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr16:76528870C>G	ENST00000476707.1	+	13	2292	c.2153C>G	c.(2152-2154)tCt>tGt	p.S718C	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S666C|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S714C|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S642C|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	715	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)		p.S690C(2)|p.S714C(2)|p.S642C(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGGGGAGGTTCTTCGCCTGAT	0.413																																																5	Substitution - Missense(5)	cervix(3)|ovary(2)	16											176.0	169.0	171.0					16																	76528870		2198	4300	6498	75086371	SO:0001583	missense	85445			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2153C>G	16.37:g.76528870C>G	ENSP00000417628:p.Ser718Cys	Unknown		x	x	x	75086371	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514783	0.64634	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.18	5.18	0.71444	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.182292	0.26792	N	0.022479	T	0.41627	0.1167	.	.	.	0.49213	D	0.999765	D;D;D;D	0.89917	0.997;0.999;0.999;1.0	D;D;D;D	0.83275	0.928;0.947;0.947;0.996	T	0.23762	-1.0179	9	0.72032	D	0.01	.	18.8634	0.92281	0.0:1.0:0.0:0.0	.	642;718;690;715	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	C	714;666;642;718	ENSP00000306893:S714C;ENSP00000439733:S666C;ENSP00000418741:S642C;ENSP00000417628:S718C	ENSP00000306893:S714C	S	+	2	0	CNTNAP4	75086371	1.000000	0.71417	0.943000	0.38184	0.595000	0.36748	5.606000	0.67641	2.861000	0.98227	0.650000	0.86243	TCT		0.413	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401		Missense_Mutation
ALOX15	246	broad.mit.edu	37	17	4542416	4542416	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr17:4542416C>A	ENST00000570836.1	-	4	445	c.349G>T	c.(349-351)Ggc>Tgc	p.G117C	ALOX15_ENST00000574640.1_Missense_Mutation_p.G78C|ALOX15_ENST00000545513.1_Missense_Mutation_p.G139C|ALOX15_ENST00000293761.3_Missense_Mutation_p.G117C			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	117	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G117C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		GGGTCCTCGCCCACAGTGCGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											136.0	130.0	132.0					17																	4542416		2203	4300	6503	4489165	SO:0001583	missense	246			M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.349G>T	17.37:g.4542416C>A	ENSP00000458832:p.Gly117Cys	Somatic		x	x	x	4489165	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	ENST00000570836.1	37	CCDS11049.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	7.704	0.693705	0.15039	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.08008	3.14;3.14	4.22	1.05	0.20165	Lipoxygenase, C-terminal (2);	0.926595	0.09054	N	0.855419	T	0.08088	0.0202	L	0.27053	0.805	0.09310	N	1	B;P;P	0.43519	0.222;0.809;0.809	B;P;P	0.48270	0.138;0.469;0.572	T	0.32402	-0.9908	10	0.41790	T	0.15	-21.1961	2.3938	0.04385	0.1895:0.4867:0.2153:0.1085	.	139;78;117	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	C	117;139	ENSP00000293761:G117C;ENSP00000439855:G139C	ENSP00000293761:G117C	G	-	1	0	ALOX15	4489165	0.000000	0.05858	0.004000	0.12327	0.006000	0.05464	-0.170000	0.09897	0.518000	0.28383	-1.360000	0.01215	GGC		0.602	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2			Missense_Mutation
ZMYND15	84225	broad.mit.edu	37	17	4648646	4648646	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr17:4648646G>C	ENST00000433935.1	+	13	2090	c.2033G>C	c.(2032-2034)aGa>aCa	p.R678T	ZMYND15_ENST00000573751.2_Missense_Mutation_p.R686T|ZMYND15_ENST00000269289.6_Missense_Mutation_p.R639T|ZMYND15_ENST00000592813.1_Missense_Mutation_p.R639T	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	678					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R639T(1)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						TTTCGCCTCAGAGCGGCCGAC	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											54.0	56.0	56.0					17																	4648646		2203	4300	6503	4595395	SO:0001583	missense	84225			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.2033G>C	17.37:g.4648646G>C	ENSP00000391742:p.Arg678Thr	Unknown		x	x	x	4595395	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493900	0.64186	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.43688	0.94;0.97	4.86	3.89	0.44902	.	0.000000	0.49305	D	0.000156	T	0.23886	0.0578	N	0.14661	0.345	0.28983	N	0.888496	P;P	0.42827	0.722;0.791	B;B	0.37888	0.26;0.142	T	0.07385	-1.0775	10	0.35671	T	0.21	-9.5018	10.4819	0.44698	0.0:0.0:0.8069:0.1931	.	678;639	B4DXY5;Q9H091	.;ZMY15_HUMAN	T	678;639	ENSP00000391742:R678T;ENSP00000269289:R639T	ENSP00000269289:R639T	R	+	2	0	ZMYND15	4595395	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	1.502000	0.35704	1.264000	0.44198	0.591000	0.81541	AGA		0.617	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265		Missense_Mutation
MYH4	4622	broad.mit.edu	37	17	10346815	10346815	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr17:10346815C>A	ENST00000255381.2	-	40	5807	c.5697G>T	c.(5695-5697)aaG>aaT	p.K1899N	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1899					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.K1899N(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GCTTGCGGAACTTGGCAAGGT	0.468																																																1	Substitution - Missense(1)	ovary(1)	17											114.0	103.0	107.0					17																	10346815		2203	4300	6503	10287540	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5697G>T	17.37:g.10346815C>A	ENSP00000255381:p.Lys1899Asn	Somatic		x	x	x	10287540		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810487	0.70797	.	.	ENSG00000141048	ENST00000255381	D	0.84146	-1.81	5.0	-4.61	0.03380	Myosin tail (1);	0.000000	0.39083	U	0.001468	D	0.90410	0.6998	M	0.83012	2.62	0.42219	D	0.991846	P	0.46784	0.884	D	0.63488	0.915	D	0.90051	0.4149	10	0.87932	D	0	.	14.8038	0.69935	0.0:0.4134:0.0:0.5866	.	1899	Q9Y623	MYH4_HUMAN	N	1899	ENSP00000255381:K1899N	ENSP00000255381:K1899N	K	-	3	2	MYH4	10287540	0.244000	0.23889	0.812000	0.32479	0.990000	0.78478	-0.295000	0.08298	-0.695000	0.05105	0.655000	0.94253	AAG		0.468	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		Missense_Mutation
FAM222B	55731	broad.mit.edu	37	17	27086227	27086227	+	Silent	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr17:27086227G>T	ENST00000341217.5	-	3	965	c.750C>A	c.(748-750)ccC>ccA	p.P250P	FAM222B_ENST00000582266.1_3'UTR|FAM222B_ENST00000452648.3_Silent_p.P250P|FAM222B_ENST00000581407.1_Silent_p.P250P	NM_018182.2	NP_060652.2	Q8WU58	F222B_HUMAN	family with sequence similarity 222, member B	250								p.P250P(1)									CCATTGAAAGGGGGATAGTTG	0.597																																																1	Substitution - coding silent(1)	ovary(1)	17											22.0	25.0	24.0					17																	27086227		2137	4243	6380	24110354	SO:0001819	synonymous_variant	55731			AK001562	CCDS45637.1, CCDS74022.1	17q11.2	2012-04-27	2012-04-27	2012-04-27	ENSG00000173065	ENSG00000173065			25563	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 63"""	C17orf63			Standard	NM_001288631		Approved	FLJ10700	uc010way.1	Q8WU58		ENST00000341217.5:c.750C>A	17.37:g.27086227G>T		Unknown		x	x	x	24110354	Q9H6F3|Q9NVJ4|Q9NXN6	Missense_Mutation	SNP	ENST00000341217.5	37	CCDS45637.1	SNP	43	Broad																																																																																				0.597	FAM222B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446703.1	NM_018182		Missense_Mutation
CYGB	114757	broad.mit.edu	37	17	74527692	74527692	+	Missense_Mutation	SNP	G	G	T	rs143488120		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr17:74527692G>T	ENST00000293230.5	-	2	587	c.225C>A	c.(223-225)agC>agA	p.S75R	CYGB_ENST00000589145.1_Missense_Mutation_p.S10R|CYGB_ENST00000590175.1_Missense_Mutation_p.S10R|PRCD_ENST00000592432.1_Intron|CYGB_ENST00000586160.1_5'Flank|CYGB_ENST00000589342.1_Missense_Mutation_p.S75R	NM_134268.4	NP_599030.1	Q8WWM9	CYGB_HUMAN	cytoglobin	75	Globin.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)	p.S75R(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)	7						GCAGCTGGGGGCTCCGCTCCA	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											65.0	65.0	65.0					17																	74527692		2203	4300	6503	72039287	SO:0001583	missense	114757			AJ315162	CCDS11746.1	17q25	2008-07-18				ENSG00000161544			16505	protein-coding gene	gene with protein product	"""stellate cell activation-associated protein"", ""histoglobin"""	608759				11919282	Standard	NM_134268		Approved	HGB, STAP	uc002jru.2	Q8WWM9		ENST00000293230.5:c.225C>A	17.37:g.74527692G>T	ENSP00000293230:p.Ser75Arg	Unknown		x	x	x	72039287	Q541Y7|Q8N2X5	Missense_Mutation	SNP	ENST00000293230.5	37	CCDS11746.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.00	3.526388	0.64860	.	.	ENSG00000161544	ENST00000293230	D	0.94576	-3.46	5.4	2.3	0.28687	Globin-like (1);Globin, structural domain (1);	0.035646	0.85682	N	0.000000	D	0.96466	0.8847	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95254	0.8362	10	0.87932	D	0	-5.7051	7.7224	0.28740	0.4043:0.0:0.5957:0.0	.	75	Q8WWM9	CYGB_HUMAN	R	75	ENSP00000293230:S75R	ENSP00000293230:S75R	S	-	3	2	CYGB	72039287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.797000	0.38804	0.628000	0.30357	0.462000	0.41574	AGC		0.612	CYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450590.1	NM_134268		Missense_Mutation
ANKRD12	23253	broad.mit.edu	37	18	9256624	9256624	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr18:9256624T>C	ENST00000262126.4	+	9	3599	c.3359T>C	c.(3358-3360)aTa>aCa	p.I1120T	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.I1097T|ANKRD12_ENST00000400020.3_Missense_Mutation_p.I1097T	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1120						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I1120T(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GAACTTAAAATAAAAGATAAA	0.318																																																1	Substitution - Missense(1)	ovary(1)	18											49.0	54.0	52.0					18																	9256624		2197	4287	6484	9246624	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3359T>C	18.37:g.9256624T>C	ENSP00000262126:p.Ile1120Thr	Unknown		x	x	x	9246624	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	9.726	1.160913	0.21538	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.63913	-0.07;-0.07	5.47	5.47	0.80525	.	0.625435	0.17746	N	0.163385	T	0.38665	0.1049	N	0.08118	0	0.24424	N	0.994603	B;B	0.14012	0.009;0.005	B;B	0.15870	0.014;0.004	T	0.18587	-1.0332	10	0.14656	T	0.56	-11.8817	9.9849	0.41835	0.0:0.0757:0.0:0.9243	.	1097;1120	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	T	1097;1120	ENSP00000372932:I1097T;ENSP00000262126:I1120T	ENSP00000262126:I1120T	I	+	2	0	ANKRD12	9246624	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.024000	0.41049	2.073000	0.62155	0.528000	0.53228	ATA		0.318	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		Missense_Mutation
RIOK3	8780	broad.mit.edu	37	18	21044582	21044582	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr18:21044582G>C	ENST00000339486.3	+	5	1150	c.533G>C	c.(532-534)aGa>aCa	p.R178T	RIOK3_ENST00000581585.1_Missense_Mutation_p.R162T|RIOK3_ENST00000577501.1_Missense_Mutation_p.R178T	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	178					chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R178T(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AACACAGCAAGAATGGAAAAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	18											73.0	69.0	70.0					18																	21044582		2203	4300	6503	19298580	SO:0001583	missense	8780			AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.533G>C	18.37:g.21044582G>C	ENSP00000341874:p.Arg178Thr	Somatic		x	x	x	19298580	Q8IXN9	Missense_Mutation	SNP	ENST00000339486.3	37	CCDS11877.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668525	0.88348	.	.	ENSG00000101782	ENST00000339486	T	0.10005	2.92	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.26810	0.0656	M	0.78049	2.395	0.80722	D	1	P;D;D	0.57899	0.944;0.981;0.968	P;P;B	0.48921	0.476;0.595;0.391	T	0.00621	-1.1640	10	0.72032	D	0.01	-9.2426	20.4745	0.99168	0.0:0.0:1.0:0.0	.	162;178;178	B4E1Q4;O14730-2;O14730	.;.;RIOK3_HUMAN	T	178	ENSP00000341874:R178T	ENSP00000341874:R178T	R	+	2	0	RIOK3	19298580	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.449000	0.97603	2.941000	0.99782	0.655000	0.94253	AGA		0.338	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1	NM_003831		Missense_Mutation
CDH20	28316	broad.mit.edu	37	18	59157965	59157965	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr18:59157965G>C	ENST00000262717.4	+	2	577	c.179G>C	c.(178-180)aGc>aCc	p.S60T	CDH20_ENST00000538374.1_Missense_Mutation_p.S60T|CDH20_ENST00000536675.2_Missense_Mutation_p.S60T			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	60					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S60T(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				ACCAAGAGGAGCTGGGTTTGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	18											121.0	120.0	121.0					18																	59157965		2203	4300	6503	57308945	SO:0001583	missense	28316			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.179G>C	18.37:g.59157965G>C	ENSP00000262717:p.Ser60Thr	Somatic		x	x	x	57308945	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240444	0.79912	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.00325	8.1;8.1;8.1	5.27	5.27	0.74061	Cadherin-like (1);	0.043338	0.85682	D	0.000000	T	0.00328	0.0010	N	0.24115	0.695	0.53005	D	0.999964	D	0.54772	0.968	P	0.55260	0.772	D	0.94673	0.7858	10	0.87932	D	0	.	19.2658	0.93984	0.0:0.0:1.0:0.0	.	60	Q9HBT6	CAD20_HUMAN	T	60	ENSP00000444767:S60T;ENSP00000442226:S60T;ENSP00000262717:S60T	ENSP00000262717:S60T	S	+	2	0	CDH20	57308945	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	9.140000	0.94607	2.620000	0.88729	0.563000	0.77884	AGC		0.512	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891		Missense_Mutation
