#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ACTN2	88	hgsc.bcm.edu	37	1	236918421	236918421	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr1:236918421G>A	ENST00000366578.4	+	17	2243	c.2077G>A	c.(2077-2079)Gac>Aac	p.D693N	ACTN2_ENST00000546208.1_Missense_Mutation_p.D187N|ACTN2_ENST00000542672.1_Missense_Mutation_p.D693N	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	693					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.D693N(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAACAACATCGACAAGCTGGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	1											201.0	192.0	195.0					1																	236918421		2203	4300	6503	234985044	SO:0001583	missense	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2077G>A	1.37:g.236918421G>A	ENSP00000355537:p.Asp693Asn	Somatic		Capture	SOLID	Phase_IV	234985044	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574577	0.65878	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.51574	0.7;0.7;0.7	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.62429	0.2427	L	0.47716	1.5	0.80722	D	1	D;B;D;D	0.76494	0.999;0.028;0.999;0.995	D;B;D;D	0.87578	0.998;0.057;0.998;0.987	T	0.61168	-0.7117	10	0.36615	T	0.2	.	17.4718	0.87648	0.0:0.0:1.0:0.0	.	478;693;463;693	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	N	693;693;187;462	ENSP00000443495:D693N;ENSP00000355537:D693N;ENSP00000438384:D187N	ENSP00000355537:D693N	D	+	1	0	ACTN2	234985044	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	9.835000	0.99442	2.100000	0.63781	0.557000	0.71058	GAC		0.527	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		Missense_Mutation
ANKRD12	23253	hgsc.bcm.edu	37	18	9255224	9255224	+	Silent	SNP	T	T	C			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr18:9255224T>C	ENST00000262126.4	+	9	2199	c.1959T>C	c.(1957-1959)caT>caC	p.H653H	ANKRD12_ENST00000400020.3_Silent_p.H630H|ANKRD12_ENST00000383440.2_Silent_p.H630H	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	653						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.H653H(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						taaaaaaacataaattgaagc	0.294																																																1	Substitution - coding silent(1)	ovary(1)	18											34.0	38.0	37.0					18																	9255224		2192	4282	6474	9245224	SO:0001819	synonymous_variant	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1959T>C	18.37:g.9255224T>C		Somatic		Capture	SOLID	Phase_IV	9245224	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1	SNP	49	Baylor																																																																																				0.294	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208		Silent
C14orf28	122525	hgsc.bcm.edu	37	14	45373649	45373649	+	Silent	SNP	C	C	A			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr14:45373649C>A	ENST00000325192.3	+	4	941	c.666C>A	c.(664-666)ccC>ccA	p.P222P	C14orf28_ENST00000553841.1_3'UTR|C14orf28_ENST00000557112.1_Silent_p.P192P|RP11-857B24.5_ENST00000555157.1_RNA	NM_001017923.1	NP_001017923.1	Q4W4Y0	CN028_HUMAN	chromosome 14 open reading frame 28	222								p.P222P(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(2)	11						ATGGGGCACCCCCTTTTGTTG	0.398																																																1	Substitution - coding silent(1)	ovary(1)	14											183.0	178.0	180.0					14																	45373649		2203	4300	6503	44443399	SO:0001819	synonymous_variant	122525			AA496212	CCDS32069.1	14q21.2	2012-08-16			ENSG00000179476	ENSG00000179476			19834	protein-coding gene	gene with protein product	"""dopamine receptor interacting protein 1"""						Standard	XM_005267316		Approved	DRIP-1	uc001wvo.3	Q4W4Y0	OTTHUMG00000170722	ENST00000325192.3:c.666C>A	14.37:g.45373649C>A		Somatic		Capture	SOLID	Phase_IV	44443399		Silent	SNP	ENST00000325192.3	37	CCDS32069.1	SNP	22	Baylor																																																																																				0.398	C14orf28-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410086.1	NM_001017923		Silent
C1QTNF7	114905	hgsc.bcm.edu	37	4	15437508	15437508	+	Silent	SNP	A	A	G			TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr4:15437508A>G	ENST00000444304.2	+	2	467	c.141A>G	c.(139-141)ggA>ggG	p.G47G	C1QTNF7_ENST00000295297.4_Silent_p.G54G|C1QTNF7_ENST00000429690.1_Silent_p.G47G			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	47	Collagen-like.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						GGCCCCCTGGAGCAAATGGTT	0.572																																																0			4											50.0	52.0	51.0					4																	15437508		2203	4300	6503	15046606	SO:0001819	synonymous_variant	114905			AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.141A>G	4.37:g.15437508A>G		Somatic		Capture	SOLID	Phase_IV	15046606	B2RBT3|J3KPW3	Silent	SNP	ENST00000444304.2	37	CCDS3414.1	SNP	11	Baylor																																																																																				0.572	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000250891.2			Silent
