#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ADAM2	2515	hgsc.bcm.edu	37	8	39613302	39613302	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1023-01	TCGA-23-1023-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr8:39613302T>G	ENST00000265708.4	-	16	1845	c.1742A>C	c.(1741-1743)cAt>cCt	p.H581P	ADAM2_ENST00000347580.4_Missense_Mutation_p.H562P|ADAM2_ENST00000379853.2_Missense_Mutation_p.H425P|ADAM2_ENST00000521880.1_Intron|AC136365.1_ENST00000408091.1_RNA	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	581	Cys-rich.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H581P(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GCTGTCTGCATGATCACTGGC	0.333																																																1	Substitution - Missense(1)	ovary(1)	8											98.0	95.0	96.0					8																	39613302		2203	4300	6503	39732459	SO:0001583	missense	2515			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1742A>C	8.37:g.39613302T>G	ENSP00000265708:p.His581Pro	Somatic		Capture	SOLID	Phase_IV	39732459	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.125	0.391266	0.11581	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708	T;T;T	0.21734	1.99;1.99;1.99	4.67	2.1	0.27182	ADAM, cysteine-rich (2);	.	.	.	.	T	0.20941	0.0504	L	0.41415	1.275	0.09310	N	1	P;B;B	0.48998	0.918;0.0;0.009	P;B;B	0.49140	0.601;0.012;0.007	T	0.09596	-1.0667	8	.	.	.	.	5.2195	0.15362	0.1798:0.0:0.1875:0.6327	.	425;562;581	Q6P2G0;Q99965-2;Q99965	.;.;ADAM2_HUMAN	P	562;425;581	ENSP00000343854:H562P;ENSP00000369182:H425P;ENSP00000265708:H581P	.	H	-	2	0	ADAM2	39732459	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.087000	0.11215	0.196000	0.20367	0.533000	0.62120	CAT		0.333	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464		Missense_Mutation
ARSF	416	hgsc.bcm.edu	37	X	3002505	3002505	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chrX:3002505G>A	ENST00000381127.1	+	6	849	c.628G>A	c.(628-630)Ggc>Agc	p.G210S	ARSF_ENST00000359361.2_Missense_Mutation_p.G210S|ARSF_ENST00000537104.1_Missense_Mutation_p.G210S	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	210					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.G210S(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAAGCTGAGCGGCTGGGTCTC	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											133.0	108.0	116.0					X																	3002505		2203	4300	6503	3012505	SO:0001583	missense	416			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.628G>A	X.37:g.3002505G>A	ENSP00000370519:p.Gly210Ser	Somatic		Capture	SOLID	Phase_IV	3012505	Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	CCDS14123.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035265	0.35893	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.93659	-3.26;-3.26;-3.26	3.44	-3.03	0.05429	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.326203	0.27139	N	0.020744	D	0.88481	0.6448	M	0.64997	1.995	0.09310	N	1	P	0.44309	0.832	B	0.43478	0.421	T	0.80710	-0.1261	10	0.38643	T	0.18	.	2.4257	0.04459	0.2605:0.3568:0.2751:0.1076	.	210	P54793	ARSF_HUMAN	S	210	ENSP00000370519:G210S;ENSP00000445594:G210S;ENSP00000352319:G210S	ENSP00000352319:G210S	G	+	1	0	ARSF	3012505	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.579000	0.02123	-0.448000	0.07128	-0.273000	0.10243	GGC		0.522	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			Missense_Mutation
ATRNL1	26033	hgsc.bcm.edu	37	10	117059759	117059759	+	Splice_Site	SNP	T	T	A	rs530243727		TCGA-23-1023-01	TCGA-23-1023-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr10:117059759T>A	ENST00000355044.3	+	16	2755		c.e16+2		ATRNL1_ENST00000423111.2_Splice_Site|ATRNL1_ENST00000303745.7_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AACCTGTTGGTAAGTAGTCCA	0.398																																																1	Unknown(1)	ovary(1)	10											59.0	61.0	60.0					10																	117059759		2203	4300	6503	117049749	SO:0001630	splice_region_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2629+2T>A	10.37:g.117059759T>A		Somatic		Capture	SOLID	Phase_IV	117049749	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Splice_Site_SNP	SNP	ENST00000355044.3	37	CCDS7592.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.4	3.978173	0.74360	.	.	ENSG00000107518	ENST00000355044;ENST00000526373	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8142	0.78586	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATRNL1	117049749	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.950000	0.87804	2.197000	0.70478	0.477000	0.44152	.		0.398	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	Intron	Splice_Site_SNP
SUGCT	79783	hgsc.bcm.edu	37	7	40488936	40488936	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr7:40488936G>T	ENST00000335693.4	+	10	911	c.888G>T	c.(886-888)caG>caT	p.Q296H	C7orf10_ENST00000401647.2_Missense_Mutation_p.Q248H|C7orf10_ENST00000309930.5_Missense_Mutation_p.Q296H	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		296					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)	p.Q296H(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						GAAATAACCAGCAGTTTGCCA	0.373																																																1	Substitution - Missense(1)	ovary(1)	7											111.0	106.0	107.0					7																	40488936		1832	4090	5922	40455461	SO:0001583	missense	79783																														ENST00000335693.4:c.888G>T	7.37:g.40488936G>T	ENSP00000338475:p.Gln296His	Somatic		Capture	SOLID	Phase_IV	40455461	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	ENST00000335693.4	37	CCDS55105.1	SNP	34	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.781|6.781	0.513084|0.513084	0.12944|0.12944	.|.	.|.	ENSG00000175600|ENSG00000175600	ENST00000309930;ENST00000401647;ENST00000335693|ENST00000416370	T;T;T|.	0.76060|.	-0.99;-0.99;-0.99|.	5.4|5.4	-2.79|-2.79	0.05841|0.05841	CoA-transferase family III domain (2);|.	0.254327|.	0.38897|.	N|.	0.001528|.	T|T	0.43033|0.43033	0.1229|0.1229	L|L	0.45698|0.45698	1.435|1.435	0.80722|0.80722	D|D	1|1	B;B;B|.	0.15473|.	0.001;0.006;0.013|.	B;B;B|.	0.20577|.	0.014;0.03;0.018|.	T|T	0.37291|0.37291	-0.9712|-0.9712	10|5	0.54805|.	T|.	0.06|.	-5.5528|-5.5528	3.1437|3.1437	0.06464|0.06464	0.3575:0.1245:0.3964:0.1215|0.3575:0.1245:0.3964:0.1215	.|.	248;296;259|.	Q4KMW8;Q9HAC7;Q9HAC7-2|.	.;CG010_HUMAN;.|.	H|I	296;248;296|291	ENSP00000312054:Q296H;ENSP00000385222:Q248H;ENSP00000338475:Q296H|.	ENSP00000312054:Q296H|.	Q|S	+|+	3|2	2|0	C7orf10|C7orf10	40455461|40455461	0.860000|0.860000	0.29831|0.29831	0.982000|0.982000	0.44146|0.44146	0.101000|0.101000	0.19017|0.19017	-0.231000|-0.231000	0.09069|0.09069	-0.401000|-0.401000	0.07644|0.07644	-1.107000|-1.107000	0.02091|0.02091	CAG|AGC		0.373	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1			Missense_Mutation
CA9	768	hgsc.bcm.edu	37	9	35679874	35679874	+	Silent	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr9:35679874G>A	ENST00000378357.4	+	8	1193	c.1089G>A	c.(1087-1089)ctG>ctA	p.L363L	CA9_ENST00000493245.1_3'UTR	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	363	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.L363L(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CTGACACCCTGTGGGGACCTG	0.597																																																1	Substitution - coding silent(1)	ovary(1)	9											75.0	65.0	68.0					9																	35679874		2203	4300	6503	35669874	SO:0001819	synonymous_variant	768			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.1089G>A	9.37:g.35679874G>A		Somatic		Capture	SOLID	Phase_IV	35669874	Q5T4R1	Silent	SNP	ENST00000378357.4	37	CCDS6585.1	SNP	48	Baylor																																																																																				0.597	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216		Silent