FAM69C	125704	broad.mit.edu	37	18	72103739	72103739	+	Missense_Mutation	SNP	C	C	A	rs76187278		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr18:72103739C>A	ENST00000343998.6	-	4	1265	c.1257G>T	c.(1255-1257)aaG>aaT	p.K419N	FAM69C_ENST00000400291.2_Missense_Mutation_p.K120N	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C	419						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.K120N(2)		breast(1)|large_intestine(2)|ovary(2)	5						AGAGTGGCTACTTCTCTGCCT	0.547																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	18											28.0	32.0	31.0					18																	72103739		1943	4141	6084	70254719	SO:0001583	missense	125704			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	ENST00000343998.6:c.1257G>T	18.37:g.72103739C>A	ENSP00000344331:p.Lys419Asn	Unknown		x	x	x	70254719		Missense_Mutation	SNP	ENST00000343998.6	37	CCDS42445.2	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	12.19	1.862932	0.32884	.	.	ENSG00000187773	ENST00000400291;ENST00000343998	.	.	.	4.95	0.704	0.18121	.	1.137480	0.06325	N	0.705187	T	0.42494	0.1205	L	0.57536	1.79	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.39482	-0.9612	9	0.51188	T	0.08	.	5.4945	0.16795	0.1275:0.5409:0.2498:0.0817	.	419	Q0P6D2	FA69C_HUMAN	N	120;419	.	ENSP00000344331:K419N	K	-	3	2	FAM69C	70254719	0.106000	0.21978	0.002000	0.10522	0.049000	0.14656	0.316000	0.19469	0.573000	0.29400	0.558000	0.71614	AAG		0.547	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346971.2	XM_058931		Missense_Mutation
EBI3	10148	broad.mit.edu	37	19	4229575	4229575	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:4229575G>C	ENST00000221847.5	+	1	81	c.28G>C	c.(28-30)Gtc>Ctc	p.V10L		NM_005755.2	NP_005746.2	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3	10					cytokine-mediated signaling pathway (GO:0019221)|humoral immune response (GO:0006959)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|T-helper 1 type immune response (GO:0042088)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)	p.V10L(1)		large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGCCCTTGTCCTCTGGGC	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											30.0	30.0	30.0					19																	4229575		2201	4300	6501	4180575	SO:0001583	missense	10148			L08187	CCDS12123.1	19p13	2013-02-11	2008-09-12		ENSG00000105246	ENSG00000105246		"""Fibronectin type III domain containing"""	3129	protein-coding gene	gene with protein product	"""IL27 subunit"", ""IL35 subunit"""	605816				8551575	Standard	NM_005755		Approved		uc002lzu.3	Q14213		ENST00000221847.5:c.28G>C	19.37:g.4229575G>C	ENSP00000221847:p.Val10Leu	Unknown		x	x	x	4180575	A0N0N2|O75269	Missense_Mutation	SNP	ENST00000221847.5	37	CCDS12123.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	8.906	0.957570	0.18507	.	.	ENSG00000105246	ENST00000221847	T	0.21361	2.01	4.23	0.712	0.18167	.	11.256200	0.00424	N	0.000063	T	0.10294	0.0252	N	0.03608	-0.345	0.09310	N	1	B	0.18461	0.028	B	0.14578	0.011	T	0.20940	-1.0260	10	0.42905	T	0.14	-9.6631	4.1896	0.10414	0.2084:0.0:0.6098:0.1818	.	10	Q14213	IL27B_HUMAN	L	10	ENSP00000221847:V10L	ENSP00000221847:V10L	V	+	1	0	EBI3	4180575	0.000000	0.05858	0.007000	0.13788	0.051000	0.14879	-0.163000	0.09997	0.133000	0.18654	0.491000	0.48974	GTC		0.667	EBI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458005.1			Missense_Mutation
TIMM44	10469	broad.mit.edu	37	19	7992971	7992971	+	Silent	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:7992971G>A	ENST00000270538.3	-	11	1387	c.1119C>T	c.(1117-1119)gaC>gaT	p.D373D	CTD-3193O13.8_ENST00000594308.1_RNA|TIMM44_ENST00000598968.1_5'UTR|CTXN1_ENST00000318978.4_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	373					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)	p.D373D(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						CGTCGACGTTGTCAATGTCTA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											142.0	101.0	115.0					19																	7992971		2203	4300	6503	7898971	SO:0001819	synonymous_variant	10469			AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.1119C>T	19.37:g.7992971G>A		Unknown		x	x	x	7898971	A8K0R9|D6W664|Q8N193	Silent	SNP	ENST00000270538.3	37	CCDS12192.1	SNP	48	Broad																																																																																				0.637	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461596.3			Silent
ZNF121	7675	broad.mit.edu	37	19	9677491	9677491	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:9677491G>A	ENST00000586602.1	-	6	714	c.298C>T	c.(298-300)Cag>Tag	p.Q100*	ZNF121_ENST00000320451.6_Nonsense_Mutation_p.Q100*			P58317	ZN121_HUMAN	zinc finger protein 121	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q100*(1)		breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						AGATGTGACTGATCAACAAAG	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	19											114.0	94.0	101.0					19																	9677491		2203	4300	6503	9538491	SO:0001587	stop_gained	7675			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.298C>T	19.37:g.9677491G>A	ENSP00000468643:p.Gln100*	Unknown		x	x	x	9538491		Nonsense_Mutation	SNP	ENST00000586602.1	37		SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	13.82	2.351336	0.41700	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	.	.	.	1.29	0.0793	0.14415	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	6.868	0.24104	0.0:0.5783:0.4216:0.0	.	.	.	.	X	100	.	ENSP00000326967:Q100X	Q	-	1	0	ZNF121	9538491	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.747000	0.04823	0.082000	0.17018	0.484000	0.47621	CAG		0.443	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727		Nonsense_Mutation
OLFM2	93145	broad.mit.edu	37	19	9965216	9965216	+	Silent	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:9965216G>C	ENST00000264833.4	-	6	1196	c.1011C>G	c.(1009-1011)acC>acG	p.T337T	OLFM2_ENST00000590841.1_Silent_p.T259T	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	337	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)		p.T337T(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						TCTGGTTGGTGGTGTACACAG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											67.0	64.0	65.0					19																	9965216		2203	4300	6503	9826216	SO:0001819	synonymous_variant	93145			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.1011C>G	19.37:g.9965216G>C		Unknown		x	x	x	9826216	Q6IMJ3|Q96FC2	Silent	SNP	ENST00000264833.4	37	CCDS12221.1	SNP	47	Broad																																																																																				0.657	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1			Silent
TYK2	7297	broad.mit.edu	37	19	10473303	10473303	+	Silent	SNP	G	G	A	rs200752112		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:10473303G>A	ENST00000525621.1	-	10	1879	c.1398C>T	c.(1396-1398)ccC>ccT	p.P466P	TYK2_ENST00000524462.1_Silent_p.P281P|TYK2_ENST00000529370.1_Silent_p.P466P|TYK2_ENST00000264818.6_Silent_p.P466P	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	466	SH2; atypical.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.P466P(1)		breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GGCCGTCCTCGGGCCGCAGCT	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		16757	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19						G		1,4197		0,1,2098	39.0	34.0	35.0		1398	-9.8	0.0	19		35	0,8190		0,0,4095	no	coding-synonymous	TYK2	NM_003331.4		0,1,6193	AA,AG,GG		0.0,0.0238,0.0081		466/1188	10473303	1,12387	2099	4095	6194	10334303	SO:0001819	synonymous_variant	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1398C>T	19.37:g.10473303G>A		Unknown		x	x	x	10334303	Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	37	CCDS12236.1	SNP	39	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.175	1.022006	0.19433	2.38E-4	0.0	ENSG00000105397	ENST00000525220	T	0.09163	3.01	4.89	-9.77	0.00500	.	0.595752	0.12386	N	0.473480	T	0.08088	0.0202	.	.	.	0.50632	D	0.999887	.	.	.	.	.	.	T	0.43507	-0.9387	7	0.41790	T	0.15	-6.6221	1.9766	0.03417	0.2501:0.2018:0.0902:0.458	.	.	.	.	L	179	ENSP00000434931:P179L	ENSP00000434931:P179L	P	-	2	0	TYK2	10334303	0.000000	0.05858	0.000000	0.03702	0.952000	0.60782	-3.582000	0.00424	-2.757000	0.00371	-0.258000	0.10820	CCG		0.657	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			Silent
IL27RA	9466	broad.mit.edu	37	19	14162431	14162431	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:14162431G>T	ENST00000263379.2	+	12	1666	c.1541G>T	c.(1540-1542)aGg>aTg	p.R514M		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	514					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.R514M(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						AACACCCTGAGGTGGAAAGTT	0.448																																					Colon(164;1849 1896 4443 37792 47834)											1	Substitution - Missense(1)	ovary(1)	19											116.0	102.0	107.0					19																	14162431		2203	4300	6503	14023431	SO:0001583	missense	9466			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1541G>T	19.37:g.14162431G>T	ENSP00000263379:p.Arg514Met	Unknown		x	x	x	14023431	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	CCDS12303.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957724	0.34565	.	.	ENSG00000104998	ENST00000263379	T	0.27104	1.69	5.07	-3.22	0.05125	Fibronectin, type III (1);	1.173350	0.06360	N	0.711591	T	0.18341	0.0440	L	0.40543	1.245	0.09310	N	1	P	0.43352	0.804	B	0.37780	0.258	T	0.25082	-1.0142	10	0.46703	T	0.11	-19.0221	7.0181	0.24899	0.3302:0.1516:0.5182:0.0	.	514	Q6UWB1	I27RA_HUMAN	M	514	ENSP00000263379:R514M	ENSP00000263379:R514M	R	+	2	0	IL27RA	14023431	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-0.818000	0.04467	-0.794000	0.04468	0.394000	0.25966	AGG		0.448	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843		Missense_Mutation
CILP2	148113	broad.mit.edu	37	19	19656673	19656673	+	Missense_Mutation	SNP	C	C	A	rs372001022		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:19656673C>A	ENST00000291495.5	+	8	3404	c.3319C>A	c.(3319-3321)Cca>Aca	p.P1107T	CILP2_ENST00000586018.1_Missense_Mutation_p.P1113T	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	1107						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.P1107T(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GTGCCGGGAGCCACCGGCCGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	19											11.0	11.0	11.0					19																	19656673		2119	4160	6279	19517673	SO:0001583	missense	148113			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.3319C>A	19.37:g.19656673C>A	ENSP00000291495:p.Pro1107Thr	Unknown		x	x	x	19517673	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373709	0.24857	.	.	ENSG00000160161	ENST00000291495	T	0.50548	0.74	5.57	4.53	0.55603	.	0.102654	0.64402	D	0.000006	T	0.32466	0.0830	N	0.22421	0.69	0.35165	D	0.771048	B;B	0.32507	0.373;0.373	B;B	0.28709	0.093;0.093	T	0.47315	-0.9127	10	0.52906	T	0.07	-10.1831	11.6439	0.51250	0.3223:0.6777:0.0:0.0	.	1107;1107	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	T	1107	ENSP00000291495:P1107T	ENSP00000291495:P1107T	P	+	1	0	CILP2	19517673	0.935000	0.31712	0.950000	0.38849	0.476000	0.33039	1.082000	0.30803	1.364000	0.46038	0.555000	0.69702	CCA		0.652	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221		Missense_Mutation
ANKRD27	84079	broad.mit.edu	37	19	33110432	33110432	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:33110432G>C	ENST00000306065.4	-	19	2013	c.1855C>G	c.(1855-1857)Ctg>Gtg	p.L619V		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	619					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.L619V(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					TCGAAGGACAGGTGATAGGCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											101.0	94.0	96.0					19																	33110432		2203	4300	6503	37802272	SO:0001583	missense	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1855C>G	19.37:g.33110432G>C	ENSP00000304292:p.Leu619Val	Unknown		x	x	x	37802272	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	5.139	0.211270	0.09757	.	.	ENSG00000105186	ENST00000306065	T	0.63580	-0.05	4.86	2.7	0.31948	Ankyrin repeat-containing domain (2);	0.322164	0.22169	N	0.063673	T	0.52125	0.1715	M	0.61703	1.905	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.39781	-0.9597	10	0.27082	T	0.32	-0.4886	5.3855	0.16216	0.2474:0.1467:0.6059:0.0	.	619	Q96NW4	ANR27_HUMAN	V	619	ENSP00000304292:L619V	ENSP00000304292:L619V	L	-	1	2	ANKRD27	37802272	0.002000	0.14202	0.001000	0.08648	0.085000	0.17905	0.706000	0.25690	0.464000	0.27142	0.462000	0.41574	CTG		0.582	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139		Missense_Mutation
WDR88	126248	broad.mit.edu	37	19	33642161	33642161	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:33642161A>T	ENST00000355868.3	+	6	830	c.754A>T	c.(754-756)Agg>Tgg	p.R252W	WDR88_ENST00000361680.2_Missense_Mutation_p.R252W	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	252								p.R252W(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					CTCATTGGACAGGTGCATCAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	19											123.0	81.0	95.0					19																	33642161		2203	4300	6503	38334001	SO:0001583	missense	126248			BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.754A>T	19.37:g.33642161A>T	ENSP00000348129:p.Arg252Trp	Unknown		x	x	x	38334001	Q8NEF8	Missense_Mutation	SNP	ENST00000355868.3	37	CCDS12429.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	18.39	3.612977	0.66672	.	.	ENSG00000166359	ENST00000355868;ENST00000361680	T;T	0.42900	0.96;0.96	5.89	4.81	0.61882	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	2.361970	0.01696	N	0.026905	T	0.64416	0.2596	L	0.53561	1.675	0.25045	N	0.991179	D	0.63880	0.993	D	0.65573	0.936	T	0.52815	-0.8525	10	0.72032	D	0.01	.	13.4499	0.61165	0.8611:0.1389:0.0:0.0	.	252	Q6ZMY6	WDR88_HUMAN	W	252	ENSP00000348129:R252W;ENSP00000355148:R252W	ENSP00000348129:R252W	R	+	1	2	WDR88	38334001	0.996000	0.38824	0.928000	0.36995	0.564000	0.35744	3.204000	0.51082	2.246000	0.74042	0.533000	0.62120	AGG		0.557	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479		Missense_Mutation