CASP1	834	hgsc.bcm.edu	37	11	104899872	104899872	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr11:104899872C>T	ENST00000533400.1	-	7	1020	c.985G>A	c.(985-987)Gct>Act	p.A329T	CASP1_ENST00000598974.1_Missense_Mutation_p.A329T|CASP1_ENST00000593315.1_Missense_Mutation_p.A308T|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.A329T|CASP1_ENST00000528974.1_Missense_Mutation_p.A290T|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000393136.4_Missense_Mutation_p.A308T|CASP1_ENST00000527979.1_Missense_Mutation_p.A292T|CASP1_ENST00000526568.1_Missense_Mutation_p.A236T|CASP1_ENST00000525825.1_Missense_Mutation_p.A308T	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	329					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)	p.A329T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	GAGCAGAAAGCGATAAAATCC	0.398																																					NSCLC(41;1246 1743 4934)											1	Substitution - Missense(1)	ovary(1)	11											122.0	114.0	117.0					11																	104899872		2202	4299	6501	104405082	SO:0001583	missense	834			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.985G>A	11.37:g.104899872C>T	ENSP00000433138:p.Ala329Thr	Somatic		Capture	SOLID	Phase_IV	104405082	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	CCDS8330.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	.	17.51	3.407002	0.62399	.	.	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000393136;ENST00000525825;ENST00000528974	T;T;T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05;2.05;2.05	4.34	3.39	0.38822	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.262127	0.37761	N	0.001944	T	0.42359	0.1199	M	0.81614	2.55	0.21579	N	0.999632	D;D;D;D;D;D	0.89917	0.975;1.0;0.986;0.989;0.986;0.992	P;D;P;P;P;P	0.80764	0.586;0.994;0.45;0.743;0.45;0.605	T	0.24048	-1.0171	10	0.23891	T	0.37	.	9.4761	0.38873	0.3849:0.6151:0.0:0.0	.	290;329;308;329;292;236	B4DVD8;A8K249;P29466-2;P29466;G3V169;P29466-3	.;.;.;CASP1_HUMAN;.;.	T	178;236;292;329;329;308;308;290	ENSP00000435536:A178T;ENSP00000434250:A236T;ENSP00000432340:A292T;ENSP00000433138:A329T;ENSP00000410076:A329T;ENSP00000376844:A308T;ENSP00000434779:A308T;ENSP00000434259:A290T	ENSP00000376844:A308T	A	-	1	0	CASP1	104405082	0.978000	0.34361	0.991000	0.47740	0.701000	0.40568	0.589000	0.23939	1.122000	0.41944	0.557000	0.71058	GCT		0.398	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292		Missense_Mutation
CCT6B	10693	hgsc.bcm.edu	37	17	33279009	33279009	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:33279009C>G	ENST00000314144.5	-	5	689	c.574G>C	c.(574-576)Gaa>Caa	p.E192Q	CCT6B_ENST00000421975.3_Missense_Mutation_p.E192Q|CCT6B_ENST00000436961.3_Missense_Mutation_p.E147Q	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	192					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)	p.E192Q(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				TCCATTATTTCTACCATGAAG	0.318																																																1	Substitution - Missense(1)	ovary(1)	17											103.0	97.0	99.0					17																	33279009		2203	4300	6503	30303122	SO:0001583	missense	10693			D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.574G>C	17.37:g.33279009C>G	ENSP00000327191:p.Glu192Gln	Somatic		Capture	SOLID	Phase_IV	30303122	B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	ENST00000314144.5	37	CCDS32617.1	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331568	0.60853	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.79247	-0.24;-1.25;-1.25	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.87688	0.6240	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	0.989;0.999;1.0	D;D;D	0.91635	0.978;0.994;0.999	D	0.88639	0.3174	10	0.62326	D	0.03	-21.0335	15.6109	0.76716	0.0:1.0:0.0:0.0	.	147;192;192	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	Q	192;192;147	ENSP00000398044:E192Q;ENSP00000327191:E192Q;ENSP00000400917:E147Q	ENSP00000327191:E192Q	E	-	1	0	CCT6B	30303122	1.000000	0.71417	0.923000	0.36655	0.236000	0.25371	6.653000	0.74382	2.627000	0.88993	0.655000	0.94253	GAA		0.318	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448014.1	NM_006584		Missense_Mutation
COL7A1	1294	hgsc.bcm.edu	37	3	48605952	48605952	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr3:48605952C>T	ENST00000328333.8	-	104	7881	c.7774G>A	c.(7774-7776)Gca>Aca	p.A2592T	COL7A1_ENST00000454817.1_Missense_Mutation_p.A2560T	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2592	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A2592T(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGGATCCCTGCTGCACCAGGT	0.647																																																1	Substitution - Missense(1)	ovary(1)	3											27.0	28.0	27.0					3																	48605952		2203	4300	6503	48580956	SO:0001583	missense	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7774G>A	3.37:g.48605952C>T	ENSP00000332371:p.Ala2592Thr	Somatic		Capture	SOLID	Phase_IV	48580956	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.89	1.772930	0.31411	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93366	-3.21;-3.21	4.56	1.41	0.22369	.	0.760238	0.11190	N	0.590034	D	0.84611	0.5510	L	0.28608	0.87	0.24560	N	0.993973	B	0.14805	0.011	B	0.12837	0.008	T	0.68515	-0.5388	10	0.12766	T	0.61	.	2.4171	0.04438	0.2931:0.4598:0.1448:0.1023	.	2592	Q02388	CO7A1_HUMAN	T	2592;2560	ENSP00000332371:A2592T;ENSP00000412569:A2560T	ENSP00000332371:A2592T	A	-	1	0	COL7A1	48580956	0.000000	0.05858	0.995000	0.50966	0.822000	0.46500	-0.697000	0.05098	0.585000	0.29608	0.462000	0.41574	GCA		0.647	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		Missense_Mutation