CDK5RAP1	51654	hgsc.bcm.edu	37	20	31984680	31984680	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr20:31984680G>T	ENST00000357886.4	-	2	344	c.191C>A	c.(190-192)aCt>aAt	p.T64N	CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.T64N|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.T64N|CDK5RAP1_ENST00000477105.1_Intron|CDK5RAP1_ENST00000339269.5_Missense_Mutation_p.T64N|CDK5RAP1_ENST00000473997.1_5'UTR			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	64	CDK5 activation inhibition.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.T64N(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						ATGTTGAAAAGTCGGTCCAGC	0.512																																																1	Substitution - Missense(1)	ovary(1)	20											83.0	84.0	84.0					20																	31984680		2203	4300	6503	31448341	SO:0001583	missense	51654			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.191C>A	20.37:g.31984680G>T	ENSP00000350558:p.Thr64Asn	Somatic		Capture	SOLID	Phase_IV	31448341	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.329	0.826109	0.16749	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000339269;ENST00000544843	.	.	.	5.42	4.45	0.53987	.	0.329618	0.35555	N	0.003133	T	0.36663	0.0975	L	0.46157	1.445	0.21841	N	0.999511	B;B;B;B;B;B	0.30634	0.007;0.288;0.007;0.007;0.003;0.004	B;B;B;B;B;B	0.32533	0.006;0.147;0.006;0.006;0.006;0.014	T	0.27054	-1.0085	9	0.38643	T	0.18	-12.0512	11.2526	0.49034	0.0:0.0:0.8181:0.1819	.	64;64;64;64;64;64	Q675N4;Q96SZ6-4;Q96SZ6;Q675N5;Q53H36;Q96SZ6-3	.;.;CK5P1_HUMAN;.;.;.	N	64	.	ENSP00000341840:T64N	T	-	2	0	CDK5RAP1	31448341	0.969000	0.33509	0.439000	0.26833	0.645000	0.38454	2.115000	0.41921	1.475000	0.48197	0.491000	0.48974	ACT		0.512	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408		Missense_Mutation
CEBPZ	10153	hgsc.bcm.edu	37	2	37456031	37456031	+	Missense_Mutation	SNP	A	A	G	rs112498574		TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr2:37456031A>G	ENST00000234170.5	-	2	450	c.305T>C	c.(304-306)gTt>gCt	p.V102A	NDUFAF7_ENST00000002125.4_5'Flank|NDUFAF7_ENST00000336237.6_5'Flank	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	102			V -> I (in dbSNP:rs2098386). {ECO:0000269|PubMed:2247079}.		positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				ATCTTCTTCAACTAAGGAAGC	0.328																																																0			2											49.0	47.0	48.0					2																	37456031		2202	4300	6502	37309535	SO:0001583	missense	10153			M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.305T>C	2.37:g.37456031A>G	ENSP00000234170:p.Val102Ala	Somatic		Capture	SOLID	Phase_IV	37309535	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	1.529	-0.544890	0.04024	.	.	ENSG00000115816	ENST00000234170;ENST00000545744;ENST00000446769	T;T	0.02258	4.37;4.37	5.65	-0.99	0.10238	.	1.280570	0.05025	N	0.473565	T	0.01523	0.0049	N	0.08118	0	0.09310	N	1	B	0.21309	0.054	B	0.13407	0.009	T	0.47995	-0.9073	10	0.66056	D	0.02	.	4.767	0.13137	0.3431:0.0:0.3607:0.2961	.	102	Q03701	CEBPZ_HUMAN	A	102;102;53	ENSP00000234170:V102A;ENSP00000391881:V53A	ENSP00000234170:V102A	V	-	2	0	CEBPZ	37309535	0.005000	0.15991	0.003000	0.11579	0.006000	0.05464	0.568000	0.23623	-0.415000	0.07484	-0.899000	0.02877	GTT		0.328	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760		Missense_Mutation
CENPE	1062	hgsc.bcm.edu	37	4	104065688	104065688	+	Silent	SNP	A	A	G			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr4:104065688A>G	ENST00000265148.3	-	33	5034	c.4945T>C	c.(4945-4947)Ttg>Ctg	p.L1649L	CENPE_ENST00000380026.3_Silent_p.L1624L	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1649					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.L1649L(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGCTCCTTCAAGTGTTCTATT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	4											118.0	113.0	115.0					4																	104065688		2203	4299	6502	104285137	SO:0001819	synonymous_variant	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4945T>C	4.37:g.104065688A>G		Somatic		Capture	SOLID	Phase_IV	104285137	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	ENST00000265148.3	37	CCDS34042.1	SNP	3	Baylor																																																																																				0.343	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Silent
CTDSP1	58190	hgsc.bcm.edu	37	2	219266330	219266330	+	Silent	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr2:219266330C>T	ENST00000273062.2	+	2	447	c.111C>T	c.(109-111)ggC>ggT	p.G37G	RP11-378A13.2_ENST00000608367.1_RNA|MIR26B_ENST00000362251.2_RNA|CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Silent_p.G37G	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	37					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)	p.G37G(1)		NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGCCGGGGCATCCTCCACT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	2											52.0	54.0	53.0					2																	219266330		2203	4300	6503	218974574	SO:0001819	synonymous_variant	58190			AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.111C>T	2.37:g.219266330C>T		Somatic		Capture	SOLID	Phase_IV	218974574	C9IYG0|Q7Z5Q3|Q7Z5Q4	Silent	SNP	ENST00000273062.2	37	CCDS2416.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704998	0.30232	.	.	ENSG00000144579	ENST00000452977;ENST00000428361;ENST00000431127	.	.	.	5.08	1.89	0.25635	.	.	.	.	.	T	0.55577	0.1929	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48210	-0.9055	4	.	.	.	-33.484	7.8771	0.29599	0.1281:0.6885:0.1113:0.0722	.	.	.	.	V	23;39;107	.	.	A	+	2	0	CTDSP1	218974574	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.627000	0.24506	0.544000	0.28883	-0.126000	0.14955	GCA		0.637	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198		Silent
COL6A3	1293	hgsc.bcm.edu	37	2	238303599	238303599	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr2:238303599C>A	ENST00000295550.4	-	3	792	c.340G>T	c.(340-342)Gga>Tga	p.G114*	COL6A3_ENST00000392004.3_Intron|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000353578.4_Intron|COL6A3_ENST00000346358.4_Nonsense_Mutation_p.G114*|COL6A3_ENST00000347401.3_Nonsense_Mutation_p.G114*	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	114	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.G114*(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGATTGGTTCCCCCAATATAA	0.463																																																1	Substitution - Nonsense(1)	ovary(1)	2											92.0	97.0	95.0					2																	238303599		2203	4300	6503	237968338	SO:0001587	stop_gained	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.340G>T	2.37:g.238303599C>A	ENSP00000295550:p.Gly114*	Somatic		Capture	SOLID	Phase_IV	237968338	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Nonsense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	40	8.048532	0.98627	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000346358;ENST00000433762	.	.	.	4.81	4.81	0.61882	.	0.000000	0.46145	U	0.000319	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9023	0.88907	0.0:1.0:0.0:0.0	.	.	.	.	X	114	.	ENSP00000295550:G114X	G	-	1	0	COL6A3	237968338	1.000000	0.71417	0.870000	0.34147	0.434000	0.31775	5.904000	0.69886	2.208000	0.71279	0.455000	0.32223	GGA		0.463	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369		Nonsense_Mutation