ZNF345	25850	broad.mit.edu	37	19	37368496	37368496	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr19:37368496A>T	ENST00000529555.1	+	2	1552	c.764A>T	c.(763-765)gAg>gTg	p.E255V	ZNF345_ENST00000589046.1_Missense_Mutation_p.E255V|ZNF345_ENST00000420450.1_Missense_Mutation_p.E255V|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	255					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E255V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATACCGGTGAGAAACCATAT	0.413																																																1	Substitution - Missense(1)	ovary(1)	19											73.0	75.0	74.0					19																	37368496		2203	4300	6503	42060336	SO:0001583	missense	25850			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.764A>T	19.37:g.37368496A>T	ENSP00000431202:p.Glu255Val	Unknown		x	x	x	42060336		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	19.52	3.844034	0.71488	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000344705	T;T	0.26810	1.71;1.71	3.96	3.96	0.45880	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45955	0.1368	M	0.66297	2.02	0.32223	N	0.57504	D	0.61697	0.99	D	0.66979	0.948	T	0.57057	-0.7876	9	0.87932	D	0	.	11.0798	0.48053	1.0:0.0:0.0:0.0	.	255	Q14585	ZN345_HUMAN	V	255;255;19	ENSP00000431216:E255V;ENSP00000431202:E255V	ENSP00000442320:E19V	E	+	2	0	ZNF345	42060336	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.339000	0.52135	1.765000	0.52091	0.459000	0.35465	GAG		0.413	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1			Missense_Mutation
ADCY3	109	broad.mit.edu	37	2	25141784	25141784	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:25141784G>A	ENST00000260600.5	-	1	924	c.73C>T	c.(73-75)Ccc>Tcc	p.P25S		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	25					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.P25S(1)		NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GGGTCGGAGGGCAGGCTGACG	0.647																																																1	Substitution - Missense(1)	ovary(1)	2											14.0	18.0	16.0					2																	25141784		2201	4300	6501	24995288	SO:0001583	missense	109			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.73C>T	2.37:g.25141784G>A	ENSP00000260600:p.Pro25Ser	Unknown		x	x	x	24995288	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835635	0.71373	.	.	ENSG00000138031	ENST00000260600;ENST00000435135;ENST00000438445	T;T;T	0.81163	-1.46;-1.34;0.19	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.76528	0.4000	L	0.51422	1.61	0.80722	D	1	B;B	0.28512	0.214;0.214	B;B	0.28553	0.091;0.091	T	0.77848	-0.2435	10	0.59425	D	0.04	.	15.1788	0.72938	0.0:0.0:1.0:0.0	.	25;25	B7ZLX9;O60266	.;ADCY3_HUMAN	S	25	ENSP00000260600:P25S;ENSP00000389799:P25S;ENSP00000406153:P25S	ENSP00000260600:P25S	P	-	1	0	ADCY3	24995288	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.309000	0.78937	2.145000	0.66743	0.467000	0.42956	CCC		0.647	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2			Missense_Mutation
POMC	5443	broad.mit.edu	37	2	25387508	25387508	+	Splice_Site	SNP	A	A	C			TCGA-13-1510-01	TCGA-13-1510-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:25387508A>C	ENST00000405623.1	-	2	588		c.e2+1		POMC_ENST00000264708.3_Splice_Site|POMC_ENST00000395826.2_Splice_Site|POMC_ENST00000380794.1_Splice_Site			P01189	COLI_HUMAN	proopiomelanocortin						cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)	p.?(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	TGGCCCACGTACCAGCAGGTT	0.557																																					Colon(110;1515 1566 8452 10082 43216)											1	Unknown(1)	ovary(1)	2											103.0	101.0	102.0					2																	25387508		2203	4300	6503	25241012	SO:0001630	splice_region_variant	5443				CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.132+1T>G	2.37:g.25387508A>C		Somatic		x	x	x	25241012	P78442|Q53T23|Q9UD39|Q9UD40	Splice_Site_SNP	SNP	ENST00000405623.1	37	CCDS1717.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	19.22	3.785665	0.70337	.	.	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4351	0.67274	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POMC	25241012	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.216000	0.72212	2.146000	0.66826	0.379000	0.24179	.		0.557	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	Intron	Splice_Site_SNP
PLB1	151056	broad.mit.edu	37	2	28814614	28814614	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:28814614G>C	ENST00000327757.5	+	31	2219	c.2175G>C	c.(2173-2175)ttG>ttC	p.L725F	PLB1_ENST00000422425.2_Missense_Mutation_p.L714F|PLB1_ENST00000329020.6_Missense_Mutation_p.L413F	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	725	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.L725F(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					CTTCTGCCTTGCACCCTACCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	2											93.0	87.0	89.0					2																	28814614		2203	4300	6503	28668118	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2175G>C	2.37:g.28814614G>C	ENSP00000330442:p.Leu725Phe	Somatic		x	x	x	28668118	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	SNP	46	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.933|8.933	0.963923|0.963923	0.18583|0.18583	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000404858|ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020	.|T;T;T;T	.|0.11930	.|2.74;2.75;2.73;2.74	5.83|5.83	-11.7|-11.7	0.00046|0.00046	.|.	.|0.708385	.|0.12776	.|N	.|0.440066	T|T	0.04907|0.04907	0.0132|0.0132	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.34372	.|0.305;0.451;0.278;0.443	.|B;B;B;B	.|0.40066	.|0.318;0.306;0.212;0.11	T|T	0.44636|0.44636	-0.9315|-0.9315	5|10	.|0.56958	.|D	.|0.05	-1.1054|-1.1054	2.7954|2.7954	0.05400|0.05400	0.4546:0.1859:0.0732:0.2864|0.4546:0.1859:0.0732:0.2864	.|.	.|714;725;413;725	.|Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6	.|.;.;.;PLB1_HUMAN	S|F	713|725;714;435;413	.|ENSP00000330442:L725F;ENSP00000416440:L714F;ENSP00000392493:L435F;ENSP00000330729:L413F	.|ENSP00000330442:L725F	C|L	+|+	2|3	0|2	PLB1|PLB1	28668118|28668118	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.120000|0.120000	0.20174|0.20174	-4.339000|-4.339000	0.00250|0.00250	-4.130000|-4.130000	0.00071|0.00071	-1.193000|-1.193000	0.01689|0.01689	TGC|TTG		0.572	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2			Missense_Mutation
SPR	6697	broad.mit.edu	37	2	73118520	73118520	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:73118520G>A	ENST00000234454.5	+	3	713	c.640G>A	c.(640-642)Gtg>Atg	p.V214M	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	214					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)	p.V214M(1)		lung(4)|ovary(2)	6						GGAGACCTCCGTGGACCCAGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											70.0	66.0	67.0					2																	73118520		2203	4300	6503	72972028	SO:0001583	missense	6697				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.640G>A	2.37:g.73118520G>A	ENSP00000234454:p.Val214Met	Somatic		x	x	x	72972028	A8K741|D6W5H2|Q53GI9|Q9UBB1	Missense_Mutation	SNP	ENST00000234454.5	37	CCDS1920.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	4.834	0.155107	0.09236	.	.	ENSG00000116096	ENST00000234454	D	0.91521	-2.86	4.72	-1.54	0.08584	NAD(P)-binding domain (1);	0.714340	0.13431	N	0.388400	T	0.75635	0.3876	N	0.04090	-0.28	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.63427	-0.6640	10	0.37606	T	0.19	-27.5021	8.4194	0.32692	0.5359:0.0:0.4641:0.0	.	214	P35270	SPRE_HUMAN	M	214	ENSP00000234454:V214M	ENSP00000234454:V214M	V	+	1	0	SPR	72972028	0.000000	0.05858	0.087000	0.20705	0.520000	0.34377	0.614000	0.24314	-0.160000	0.11002	-1.300000	0.01332	GTG		0.557	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251993.2			Missense_Mutation
ALMS1	7840	broad.mit.edu	37	2	73646442	73646442	+	Silent	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:73646442G>T	ENST00000264448.6	+	3	753	c.642G>T	c.(640-642)ctG>ctT	p.L214L	ALMS1_ENST00000377715.1_Silent_p.L214L|ALMS1_ENST00000409009.1_Silent_p.L172L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	214					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.L214L(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GTTCTCCACTGCTAGGTAATG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	2											125.0	122.0	123.0					2																	73646442		1836	4095	5931	73499950	SO:0001819	synonymous_variant	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.642G>T	2.37:g.73646442G>T		Unknown		x	x	x	73499950	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	37	CCDS42697.1	SNP	46	Broad																																																																																				0.413	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		Silent
SH3RF3	344558	broad.mit.edu	37	2	109964324	109964324	+	Silent	SNP	C	C	T	rs377473947		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:109964324C>T	ENST00000309415.6	+	2	768	c.768C>T	c.(766-768)caC>caT	p.H256H		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	256	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)	p.H256H(1)		endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CCTTGCCACACGCCCCGCCCC	0.582																																																1	Substitution - coding silent(1)	ovary(1)	2						C		0,4188		0,0,2094	40.0	46.0	44.0		768	-2.1	0.0	2		44	2,8428		0,2,4213	no	coding-synonymous	SH3RF3	NM_001099289.1		0,2,6307	TT,TC,CC		0.0237,0.0,0.0159		256/883	109964324	2,12616	2094	4215	6309	109330756	SO:0001819	synonymous_variant	344558			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.768C>T	2.37:g.109964324C>T		Unknown		x	x	x	109330756	A0SDZ7|A8MPR1|Q8NDU1	Silent	SNP	ENST00000309415.6	37		SNP	19	Broad																																																																																				0.582	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289		Silent
SCN3A	6328	broad.mit.edu	37	2	165952156	165952156	+	Silent	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:165952156A>G	ENST00000360093.3	-	25	4787	c.4296T>C	c.(4294-4296)gtT>gtC	p.V1432V	SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000409101.3_Silent_p.V1383V|SCN3A_ENST00000283254.7_Silent_p.V1432V|SCN3A_ENST00000540861.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1432					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.V1432V(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGAAGTTTAACCTAAATGA	0.269																																																1	Substitution - coding silent(1)	ovary(1)	2											38.0	37.0	37.0					2																	165952156		2198	4293	6491	165660402	SO:0001819	synonymous_variant	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4296T>C	2.37:g.165952156A>G		Somatic		x	x	x	165660402	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37		SNP	13	Broad																																																																																				0.269	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922		Silent
DNAH7	56171	broad.mit.edu	37	2	196740466	196740466	+	Silent	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:196740466A>G	ENST00000312428.6	-	38	6319	c.6219T>C	c.(6217-6219)taT>taC	p.Y2073Y		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2073	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.Y2073Y(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CTTTTAGATCATACCAGTTCC	0.413																																																1	Substitution - coding silent(1)	ovary(1)	2											91.0	86.0	88.0					2																	196740466		1882	4111	5993	196448711	SO:0001819	synonymous_variant	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6219T>C	2.37:g.196740466A>G		Unknown		x	x	x	196448711	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1	SNP	8	Broad																																																																																				0.413	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		Silent
MAP2	4133	broad.mit.edu	37	2	210518128	210518128	+	Silent	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:210518128G>A	ENST00000360351.4	+	4	740	c.234G>A	c.(232-234)gaG>gaA	p.E78E	MAP2_ENST00000199940.6_Silent_p.E78E|MAP2_ENST00000447185.1_Silent_p.E78E|MAP2_ENST00000361559.4_Silent_p.E78E|MAP2_ENST00000392194.1_Silent_p.E78E	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	78					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.E78E(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCAACGGAGAGCTGACCTCAG	0.473																																					Pancreas(27;423 979 28787 29963)											1	Substitution - coding silent(1)	ovary(1)	2											100.0	102.0	101.0					2																	210518128		2203	4300	6503	210226373	SO:0001819	synonymous_variant	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.234G>A	2.37:g.210518128G>A		Somatic		x	x	x	210226373	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	CCDS2384.1	SNP	34	Broad																																																																																				0.473	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		Silent
RRBP1	6238	broad.mit.edu	37	20	17641138	17641138	+	Silent	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr20:17641138G>A	ENST00000377813.1	-	3	318	c.15C>T	c.(13-15)gaC>gaT	p.D5D	RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000246043.4_Silent_p.D5D|RRBP1_ENST00000377807.2_Silent_p.D5D|RRBP1_ENST00000360807.4_Silent_p.D5D			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	5					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)	p.D5D(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						AGGTTTGAGTGTCGTAAATAT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	20											77.0	77.0	77.0					20																	17641138		2203	4300	6503	17589138	SO:0001819	synonymous_variant	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.15C>T	20.37:g.17641138G>A		Unknown		x	x	x	17589138	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	ENST00000377813.1	37		SNP	48	Broad																																																																																				0.438	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576		Silent