CXorf21	80231	hgsc.bcm.edu	37	X	30578015	30578015	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chrX:30578015C>T	ENST00000378962.3	-	3	780	c.458G>A	c.(457-459)gGc>gAc	p.G153D		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	153								p.G153D(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						CAGCAAAGGGCCATATTCAAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											54.0	53.0	53.0					X																	30578015		2202	4300	6502	30487936	SO:0001583	missense	80231			BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.458G>A	X.37:g.30578015C>T	ENSP00000368245:p.Gly153Asp	Somatic		Capture	SOLID	Phase_IV	30487936		Missense_Mutation	SNP	ENST00000378962.3	37	CCDS14224.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510619	0.64522	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	T	0.72977	0.3528	L	0.61387	1.9	0.48185	D	0.999606	D	0.61080	0.989	P	0.55749	0.783	T	0.76149	-0.3065	9	0.66056	D	0.02	-25.7028	17.958	0.89075	0.0:1.0:0.0:0.0	.	153	Q9HAI6	CX021_HUMAN	D	153	.	ENSP00000368245:G153D	G	-	2	0	CXorf21	30487936	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	5.459000	0.66685	2.431000	0.82371	0.513000	0.50165	GGC		0.443	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159		Missense_Mutation
CPXCR1	53336	hgsc.bcm.edu	37	X	88008468	88008468	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chrX:88008468A>T	ENST00000276127.4	+	3	312	c.53A>T	c.(52-54)aAt>aTt	p.N18I	CPXCR1_ENST00000373111.1_Missense_Mutation_p.N18I	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	18							metal ion binding (GO:0046872)	p.N18I(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						GCTCACAAAAATTCTGAAAAT	0.373																																																1	Substitution - Missense(1)	ovary(1)	X											31.0	27.0	29.0					X																	88008468		2203	4297	6500	87895124	SO:0001583	missense	53336			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.53A>T	X.37:g.88008468A>T	ENSP00000276127:p.Asn18Ile	Somatic		Capture	SOLID	Phase_IV	87895124	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307411	0.23821	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.35048	1.33;1.33	3.28	2.08	0.27032	.	0.182677	0.26578	N	0.023592	T	0.24431	0.0592	L	0.29908	0.895	0.09310	N	1	P	0.44816	0.844	B	0.43809	0.432	T	0.06588	-1.0818	9	.	.	.	.	5.0645	0.14574	0.7323:0.0:0.0:0.2677	.	18	Q8N123	CPXCR_HUMAN	I	18	ENSP00000276127:N18I;ENSP00000362203:N18I	.	N	+	2	0	CPXCR1	87895124	0.051000	0.20477	0.070000	0.20053	0.280000	0.26924	0.280000	0.18790	0.472000	0.27344	0.481000	0.45027	AAT		0.373	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048		Missense_Mutation
CYP8B1	1582	hgsc.bcm.edu	37	3	42916315	42916315	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr3:42916315C>T	ENST00000316161.4	-	1	1318	c.994G>A	c.(994-996)Ggt>Agt	p.G332S	KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.G332S|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	332					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)	p.G332S(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		TGCAGGGCACCGAGTTTGAAG	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											39.0	38.0	38.0					3																	42916315		2203	4300	6503	42891319	SO:0001583	missense	1582			AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.994G>A	3.37:g.42916315C>T	ENSP00000318867:p.Gly332Ser	Somatic		Capture	SOLID	Phase_IV	42891319	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	CCDS2707.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.688369	0.00738	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01203	5.18;5.18	5.27	-1.48	0.08745	.	0.473932	0.22942	N	0.053764	T	0.00440	0.0014	N	0.00661	-1.28	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.08055	0.003;0.002	T	0.46105	-0.9215	10	0.14252	T	0.57	-0.5105	10.7228	0.46050	0.0:0.4678:0.0:0.5322	.	332;332	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	S	332	ENSP00000404499:G332S;ENSP00000318867:G332S	ENSP00000318867:G332S	G	-	1	0	CYP8B1	42891319	0.006000	0.16342	0.000000	0.03702	0.008000	0.06430	0.480000	0.22244	-0.532000	0.06332	-1.434000	0.01081	GGT		0.597	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391		Missense_Mutation
DAG1	1605	hgsc.bcm.edu	37	3	49568626	49568626	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr3:49568626G>T	ENST00000539901.1	+	3	1240	c.682G>T	c.(682-684)Gtg>Ttg	p.V228L	DAG1_ENST00000515359.2_Missense_Mutation_p.V228L|DAG1_ENST00000541308.1_Missense_Mutation_p.V228L|DAG1_ENST00000538711.1_Missense_Mutation_p.V228L|DAG1_ENST00000545947.1_Missense_Mutation_p.V228L|DAG1_ENST00000308775.2_Missense_Mutation_p.V228L	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	228	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)	p.V228L(1)		NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CATGAAATTAGTGCCGGTGGT	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											78.0	83.0	81.0					3																	49568626		2203	4300	6503	49543630	SO:0001583	missense	1605			L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.682G>T	3.37:g.49568626G>T	ENSP00000439334:p.Val228Leu	Somatic		Capture	SOLID	Phase_IV	49543630	A8K6M7|Q969J9	Missense_Mutation	SNP	ENST00000539901.1	37	CCDS2799.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	8.279	0.815023	0.16607	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711;ENST00000415315	T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01	5.92	5.05	0.67936	.	0.058901	0.64402	D	0.000003	T	0.56731	0.2005	N	0.05124	-0.11	0.40964	D	0.984642	B	0.29188	0.236	B	0.23852	0.049	T	0.56360	-0.7992	10	0.18710	T	0.47	-17.7946	14.3493	0.66688	0.0719:0.0:0.9281:0.0	.	228	Q14118	DAG1_HUMAN	L	228;228;228;228;228;228;27	ENSP00000440705:V228L;ENSP00000312435:V228L;ENSP00000442600:V228L;ENSP00000440590:V228L;ENSP00000439334:V228L;ENSP00000438421:V228L	ENSP00000312435:V228L	V	+	1	0	DAG1	49543630	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	2.891000	0.48617	1.525000	0.49052	-0.123000	0.14984	GTG		0.507	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1			Missense_Mutation