CTNND2	1501	hgsc.bcm.edu	37	5	10973590	10973590	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr5:10973590G>A	ENST00000304623.8	-	22	3842	c.3653C>T	c.(3652-3654)cCg>cTg	p.P1218L	CTNND2_ENST00000511377.1_Missense_Mutation_p.P1127L|CTNND2_ENST00000458100.2_Missense_Mutation_p.P785L|CTNND2_ENST00000359640.2_Missense_Mutation_p.P1160L|CTNND2_ENST00000503622.1_Missense_Mutation_p.P881L|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1218					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P1218L(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGGGGAGGCCGGGTAGTGGCT	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											50.0	56.0	54.0					5																	10973590		2203	4300	6503	11026590	SO:0001583	missense	1501			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3653C>T	5.37:g.10973590G>A	ENSP00000307134:p.Pro1218Leu	Somatic		Capture	SOLID	Phase_IV	11026590	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181097	0.78677	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	D;D;D;D;T	0.82526	-1.52;-1.62;-1.56;-1.54;-1.49	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88306	0.6401	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.992	D	0.88846	0.3316	10	0.87932	D	0	-23.6005	20.0522	0.97631	0.0:0.0:1.0:0.0	.	881;810;1218	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	L	1218;1160;1127;313;785;881	ENSP00000307134:P1218L;ENSP00000352661:P1160L;ENSP00000426510:P1127L;ENSP00000391155:P785L;ENSP00000426887:P881L	ENSP00000307134:P1218L	P	-	2	0	CTNND2	11026590	1.000000	0.71417	0.969000	0.41365	0.954000	0.61252	9.476000	0.97823	2.737000	0.93849	0.563000	0.77884	CCG		0.542	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		Missense_Mutation
EIF2AK3	9451	hgsc.bcm.edu	37	2	88857412	88857412	+	Nonsense_Mutation	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr2:88857412G>A	ENST00000303236.3	-	17	3494	c.3193C>T	c.(3193-3195)Cga>Tga	p.R1065*	EIF2AK3_ENST00000419748.1_Nonsense_Mutation_p.R914*|AC104134.2_ENST00000413234.1_RNA	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	1065	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)	p.R1064*(1)		ovary(3)	3						GCTTCAGGTCGTTCCATGGGG	0.413																																					GBM(138;671 1851 16235 39058 45249)											1	Substitution - Nonsense(1)	ovary(1)	2											161.0	154.0	157.0					2																	88857412		2203	4300	6503	88638527	SO:0001587	stop_gained	9451			AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.3193C>T	2.37:g.88857412G>A	ENSP00000307235:p.Arg1065*	Somatic		Capture	SOLID	Phase_IV	88638527	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Nonsense_Mutation	SNP	ENST00000303236.3	37	CCDS33241.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	G	40	8.503850	0.98838	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	.	.	.	5.65	3.7	0.42460	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.379	14.4007	0.67044	0.0:0.0:0.5777:0.4223	.	.	.	.	X	914;1065;914;944	.	ENSP00000307235:R1065X	R	-	1	2	EIF2AK3	88638527	0.996000	0.38824	0.940000	0.37924	0.866000	0.49608	1.785000	0.38684	1.483000	0.48342	0.655000	0.94253	CGA		0.413	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836		Nonsense_Mutation
EPHB4	2050	hgsc.bcm.edu	37	7	100410422	100410422	+	Missense_Mutation	SNP	C	C	T	rs529340542		TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr7:100410422C>T	ENST00000358173.3	-	12	2533	c.2065G>A	c.(2065-2067)Gtc>Atc	p.V689I	EPHB4_ENST00000360620.3_Missense_Mutation_p.V689I|EPHB4_ENST00000477446.1_5'Flank	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	689	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V689I(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGAATCATGACGGGCATGCTG	0.627																																					GBM(200;2113 3072 25865 52728)											1	Substitution - Missense(1)	ovary(1)	7											88.0	84.0	85.0					7																	100410422		2203	4300	6503	100248358	SO:0001583	missense	2050			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.2065G>A	7.37:g.100410422C>T	ENSP00000350896:p.Val689Ile	Somatic		Capture	SOLID	Phase_IV	100248358	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	37	CCDS5706.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048239	0.55110	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.61859	0.07;0.07	4.79	4.79	0.61399	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000166	T	0.53916	0.1826	N	0.02802	-0.49	0.54753	D	0.999981	D;D	0.89917	0.996;1.0	D;D	0.79108	0.97;0.992	T	0.67730	-0.5595	10	0.56958	D	0.05	.	15.6721	0.77286	0.0:1.0:0.0:0.0	.	689;689	Q96L35;P54760	.;EPHB4_HUMAN	I	689	ENSP00000353833:V689I;ENSP00000350896:V689I	ENSP00000350896:V689I	V	-	1	0	EPHB4	100248358	0.997000	0.39634	0.934000	0.37439	0.028000	0.11728	3.649000	0.54417	2.368000	0.80403	0.650000	0.86243	GTC		0.627	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444		Missense_Mutation
FBXL20	84961	hgsc.bcm.edu	37	17	37425079	37425079	+	Splice_Site	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr17:37425079C>T	ENST00000264658.6	-	12	1194		c.e12+1		FBXL20_ENST00000394294.3_Splice_Site|FBXL20_ENST00000583610.1_Splice_Site|FBXL20_ENST00000577399.1_Splice_Site	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20						behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)		p.?(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			TACAATCTTACCTGAACACAC	0.333																																																1	Unknown(1)	ovary(1)	17											135.0	129.0	131.0					17																	37425079		2203	4300	6503	34678605	SO:0001630	splice_region_variant	84961			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.933+1G>A	17.37:g.37425079C>T		Somatic		Capture	SOLID	Phase_IV	34678605	A8K729|Q38J52	Splice_Site_SNP	SNP	ENST00000264658.6	37	CCDS32640.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518841	0.85495	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.834	0.88691	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBXL20	34678605	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.747000	0.85070	2.303000	0.77524	0.650000	0.86243	.		0.333	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444315.2	NM_032875	Intron	Splice_Site_SNP
FGFR1	2260	hgsc.bcm.edu	37	8	38275796	38275796	+	Silent	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr8:38275796G>A	ENST00000447712.2	-	10	2321	c.1380C>T	c.(1378-1380)gtC>gtT	p.V460V	FGFR1_ENST00000326324.6_Silent_p.V369V|FGFR1_ENST00000335922.5_Silent_p.V450V|FGFR1_ENST00000532791.1_Silent_p.V458V|FGFR1_ENST00000397091.5_Silent_p.V458V|FGFR1_ENST00000397113.2_Silent_p.V458V|FGFR1_ENST00000397103.1_Silent_p.V371V|FGFR1_ENST00000356207.5_Silent_p.V371V|FGFR1_ENST00000397108.4_Silent_p.V458V|FGFR1_ENST00000425967.3_Silent_p.V491V|FGFR1_ENST00000341462.5_Silent_p.V460V	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	460					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.V460V(2)	FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CATACTCAGAGACCCCTGCTA	0.542		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	2	Substitution - coding silent(2)	ovary(2)	8											73.0	78.0	77.0					8																	38275796		2025	4176	6201	38394953	SO:0001819	synonymous_variant	2260			M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1380C>T	8.37:g.38275796G>A		Somatic		Capture	SOLID	Phase_IV	38394953	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	ENST00000447712.2	37	CCDS6107.2	SNP	33	Baylor																																																																																				0.542	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				Silent