CFAP61	26074	broad.mit.edu	37	20	20243721	20243721	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr20:20243721A>T	ENST00000245957.5	+	21	2526	c.2450A>T	c.(2449-2451)gAg>gTg	p.E817V	C20orf26_ENST00000377309.2_Missense_Mutation_p.E173V|C20orf26_ENST00000377293.1_Missense_Mutation_p.E173V|RP5-1096J16.1_ENST00000460400.1_RNA|C20orf26_ENST00000389656.3_Missense_Mutation_p.E173V	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		817								p.E817V(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AACGAGGAAGAGGATTGCTTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	20											131.0	125.0	127.0					20																	20243721		2203	4300	6503	20191721	SO:0001583	missense	26074																														ENST00000245957.5:c.2450A>T	20.37:g.20243721A>T	ENSP00000245957:p.Glu817Val	Somatic		x	x	x	20191721	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	8.710	0.911709	0.17833	.	.	ENSG00000089101	ENST00000343997;ENST00000377309;ENST00000389656;ENST00000389655;ENST00000245957;ENST00000377293	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.1	5.1	0.69264	.	0.444680	0.25400	N	0.030952	T	0.33818	0.0876	L	0.36672	1.1	0.37293	D	0.908343	P;P;D	0.57571	0.692;0.682;0.98	B;B;P	0.52424	0.281;0.222;0.698	T	0.12426	-1.0548	10	0.13470	T	0.59	.	15.0607	0.71951	1.0:0.0:0.0:0.0	.	797;173;817	F8W6K4;Q8NHU2-5;Q8NHU2	.;.;CT026_HUMAN	V	757;173;173;797;817;173	ENSP00000366524:E173V;ENSP00000374307:E173V;ENSP00000245957:E817V;ENSP00000366508:E173V	ENSP00000245957:E817V	E	+	2	0	C20orf26	20191721	1.000000	0.71417	0.977000	0.42913	0.048000	0.14542	5.189000	0.65098	2.136000	0.66102	0.533000	0.62120	GAG		0.453	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			Missense_Mutation
SNAI1	6615	broad.mit.edu	37	20	48600422	48600422	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr20:48600422G>C	ENST00000244050.2	+	2	205	c.144G>C	c.(142-144)gaG>gaC	p.E48D		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	48					cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.E48D(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CACCTCCGGAGATCCTCAACC	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											55.0	57.0	56.0					20																	48600422		2203	4300	6503	48033829	SO:0001583	missense	6615			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.144G>C	20.37:g.48600422G>C	ENSP00000244050:p.Glu48Asp	Unknown		x	x	x	48033829	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	ENST00000244050.2	37	CCDS13423.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	17.97	3.519013	0.64634	.	.	ENSG00000124216	ENST00000244050	T	0.24350	1.86	4.73	4.73	0.59995	.	0.189453	0.43579	D	0.000560	T	0.20700	0.0498	L	0.43923	1.385	0.43238	D	0.995145	B	0.18166	0.026	B	0.17433	0.018	T	0.04752	-1.0929	10	0.26408	T	0.33	-32.8348	9.7236	0.40317	0.0801:0.1425:0.7774:0.0	.	48	O95863	SNAI1_HUMAN	D	48	ENSP00000244050:E48D	ENSP00000244050:E48D	E	+	3	2	SNAI1	48033829	1.000000	0.71417	0.999000	0.59377	0.850000	0.48378	2.005000	0.40864	2.177000	0.69029	0.557000	0.71058	GAG		0.602	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080350.1			Missense_Mutation
PHACTR3	116154	broad.mit.edu	37	20	58318189	58318189	+	Missense_Mutation	SNP	G	G	A	rs143288140		TCGA-13-1510-01	TCGA-13-1510-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr20:58318189G>A	ENST00000371015.1	+	2	613	c.146G>A	c.(145-147)cGt>cAt	p.R49H	PHACTR3_ENST00000355648.4_Missense_Mutation_p.R8H|PHACTR3_ENST00000395639.4_Missense_Mutation_p.R8H|PHACTR3_ENST00000361300.4_Missense_Mutation_p.R8H|PHACTR3_ENST00000359926.3_Missense_Mutation_p.R46H|PHACTR3_ENST00000395636.2_Missense_Mutation_p.R8H|PHACTR3_ENST00000541461.1_Missense_Mutation_p.R8H	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	49						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.R49H(3)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CCCCCGGCGCGTCCTGAATAT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18499	0.001		0.0	False		,,,				2504	0.0															3	Substitution - Missense(3)	ovary(1)|lung(1)|large_intestine(1)	20						G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	86.0	95.0	91.0		137,23,146,23,23	4.4	0.1	20	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	PHACTR3	NM_001199505.1,NM_001199506.1,NM_080672.3,NM_183244.1,NM_183246.1	29,29,29,29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	46/557,8/519,49/560,8/519,8/449	58318189	2,13004	2203	4300	6503	57751584	SO:0001583	missense	116154			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.146G>A	20.37:g.58318189G>A	ENSP00000360054:p.Arg49His	Somatic		x	x	x	57751584	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	CCDS13480.1	SNP	40	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.84	2.357583	0.41801	0.0	2.33E-4	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.45668	1.58;1.68;0.89;1.27;1.27;1.27;0.89	4.4	4.4	0.53042	.	0.105543	0.64402	D	0.000003	T	0.31857	0.0810	L	0.43152	1.355	0.54753	D	0.999982	B;P;P	0.46395	0.026;0.53;0.877	B;B;B	0.32022	0.016;0.085;0.139	T	0.32348	-0.9910	10	0.48119	T	0.1	-14.0518	15.9499	0.79827	0.0:0.0:1.0:0.0	.	8;49;46	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	H	46;49;8;8;8;8;8	ENSP00000353002:R46H;ENSP00000360054:R49H;ENSP00000379001:R8H;ENSP00000442483:R8H;ENSP00000347866:R8H;ENSP00000378998:R8H;ENSP00000354555:R8H	ENSP00000347866:R8H	R	+	2	0	PHACTR3	57751584	1.000000	0.71417	0.077000	0.20336	0.558000	0.35554	4.878000	0.63093	1.988000	0.58038	0.455000	0.32223	CGT		0.567	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		Missense_Mutation
MYT1	4661	broad.mit.edu	37	20	62848515	62848515	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr20:62848515A>G	ENST00000328439.1	+	11	2091	c.1727A>G	c.(1726-1728)gAg>gGg	p.E576G	MYT1_ENST00000360149.4_Missense_Mutation_p.E278G|MYT1_ENST00000536311.1_Missense_Mutation_p.E576G	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E576G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TTGGCCAAGGAGCTGGAGAAG	0.582																																					GBM(59;481 1041 20555 21139 33705)											1	Substitution - Missense(1)	ovary(1)	20											93.0	90.0	91.0					20																	62848515		2203	4300	6503	62318959	SO:0001583	missense	4661			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1727A>G	20.37:g.62848515A>G	ENSP00000327465:p.Glu576Gly	Unknown		x	x	x	62318959	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	18.28	3.589674	0.66105	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.59772	0.24;0.24;0.24	5.67	4.57	0.56435	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.73194	0.3556	M	0.71206	2.165	0.53688	D	0.999979	D;D;P	0.89917	1.0;1.0;0.955	D;D;P	0.85130	0.997;0.992;0.763	T	0.75193	-0.3404	10	0.87932	D	0	-30.4971	11.6254	0.51142	0.9307:0.0:0.0693:0.0	.	576;576;278	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	G	278;576;576	ENSP00000353269:E278G;ENSP00000327465:E576G;ENSP00000442412:E576G	ENSP00000327465:E576G	E	+	2	0	MYT1	62318959	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.204000	0.95041	0.982000	0.38575	0.533000	0.62120	GAG		0.582	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535		Missense_Mutation
MICAL3	57553	broad.mit.edu	37	22	18363984	18363984	+	Intron	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr22:18363984T>C	ENST00000441493.2	-	16	2594				MICAL3_ENST00000400561.2_Intron|MICAL3_ENST00000207726.7_Intron|MICAL3_ENST00000429452.1_Missense_Mutation_p.H776R|MICAL3_ENST00000585038.1_Missense_Mutation_p.H776R|MICAL3_ENST00000383094.3_Intron|MICAL3_ENST00000444520.1_Intron|MICAL3_ENST00000414725.2_Intron	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3						actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTGGCCGCCATGTGCCCGACA	0.557																																																0			22											123.0	127.0	126.0					22																	18363984		1568	3582	5150	16743984	SO:0001627	intron_variant	57553			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2241+4659A>G	22.37:g.18363984T>C		Unknown		x	x	x	16743984	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	SNP	51	Broad	.	.	.	.	.	.	.	.	.	.	T	8.240	0.806637	0.16467	.	.	ENSG00000093100	ENST00000429452	T	0.65549	-0.16	5.56	-8.09	0.01090	.	.	.	.	.	T	0.36026	0.0952	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24012	-1.0172	8	0.18276	T	0.48	.	8.7	0.34320	0.0:0.1182:0.3311:0.5507	.	776	B2RXJ5	.	R	776	ENSP00000414846:H776R	ENSP00000414846:H776R	H	-	2	0	XXbac-B461K10.4	16743984	0.000000	0.05858	0.000000	0.03702	0.158000	0.22134	-1.916000	0.01576	-1.252000	0.02491	-1.276000	0.01395	CAT		0.557	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1			Missense_Mutation
SF3A1	10291	broad.mit.edu	37	22	30738210	30738210	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr22:30738210C>A	ENST00000215793.8	-	6	1010	c.856G>T	c.(856-858)Gac>Tac	p.D286Y	SF3A1_ENST00000439242.1_Missense_Mutation_p.D221Y	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	286					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D286Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						GGTTGGAAGTCCACTGTTTCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	22											143.0	114.0	124.0					22																	30738210		2203	4300	6503	29068210	SO:0001583	missense	10291			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.856G>T	22.37:g.30738210C>A	ENSP00000215793:p.Asp286Tyr	Unknown		x	x	x	29068210	E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	CCDS13875.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984528	0.74474	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.35048	1.33;1.34	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.67757	0.2927	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72137	-0.4381	10	0.87932	D	0	-29.9111	19.6787	0.95950	0.0:1.0:0.0:0.0	.	286	Q15459	SF3A1_HUMAN	Y	221;286;183	ENSP00000390336:D221Y;ENSP00000215793:D286Y	ENSP00000215793:D286Y	D	-	1	0	SF3A1	29068210	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.606000	0.82863	2.884000	0.98904	0.655000	0.94253	GAC		0.547	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		Missense_Mutation
CELSR3	1951	broad.mit.edu	37	3	48686226	48686226	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:48686226C>A	ENST00000164024.4	-	18	6983	c.6703G>T	c.(6703-6705)Gcc>Tcc	p.A2235S	CELSR3_ENST00000544264.1_Missense_Mutation_p.A2240S	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2235					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A2235S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGCAGGTGGGCCAGCAGGCGG	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											48.0	51.0	50.0					3																	48686226		2203	4300	6503	48661230	SO:0001583	missense	1951			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6703G>T	3.37:g.48686226C>A	ENSP00000164024:p.Ala2235Ser	Unknown		x	x	x	48661230	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684556	0.29872	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.09350	2.99;2.99	5.1	4.17	0.49024	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.04048	0.0113	N	0.01705	-0.755	0.34725	D	0.729184	B;B	0.20550	0.016;0.046	B;B	0.26202	0.028;0.067	T	0.27434	-1.0074	9	0.08179	T	0.78	.	11.046	0.47859	0.3776:0.6224:0.0:0.0	.	2235;2305	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	S	2235;2240	ENSP00000164024:A2235S;ENSP00000445694:A2240S	ENSP00000164024:A2235S	A	-	1	0	CELSR3	48661230	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.375000	0.52410	2.376000	0.81061	0.655000	0.94253	GCC		0.597	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407		Missense_Mutation
RBM6	10180	broad.mit.edu	37	3	50095971	50095971	+	Silent	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:50095971C>G	ENST00000266022.4	+	10	2365	c.2106C>G	c.(2104-2106)ggC>ggG	p.G702G	RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000442092.1_Silent_p.G180G|RBM6_ENST00000422955.1_Silent_p.G180G|RBM6_ENST00000443081.1_Silent_p.G570G|RBM6_ENST00000539992.1_Silent_p.G44G	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	702					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G702G(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ATACCTATGGCTTTATTGACC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	3											178.0	159.0	165.0					3																	50095971		2203	4300	6503	50070975	SO:0001819	synonymous_variant	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2106C>G	3.37:g.50095971C>G		Unknown		x	x	x	50070975	O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	37	CCDS2809.1	SNP	28	Broad																																																																																				0.527	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777		Silent
CADPS	8618	broad.mit.edu	37	3	62518675	62518675	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:62518675A>T	ENST00000383710.4	-	13	2511	c.2162T>A	c.(2161-2163)gTc>gAc	p.V721D	CADPS_ENST00000357948.3_Missense_Mutation_p.V704D|CADPS_ENST00000283269.9_Missense_Mutation_p.V721D	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	721					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.V721D(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ACACCCCCGGACTCCATTTCG	0.498																																																1	Substitution - Missense(1)	ovary(1)	3											98.0	91.0	93.0					3																	62518675		2203	4300	6503	62493715	SO:0001583	missense	8618			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2162T>A	3.37:g.62518675A>T	ENSP00000373215:p.Val721Asp	Unknown		x	x	x	62493715	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	SNP	10	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	29.7|29.7|29.7	5.028299|5.028299|5.028299	0.93518|0.93518|0.93518	.|.|.	.|.|.	ENSG00000163618|ENSG00000163618|ENSG00000163618	ENST00000491424|ENST00000468271;ENST00000478434|ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	.|.|T;T;T	.|.|0.35605	.|.|1.3;1.3;1.3	5.77|5.77|5.77	5.77|5.77|5.77	0.91146|0.91146|0.91146	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.63616|0.63616|0.63616	0.2526|0.2526|0.2526	M|M|M	0.79926|0.79926|0.79926	2.475|2.475|2.475	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D	.|.|0.89917	.|.|1.0;0.994;0.999;1.0	.|.|D;D;D;D	.|.|0.97110	.|.|1.0;0.986;0.994;1.0	T|T|T	0.68697|0.68697|0.68697	-0.5340|-0.5340|-0.5340	5|5|10	.|.|0.87932	.|.|D	.|.|0	.|.|.	16.0908|16.0908|16.0908	0.81090|0.81090|0.81090	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|704;721;721;721	.|.|Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.|.|.;.;CAPS1_HUMAN;.	R|T|D	27|66;152|721;721;704;721	.|.|ENSP00000373215:V721D;ENSP00000350632:V704D;ENSP00000283269:V721D	.|.|ENSP00000283269:V721D	S|S|V	-|-|-	3|1|2	2|0|0	CADPS|CADPS|CADPS	62493715|62493715|62493715	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.928000|0.928000|0.928000	0.56348|0.56348|0.56348	9.339000|9.339000|9.339000	0.96797|0.96797|0.96797	2.202000|2.202000|2.202000	0.70862|0.70862|0.70862	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	AGT|TCC|GTC		0.498	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394		Missense_Mutation