DIP2B	57609	hgsc.bcm.edu	37	12	51074522	51074522	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr12:51074522A>T	ENST00000301180.5	+	9	1216	c.1182A>T	c.(1180-1182)gaA>gaT	p.E394D		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	394						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.E394D(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCAAAAATGAACCTGTGTTAA	0.353																																																1	Substitution - Missense(1)	ovary(1)	12											215.0	247.0	236.0					12																	51074522		2203	4300	6503	49360789	SO:0001583	missense	57609			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.1182A>T	12.37:g.51074522A>T	ENSP00000301180:p.Glu394Asp	Somatic		Capture	SOLID	Phase_IV	49360789	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.79	2.937857	0.52972	.	.	ENSG00000066084	ENST00000301180	T	0.48201	0.82	4.87	-1.27	0.09347	AMP-dependent synthetase/ligase (1);	0.105068	0.64402	D	0.000002	T	0.62344	0.2420	M	0.79805	2.47	0.46028	D	0.998823	P	0.51147	0.942	P	0.62298	0.9	T	0.64407	-0.6415	10	0.49607	T	0.09	-8.0763	11.5431	0.50677	0.5218:0.0:0.4782:0.0	.	394	Q9P265	DIP2B_HUMAN	D	394	ENSP00000301180:E394D	ENSP00000301180:E394D	E	+	3	2	DIP2B	49360789	0.640000	0.27243	0.996000	0.52242	0.998000	0.95712	-0.040000	0.12104	-0.086000	0.12550	0.529000	0.55759	GAA		0.353	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602		Missense_Mutation
DNAH2	146754	hgsc.bcm.edu	37	17	7636505	7636505	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:7636505A>T	ENST00000572933.1	+	5	1960	c.500A>T	c.(499-501)tAt>tTt	p.Y167F	DNAH2_ENST00000570791.1_Missense_Mutation_p.Y167F|DNAH2_ENST00000389173.2_Missense_Mutation_p.Y167F|DNAH2_ENST00000082259.3_Missense_Mutation_p.Y167F			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	167	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Y167F(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CGGGGCCCCTATATCCCGGCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	17											92.0	90.0	91.0					17																	7636505		2203	4300	6503	7577230	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.500A>T	17.37:g.7636505A>T	ENSP00000458355:p.Tyr167Phe	Somatic		Capture	SOLID	Phase_IV	7577230	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039357	0.55003	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.42131	0.98;0.98	5.42	5.42	0.78866	.	1.787720	0.02770	N	0.119601	T	0.46619	0.1402	L	0.27053	0.805	0.28732	N	0.902446	B;D	0.53745	0.201;0.962	B;P	0.54706	0.073;0.759	T	0.31586	-0.9938	10	0.13853	T	0.58	.	10.5872	0.45290	0.8385:0.1615:0.0:0.0	.	167;167	Q9P225;Q9P225-3	DYH2_HUMAN;.	F	167	ENSP00000373825:Y167F;ENSP00000082259:Y167F	ENSP00000082259:Y167F	Y	+	2	0	DNAH2	7577230	1.000000	0.71417	0.999000	0.59377	0.696000	0.40369	4.231000	0.58639	2.071000	0.62044	0.459000	0.35465	TAT		0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		Missense_Mutation
ESPL1	9700	hgsc.bcm.edu	37	12	53663779	53663779	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr12:53663779C>T	ENST00000257934.4	+	3	1144	c.1053C>T	c.(1051-1053)acC>acT	p.T351T	ESPL1_ENST00000552462.1_Silent_p.T351T	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	351					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						AACGAGGCACCAAGAGGCGCT	0.532																																					Colon(53;1069 1201 2587 5382)											0			12											90.0	94.0	93.0					12																	53663779		2203	4300	6503	51950046	SO:0001819	synonymous_variant	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1053C>T	12.37:g.53663779C>T		Somatic		Capture	SOLID	Phase_IV	51950046		Silent	SNP	ENST00000257934.4	37	CCDS8852.1	SNP	21	Baylor																																																																																				0.532	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		Silent
GAREM	64762	hgsc.bcm.edu	37	18	29866996	29866996	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr18:29866996C>G	ENST00000269209.6	-	4	1567	c.1564G>C	c.(1564-1566)Gcc>Ccc	p.A522P	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000399218.4_Missense_Mutation_p.A522P|GAREM_ENST00000578619.1_5'Flank			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	522	Necessary for interaction with GRB2.|Pro-rich.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)	p.A522P(1)									TGACTTACGGCTTCAGATTTG	0.478																																																1	Substitution - Missense(1)	ovary(1)	18											71.0	76.0	74.0					18																	29866996		2203	4300	6503	28120994	SO:0001583	missense	64762			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1564G>C	18.37:g.29866996C>G	ENSP00000269209:p.Ala522Pro	Somatic		Capture	SOLID	Phase_IV	28120994	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453422	0.84209	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.22945	1.93;1.94	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	L	0.42245	1.32	0.80722	D	1	D;D	0.69078	0.993;0.997	P;D	0.71414	0.844;0.973	T	0.21586	-1.0241	10	0.56958	D	0.05	-26.6956	19.3995	0.94621	0.0:1.0:0.0:0.0	.	522;522	Q9H706;Q9H706-3	FA59A_HUMAN;.	P	522	ENSP00000382165:A522P;ENSP00000269209:A522P	ENSP00000269209:A522P	A	-	1	0	FAM59A	28120994	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.231000	0.78106	2.890000	0.99128	0.655000	0.94253	GCC		0.478	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751		Missense_Mutation