FNDC3B	64778	hgsc.bcm.edu	37	3	171965365	171965365	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr3:171965365C>T	ENST00000336824.4	+	5	406	c.307C>T	c.(307-309)Ccc>Tcc	p.P103S	FNDC3B_ENST00000416957.1_Missense_Mutation_p.P103S|FNDC3B_ENST00000415807.2_Missense_Mutation_p.P103S	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	103					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.P103S(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		GGTGGTCACACCCCAGTCTCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											168.0	148.0	155.0					3																	171965365		2203	4300	6503	173448059	SO:0001583	missense	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.307C>T	3.37:g.171965365C>T	ENSP00000338523:p.Pro103Ser	Somatic		Capture	SOLID	Phase_IV	173448059	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	32	5.129952	0.94473	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957;ENST00000443501	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.60741	0.2292	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.983	T	0.62334	-0.6876	10	0.87932	D	0	-14.3507	20.2192	0.98319	0.0:1.0:0.0:0.0	.	103;103	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	S	103;103;103;76	ENSP00000411242:P103S;ENSP00000338523:P103S;ENSP00000389094:P103S;ENSP00000389064:P76S	ENSP00000338523:P103S	P	+	1	0	FNDC3B	173448059	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.219000	0.78000	2.780000	0.95670	0.655000	0.94253	CCC		0.458	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763		Missense_Mutation
GJA5	2702	hgsc.bcm.edu	37	1	147231245	147231245	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr1:147231245C>T	ENST00000271348.2	-	2	263	c.102G>A	c.(100-102)atG>atA	p.M34I	GJA5_ENST00000369237.1_Missense_Mutation_p.M34I|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	34					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)	p.M34I(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CCAGCACGAGCATACGGAATA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											101.0	100.0	100.0					1																	147231245		2203	4300	6503	145697869	SO:0001583	missense	2702				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.102G>A	1.37:g.147231245C>T	ENSP00000271348:p.Met34Ile	Somatic		Capture	SOLID	Phase_IV	145697869	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	37	CCDS929.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.091	0.385006	0.11524	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.98313	-4.86;-4.86;-4.86	5.78	4.87	0.63330	Connexin, N-terminal (1);	0.080516	0.85682	N	0.000000	D	0.85279	0.5660	N	0.01473	-0.845	0.54753	D	0.999988	B	0.20052	0.041	B	0.24269	0.052	T	0.80975	-0.1142	10	0.02654	T	1	.	14.8613	0.70384	0.0:0.9314:0.0:0.0686	.	34	P36382	CXA5_HUMAN	I	34	ENSP00000271348:M34I;ENSP00000358240:M34I;ENSP00000407645:M34I	ENSP00000271348:M34I	M	-	3	0	GJA5	145697869	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.637000	0.54324	1.452000	0.47756	0.563000	0.77884	ATG		0.557	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703		Missense_Mutation
MCMBP	79892	hgsc.bcm.edu	37	10	121586929	121586929	+	IGR	SNP	G	G	A	rs563867547		TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr10:121586929G>A	ENST00000360003.3	-	0	4113				INPP5F_ENST00000361976.2_Silent_p.S1012S|INPP5F_ENST00000369080.3_Silent_p.S402S	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein						DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.S1012S(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						CTCGGCCATCGCAATTAGATG	0.463													g|||	1	0.000199681	0.0	0.0	5008	,	,		21259	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	10											129.0	123.0	125.0					10																	121586929		2203	4300	6503	121576919	SO:0001628	intergenic_variant	22876			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159		10.37:g.121586929G>A		Somatic		Capture	SOLID	Phase_IV	121576919	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Silent	SNP	ENST00000360003.3	37	CCDS7617.1	SNP	38	Baylor																																																																																				0.463	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834		Silent
ITGB7	3695	hgsc.bcm.edu	37	12	53585702	53585702	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr12:53585702A>G	ENST00000267082.5	-	15	2488	c.2257T>C	c.(2257-2259)Tat>Cat	p.Y753H	ITGB7_ENST00000422257.3_Missense_Mutation_p.Y753H|ITGB7_ENST00000338737.4_Missense_Mutation_p.Y605H|ITGB7_ENST00000550743.2_Missense_Mutation_p.Y605H	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	753					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.Y753H(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGGCGGTCATAGATTTCCACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											56.0	57.0	57.0					12																	53585702		2203	4300	6503	51871969	SO:0001583	missense	3695				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.2257T>C	12.37:g.53585702A>G	ENSP00000267082:p.Tyr753His	Somatic		Capture	SOLID	Phase_IV	51871969	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	SNP	15	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247410	0.39697	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737	D;D;D	0.86230	-2.09;-2.09;-2.09	4.86	4.86	0.63082	Integrin beta subunit, cytoplasmic (2);	0.000000	0.38548	N	0.001645	T	0.77370	0.4120	N	0.20574	0.59	0.32126	N	0.587357	P	0.36199	0.543	B	0.39660	0.306	T	0.74368	-0.3688	10	0.02654	T	1	.	13.7769	0.63059	1.0:0.0:0.0:0.0	.	753	P26010	ITB7_HUMAN	H	753;753;605	ENSP00000408741:Y753H;ENSP00000267082:Y753H;ENSP00000345501:Y605H	ENSP00000267082:Y753H	Y	-	1	0	ITGB7	51871969	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.980000	0.49321	1.970000	0.57323	0.533000	0.62120	TAT		0.597	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2			Missense_Mutation
KCNJ1	3758	hgsc.bcm.edu	37	11	128709991	128709991	+	Frame_Shift_Del	DEL	A	A	-			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr11:128709991delA	ENST00000392664.2	-	2	321	c.205delT	c.(205-207)tggfs	p.W69fs	KCNJ1_ENST00000392665.2_Frame_Shift_Del_p.W50fs|KCNJ1_ENST00000392666.1_Frame_Shift_Del_p.W50fs|KCNJ1_ENST00000324036.3_Frame_Shift_Del_p.W50fs|KCNJ1_ENST00000440599.2_Frame_Shift_Del_p.W50fs	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	69					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.W69fs*13(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	ACCGTTGTCCAGATGTCCACA	0.443																																																1	Deletion - Frameshift(1)	ovary(1)	11											189.0	176.0	180.0					11																	128709991		2201	4297	6498	128215201	SO:0001589	frameshift_variant	3758			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.205delT	11.37:g.128709991delA	ENSP00000376432:p.Trp69fs	Somatic		Capture	SOLID	Phase_IV	128215201	B2RMR4|Q6LD67	Frame_Shift_Del	DEL	ENST00000392664.2	37	CCDS8476.1	DEL	7	Baylor																																																																																				0.443	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220		Frame_Shift_Del