CD80	941	broad.mit.edu	37	3	119256010	119256010	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1510-01	TCGA-13-1510-10			A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:119256010A>T	ENST00000264246.3	-	4	1036	c.674T>A	c.(673-675)gTg>gAg	p.V225E	CD80_ENST00000383668.3_Intron|CD80_ENST00000478182.1_Missense_Mutation_p.V225E|CD80_ENST00000383669.3_Missense_Mutation_p.V225E	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	225	Ig-like C2-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.V225E(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	GGTCTGATTCACTCTTAAATG	0.373																																					Melanoma(132;135 1764 1806 5833 14593)											1	Substitution - Missense(1)	ovary(1)	3											203.0	192.0	196.0					3																	119256010		2203	4300	6503	120738700	SO:0001583	missense	941				CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.674T>A	3.37:g.119256010A>T	ENSP00000264246:p.Val225Glu	Somatic		x	x	x	120738700	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	37	CCDS2989.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	18.22	3.576358	0.65878	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669	T;T;T	0.74737	-0.87;-0.87;-0.87	5.19	5.19	0.71726	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.46442	D	0.000295	D	0.84924	0.5580	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.84701	0.0728	10	0.38643	T	0.18	-18.903	11.3641	0.49662	1.0:0.0:0.0:0.0	.	225;225	Q5DTB0;P33681	.;CD80_HUMAN	E	225	ENSP00000264246:V225E;ENSP00000418364:V225E;ENSP00000373165:V225E	ENSP00000264246:V225E	V	-	2	0	CD80	120738700	0.888000	0.30383	0.788000	0.31933	0.047000	0.14425	3.987000	0.56944	2.175000	0.68902	0.528000	0.53228	GTG		0.373	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191		Missense_Mutation
CD86	942	broad.mit.edu	37	3	121822481	121822481	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:121822481T>G	ENST00000330540.2	+	3	303	c.187T>G	c.(187-189)Ttg>Gtg	p.L63V	CD86_ENST00000264468.5_Intron|CD86_ENST00000483949.1_3'UTR|CD86_ENST00000393627.2_Missense_Mutation_p.L57V|CD86_ENST00000469710.1_5'UTR|CD86_ENST00000493101.1_Intron	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	63	Ig-like V-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)	p.L63V(1)		breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	CCAGGAAAACTTGGTTCTGAA	0.433																																					GBM(67;1379 1389 36064 39806)											1	Substitution - Missense(1)	ovary(1)	3											126.0	125.0	125.0					3																	121822481		2203	4300	6503	123305171	SO:0001583	missense	942				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.187T>G	3.37:g.121822481T>G	ENSP00000332049:p.Leu63Val	Unknown		x	x	x	123305171	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	ENST00000330540.2	37	CCDS3009.1	SNP	56	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.82|10.82	1.458862|1.458862	0.26248|0.26248	.|.	.|.	ENSG00000114013|ENSG00000114013	ENST00000478741|ENST00000330540;ENST00000482356;ENST00000393627	.|T;T;T	.|0.67523	.|-0.27;-0.27;-0.27	5.13|5.13	-7.7|-7.7	0.01259|0.01259	.|Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	1.370310|1.370310	0.05187|0.05187	N|N	0.502518|0.502518	T|T	0.71316|0.71316	0.3325|0.3325	M|M	0.78637|0.78637	2.42|2.42	0.09310|0.09310	N|N	1|1	.|P	.|0.44986	.|0.847	.|P	.|0.50082	.|0.63	T|T	0.70813|0.70813	-0.4770|-0.4770	6|10	.|0.37606	.|T	.|0.19	-0.0083|-0.0083	11.8847|11.8847	0.52596|0.52596	0.1204:0.6818:0.0:0.1978|0.1204:0.6818:0.0:0.1978	.|.	.|63	.|P42081	.|CD86_HUMAN	R|V	58|63;57;57	.|ENSP00000332049:L63V;ENSP00000419116:L57V;ENSP00000377248:L57V	.|ENSP00000332049:L63V	L|L	+|+	2|1	0|2	CD86|CD86	123305171|123305171	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.019000|0.019000	0.09904|0.09904	-2.799000|-2.799000	0.00762|0.00762	-1.379000|-1.379000	0.02118|0.02118	0.533000|0.533000	0.62120|0.62120	CTT|TTG		0.433	CD86-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355671.1	NM_006889		Missense_Mutation
SLC12A8	84561	broad.mit.edu	37	3	124909290	124909290	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:124909290C>A	ENST00000393469.4	-	2	176	c.127G>T	c.(127-129)Gat>Tat	p.D43Y	SLC12A8_ENST00000423114.2_Missense_Mutation_p.D72Y|SLC12A8_ENST00000314584.7_5'UTR|SLC12A8_ENST00000469902.1_Missense_Mutation_p.D43Y	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	43					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.D43Y(1)		endometrium(2)|kidney(2)|lung(12)	16						AACACACCATCCCAGGTCCCA	0.572																																																1	Substitution - Missense(1)	ovary(1)	3											142.0	153.0	149.0					3																	124909290		2068	4215	6283	126391980	SO:0001583	missense	84561				CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.127G>T	3.37:g.124909290C>A	ENSP00000377112:p.Asp43Tyr	Unknown		x	x	x	126391980	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	37	CCDS43143.1	SNP	30	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.10|15.10	2.731975|2.731975	0.48939|0.48939	.|.	.|.	ENSG00000221955|ENSG00000221955	ENST00000393469;ENST00000423114;ENST00000469902;ENST00000462437|ENST00000479826	D;D;D;D|T	0.96104|0.80304	-2.48;-2.48;-2.48;-3.91|-1.36	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|.	.|.	.|.	.|.	D|D	0.88340|0.88340	0.6410|0.6410	M|M	0.77313|0.77313	2.365|2.365	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	D|D	0.87928|0.87928	0.2708|0.2708	9|6	0.87932|.	D|.	0|.	.|.	17.6789|17.6789	0.88237|0.88237	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	72;43|.	A0AV02-2;A0AV02|.	.;S12A8_HUMAN|.	Y|V	43;72;43;11|2	ENSP00000377112:D43Y;ENSP00000404243:D72Y;ENSP00000418783:D43Y;ENSP00000418636:D11Y|ENSP00000420197:G2V	ENSP00000377112:D43Y|.	D|G	-|-	1|2	0|0	SLC12A8|SLC12A8	126391980|126391980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.396000|7.396000	0.79891|0.79891	2.593000|2.593000	0.87608|0.87608	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.572	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628		Missense_Mutation
MBD4	8930	broad.mit.edu	37	3	129155468	129155468	+	Missense_Mutation	SNP	T	T	C	rs372593697		TCGA-13-1510-01	TCGA-13-1510-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:129155468T>C	ENST00000249910.1	-	3	1194	c.1019A>G	c.(1018-1020)aAa>aGa	p.K340R	MBD4_ENST00000503197.1_Missense_Mutation_p.K340R|MBD4_ENST00000507208.1_Missense_Mutation_p.K340R|MBD4_ENST00000429544.2_Missense_Mutation_p.K340R|MBD4_ENST00000509587.1_Intron|MBD4_ENST00000393278.2_Intron	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	340					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.K340R(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						TTCTGAGTCTTTGGCTGAACA	0.328								Base excision repair (BER), DNA glycosylases																																								1	Substitution - Missense(1)	ovary(1)	3						T	ARG/LYS	2,4404	4.2+/-10.8	0,2,2201	102.0	109.0	107.0		1019	-3.0	0.0	3		107	0,8600		0,0,4300	no	missense	MBD4	NM_003925.1	26	0,2,6501	CC,CT,TT		0.0,0.0454,0.0154	benign	340/581	129155468	2,13004	2203	4300	6503	130638158	SO:0001583	missense	8930			AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1019A>G	3.37:g.129155468T>C	ENSP00000249910:p.Lys340Arg	Somatic		x	x	x	130638158	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	37	CCDS3058.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	10.37	1.331968	0.24167	4.54E-4	0.0	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000503197;ENST00000507208	D;D;D;D	0.93133	-2.97;-2.97;-3.17;-3.17	5.65	-2.99	0.05497	.	1.130980	0.06294	N	0.699639	D	0.84647	0.5518	N	0.24115	0.695	0.22858	N	0.998647	B;B;B;B	0.09022	0.002;0.001;0.0;0.002	B;B;B;B	0.09377	0.001;0.004;0.001;0.002	T	0.69840	-0.5036	10	0.16420	T	0.52	-0.0792	5.4198	0.16394	0.0:0.3042:0.2532:0.4426	.	340;340;340;340	E9PEE4;O95243-2;O95243-3;O95243	.;.;.;MBD4_HUMAN	R	340	ENSP00000394080:K340R;ENSP00000249910:K340R;ENSP00000424873:K340R;ENSP00000422327:K340R	ENSP00000249910:K340R	K	-	2	0	MBD4	130638158	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.192000	0.09587	-0.864000	0.04078	-0.450000	0.05554	AAA		0.328	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925		Missense_Mutation
P2RY12	64805	broad.mit.edu	37	3	151055941	151055941	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:151055941C>A	ENST00000302632.3	-	3	992	c.693G>T	c.(691-693)agG>agT	p.R231S	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	231					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.R231S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TCACCTTTTTCCTGGGGACTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											74.0	76.0	75.0					3																	151055941		2203	4300	6503	152538631	SO:0001583	missense	64805			AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.693G>T	3.37:g.151055941C>A	ENSP00000307259:p.Arg231Ser	Unknown		x	x	x	152538631	D3DNJ5|Q546J7	Missense_Mutation	SNP	ENST00000302632.3	37	CCDS3159.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466138	0.26335	.	.	ENSG00000169313	ENST00000302632;ENST00000455408	T	0.52983	0.64	5.26	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.470849	0.26658	N	0.023165	T	0.39937	0.1097	L	0.46157	1.445	0.25325	N	0.989082	B	0.06786	0.001	B	0.14023	0.01	T	0.38329	-0.9666	10	0.62326	D	0.03	-8.4842	8.971	0.35905	0.0:0.7238:0.0:0.2762	.	231	Q9H244	P2Y12_HUMAN	S	231;134	ENSP00000307259:R231S	ENSP00000307259:R231S	R	-	3	2	P2RY12	152538631	0.752000	0.28338	0.652000	0.29579	0.969000	0.65631	0.953000	0.29162	1.347000	0.45714	0.655000	0.94253	AGG		0.373	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357796.1			Missense_Mutation
GPR149	344758	broad.mit.edu	37	3	154147257	154147257	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:154147257C>A	ENST00000389740.2	-	1	247	c.148G>T	c.(148-150)Ggc>Tgc	p.G50C		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	50					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G50C(1)		autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TAAATGCTGCCCACCAAGGCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	3											85.0	82.0	83.0					3																	154147257		1949	4145	6094	155629951	SO:0001583	missense	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.148G>T	3.37:g.154147257C>A	ENSP00000374390:p.Gly50Cys	Unknown		x	x	x	155629951		Missense_Mutation	SNP	ENST00000389740.2	37	CCDS43162.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426786	0.83667	.	.	ENSG00000174948	ENST00000389740	T	0.56941	0.43	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.65322	0.2680	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66960	-0.5791	10	0.87932	D	0	-21.3253	20.2985	0.98592	0.0:1.0:0.0:0.0	.	50	Q86SP6	GP149_HUMAN	C	50	ENSP00000374390:G50C	ENSP00000374390:G50C	G	-	1	0	GPR149	155629951	1.000000	0.71417	0.970000	0.41538	0.932000	0.56968	7.141000	0.77330	2.793000	0.96121	0.655000	0.94253	GGC		0.433	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580		Missense_Mutation
LEKR1	389170	broad.mit.edu	37	3	156763145	156763145	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:156763145A>G	ENST00000470811.1	+	14	2108	c.773A>G	c.(772-774)gAg>gGg	p.E258G	LEKR1_ENST00000356539.4_Missense_Mutation_p.E562G			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	258								p.E258G(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTTCTTCAGGAGACAGTGCGT	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											77.0	81.0	79.0					3																	156763145		2203	4300	6503	158245839	SO:0001583	missense	389170			AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.773A>G	3.37:g.156763145A>G	ENSP00000418214:p.Glu258Gly	Unknown		x	x	x	158245839		Missense_Mutation	SNP	ENST00000470811.1	37		SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	21.6	4.168517	0.78339	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.62639	0.01;0.02	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000007	T	0.77184	0.4093	M	0.75264	2.295	0.42943	D	0.99435	D	0.71674	0.998	D	0.72338	0.977	T	0.77882	-0.2422	10	0.38643	T	0.18	-12.8723	14.3132	0.66429	1.0:0.0:0.0:0.0	.	258	Q6ZMV7	LEKR1_HUMAN	G	258;562	ENSP00000418214:E258G;ENSP00000348936:E562G	ENSP00000348936:E562G	E	+	2	0	LEKR1	158245839	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.885000	0.75606	1.857000	0.53885	0.533000	0.62120	GAG		0.408	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000351625.3	NM_001004316		Missense_Mutation