HIST1H1T	3010	hgsc.bcm.edu	37	6	26108018	26108018	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr6:26108018C>G	ENST00000338379.4	-	1	346	c.304G>C	c.(304-306)Ggt>Cgt	p.G102R		NM_005323.3	NP_005314.2	P22492	H1T_HUMAN	histone cluster 1, H1t	102	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				binding of sperm to zona pellucida (GO:0007339)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|nucleosome assembly (GO:0006334)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G102R(1)		breast(2)|endometrium(1)|lung(3)|ovary(2)|prostate(1)	9						GCACCAGTACCCCTGGTTTGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											101.0	101.0	101.0					6																	26108018		2203	4300	6503	26215997	SO:0001583	missense	3010			M60094	CCDS34349.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000187475	ENSG00000187475		"""Histones / Replication-dependent"""	4720	protein-coding gene	gene with protein product		142712	"""H1 histone family, member T (testis-specific)"", ""histone 1, H1t"""	H1FT		8175896, 12408966	Standard	NM_005323		Approved	H1t	uc003ngj.3	P22492	OTTHUMG00000014430	ENST00000338379.4:c.304G>C	6.37:g.26108018C>G	ENSP00000341214:p.Gly102Arg	Somatic		Capture	SOLID	Phase_IV	26215997	Q6ISI1|Q8IUE8	Missense_Mutation	SNP	ENST00000338379.4	37	CCDS34349.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	.	16.05	3.013580	0.54468	.	.	ENSG00000187475	ENST00000338379	T	0.36157	1.27	5.53	4.64	0.57946	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.70911	0.3278	H	0.98818	4.34	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.84701	0.0728	10	0.87932	D	0	-20.8268	15.39	0.74735	0.0:0.8605:0.1395:0.0	.	102	P22492	H1T_HUMAN	R	102	ENSP00000341214:G102R	ENSP00000341214:G102R	G	-	1	0	HIST1H1T	26215997	1.000000	0.71417	0.084000	0.20598	0.071000	0.16799	4.786000	0.62425	1.514000	0.48869	0.655000	0.94253	GGT		0.483	HIST1H1T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040093.2	NM_005323		Missense_Mutation
FRMD1	79981	hgsc.bcm.edu	37	6	168464403	168464403	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr6:168464403G>A	ENST00000283309.6	-	6	746	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W	FRMD1_ENST00000440994.2_Missense_Mutation_p.R160W|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.R228W(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCATGTGCCGGAGGATGTAG	0.657																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)											1	Substitution - Missense(1)	ovary(1)	6											103.0	86.0	92.0					6																	168464403		2203	4300	6503	168207252	SO:0001583	missense	79981				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.682C>T	6.37:g.168464403G>A	ENSP00000283309:p.Arg228Trp	Somatic		Capture	SOLID	Phase_IV	168207252	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	CCDS5306.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.08	1.532869	0.27387	.	.	ENSG00000153303	ENST00000283309;ENST00000440994	T;T	0.78707	-1.2;-1.2	2.83	0.191	0.15130	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.506221	0.18349	U	0.143925	T	0.77425	0.4128	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;P	0.65140	0.932;0.932;0.888	T	0.77104	-0.2711	10	0.87932	D	0	.	9.1883	0.37184	0.0:0.0:0.3699:0.6301	.	140;228;160	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	W	228;160	ENSP00000283309:R228W;ENSP00000414115:R160W	ENSP00000283309:R228W	R	-	1	2	FRMD1	168207252	0.549000	0.26481	0.003000	0.11579	0.137000	0.21094	-0.029000	0.12329	-0.172000	0.10779	0.305000	0.20034	CGG		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919		Missense_Mutation
KIAA2018	205717	hgsc.bcm.edu	37	3	113377482	113377482	+	Frame_Shift_Del	DEL	T	T	-	rs78597857		TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr3:113377482delT	ENST00000478658.1	-	5	3064	c.3047delA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N1016fs			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTCTGAGGGTTTTTTTTTTT	0.363																																																3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)	3											99.0	91.0	93.0					3																	113377482		1809	4067	5876	114860172	SO:0001589	frameshift_variant	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3047delA	3.37:g.113377482delT	ENSP00000420721:p.Asn1016fs	Somatic		Capture	SOLID	Phase_IV	114860172	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	ENST00000478658.1	37	CCDS43133.1	DEL	60	Baylor																																																																																				0.363	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899		Frame_Shift_Del