KCNK10	54207	hgsc.bcm.edu	37	14	88693873	88693873	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr14:88693873C>G	ENST00000340700.5	-	4	963	c.512G>C	c.(511-513)gGg>gCg	p.G171A	KCNK10_ENST00000319231.5_Missense_Mutation_p.G176A|KCNK10_ENST00000312350.5_Missense_Mutation_p.G176A	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	171					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.G171A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						AGCAATATTCCCATACCCTGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											81.0	89.0	86.0					14																	88693873		2203	4300	6503	87763626	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.512G>C	14.37:g.88693873C>G	ENSP00000343104:p.Gly171Ala	Somatic		Capture	SOLID	Phase_IV	87763626	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910219	0.92107	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.82893	-1.66;-1.66;-1.66	5.91	5.91	0.95273	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94917	0.8070	10	0.87932	D	0	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	171;176;176	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	A	171;176;176	ENSP00000343104:G171A;ENSP00000310568:G176A;ENSP00000312811:G176A	ENSP00000310568:G176A	G	-	2	0	KCNK10	87763626	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	GGG		0.393	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161		Missense_Mutation
MAS1L	116511	hgsc.bcm.edu	37	6	29455532	29455532	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr6:29455532C>T	ENST00000377127.3	-	1	206	c.148G>A	c.(148-150)Gtc>Atc	p.V50I		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	50					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V50I(2)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						TGAAGAAAGACGCCACAGAGC	0.498																																					NSCLC(153;755 1987 3859 11251 32945)											2	Substitution - Missense(2)	ovary(2)	6											89.0	88.0	88.0					6																	29455532		2203	4300	6503	29563511	SO:0001583	missense	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.148G>A	6.37:g.29455532C>T	ENSP00000366331:p.Val50Ile	Somatic		Capture	SOLID	Phase_IV	29563511	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	37	CCDS4661.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.103	0.017108	0.07959	.	.	ENSG00000204687	ENST00000377127	T	0.03745	3.82	0.675	-1.35	0.09114	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44513	-0.9323	8	0.20519	T	0.43	.	.	.	.	.	50	P35410	MAS1L_HUMAN	I	50	ENSP00000366331:V50I	ENSP00000366331:V50I	V	-	1	0	MAS1L	29563511	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-1.652000	0.01988	-0.526000	0.06383	0.388000	0.25769	GTC		0.498	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967		Missense_Mutation
LAMA2	3908	hgsc.bcm.edu	37	6	129663610	129663610	+	Silent	SNP	C	C	T			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr6:129663610C>T	ENST00000421865.2	+	30	4483	c.4434C>T	c.(4432-4434)aaC>aaT	p.N1478N		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1478	Laminin EGF-like 16. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.N1478N(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTTCCAGTAACAAGTAAGATT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	6											118.0	112.0	114.0					6																	129663610		2203	4300	6503	129705303	SO:0001819	synonymous_variant	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4434C>T	6.37:g.129663610C>T		Somatic		Capture	SOLID	Phase_IV	129705303	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1	SNP	17	Baylor																																																																																				0.408	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1			Silent
MMP1	4312	hgsc.bcm.edu	37	11	102663432	102663432	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1023-01	TCGA-23-1023-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr11:102663432C>G	ENST00000315274.6	-	7	1004	c.937G>C	c.(937-939)Gag>Cag	p.E313Q	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	313					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E313Q(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	AAATTGAGCTCAACTTCCGGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	11											119.0	119.0	119.0					11																	102663432		2203	4299	6502	102168642	SO:0001583	missense	4312			X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.937G>C	11.37:g.102663432C>G	ENSP00000322788:p.Glu313Gln	Somatic		Capture	SOLID	Phase_IV	102168642	P08156	Missense_Mutation	SNP	ENST00000315274.6	37	CCDS8322.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	c	18.43	3.622298	0.66787	.	.	ENSG00000196611	ENST00000315274	T	0.02812	4.15	6.16	6.16	0.99307	Hemopexin/matrixin (2);	0.259487	0.33346	N	0.005016	T	0.05868	0.0153	L	0.60012	1.86	0.58432	D	0.999996	D	0.56287	0.975	P	0.44946	0.465	T	0.04678	-1.0934	10	0.66056	D	0.02	.	12.6979	0.57014	0.0:0.9251:0.0:0.0749	.	313	P03956	MMP1_HUMAN	Q	313	ENSP00000322788:E313Q	ENSP00000322788:E313Q	E	-	1	0	MMP1	102168642	0.995000	0.38212	0.990000	0.47175	0.502000	0.33828	5.027000	0.64109	2.937000	0.99478	0.650000	0.86243	GAG		0.408	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109632.1	NM_002421		Missense_Mutation
MNAT1	4331	hgsc.bcm.edu	37	14	61285490	61285490	+	Silent	SNP	A	A	G			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr14:61285490A>G	ENST00000261245.4	+	6	713	c.612A>G	c.(610-612)agA>agG	p.R204R	MNAT1_ENST00000539616.2_Intron	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	204					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)	p.R204R(1)		NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		ATAAAGATAGATCTACCCAAT	0.363								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - coding silent(1)	ovary(1)	14											77.0	77.0	77.0					14																	61285490		2203	4300	6503	60355243	SO:0001819	synonymous_variant	4331			X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.612A>G	14.37:g.61285490A>G		Somatic		Capture	SOLID	Phase_IV	60355243	G3V1U8|Q15817|Q6ICQ7	Silent	SNP	ENST00000261245.4	37	CCDS9750.1	SNP	12	Baylor																																																																																				0.363	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431		Silent
NUPL1	9818	hgsc.bcm.edu	37	13	25910372	25910372	+	Intron	SNP	C	C	A			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr13:25910372C>A	ENST00000381736.3	+	14	1685				NUPL1_ENST00000466694.1_Intron|NUPL1_ENST00000381718.3_Intron|NUPL1_ENST00000463407.1_3'UTR	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TGTAATGTAGCAGAGCTTAAG	0.303																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)											0			13											124.0	121.0	122.0					13																	25910372		2200	4299	6499	24808372	SO:0001627	intron_variant	9818			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.1436-702C>A	13.37:g.25910372C>A		Somatic		Capture	SOLID	Phase_IV	24808372	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	ENST00000381736.3	37	CCDS9314.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.95	2.391069	0.42410	.	.	ENSG00000139496	ENST00000381745;ENST00000381747;ENST00000394327	T;T	0.52526	1.27;0.66	5.6	5.6	0.85130	.	.	.	.	.	T	0.66809	0.2827	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68884	-0.5291	6	0.62326	D	0.03	.	17.7846	0.88533	0.0:1.0:0.0:0.0	.	.	.	.	E	474;486;433	ENSP00000371166:A486E;ENSP00000408147:A433E	ENSP00000371164:A474E	A	+	2	0	NUPL1	24808372	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.521000	0.45563	2.628000	0.89032	0.655000	0.94253	GCA		0.303	NUPL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044228.2			Missense_Mutation