TNIK	23043	broad.mit.edu	37	3	170811744	170811744	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr3:170811744G>T	ENST00000436636.2	-	23	2949	c.2605C>A	c.(2605-2607)Cca>Aca	p.P869T	TNIK_ENST00000538048.1_Missense_Mutation_p.P821T|TNIK_ENST00000341852.6_Missense_Mutation_p.P785T|TNIK_ENST00000357327.5_Missense_Mutation_p.P840T|TNIK_ENST00000369326.5_Missense_Mutation_p.P847T|TNIK_ENST00000284483.8_Missense_Mutation_p.P861T|TNIK_ENST00000488470.1_Missense_Mutation_p.P814T|TNIK_ENST00000460047.1_Missense_Mutation_p.P806T|TNIK_ENST00000470834.1_Missense_Mutation_p.P832T|TNIK_ENST00000475336.1_Missense_Mutation_p.P777T	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	869	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.P869T(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTGCTGCCTGGAGCTCCTGTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	95.0	95.0					3																	170811744		2081	4232	6313	172294438	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2605C>A	3.37:g.170811744G>T	ENSP00000399511:p.Pro869Thr	Unknown		x	x	x	172294438	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	7.697	0.692217	0.15039	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	5.39	5.39	0.77823	.	0.615270	0.16610	N	0.206957	T	0.61714	0.2369	L	0.29908	0.895	0.32042	N	0.598097	B;B;B;B;B;B;B;B	0.15473	0.013;0.001;0.013;0.013;0.01;0.001;0.013;0.006	B;B;B;B;B;B;B;B	0.22386	0.01;0.009;0.01;0.01;0.039;0.009;0.01;0.017	T	0.60662	-0.7219	10	0.22109	T	0.4	.	9.7814	0.40651	0.1529:0.0:0.8471:0.0	.	777;832;806;785;861;840;814;869	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	T	869;847;821;785;861;777;840;806;814;832	ENSP00000399511:P869T;ENSP00000358332:P847T;ENSP00000443278:P821T;ENSP00000345352:P785T;ENSP00000284483:P861T;ENSP00000418156:P777T;ENSP00000349880:P840T;ENSP00000418916:P806T;ENSP00000418378:P814T;ENSP00000419990:P832T	ENSP00000284483:P861T	P	-	1	0	TNIK	172294438	1.000000	0.71417	0.965000	0.40720	0.879000	0.50718	4.128000	0.57951	2.500000	0.84329	0.655000	0.94253	CCA		0.453	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352973.2	XM_039796		Missense_Mutation
FGFRL1	53834	broad.mit.edu	37	4	1016193	1016193	+	Silent	SNP	C	C	T	rs558236459	byFrequency	TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr4:1016193C>T	ENST00000398484.2	+	4	862	c.282C>T	c.(280-282)gcC>gcT	p.A94A	FGFRL1_ENST00000504138.1_Silent_p.A94A|FGFRL1_ENST00000510644.1_Silent_p.A94A|FGFRL1_ENST00000264748.6_Silent_p.A94A			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	94	Ig-like C2-type 1.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)	p.A94A(1)		endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGGAGGATGCCGGCGTGTACG	0.657													c|||	2	0.000399361	0.0	0.0	5008	,	,		15025	0.0		0.0	False		,,,				2504	0.002															1	Substitution - coding silent(1)	ovary(1)	4											62.0	52.0	56.0					4																	1016193		2196	4297	6493	1006193	SO:0001819	synonymous_variant	53834				CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.282C>T	4.37:g.1016193C>T		Unknown		x	x	x	1006193	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Silent	SNP	ENST00000398484.2	37	CCDS3344.1	SNP	23	Broad																																																																																				0.657	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923		Silent
RBM47	54502	broad.mit.edu	37	4	40440784	40440784	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr4:40440784C>A	ENST00000381793.2	-	3	523	c.127G>T	c.(127-129)Ggc>Tgc	p.G43C	RBM47_ENST00000514014.1_Missense_Mutation_p.G5C|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Missense_Mutation_p.G43C|RBM47_ENST00000295971.7_Missense_Mutation_p.G43C|RBM47_ENST00000381795.6_Missense_Mutation_p.G43C			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	43					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G43C(2)		breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						ATGCTGTAGCCCGTGCGCTCC	0.731																																																2	Substitution - Missense(2)	ovary(2)	4											13.0	15.0	15.0					4																	40440784		2169	4203	6372	40135541	SO:0001583	missense	54502			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.127G>T	4.37:g.40440784C>A	ENSP00000371212:p.Gly43Cys	Unknown		x	x	x	40135541	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	ENST00000381793.2	37	CCDS43223.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982553	0.74474	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000514014;ENST00000515053;ENST00000513473;ENST00000505414;ENST00000514782;ENST00000507180;ENST00000511598;ENST00000511902;ENST00000505220	T;T;T;T;T;T;T;T;T;T;T	0.44881	2.22;0.91;2.22;0.91;1.78;1.71;0.91;0.91;0.91;0.91;0.91	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.71719	0.3373	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.971	T	0.75758	-0.3205	10	0.87932	D	0	-26.481	20.0143	0.97474	0.0:1.0:0.0:0.0	.	43;43	A0AV96-2;A0AV96	.;RBM47_HUMAN	C	43;43;43;43;5;43;43;43;43;43;43;43;43	ENSP00000320108:G43C;ENSP00000371212:G43C;ENSP00000371214:G43C;ENSP00000295971:G43C;ENSP00000423243:G5C;ENSP00000422564:G43C;ENSP00000421589:G43C;ENSP00000423527:G43C;ENSP00000426542:G43C;ENSP00000423398:G43C;ENSP00000424019:G43C	ENSP00000295971:G43C	G	-	1	0	RBM47	40135541	1.000000	0.71417	1.000000	0.80357	0.648000	0.38561	7.780000	0.85658	2.740000	0.93945	0.313000	0.20887	GGC		0.731	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027		Missense_Mutation
FGB	2244	broad.mit.edu	37	4	155488794	155488794	+	Silent	SNP	A	A	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr4:155488794A>G	ENST00000302068.4	+	4	603	c.540A>G	c.(538-540)caA>caG	p.Q180Q	FGB_ENST00000509493.1_5'UTR|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	180					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)	p.Q180Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AAAAGCACCAATTATATATAG	0.333																																					NSCLC(106;1133 1613 21870 46110 52656)											1	Substitution - coding silent(1)	ovary(1)	4											92.0	90.0	90.0					4																	155488794		2203	4300	6503	155708244	SO:0001819	synonymous_variant	2244				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.540A>G	4.37:g.155488794A>G		Unknown		x	x	x	155708244	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Silent	SNP	ENST00000302068.4	37	CCDS3786.1	SNP	4	Broad																																																																																				0.333	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141		Silent
BRD9	65980	broad.mit.edu	37	5	865625	865625	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:865625C>A	ENST00000467963.1	-	15	1763	c.1597G>T	c.(1597-1599)Gac>Tac	p.D533Y	BRD9_ENST00000323510.4_Missense_Mutation_p.D437Y|BRD9_ENST00000483173.1_Missense_Mutation_p.D480Y|BRD9_ENST00000388890.4_Missense_Mutation_p.D417Y	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	533					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.D437Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			TCGTGCAGGTCCTGCAGGAGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	5											157.0	154.0	155.0					5																	865625		2203	4300	6503	918625	SO:0001583	missense	65980			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1597G>T	5.37:g.865625C>A	ENSP00000419765:p.Asp533Tyr	Unknown		x	x	x	918625	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	c	17.92	3.506393	0.64410	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.15	5.15	0.70609	.	0.089231	0.85682	D	0.000000	T	0.68933	0.3055	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.70935	0.962;0.962;0.971;0.971	T	0.72020	-0.4416	10	0.87932	D	0	.	18.2274	0.89923	0.0:1.0:0.0:0.0	.	480;533;437;417	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	Y	437;417;480;533	ENSP00000323557:D437Y;ENSP00000373542:D417Y;ENSP00000419845:D480Y;ENSP00000419765:D533Y	ENSP00000323557:D437Y	D	-	1	0	BRD9	918625	1.000000	0.71417	1.000000	0.80357	0.164000	0.22412	6.624000	0.74243	2.416000	0.81992	0.561000	0.74099	GAC		0.622	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924		Missense_Mutation
DROSHA	29102	broad.mit.edu	37	5	31449423	31449423	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:31449423T>A	ENST00000511367.2	-	21	3030	c.2786A>T	c.(2785-2787)gAc>gTc	p.D929V	DROSHA_ENST00000513349.1_Missense_Mutation_p.D892V|DROSHA_ENST00000442743.1_Missense_Mutation_p.D892V|DROSHA_ENST00000344624.3_Missense_Mutation_p.D929V	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	929	Necessary for interaction with DGCR8 and pri-miRNA processing activity.|RNase III 1.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.D929V(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						AACTTTTCTGTCTCCGTATTT	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	93.0	94.0					5																	31449423		1915	4130	6045	31485180	SO:0001583	missense	29102			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2786A>T	5.37:g.31449423T>A	ENSP00000425979:p.Asp929Val	Unknown		x	x	x	31485180	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	CCDS47195.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	27.1	4.801995	0.90538	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.53206	1.24;1.24;0.63;0.63	5.76	5.76	0.90799	Ribonuclease III (2);	0.094532	0.64402	D	0.000001	T	0.68495	0.3007	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.68483	0.958;0.948	T	0.72603	-0.4243	10	0.87932	D	0	-25.5645	16.0863	0.81056	0.0:0.0:0.0:1.0	.	892;929	E7EMP9;Q9NRR4	.;RNC_HUMAN	V	929;929;892;892;854;885	ENSP00000425979:D929V;ENSP00000339845:D929V;ENSP00000409335:D892V;ENSP00000424161:D892V	ENSP00000265075:D854V	D	-	2	0	DROSHA	31485180	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.567000	0.82357	2.197000	0.70478	0.454000	0.30748	GAC		0.383	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235		Missense_Mutation
NDST1	3340	broad.mit.edu	37	5	149901054	149901054	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:149901054C>T	ENST00000261797.6	+	2	740	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	NDST1_ENST00000523767.1_Missense_Mutation_p.R80C	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	80	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.R80C(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACCCCTTCCCGCACAGACCC	0.682																																																1	Substitution - Missense(1)	ovary(1)	5											45.0	52.0	50.0					5																	149901054		2203	4300	6503	149881247	SO:0001583	missense	3340			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.238C>T	5.37:g.149901054C>T	ENSP00000261797:p.Arg80Cys	Unknown		x	x	x	149881247	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	19.48	3.834635	0.71373	.	.	ENSG00000070614	ENST00000519157;ENST00000523767;ENST00000261797	T;T;T	0.52983	0.64;0.79;1.12	5.11	5.11	0.69529	.	0.055916	0.64402	D	0.000001	T	0.73814	0.3635	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.953;0.949;0.977	T	0.79252	-0.1880	10	0.87932	D	0	.	18.9189	0.92518	0.0:1.0:0.0:0.0	.	80;80;80	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	C	80	ENSP00000427813:R80C;ENSP00000428604:R80C;ENSP00000261797:R80C	ENSP00000261797:R80C	R	+	1	0	NDST1	149881247	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	6.075000	0.71261	2.535000	0.85469	0.655000	0.94253	CGC		0.682	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543		Missense_Mutation
FAT2	2196	broad.mit.edu	37	5	150917475	150917475	+	Silent	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:150917475T>A	ENST00000261800.5	-	11	9084	c.9072A>T	c.(9070-9072)gtA>gtT	p.V3024V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3024	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V3024V(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTCCTGGAAATACATCTTCAT	0.463																																																1	Substitution - coding silent(1)	ovary(1)	5											114.0	104.0	107.0					5																	150917475		2203	4300	6503	150897668	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9072A>T	5.37:g.150917475T>A		Unknown		x	x	x	150897668	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1	SNP	49	Broad																																																																																				0.463	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		Silent
SPARC	6678	broad.mit.edu	37	5	151047084	151047084	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:151047084T>A	ENST00000231061.4	-	7	842	c.529A>T	c.(529-531)Acc>Tcc	p.T177S	SPARC_ENST00000537849.1_5'UTR	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	177					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)	p.T177S(1)		central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		TCATACAGGGTGACCAGGACG	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											108.0	86.0	94.0					5																	151047084		2203	4300	6503	151027277	SO:0001583	missense	6678				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.529A>T	5.37:g.151047084T>A	ENSP00000231061:p.Thr177Ser	Unknown		x	x	x	151027277	D3DQH9|Q6IBK4	Missense_Mutation	SNP	ENST00000231061.4	37	CCDS4318.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	14.97	2.695158	0.48202	.	.	ENSG00000113140	ENST00000231061;ENST00000538026;ENST00000521569	T	0.22134	1.97	5.22	4.02	0.46733	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.094513	0.64402	D	0.000001	T	0.12518	0.0304	N	0.12961	0.28	0.48341	D	0.99963	B	0.02656	0.0	B	0.06405	0.002	T	0.07539	-1.0767	10	0.33141	T	0.24	-23.3234	11.3306	0.49473	0.1362:0.0:0.0:0.8638	.	177	P09486	SPRC_HUMAN	S	177;86;86	ENSP00000231061:T177S	ENSP00000231061:T177S	T	-	1	0	SPARC	151027277	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.438000	0.80431	0.789000	0.33779	0.533000	0.62120	ACC		0.582	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118		Missense_Mutation
COL23A1	91522	broad.mit.edu	37	5	177669341	177669341	+	Splice_Site	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr5:177669341C>A	ENST00000390654.3	-	26	1852		c.e26+1			NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GCTGCCCTCACCTTCTCTCCA	0.607																																																1	Unknown(1)	ovary(1)	5											55.0	61.0	59.0					5																	177669341		2111	4215	6326	177601947	SO:0001630	splice_region_variant	91522			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1494+1G>T	5.37:g.177669341C>A		Unknown		x	x	x	177601947	Q8IVR4|Q9NT93	Splice_Site_SNP	SNP	ENST00000390654.3	37	CCDS4436.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	18.97	3.734904	0.69189	.	.	ENSG00000050767	ENST00000390654	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8235	0.57707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL23A1	177601947	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.870000	0.63035	2.143000	0.66587	0.455000	0.32223	.		0.607	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	Intron	Splice_Site_SNP