MAN2B1	4125	hgsc.bcm.edu	37	19	12774554	12774554	+	Silent	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr19:12774554G>A	ENST00000456935.2	-	5	766	c.726C>T	c.(724-726)agC>agT	p.S242S	MAN2B1_ENST00000221363.4_Silent_p.S242S	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	242					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAGGCTGGTGCTGGCCCGCC	0.622																																																0			19											30.0	29.0	29.0					19																	12774554		2203	4300	6503	12635554	SO:0001819	synonymous_variant	4125				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.726C>T	19.37:g.12774554G>A		Somatic		Capture	SOLID	Phase_IV	12635554	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	CCDS32919.1	SNP	46	Baylor																																																																																				0.622	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1			Silent
MASTL	84930	hgsc.bcm.edu	37	10	27459587	27459587	+	Missense_Mutation	SNP	A	A	G	rs371475858		TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr10:27459587A>G	ENST00000375940.4	+	8	1756	c.1699A>G	c.(1699-1701)Atg>Gtg	p.M567V	MASTL_ENST00000477034.1_3'UTR|MASTL_ENST00000342386.6_Missense_Mutation_p.M567V|MASTL_ENST00000375946.4_Missense_Mutation_p.M567V			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	567	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)	p.M567V(1)		breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAATATTTCTATGAACTCTGA	0.338																																																1	Substitution - Missense(1)	ovary(1)	10						A	VAL/MET,VAL/MET,VAL/MET	0,4406		0,0,2203	39.0	41.0	41.0		1699,1699,1699	2.1	0.4	10		41	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense,missense	MASTL	NM_001172303.1,NM_001172304.1,NM_032844.3	21,21,21	0,1,6498	GG,GA,AA		0.0116,0.0,0.0077	benign,benign,benign	567/880,567/841,567/879	27459587	1,12997	2203	4296	6499	27499593	SO:0001583	missense	84930			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1699A>G	10.37:g.27459587A>G	ENSP00000365107:p.Met567Val	Somatic		Capture	SOLID	Phase_IV	27499593	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	37	CCDS53502.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.837	-0.743125	0.03088	0.0	1.16E-4	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.22539	1.95;1.95;1.95	5.58	2.07	0.26955	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.497646	0.25094	N	0.033182	T	0.10937	0.0267	N	0.20685	0.6	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.22068	-1.0227	10	0.33141	T	0.24	-3.1704	5.1482	0.14996	0.294:0.3231:0.3829:0.0	.	567;567;567	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	V	567	ENSP00000365113:M567V;ENSP00000343446:M567V;ENSP00000365107:M567V	ENSP00000343446:M567V	M	+	1	0	MASTL	27499593	0.425000	0.25498	0.364000	0.25888	0.376000	0.30014	0.637000	0.24659	0.419000	0.25927	0.482000	0.46254	ATG		0.338	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844		Missense_Mutation
MMP16	4325	hgsc.bcm.edu	37	8	89128918	89128918	+	Nonsense_Mutation	SNP	T	T	A			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr8:89128918T>A	ENST00000286614.6	-	6	1182	c.901A>T	c.(901-903)Aga>Tga	p.R301*	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	301					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R301*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GGTAGAGGTCTTGTAGGTGGA	0.512																																																1	Substitution - Nonsense(1)	ovary(1)	8											198.0	205.0	202.0					8																	89128918		2203	4300	6503	89198034	SO:0001587	stop_gained	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.901A>T	8.37:g.89128918T>A	ENSP00000286614:p.Arg301*	Somatic		Capture	SOLID	Phase_IV	89198034	B2RAN7|Q14824|Q52H48	Nonsense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	39	7.558196	0.98358	.	.	ENSG00000156103	ENST00000286614	.	.	.	5.79	3.32	0.38043	.	0.154467	0.52532	D	0.000077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6824	0.56928	0.0:0.0:0.2603:0.7397	.	.	.	.	X	301	.	ENSP00000286614:R301X	R	-	1	2	MMP16	89198034	1.000000	0.71417	0.974000	0.42286	0.998000	0.95712	2.488000	0.45276	0.412000	0.25729	0.455000	0.32223	AGA		0.512	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		Nonsense_Mutation
MOSPD3	64598	hgsc.bcm.edu	37	7	100211201	100211201	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr7:100211201G>A	ENST00000393950.2	+	3	665	c.383G>A	c.(382-384)cGc>cAc	p.R128H	MOSPD3_ENST00000223054.4_Missense_Mutation_p.R128H|MOSPD3_ENST00000424091.2_Missense_Mutation_p.R118H|MOSPD3_ENST00000379527.2_Missense_Mutation_p.R128H	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	128	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.				heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)	p.R128H(1)		breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GTGGTGGGACGCAAGGACATT	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											77.0	70.0	73.0					7																	100211201		2203	4300	6503	100049137	SO:0001583	missense	64598			BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.383G>A	7.37:g.100211201G>A	ENSP00000377522:p.Arg128His	Somatic		Capture	SOLID	Phase_IV	100049137	A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Missense_Mutation	SNP	ENST00000393950.2	37	CCDS5701.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971836	0.74246	.	.	ENSG00000106330	ENST00000223054;ENST00000493970;ENST00000379527;ENST00000393950;ENST00000424091;ENST00000393953	.	.	.	4.13	3.22	0.36961	PapD-like (1);	0.000000	0.48767	D	0.000178	T	0.66771	0.2823	L	0.42245	1.32	0.39542	D	0.968832	D;D	0.89917	0.964;1.0	P;D	0.87578	0.451;0.998	T	0.70554	-0.4840	9	0.66056	D	0.02	-10.3986	12.0543	0.53524	0.0:0.1758:0.8242:0.0	.	118;128	C9JE89;O75425	.;MSPD3_HUMAN	H	128;128;128;128;118;114	.	ENSP00000223054:R128H	R	+	2	0	MOSPD3	100049137	0.993000	0.37304	1.000000	0.80357	0.988000	0.76386	4.064000	0.57506	1.292000	0.44672	0.563000	0.77884	CGC		0.617	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	NM_023948		Missense_Mutation