OR5B17	219965	hgsc.bcm.edu	37	11	58126179	58126179	+	Missense_Mutation	SNP	C	C	T	rs372264787		TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr11:58126179C>T	ENST00000357377.3	-	1	363	c.364G>A	c.(364-366)Gca>Aca	p.A122T		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A122T(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CACACTGCTGCGTAGCGGTCA	0.478																																																1	Substitution - Missense(1)	ovary(1)	11						C	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	122.0	110.0	114.0		364	1.4	0.0	11		114	3,8587	3.0+/-9.4	0,3,4292	no	missense	OR5B17	NM_001005489.1	58	0,4,6492	TT,TC,CC		0.0349,0.0227,0.0308	benign	122/315	58126179	4,12988	2201	4295	6496	57882755	SO:0001583	missense	219965			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.364G>A	11.37:g.58126179C>T	ENSP00000349945:p.Ala122Thr	Somatic		Capture	SOLID	Phase_IV	57882755	Q6IEX1	Missense_Mutation	SNP	ENST00000357377.3	37	CCDS31548.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	c	11.79	1.743809	0.30865	2.27E-4	3.49E-4	ENSG00000197786	ENST00000357377	T	0.00402	7.56	3.6	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	1.037490	0.07744	N	0.947442	T	0.00328	0.0010	L	0.48174	1.505	0.09310	N	1	P	0.44776	0.843	B	0.34536	0.185	T	0.50808	-0.8784	10	0.56958	D	0.05	-0.0087	7.6295	0.28230	0.0:0.7521:0.0:0.2479	.	122	Q8NGF7	OR5BH_HUMAN	T	122	ENSP00000349945:A122T	ENSP00000349945:A122T	A	-	1	0	OR5B17	57882755	0.000000	0.05858	0.008000	0.14137	0.610000	0.37248	-0.861000	0.04268	0.082000	0.17018	0.461000	0.40582	GCA		0.478	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489		Missense_Mutation
PDCL2	132954	hgsc.bcm.edu	37	4	56428648	56428648	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr4:56428648A>C	ENST00000295645.4	-	5	596	c.494T>G	c.(493-495)tTt>tGt	p.F165C		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	165	Thioredoxin fold. {ECO:0000250}.							p.F165C(1)		endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TTTATACACAAAAATTGTTGG	0.318																																																1	Substitution - Missense(1)	ovary(1)	4											71.0	67.0	68.0					4																	56428648		1800	4076	5876	56123405	SO:0001583	missense	132954			BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.494T>G	4.37:g.56428648A>C	ENSP00000295645:p.Phe165Cys	Somatic		Capture	SOLID	Phase_IV	56123405	A8MWA2|B9ZVQ9	Missense_Mutation	SNP	ENST00000295645.4	37	CCDS47059.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.7	4.319908	0.81469	.	.	ENSG00000163440	ENST00000295645	T	0.43294	0.95	5.85	5.85	0.93711	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.084010	0.52532	D	0.000075	T	0.67496	0.2899	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71699	-0.4514	10	0.66056	D	0.02	-14.9925	16.2236	0.82274	1.0:0.0:0.0:0.0	.	165	Q8N4E4	PDCL2_HUMAN	C	165	ENSP00000295645:F165C	ENSP00000295645:F165C	F	-	2	0	PDCL2	56123405	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.591000	0.90824	2.235000	0.73313	0.402000	0.26972	TTT		0.318	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361659.1	NM_152401		Missense_Mutation
ZNF512B	57473	hgsc.bcm.edu	37	20	62641616	62641616	+	Intron	SNP	A	A	T			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr20:62641616A>T	ENST00000450537.1	-	1	56				PRPF6_ENST00000535781.1_Missense_Mutation_p.E417V|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E417V(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GAAGAACCTGAAGATGCTAGA	0.567																																																1	Substitution - Missense(1)	ovary(1)	20											111.0	100.0	104.0					20																	62641616		2203	4300	6503	62112060	SO:0001627	intron_variant	24148			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+38441T>A	20.37:g.62641616A>T		Somatic		Capture	SOLID	Phase_IV	62112060	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	26.0	4.698609	0.88830	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.38560	1.13;1.13	5.99	5.99	0.97316	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.72350	0.3449	H	0.94582	3.555	0.80722	D	1	D;P	0.59767	0.986;0.955	P;P	0.61592	0.891;0.642	T	0.80810	-0.1216	10	0.66056	D	0.02	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	417;417	O94906-2;O94906	.;PRP6_HUMAN	V	417	ENSP00000266079:E417V;ENSP00000446216:E417V	ENSP00000266079:E417V	E	+	2	0	PRPF6	62112060	1.000000	0.71417	0.866000	0.34008	0.456000	0.32438	8.994000	0.93529	2.291000	0.77112	0.533000	0.62120	GAA		0.567	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713		Missense_Mutation
RBM10	8241	hgsc.bcm.edu	37	X	47028833	47028833	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chrX:47028833G>A	ENST00000377604.3	+	3	879	c.137G>A	c.(136-138)cGc>cAc	p.R46H	RBM10_ENST00000329236.7_Missense_Mutation_p.R46H|RBM10_ENST00000345781.6_Missense_Mutation_p.R46H	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	46					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R46H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						TCATATCCTCGCGAGTATGGC	0.637																																					Melanoma(171;120 2705 19495 39241)											1	Substitution - Missense(1)	ovary(1)	X											91.0	58.0	69.0					X																	47028833		2203	4300	6503	46913777	SO:0001583	missense	8241			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.137G>A	X.37:g.47028833G>A	ENSP00000366829:p.Arg46His	Somatic		Capture	SOLID	Phase_IV	46913777	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907271	0.72868	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.20069	2.52;2.1;2.34	4.65	4.65	0.58169	.	0.263378	0.31936	N	0.006822	T	0.30355	0.0762	N	0.24115	0.695	0.26362	N	0.977035	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999	D;P;D;D;D	0.76071	0.984;0.902;0.955;0.984;0.987	T	0.06162	-1.0842	10	0.49607	T	0.09	-10.6527	12.3651	0.55224	0.0:0.0:1.0:0.0	.	46;111;46;46;46	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	H	46	ENSP00000366829:R46H;ENSP00000328848:R46H;ENSP00000329659:R46H	ENSP00000328848:R46H	R	+	2	0	RBM10	46913777	1.000000	0.71417	0.766000	0.31476	0.734000	0.41952	6.182000	0.71995	2.056000	0.61249	0.513000	0.50165	CGC		0.637	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676		Missense_Mutation
SLC2A14	144195	hgsc.bcm.edu	37	12	7970608	7970608	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr12:7970608A>C	ENST00000543909.1	-	15	1922	c.1163T>G	c.(1162-1164)tTt>tGt	p.F388C	SLC2A14_ENST00000396589.2_Missense_Mutation_p.F388C|SLC2A14_ENST00000535295.1_Missense_Mutation_p.F279C|SLC2A14_ENST00000542505.1_Missense_Mutation_p.F29C|SLC2A14_ENST00000431042.2_Missense_Mutation_p.F365C|SLC2A14_ENST00000542546.1_Missense_Mutation_p.F279C|SLC2A14_ENST00000340749.5_Missense_Mutation_p.F365C|SLC2A14_ENST00000539924.1_Missense_Mutation_p.F403C			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	388					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)	p.F388C(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AATACAGACAAAGCTCATCCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	12											40.0	41.0	41.0					12																	7970608		2203	4300	6503	7861875	SO:0001583	missense	144195			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1163T>G	12.37:g.7970608A>C	ENSP00000440480:p.Phe388Cys	Somatic		Capture	SOLID	Phase_IV	7861875	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	37	CCDS8585.1	SNP	1	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.286	0.816601	0.16607	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000542505;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	D;D;D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	3.12	-0.717	0.11208	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.169871	0.53938	D	0.000049	T	0.69424	0.3109	L	0.28556	0.865	0.38894	D	0.957177	B;B;B;B	0.15141	0.012;0.004;0.001;0.003	B;B;B;B	0.20577	0.03;0.021;0.012;0.021	T	0.60627	-0.7226	10	0.87932	D	0	.	6.4599	0.21950	0.3434:0.0:0.0:0.6566	.	403;279;365;388	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	C	365;388;365;29;388;279;279;403	ENSP00000340450:F365C;ENSP00000440480:F388C;ENSP00000407287:F365C;ENSP00000438484:F29C;ENSP00000379834:F388C;ENSP00000440492:F279C;ENSP00000443903:F279C;ENSP00000445929:F403C	ENSP00000340450:F365C	F	-	2	0	SLC2A14	7861875	1.000000	0.71417	0.902000	0.35471	0.417000	0.31264	4.515000	0.60489	0.190000	0.20209	0.164000	0.16699	TTT		0.463	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449		Missense_Mutation