BEND3	57673	broad.mit.edu	37	6	107390876	107390876	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr6:107390876C>T	ENST00000369042.1	-	4	1709	c.1519G>A	c.(1519-1521)Gac>Aac	p.D507N	BEND3_ENST00000429433.2_Missense_Mutation_p.D507N			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	507								p.D507N(2)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						ACTGAGATGTCGTCGGGCAGA	0.647																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	6											30.0	29.0	29.0					6																	107390876		2203	4298	6501	107497569	SO:0001583	missense	57673			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.1519G>A	6.37:g.107390876C>T	ENSP00000358038:p.Asp507Asn	Unknown		x	x	x	107497569	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582913	0.65992	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.21227	0.0511	N	0.17082	0.46	0.50039	D	0.999844	P	0.41041	0.736	B	0.26310	0.068	T	0.10965	-1.0607	9	0.41790	T	0.15	-23.2139	18.6025	0.91253	0.0:1.0:0.0:0.0	.	507	Q5T5X7	BEND3_HUMAN	N	507	.	ENSP00000358038:D507N	D	-	1	0	BEND3	107497569	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	5.541000	0.67212	2.625000	0.88918	0.561000	0.74099	GAC		0.647	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913		Missense_Mutation
KIAA0408	9729	broad.mit.edu	37	6	127768163	127768163	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr6:127768163C>T	ENST00000483725.3	-	5	1637	c.1301G>A	c.(1300-1302)aGg>aAg	p.R434K	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	434								p.R434K(1)		endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		CTTCTCATTCCTTGTAGTCCT	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											67.0	70.0	69.0					6																	127768163		2203	4299	6502	127809856	SO:0001583	missense	9729			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1301G>A	6.37:g.127768163C>T	ENSP00000435150:p.Arg434Lys	Unknown		x	x	x	127809856	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Missense_Mutation	SNP	ENST00000483725.3	37	CCDS34531.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	8.626	0.892580	0.17613	.	.	ENSG00000189367	ENST00000465254;ENST00000483725	T	0.32515	1.45	5.18	3.04	0.35103	.	0.843611	0.09430	U	0.803229	T	0.10852	0.0265	L	0.34521	1.04	0.09310	N	0.999996	B	0.19583	0.037	B	0.19148	0.024	T	0.31668	-0.9935	10	0.44086	T	0.13	-5.2325	10.9388	0.47262	0.0:0.7677:0.0:0.2323	.	434	Q6ZU52	K0408_HUMAN	K	23;434	ENSP00000435150:R434K	ENSP00000436178:R23K	R	-	2	0	KIAA0408	127809856	0.976000	0.34144	0.983000	0.44433	0.033000	0.12548	0.812000	0.27211	1.179000	0.42884	-0.150000	0.13652	AGG		0.398	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702		Missense_Mutation
TNFAIP3	7128	broad.mit.edu	37	6	138199843	138199843	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr6:138199843C>G	ENST00000237289.4	+	7	1327	c.1261C>G	c.(1261-1263)Ctg>Gtg	p.L421V		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	421	Interaction with RIPK1.|Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.L421V(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		ACTCCCAAAGCTGAACTCCAA	0.587			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(25)|ovary(1)	6											41.0	48.0	45.0					6																	138199843		2203	4300	6503	138241536	SO:0001583	missense	7128			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1261C>G	6.37:g.138199843C>G	ENSP00000237289:p.Leu421Val	Unknown		x	x	x	138241536	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	8.692	0.907636	0.17833	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.22134	1.97	5.17	2.35	0.29111	.	1.116930	0.06700	N	0.771149	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.43734	-0.9373	10	0.27785	T	0.31	-21.634	6.5269	0.22307	0.0:0.6924:0.1485:0.1592	.	421	P21580	TNAP3_HUMAN	V	421	ENSP00000237289:L421V	ENSP00000237289:L421V	L	+	1	2	TNFAIP3	138241536	0.999000	0.42202	0.001000	0.08648	0.989000	0.77384	2.096000	0.41738	0.177000	0.19895	-0.136000	0.14681	CTG		0.587	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1			Missense_Mutation
RBAK	57786	broad.mit.edu	37	7	5104645	5104646	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-13-1510-01	TCGA-13-1510-10			TT	AA	TT	TT	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:5104645_5104646TT>AA	ENST00000353796.3	+	6	1882_1883	c.1558_1559TT>AA	c.(1558-1560)TTc>AAc	p.F520N	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Missense_Mutation_p.F520N|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	520	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.F520N(1)		NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGGGAAAACCTTCCTTGTAAAT	0.396																																																1	Substitution - Missense(1)	ovary(1)	7																																								5071172	SO:0001583	missense	57786			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	Exception_encountered	7.37:g.5104645_5104646delinsAA	ENSP00000275423:p.Phe520Asn	Somatic		x	x	x	5071171	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	DNP	ENST00000353796.3	37	CCDS5337.1	DNP	56	Broad																																																																																				0.396	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		Missense_Mutation
VPS41	27072	broad.mit.edu	37	7	38812121	38812121	+	Splice_Site	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:38812121C>T	ENST00000310301.4	-	13	1183		c.e13+1		VPS41_ENST00000466017.1_5'Flank|VPS41_ENST00000395969.2_Splice_Site	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)						Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						ATCAAGGGTACTTCATATTTC	0.348																																																1	Unknown(1)	ovary(1)	7											106.0	98.0	101.0					7																	38812121		2203	4300	6503	38778646	SO:0001630	splice_region_variant	27072			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1128+1G>A	7.37:g.38812121C>T		Unknown		x	x	x	38778646	E9PF36|Q86TP8|Q99851|Q99852	Splice_Site_SNP	SNP	ENST00000310301.4	37	CCDS5457.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833956	0.91036	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS41	38778646	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.757000	0.85209	2.765000	0.95021	0.655000	0.94253	.		0.348	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3		Intron	Splice_Site_SNP
PPP1R3A	5506	broad.mit.edu	37	7	113519908	113519908	+	Silent	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:113519908T>A	ENST00000284601.3	-	4	1307	c.1239A>T	c.(1237-1239)ggA>ggT	p.G413G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	413					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.G413G(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GCTTGATTTCTCCCATATTTG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	7											157.0	147.0	150.0					7																	113519908		2203	4300	6503	113307144	SO:0001819	synonymous_variant	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1239A>T	7.37:g.113519908T>A		Somatic		x	x	x	113307144	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	54	Broad																																																																																				0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Silent
IMPDH1	3614	broad.mit.edu	37	7	128038521	128038521	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:128038521C>T	ENST00000480861.1	-	7	828	c.751G>A	c.(751-753)Gac>Aac	p.D251N	IMPDH1_ENST00000348127.6_Missense_Mutation_p.D305N|IMPDH1_ENST00000470772.1_Missense_Mutation_p.D255N|IMPDH1_ENST00000496200.1_Missense_Mutation_p.D231N|IMPDH1_ENST00000378717.4_Missense_Mutation_p.D272N|IMPDH1_ENST00000338791.6_Missense_Mutation_p.D341N|IMPDH1_ENST00000354269.5_Missense_Mutation_p.D331N|IMPDH1_ENST00000419067.2_Missense_Mutation_p.D308N|IMPDH1_ENST00000343214.4_Missense_Mutation_p.D231N	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1									p.D341N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						CGGTATTTGTCATCCTCACGG	0.622											OREG0018292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	7											51.0	53.0	52.0					7																	128038521		2203	4300	6503	127825757	SO:0001583	missense	3614				CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.751G>A	7.37:g.128038521C>T	ENSP00000420185:p.Asp251Asn	Unknown	1561	x	x	x	127825757		Missense_Mutation	SNP	ENST00000480861.1	37	CCDS55161.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.573944	0.96553	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868	T;T;T;T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.29	5.29	0.74685	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.88851	0.6549	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.998;0.999;0.999;1.0;0.997	D;D;D;D;D;D;D;D	0.97110	1.0;0.992;1.0;0.986;0.997;0.984;0.995;0.987	D	0.90368	0.4378	10	0.87932	D	0	-40.2298	16.4619	0.84059	0.0:1.0:0.0:0.0	.	308;251;256;272;331;305;341;231	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	N	308;341;231;331;272;305;231;255;251;272	ENSP00000399400:D308N;ENSP00000345096:D341N;ENSP00000420803:D231N;ENSP00000346219:D331N;ENSP00000367989:D272N;ENSP00000265385:D305N;ENSP00000342438:D231N;ENSP00000417296:D255N;ENSP00000420185:D251N;ENSP00000419609:D272N	ENSP00000345096:D341N	D	-	1	0	IMPDH1	127825757	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.794000	0.85869	2.489000	0.83994	0.655000	0.94253	GAC		0.622	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883		Missense_Mutation
MKLN1	4289	broad.mit.edu	37	7	131155683	131155683	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:131155683G>C	ENST00000352689.6	+	16	2051	c.2011G>C	c.(2011-2013)Gac>Cac	p.D671H	MKLN1_ENST00000498778.1_3'UTR|MKLN1_ENST00000421797.2_Missense_Mutation_p.D579H	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	671					signal transduction (GO:0007165)	cytoplasm (GO:0005737)		p.D671H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					GGATCATTCAGACCCAGAAGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	7											59.0	61.0	61.0					7																	131155683		2203	4294	6497	130806223	SO:0001583	missense	4289			AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.2011G>C	7.37:g.131155683G>C	ENSP00000323527:p.Asp671His	Unknown		x	x	x	130806223	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Missense_Mutation	SNP	ENST00000352689.6	37	CCDS34754.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616970	0.87359	.	.	ENSG00000128585	ENST00000421797;ENST00000352689;ENST00000388758	T;T	0.54866	1.54;0.55	5.87	5.87	0.94306	.	0.089676	0.85682	D	0.000000	T	0.75413	0.3846	M	0.80982	2.52	0.80722	D	1	D;D;D;D	0.89917	0.996;0.999;0.999;1.0	D;D;D;D	0.74674	0.919;0.946;0.946;0.984	T	0.77512	-0.2560	10	0.87932	D	0	-14.2425	19.2041	0.93723	0.0:0.0:1.0:0.0	.	671;648;579;161	Q9UL63;B4DG30;C9J7E8;F8W7E8	MKLN1_HUMAN;.;.;.	H	579;671;161	ENSP00000398094:D579H;ENSP00000323527:D671H	ENSP00000323527:D671H	D	+	1	0	MKLN1	130806223	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.124000	0.94394	2.784000	0.95788	0.549000	0.68633	GAC		0.313	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255		Missense_Mutation
CNPY1	285888	broad.mit.edu	37	7	155299769	155299769	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr7:155299769G>A	ENST00000321736.5	-	3	349	c.187C>T	c.(187-189)Ctt>Ttt	p.L63F	CNPY1_ENST00000406197.1_Missense_Mutation_p.L63F	NM_001103176.1	NP_001096646.1	Q3B7I2	CNPY1_HUMAN	canopy FGF signaling regulator 1	63								p.L63F(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		TGGGCGATAAGTGAGGATATT	0.438																																																1	Substitution - Missense(1)	ovary(1)	7											162.0	158.0	159.0					7																	155299769		2013	4180	6193	154992530	SO:0001583	missense	285888				CCDS43684.1	7q36.3	2014-02-12	2013-07-23		ENSG00000146910	ENSG00000146910			27786	protein-coding gene	gene with protein product		612493	"""canopy 1 homolog (zebrafish)"""			16488878	Standard	NM_001103176		Approved		uc003wmc.1	Q3B7I2	OTTHUMG00000151353	ENST00000321736.5:c.187C>T	7.37:g.155299769G>A	ENSP00000317439:p.Leu63Phe	Unknown		x	x	x	154992530	A6NGX3	Missense_Mutation	SNP	ENST00000321736.5	37	CCDS43684.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583323	0.28268	.	.	ENSG00000146910	ENST00000406197;ENST00000321736	T;T	0.36520	1.25;1.25	5.1	5.1	0.69264	.	0.235442	0.35646	N	0.003078	T	0.52901	0.1763	.	.	.	0.42869	D	0.994132	D	0.89917	1.0	D	0.77557	0.99	T	0.44711	-0.9310	9	0.19147	T	0.46	-12.9141	14.1933	0.65654	0.0:0.1494:0.8506:0.0	.	63	Q3B7I2	CNPY1_HUMAN	F	63	ENSP00000384514:L63F;ENSP00000317439:L63F	ENSP00000317439:L63F	L	-	1	0	CNPY1	154992530	1.000000	0.71417	0.950000	0.38849	0.361000	0.29550	5.632000	0.67819	2.370000	0.80446	0.561000	0.74099	CTT		0.438	CNPY1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322335.1	XM_001129537		Missense_Mutation
SQLE	6713	broad.mit.edu	37	8	126011654	126011654	+	Silent	SNP	T	T	A			TCGA-13-1510-01	TCGA-13-1510-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr8:126011654T>A	ENST00000265896.5	+	1	907	c.9T>A	c.(7-9)acT>acA	p.T3T	SQLE_ENST00000523430.1_Intron|RP11-6D1.3_ENST00000523030.1_RNA	NM_003129.3	NP_003120.2	Q14534	ERG1_HUMAN	squalene epoxidase	3					cellular aromatic compound metabolic process (GO:0006725)|cholesterol biosynthetic process (GO:0006695)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|squalene monooxygenase activity (GO:0004506)	p.T3T(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)	CCATGTGGACTTTTCTGGGCA	0.498																																																1	Substitution - coding silent(1)	ovary(1)	8											56.0	57.0	57.0					8																	126011654		1932	4136	6068	126080835	SO:0001819	synonymous_variant	6713			D78130	CCDS47918.1	8q24.1	2014-06-23			ENSG00000104549	ENSG00000104549	1.14.13.132		11279	protein-coding gene	gene with protein product	"""squalene monooxygenase"""	602019				9286711	Standard	NM_003129		Approved		uc011liq.2	Q14534	OTTHUMG00000164990	ENST00000265896.5:c.9T>A	8.37:g.126011654T>A		Somatic		x	x	x	126080835	Q9UEK6	Silent	SNP	ENST00000265896.5	37	CCDS47918.1	SNP	56	Broad																																																																																				0.498	SQLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381362.1	NM_003129		Silent