NES	10763	hgsc.bcm.edu	37	1	156641953	156641953	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr1:156641953T>C	ENST00000368223.3	-	4	2159	c.2027A>G	c.(2026-2028)gAg>gGg	p.E676G		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	676	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.E676G(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCTCAGTGGCTCTTGATTCTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	51.0	53.0					1																	156641953		2203	4300	6503	154908577	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2027A>G	1.37:g.156641953T>C	ENSP00000357206:p.Glu676Gly	Somatic		Capture	SOLID	Phase_IV	154908577	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433889	0.83776	.	.	ENSG00000132688	ENST00000368223	D	0.87491	-2.26	4.75	3.62	0.41486	.	0.000000	0.33057	N	0.005333	T	0.70535	0.3235	L	0.54323	1.7	0.09310	N	1	B	0.22683	0.073	B	0.17433	0.018	T	0.62728	-0.6793	10	0.39692	T	0.17	.	8.554	0.33469	0.0:0.092:0.0:0.908	.	676	P48681	NEST_HUMAN	G	676	ENSP00000357206:E676G	ENSP00000357206:E676G	E	-	2	0	NES	154908577	0.018000	0.18449	0.014000	0.15608	0.866000	0.49608	2.170000	0.42443	0.847000	0.35167	0.383000	0.25322	GAG		0.438	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		Missense_Mutation
OLFML1	283298	hgsc.bcm.edu	37	11	7509443	7509443	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr11:7509443G>T	ENST00000329293.3	+	2	609	c.215G>T	c.(214-216)gGa>gTa	p.G72V	OLFML1_ENST00000528758.1_Intron|OLFML1_ENST00000530135.1_Missense_Mutation_p.G72V|CTD-2516F10.2_ENST00000530201.1_RNA	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	72						extracellular region (GO:0005576)		p.G72V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GTCATGCTGGGAAGATGTCAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											104.0	91.0	95.0					11																	7509443		2201	4296	6497	7466019	SO:0001583	missense	283298			AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.215G>T	11.37:g.7509443G>T	ENSP00000332511:p.Gly72Val	Somatic		Capture	SOLID	Phase_IV	7466019	B4DP03|Q569G4	Missense_Mutation	SNP	ENST00000329293.3	37	CCDS7779.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494836	0.64186	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	D;D	0.88277	-2.36;-2.36	5.77	4.76	0.60689	.	0.489631	0.20641	N	0.088402	D	0.87458	0.6182	L	0.57536	1.79	0.80722	D	1	D;D	0.56521	0.976;0.976	P;P	0.49140	0.524;0.601	D	0.85531	0.1209	10	0.41790	T	0.15	.	6.6823	0.23127	0.1457:0.0:0.8543:0.0	.	72;72	Q6UWY5;Q5HYE3	OLFL1_HUMAN;.	V	72	ENSP00000433455:G72V;ENSP00000332511:G72V	ENSP00000332511:G72V	G	+	2	0	OLFML1	7466019	0.996000	0.38824	1.000000	0.80357	0.917000	0.54804	2.962000	0.49176	2.732000	0.93576	0.655000	0.94253	GGA		0.433	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474		Missense_Mutation
PBX2	5089	hgsc.bcm.edu	37	6	32156565	32156565	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr6:32156565G>A	ENST00000375050.4	-	2	500	c.230C>T	c.(229-231)gCc>gTc	p.A77V	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	77					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.A77V(1)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GCAGTTTAGGGCGTGTTTCCT	0.552																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	143.0	133.0					6																	32156565		1511	2709	4220	32264543	SO:0001583	missense	5089				CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.230C>T	6.37:g.32156565G>A	ENSP00000364190:p.Ala77Val	Somatic		Capture	SOLID	Phase_IV	32264543	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569766	0.65765	.	.	ENSG00000204304	ENST00000375050	T	0.32515	1.45	4.92	4.05	0.47172	PBX (1);	0.082836	0.49916	N	0.000129	T	0.27832	0.0685	M	0.71581	2.175	0.58432	D	0.999992	P;P	0.46142	0.763;0.873	B;P	0.47941	0.378;0.562	T	0.10291	-1.0636	10	0.72032	D	0.01	-32.7796	11.0297	0.47765	0.0922:0.0:0.9078:0.0	.	77;77	Q7KZE5;P40425	.;PBX2_HUMAN	V	77	ENSP00000364190:A77V	ENSP00000364190:A77V	A	-	2	0	PBX2	32264543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.480000	0.81109	1.060000	0.40578	0.561000	0.74099	GCC		0.552	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4			Missense_Mutation