SLK	9748	hgsc.bcm.edu	37	10	105762745	105762745	+	Silent	SNP	A	A	G			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr10:105762745A>G	ENST00000369755.3	+	9	2354	c.1809A>G	c.(1807-1809)aaA>aaG	p.K603K	SLK_ENST00000335753.4_Silent_p.K603K	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	603	Glu-rich.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TTCCTATTAAAGAAATAGTTG	0.373																																					NSCLC(111;540 1651 1927 4474 17706)											0			10											35.0	36.0	36.0					10																	105762745		2203	4300	6503	105752735	SO:0001819	synonymous_variant	9748				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.1809A>G	10.37:g.105762745A>G		Somatic		Capture	SOLID	Phase_IV	105752735	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Silent	SNP	ENST00000369755.3	37	CCDS7553.1	SNP	3	Baylor																																																																																				0.373	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720		Silent
SNX12	29934	hgsc.bcm.edu	37	X	70282710	70282710	+	Silent	SNP	A	A	G			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chrX:70282710A>G	ENST00000374274.3	-	2	371	c.255T>C	c.(253-255)gaT>gaC	p.D85D	SNX12_ENST00000465030.1_5'UTR|SNX12_ENST00000276105.3_Silent_p.D81D	NM_001256185.1|NM_001256188.1|NM_013346.3	NP_001243114.1|NP_001243117.1|NP_037478.2	Q9UMY4	SNX12_HUMAN	sorting nexin 12	85	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of protein transport (GO:0051224)|regulation of endocytosis (GO:0030100)	early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)	p.D85D(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	8	Renal(35;0.156)					ATACCTTGCTATCTCTCTCCA	0.483																																																1	Substitution - coding silent(1)	ovary(1)	X											107.0	82.0	91.0					X																	70282710		2203	4300	6503	70199435	SO:0001819	synonymous_variant	29934			AF171229	CCDS14405.1, CCDS59169.1	Xq13.1	2008-03-11			ENSG00000147164	ENSG00000147164		"""Sorting nexins"""	14976	protein-coding gene	gene with protein product		300883					Standard	NM_013346		Approved		uc004dyr.2	Q9UMY4	OTTHUMG00000021786	ENST00000374274.3:c.255T>C	X.37:g.70282710A>G		Somatic		Capture	SOLID	Phase_IV	70199435	F8W8K5|Q8WUG9	Silent	SNP	ENST00000374274.3	37	CCDS14405.1	SNP	16	Baylor																																																																																				0.483	SNX12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057094.1	NM_013346		Silent
SON	6651	hgsc.bcm.edu	37	21	34948696	34948696	+	Frame_Shift_Del	DEL	G	G	-	rs201284665|rs34373121		TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr21:34948696delG	ENST00000356577.4	+	12	7722	c.7247delG	c.(7246-7248)agafs	p.R2416fs	SON_ENST00000381692.2_Frame_Shift_Del_p.R444fs|DONSON_ENST00000303113.6_Intron|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000290239.6_3'UTR|SON_ENST00000470533.1_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2416	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.			ALTR -> SPYQ (in Ref. 2; AAK07692). {ECO:0000305}.	cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCCCTTACCAGACCCAATTGT	0.363																																																0			21											45.0	46.0	46.0					21																	34948696		2202	4291	6493	33870566	SO:0001589	frameshift_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7247delG	21.37:g.34948696delG	ENSP00000348984:p.Arg2416fs	Somatic		Capture	SOLID	Phase_IV	33870566	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Del	DEL	ENST00000356577.4	37	CCDS13629.1	DEL	33	Baylor																																																																																				0.363	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		Frame_Shift_Del
SREBF2	6721	hgsc.bcm.edu	37	22	42269825	42269825	+	Silent	SNP	C	C	G			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr22:42269825C>G	ENST00000361204.4	+	5	1057	c.891C>G	c.(889-891)acC>acG	p.T297T		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	297	Interaction with LMNA. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T297T(1)		NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GCAGTGGGACCATTCTGACCA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	22											52.0	39.0	44.0					22																	42269825		2203	4300	6503	40599771	SO:0001819	synonymous_variant	6721			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.891C>G	22.37:g.42269825C>G		Somatic		Capture	SOLID	Phase_IV	40599771	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	ENST00000361204.4	37	CCDS14023.1	SNP	21	Baylor																																																																																				0.522	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599		Silent
TDRD7	23424	hgsc.bcm.edu	37	9	100190856	100190856	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1023-01	TCGA-23-1023-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr9:100190856G>C	ENST00000355295.4	+	2	404	c.109G>C	c.(109-111)Gac>Cac	p.D37H	TDRD7_ENST00000422139.2_Intron	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	37	HTH OST-type 1. {ECO:0000255|PROSITE- ProRule:PRU00975}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)	p.D37H(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				CTTGACTGGAGACTGGATCCC	0.488																																																1	Substitution - Missense(1)	ovary(1)	9											110.0	104.0	106.0					9																	100190856		2203	4300	6503	99230677	SO:0001583	missense	23424			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.109G>C	9.37:g.100190856G>C	ENSP00000347444:p.Asp37His	Somatic		Capture	SOLID	Phase_IV	99230677	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	ENST00000355295.4	37	CCDS6725.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313728	0.81358	.	.	ENSG00000196116	ENST00000355295	T	0.41400	1.0	4.75	4.75	0.60458	.	0.047132	0.85682	D	0.000000	T	0.48132	0.1483	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.64410	0.925	T	0.53049	-0.8493	10	0.66056	D	0.02	-24.7046	16.0463	0.80724	0.0:0.0:1.0:0.0	.	37	Q8NHU6	TDRD7_HUMAN	H	37	ENSP00000347444:D37H	ENSP00000347444:D37H	D	+	1	0	TDRD7	99230677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.659000	0.83766	2.563000	0.86464	0.591000	0.81541	GAC		0.488	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290		Missense_Mutation
TMEM132D	121256	hgsc.bcm.edu	37	12	129558988	129558988	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1023-01	TCGA-23-1023-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr12:129558988T>A	ENST00000422113.2	-	9	3058	c.2732A>T	c.(2731-2733)aAa>aTa	p.K911I	TMEM132D_ENST00000389441.4_Missense_Mutation_p.K449I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	911					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.K911I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GCTCAGCCCTTTGGATGCCTG	0.493																																																1	Substitution - Missense(1)	ovary(1)	12											132.0	115.0	121.0					12																	129558988		2203	4300	6503	128124941	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2732A>T	12.37:g.129558988T>A	ENSP00000408581:p.Lys911Ile	Somatic		Capture	SOLID	Phase_IV	128124941	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	13.66	2.304271	0.40795	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.15017	2.46;2.46	4.21	-0.0458	0.13850	.	0.161832	0.41500	D	0.000874	T	0.22003	0.0530	L	0.53249	1.67	0.30599	N	0.76071	D;P	0.53885	0.963;0.896	P;P	0.53809	0.735;0.555	T	0.10177	-1.0641	9	.	.	.	-9.7941	7.4063	0.26993	0.0:0.662:0.0:0.338	.	911;449	Q14C87;Q14C87-2	T132D_HUMAN;.	I	449;911	ENSP00000374092:K449I;ENSP00000408581:K911I	.	K	-	2	0	TMEM132D	128124941	0.992000	0.36948	0.119000	0.21687	0.272000	0.26649	3.100000	0.50275	0.134000	0.18681	0.383000	0.25322	AAA		0.493	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		Missense_Mutation