MROH5	389690	broad.mit.edu	37	8	142446070	142446070	+	RNA	SNP	G	G	T			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr8:142446070G>T	ENST00000606664.1	+	0	1426				MROH5_ENST00000430863.1_RNA														p.?(1)									CCATGCTCTGGTGCACCTGGG	0.667																																																1	Unknown(1)	ovary(1)	8											40.0	49.0	46.0					8																	142446070		2163	4248	6411	142515252			389690																															8.37:g.142446070G>T		Unknown		x	x	x	142515252		Missense_Mutation	SNP	ENST00000606664.1	37		SNP	44	Broad																																																																																				0.667	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000470872.1			Missense_Mutation
SLC39A4	55630	broad.mit.edu	37	8	145638009	145638009	+	Silent	SNP	G	G	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr8:145638009G>A	ENST00000301305.3	-	12	1962	c.1857C>T	c.(1855-1857)ctC>ctT	p.L619L	GS1-393G12.14_ENST00000607491.1_RNA|SLC39A4_ENST00000276833.5_Silent_p.L594L|SLC39A4_ENST00000531013.1_5'UTR	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	619					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.L619L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GCAGGAAGAGGAGCCAGGGCC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	8											74.0	76.0	75.0					8																	145638009		2203	4300	6503	145608817	SO:0001819	synonymous_variant	55630			AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.1857C>T	8.37:g.145638009G>A		Unknown		x	x	x	145608817	Q7L5S5|Q9H6T8|Q9NXC4	Silent	SNP	ENST00000301305.3	37	CCDS6424.1	SNP	41	Broad																																																																																				0.657	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1			Silent
TRPM6	140803	broad.mit.edu	37	9	77370284	77370284	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr9:77370284T>C	ENST00000360774.1	-	28	5128	c.4891A>G	c.(4891-4893)Aaa>Gaa	p.K1631E	TRPM6_ENST00000376872.3_Missense_Mutation_p.K582E|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.K1626E|TRPM6_ENST00000449912.2_Missense_Mutation_p.K1626E|TRPM6_ENST00000451710.3_Missense_Mutation_p.K1631E|TRPM6_ENST00000376864.4_Missense_Mutation_p.K1631E	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1631					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.K1631E(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGACTAAATTTGGACACTGTG	0.468																																																1	Substitution - Missense(1)	ovary(1)	9											182.0	164.0	170.0					9																	77370284		2203	4300	6503	76560104	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4891A>G	9.37:g.77370284T>C	ENSP00000354006:p.Lys1631Glu	Unknown		x	x	x	76560104	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	6.653	0.488995	0.12641	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T	0.53423	0.71;0.71;0.62;0.71;0.71;0.62	5.34	2.98	0.34508	.	1.088410	0.06810	N	0.790164	T	0.34454	0.0898	L	0.29908	0.895	0.21290	N	0.999733	B;B;B;B	0.29432	0.244;0.001;0.001;0.001	B;B;B;B	0.22753	0.041;0.001;0.003;0.003	T	0.18053	-1.0349	10	0.21014	T	0.42	.	9.4853	0.38926	0.0:0.1522:0.0:0.8478	.	582;1631;1626;1626	Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;TRPM6_HUMAN;.;.	E	1631;1631;582;1626;1626;1631	ENSP00000354006:K1631E;ENSP00000407341:K1631E;ENSP00000366068:K582E;ENSP00000396672:K1626E;ENSP00000354962:K1626E;ENSP00000366060:K1631E	ENSP00000354006:K1631E	K	-	1	0	TRPM6	76560104	1.000000	0.71417	0.738000	0.30950	0.019000	0.09904	1.763000	0.38461	0.986000	0.38683	0.533000	0.62120	AAA		0.468	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662		Missense_Mutation
PTGR1	22949	broad.mit.edu	37	9	114345778	114345778	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr9:114345778C>G	ENST00000407693.2	-	6	731	c.469G>C	c.(469-471)Gtc>Ctc	p.V157L	PTGR1_ENST00000538962.1_Missense_Mutation_p.V157L|PTGR1_ENST00000238248.3_Missense_Mutation_p.V34L|PTGR1_ENST00000309195.5_Missense_Mutation_p.V157L	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	157					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)	p.V157L(1)		endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						TGCCCCACGACTGAGCCCACA	0.473																																					Ovarian(200;132 2151 7551 19220 46064)											1	Substitution - Missense(1)	ovary(1)	9											179.0	163.0	168.0					9																	114345778		2203	4300	6503	113385599	SO:0001583	missense	22949			D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.469G>C	9.37:g.114345778C>G	ENSP00000385763:p.Val157Leu	Unknown		x	x	x	113385599	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.538832	0.00942	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000374324;ENST00000238248	T;T;T;T	0.03772	3.81;3.81;3.81;3.81	4.72	1.87	0.25490	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.181581	0.48286	D	0.000197	T	0.03263	0.0095	N	0.20986	0.625	0.09310	N	0.999999	B;B;B;B	0.16166	0.007;0.016;0.003;0.002	B;B;B;B	0.16722	0.009;0.015;0.016;0.011	T	0.45963	-0.9225	10	0.21014	T	0.42	-10.3646	8.255	0.31751	0.0:0.6706:0.0:0.3294	.	157;157;34;157	F5GY50;B4DPK3;Q5JVP3;Q14914	.;.;.;PTGR1_HUMAN	L	157;157;157;34;34	ENSP00000440281:V157L;ENSP00000311572:V157L;ENSP00000385763:V157L;ENSP00000238248:V34L	ENSP00000238248:V34L	V	-	1	0	PTGR1	113385599	0.227000	0.23707	0.005000	0.12908	0.107000	0.19398	0.843000	0.27640	0.285000	0.22329	0.655000	0.94253	GTC		0.473	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2			Missense_Mutation
LMX1B	4010	broad.mit.edu	37	9	129455542	129455542	+	Silent	SNP	C	C	A	rs147071667		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr9:129455542C>A	ENST00000373474.4	+	4	688	c.681C>A	c.(679-681)acC>acA	p.T227T	LMX1B_ENST00000425646.2_Silent_p.T204T|LMX1B_ENST00000561065.1_Silent_p.T204T|LMX1B_ENST00000526117.1_Silent_p.T227T|LMX1B_ENST00000355497.5_Silent_p.T227T			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	227					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T204T(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CCATCCTCACCACGCAGCAGC	0.697									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)											1	Substitution - coding silent(1)	ovary(1)	9											38.0	41.0	40.0					9																	129455542		2200	4298	6498	128495363	SO:0001819	synonymous_variant	4010	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.681C>A	9.37:g.129455542C>A		Unknown		x	x	x	128495363	F8W7W6|O75463|Q5JU95|Q6ISC9	Silent	SNP	ENST00000373474.4	37	CCDS55342.1	SNP	21	Broad																																																																																				0.697	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2			Silent
KLHL13	90293	broad.mit.edu	37	X	117035823	117035823	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chrX:117035823C>A	ENST00000262820.3	-	6	2362	c.1453G>T	c.(1453-1455)Gtg>Ttg	p.V485L	KLHL13_ENST00000469946.1_Missense_Mutation_p.V434L|KLHL13_ENST00000541812.1_Missense_Mutation_p.V469L|KLHL13_ENST00000540167.1_Missense_Mutation_p.V469L|KLHL13_ENST00000539496.1_Missense_Mutation_p.V488L|KLHL13_ENST00000545703.1_Missense_Mutation_p.V443L|KLHL13_ENST00000371882.1_Missense_Mutation_p.V434L|KLHL13_ENST00000371878.1_Missense_Mutation_p.V434L|KLHL13_ENST00000371876.1_Missense_Mutation_p.V434L	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	485					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						CCTCCATACACAGTTCCAGCA	0.348																																																0			X											156.0	133.0	140.0					X																	117035823		2203	4300	6503	116919851	SO:0001583	missense	90293			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.1453G>T	X.37:g.117035823C>A	ENSP00000262820:p.Val485Leu	Unknown		x	x	x	116919851	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	ENST00000262820.3	37	CCDS14571.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	27.7	4.855636	0.91355	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	D;D;D;D;D;D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66;-1.66	3.99	3.99	0.46301	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.91838	0.7417	M	0.88704	2.975	0.58432	D	0.999999	D;D;D;D	0.76494	0.991;0.999;0.991;0.988	D;D;D;P	0.71656	0.915;0.974;0.915;0.899	D	0.93779	0.7082	10	0.87932	D	0	.	15.8334	0.78778	0.0:1.0:0.0:0.0	.	469;488;479;485	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	L	434;434;434;434;469;469;488;485;443;434	ENSP00000360949:V434L;ENSP00000360943:V434L;ENSP00000360945:V434L;ENSP00000412640:V434L;ENSP00000444450:V469L;ENSP00000441029:V469L;ENSP00000443191:V488L;ENSP00000262820:V485L;ENSP00000440707:V443L;ENSP00000419803:V434L	ENSP00000262820:V485L	V	-	1	0	KLHL13	116919851	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.609000	0.82925	1.984000	0.57885	0.538000	0.68166	GTG		0.348	KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_033495		Missense_Mutation
DCAF12L2	340578	broad.mit.edu	37	X	125298656	125298656	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1510-01	TCGA-13-1510-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chrX:125298656C>A	ENST00000360028.2	-	1	1278	c.1252G>T	c.(1252-1254)Gtg>Ttg	p.V418L	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.V418L			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	418								p.V418L(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						AAGTAGTTCACCCAGACGTCA	0.622																																																1	Substitution - Missense(1)	ovary(1)	X											109.0	111.0	110.0					X																	125298656		2203	4300	6503	125126337	SO:0001583	missense	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1252G>T	X.37:g.125298656C>A	ENSP00000353128:p.Val418Leu	Somatic		x	x	x	125126337	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	CCDS43991.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	3.861	-0.029891	0.07543	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.17213	2.29;2.29	4.14	2.36	0.29203	.	0.262289	0.20197	N	0.097188	T	0.10895	0.0266	L	0.44542	1.39	0.29425	N	0.860247	B	0.15719	0.014	B	0.14023	0.01	T	0.30387	-0.9980	10	0.11485	T	0.65	.	3.8079	0.08785	0.0:0.5753:0.1996:0.225	.	418	Q5VW00	DC122_HUMAN	L	418	ENSP00000441489:V418L;ENSP00000353128:V418L	ENSP00000353128:V418L	V	-	1	0	DCAF12L2	125126337	1.000000	0.71417	0.961000	0.40146	0.820000	0.46376	2.620000	0.46410	0.508000	0.28173	-0.990000	0.02549	GTG		0.622	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628		Missense_Mutation
FAP	2191	broad.mit.edu	37	2	163044874	163044910	+	Splice_Site	DEL	CTAAAGGAAAAACAAAAAAAACAAGAATCTTTGATTG	CTAAAGGAAAAACAAAAAAAACAAGAATCTTTGATTG	-	rs377402804|rs572215742|rs571721576|rs200451968	byFrequency	TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr2:163044874_163044910delCTAAAGGAAAAACAAAAAAAACAAGAATCTTTGATTG	ENST00000188790.4	-	20	1827		c.e20-1		FAP_ENST00000443424.1_Splice_Site	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.?(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						ACCACCATACCTAAAGGAAAAACAAAAAAAACAAGAATCTTTGATTGCTTTGTAAAA	0.376																																																1	Unknown(1)	ovary(1)	2																																								162753156	SO:0001630	splice_region_variant	2191			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1620-1CAATCAAAGATTCTTGTTTTTTTTGTTTTTCCTTTAG>-	2.37:g.163044874_163044910delCTAAAGGAAAAACAAAAAAAACAAGAATCTTTGATTG		Unknown		Capture	Illumina GAIIx	Phase_I	162753120		Splice_Site_Del	DEL	ENST00000188790.4	37	CCDS33311.1	DEL	24	Broad																																																																																				0.376	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		Intron	Splice_Site_Del
UTP3	57050	broad.mit.edu	37	4	71554419	71554431	+	Frame_Shift_Del	DEL	GGAGCAGCTAAGT	GGAGCAGCTAAGT	-	rs558424955		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr4:71554419_71554431delGGAGCAGCTAAGT	ENST00000254803.2	+	1	224_236	c.25_37delGGAGCAGCTAAGT	c.(25-39)ggagcagctaagtggfs	p.GAAKW9fs		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	9					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.A10fs*19(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			CCGGCGGCGCGGAGCAGCTAAGTGGGCAGCTGT	0.601																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								71773295	SO:0001589	frameshift_variant	57050			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.25_37delGGAGCAGCTAAGT	4.37:g.71554419_71554431delGGAGCAGCTAAGT	ENSP00000254803:p.Gly9fs	Unknown		Capture	Illumina GAIIx	Phase_I	71773283	Q6FI82	Frame_Shift_Del	DEL	ENST00000254803.2	37	CCDS3546.1	DEL	39	Broad																																																																																				0.601	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252163.2	NM_020368		Frame_Shift_Del
GSTCD	79807	broad.mit.edu	37	4	106755654	106755678	+	Frame_Shift_Del	DEL	GTGATTGAGCACTGTATCAAAACAC	GTGATTGAGCACTGTATCAAAACAC	-	rs372510155		TCGA-13-1510-01	TCGA-13-1510-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-13-1510-01	TCGA-13-1510-10	g.chr4:106755654_106755678delGTGATTGAGCACTGTATCAAAACAC	ENST00000515279.1	+	9	1787_1811	c.1567_1591delGTGATTGAGCACTGTATCAAAACAC	c.(1567-1593)gtgattgagcactgtatcaaaacacggfs	p.VIEHCIKTR523fs	GSTCD_ENST00000394730.3_Frame_Shift_Del_p.VIEHCIKTR436fs|GSTCD_ENST00000394728.3_Frame_Shift_Del_p.VIEHCIKTR523fs|GSTCD_ENST00000360505.5_Frame_Shift_Del_p.VIEHCIKTR523fs|GSTCD_ENST00000515255.1_3'UTR			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	523						extracellular vesicular exosome (GO:0070062)		p.V436fs*38(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		AACAGACATGGTGATTGAGCACTGTATCAAAACACGGGCTTCCTT	0.413																																																1	Deletion - Frameshift(1)	ovary(1)	4																																								106975127	SO:0001589	frameshift_variant	79807			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1567_1591delGTGATTGAGCACTGTATCAAAACAC	4.37:g.106755654_106755678delGTGATTGAGCACTGTATCAAAACAC	ENSP00000422354:p.Val523fs	Unknown		Capture	Illumina GAIIx	Phase_I	106975103	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Frame_Shift_Del	DEL	ENST00000515279.1	37	CCDS43257.1	DEL	44	Broad																																																																																				0.413	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751		Frame_Shift_Del