TNR	7143	hgsc.bcm.edu	37	1	175372583	175372583	+	Silent	SNP	G	G	A			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr1:175372583G>A	ENST00000367674.2	-	4	1377	c.669C>T	c.(667-669)agC>agT	p.S223S	TNR_ENST00000263525.2_Silent_p.S223S			Q92752	TENR_HUMAN	tenascin R	223	Cys-rich.|EGF-like 2.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.S223S(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CGCTGTACTCGCTGTCACAGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	1											108.0	107.0	107.0					1																	175372583		2203	4300	6503	173639206	SO:0001819	synonymous_variant	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.669C>T	1.37:g.175372583G>A		Somatic		Capture	SOLID	Phase_IV	173639206	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1	SNP	38	Baylor																																																																																				0.627	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		Silent
TTC33	23548	hgsc.bcm.edu	37	5	40716408	40716408	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr5:40716408C>A	ENST00000337702.4	-	5	780	c.628G>T	c.(628-630)Gag>Tag	p.E210*	TTC33_ENST00000503936.2_5'UTR	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	210								p.E210*(1)		NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GCAACAATCTCATCACTTTCA	0.408																																																1	Substitution - Nonsense(1)	ovary(1)	5											120.0	106.0	111.0					5																	40716408		2203	4300	6503	40752165	SO:0001587	stop_gained	23548			BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.628G>T	5.37:g.40716408C>A	ENSP00000338533:p.Glu210*	Somatic		Capture	SOLID	Phase_IV	40752165	B2R6G0|O95105	Nonsense_Mutation	SNP	ENST00000337702.4	37	CCDS3931.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879925	0.91740	.	.	ENSG00000113638	ENST00000337702	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-23.8489	19.4191	0.94713	0.0:1.0:0.0:0.0	.	.	.	.	X	210	.	ENSP00000338533:E210X	E	-	1	0	TTC33	40752165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.294000	0.72738	2.594000	0.87642	0.650000	0.86243	GAG		0.408	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253831.1	NM_012382		Nonsense_Mutation
VPS13A	23230	hgsc.bcm.edu	37	9	79929533	79929533	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1023-01	TCGA-23-1023-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr9:79929533C>G	ENST00000360280.3	+	37	4625	c.4365C>G	c.(4363-4365)aaC>aaG	p.N1455K	VPS13A_ENST00000376634.4_Missense_Mutation_p.N1455K|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000357409.5_Missense_Mutation_p.N1455K|VPS13A_ENST00000376636.3_Missense_Mutation_p.N1416K	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1455					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.N1455K(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CATTAAAAAACTGTATTTTAG	0.294																																																1	Substitution - Missense(1)	ovary(1)	9											55.0	58.0	57.0					9																	79929533		2200	4294	6494	79119353	SO:0001583	missense	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.4365C>G	9.37:g.79929533C>G	ENSP00000353422:p.Asn1455Lys	Somatic		Capture	SOLID	Phase_IV	79119353	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630887	0.46944	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.46063	1.06;0.88;0.96;1.06	5.59	0.64	0.17752	.	0.375086	0.25747	N	0.028561	T	0.32496	0.0831	L	0.50333	1.59	0.80722	D	1	P;P;P;P	0.47762	0.696;0.704;0.9;0.9	B;B;B;B	0.42522	0.358;0.231;0.39;0.39	T	0.04737	-1.0930	10	0.42905	T	0.14	.	5.748	0.18130	0.1212:0.5295:0.0:0.3493	.	1416;1455;1455;1455	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	K	1455;1416;1455;1455	ENSP00000365821:N1455K;ENSP00000365823:N1416K;ENSP00000353422:N1455K;ENSP00000349985:N1455K	ENSP00000349985:N1455K	N	+	3	2	VPS13A	79119353	0.169000	0.23002	0.997000	0.53966	0.991000	0.79684	-0.521000	0.06245	0.057000	0.16193	0.557000	0.71058	AAC		0.294	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186		Missense_Mutation
XRN1	54464	hgsc.bcm.edu	37	3	142140334	142140334	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1023-01	TCGA-23-1023-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr3:142140334A>T	ENST00000264951.4	-	9	1136	c.1019T>A	c.(1018-1020)cTt>cAt	p.L340H	XRN1_ENST00000463916.1_Missense_Mutation_p.L340H|XRN1_ENST00000392981.2_Missense_Mutation_p.L340H|XRN1_ENST00000544157.1_Missense_Mutation_p.L130H|RNU1-100P_ENST00000365255.1_RNA	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	340					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.L340H(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TAGTTTCACAAGGTATTTCTC	0.328																																																1	Substitution - Missense(1)	ovary(1)	3											60.0	59.0	59.0					3																	142140334		2202	4299	6501	143623024	SO:0001583	missense	54464			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1019T>A	3.37:g.142140334A>T	ENSP00000264951:p.Leu340His	Somatic		Capture	SOLID	Phase_IV	143623024	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	SNP	3	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.0	4.231265	0.79688	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157	T;T	0.50277	0.75;0.76	5.27	5.27	0.74061	.	0.174438	0.51477	D	0.000089	T	0.76219	0.3957	M	0.93150	3.385	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.999	D;D;D;D;D	0.76071	0.986;0.952;0.95;0.987;0.971	D	0.83361	0.0002	10	0.87932	D	0	-17.5749	15.1465	0.72657	1.0:0.0:0.0:0.0	.	130;340;201;340;340	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	H	340;340;340;130	ENSP00000264951:L340H;ENSP00000376707:L340H	ENSP00000264951:L340H	L	-	2	0	XRN1	143623024	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.730000	0.91510	2.118000	0.64928	0.377000	0.23210	CTT		0.328	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		Missense_Mutation
ZFP69	339559	hgsc.bcm.edu	37	1	40945126	40945126	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1023-01	TCGA-23-1023-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1023-01	TCGA-23-1023-10	g.chr1:40945126delG	ENST00000372706.1	+	2	1099	c.93delG	c.(91-93)ctgfs	p.L31fs	ZFP69_ENST00000372705.3_Frame_Shift_Del_p.L31fs			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	31	SCAN box.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W32fs*4(1)									GGGCGCCCCTGTGGGAGGATG	0.547																																																1	Deletion - Frameshift(1)	ovary(1)	1											42.0	45.0	44.0					1																	40945126		2203	4300	6503	40717713	SO:0001589	frameshift_variant	339559			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.93delG	1.37:g.40945126delG	ENSP00000361791:p.Leu31fs	Somatic		Capture	SOLID	Phase_IV	40717713	Q5SWM5|Q6ZWK8	Frame_Shift_Del	DEL	ENST00000372706.1	37	CCDS30686.1	DEL	48	Baylor																																																																																				0.547	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1	NM_198494		Frame_Shift_Del