PCNXL3	399909	hgsc.bcm.edu	37	11	65389726	65389726	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr11:65389726T>C	ENST00000355703.3	+	11	2785	c.2246T>C	c.(2245-2247)cTg>cCg	p.L749P		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	749						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GAGCAGACACTGATGGAAGAA	0.647																																																0			11											20.0	23.0	22.0					11																	65389726		2040	4185	6225	65146302	SO:0001583	missense	399909			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2246T>C	11.37:g.65389726T>C	ENSP00000347931:p.Leu749Pro	Somatic		Capture	SOLID	Phase_IV	65146302	Q6MZN8	Missense_Mutation	SNP	ENST00000355703.3	37	CCDS44650.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	15.08	2.727150	0.48833	.	.	ENSG00000197136	ENST00000355703	T	0.28069	1.63	4.32	4.32	0.51571	.	.	.	.	.	T	0.42449	0.1203	L	0.40543	1.245	0.58432	D	0.999998	D	0.65815	0.995	D	0.72982	0.979	T	0.14035	-1.0487	9	0.29301	T	0.29	.	11.4727	0.50280	0.0:0.0:0.0:1.0	.	749	Q9H6A9	PCX3_HUMAN	P	749	ENSP00000347931:L749P	ENSP00000347931:L749P	L	+	2	0	PCNXL3	65146302	1.000000	0.71417	0.988000	0.46212	0.872000	0.50106	5.296000	0.65698	1.610000	0.50200	0.459000	0.35465	CTG		0.647	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223		Missense_Mutation
PPFIA2	8499	hgsc.bcm.edu	37	12	81732980	81732980	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr12:81732980T>C	ENST00000549396.1	-	21	2687	c.2527A>G	c.(2527-2529)Aaa>Gaa	p.K843E	PPFIA2_ENST00000552948.1_Missense_Mutation_p.K843E|PPFIA2_ENST00000550359.2_Missense_Mutation_p.K690E|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000407050.4_Missense_Mutation_p.K769E|PPFIA2_ENST00000548586.1_Missense_Mutation_p.K843E|PPFIA2_ENST00000549325.1_Missense_Mutation_p.K825E|PPFIA2_ENST00000541570.2_Missense_Mutation_p.K410E|PPFIA2_ENST00000333447.7_Missense_Mutation_p.K825E|PPFIA2_ENST00000443686.3_Missense_Mutation_p.K744E|PPFIA2_ENST00000550584.2_Missense_Mutation_p.K843E|PPFIA2_ENST00000541017.1_Missense_Mutation_p.K60E	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	843					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.K843E(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						AGTCGAGCTTTTTCTTTTTTA	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											200.0	196.0	197.0					12																	81732980		1853	4106	5959	80257111	SO:0001583	missense	8499			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2527A>G	12.37:g.81732980T>C	ENSP00000450337:p.Lys843Glu	Somatic		Capture	SOLID	Phase_IV	80257111	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	SNP	64	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.617894|4.617894	0.87359|0.87359	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000551147	T;T;T;T;T;T;T;T;T|.	0.54866|.	0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.79173|0.79173	0.4401|0.4401	M|M	0.85777|0.85777	2.775|2.775	0.80722|0.80722	D|D	1|1	D|.	0.58620|.	0.983|.	P|.	0.52758|.	0.708|.	T|T	0.81805|0.81805	-0.0764|-0.0764	10|6	0.56958|.	D|.	0.05|.	-30.2066|-30.2066	15.8745|15.8745	0.79151|0.79151	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	843|.	O75334|.	LIPA2_HUMAN|.	E|R	843;825;410;60;769;854;825;843;744;843|5	ENSP00000450337:K843E;ENSP00000450298:K825E;ENSP00000438337:K410E;ENSP00000445532:K60E;ENSP00000385093:K769E;ENSP00000327416:K825E;ENSP00000449338:K843E;ENSP00000388373:K744E;ENSP00000447868:K843E|.	ENSP00000327416:K825E|.	K|K	-|-	1|2	0|0	PPFIA2|PPFIA2	80257111|80257111	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.750000|0.750000	0.42670|0.42670	7.937000|7.937000	0.87672|0.87672	2.151000|2.151000	0.67156|0.67156	0.459000|0.459000	0.35465|0.35465	AAA|AAA		0.428	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1			Missense_Mutation
PRPSAP1	5635	hgsc.bcm.edu	37	17	74309053	74309053	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:74309053C>T	ENST00000446526.3	-	9	1342	c.897G>A	c.(895-897)gaG>gaA	p.E299E	PRPSAP1_ENST00000588364.1_5'UTR|PRPSAP1_ENST00000324684.4_Silent_p.E196E	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	270					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)	p.E270E(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						CTTTCAGGATCTCCGCGGCAG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	17											109.0	106.0	107.0					17																	74309053		2203	4300	6503	71820648	SO:0001819	synonymous_variant	5635			D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.897G>A	17.37:g.74309053C>T		Somatic		Capture	SOLID	Phase_IV	71820648	B2R6M4|Q96H06	Silent	SNP	ENST00000446526.3	37	CCDS11743.2	SNP	32	Baylor																																																																																				0.527	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342480.2	NM_002766		Silent
PRR4	11272	hgsc.bcm.edu	37	12	10999790	10999790	+	Nonsense_Mutation	SNP	G	G	A	rs200314617		TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr12:10999790G>A	ENST00000228811.4	-	3	314	c.277C>T	c.(277-279)Cga>Tga	p.R93*	PRR4_ENST00000540107.1_Missense_Mutation_p.T35M|PRR4_ENST00000544994.1_Intron|PRR4_ENST00000536668.1_5'UTR	NM_007244.2	NP_009175.2	Q16378	PROL4_HUMAN	proline rich 4 (lacrimal)	93	Pro-rich.				retina homeostasis (GO:0001895)|visual perception (GO:0007601)	extracellular space (GO:0005615)		p.R93*(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	9						CGGGGTGGTCGTTGCTGATTT	0.542													G|||	0	0.0	0.0	0.0	5008	,	,		17811	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	12											243.0	251.0	249.0					12																	10999790		2038	4179	6217	10891057	SO:0001587	stop_gained	11272				CCDS41756.1, CCDS55804.1	12p13	2008-02-05		2004-05-28		ENSG00000111215			18020	protein-coding gene	gene with protein product		605359		PROL4		7544782	Standard	NM_007244		Approved	LPRP	uc001qyz.4	Q16378		ENST00000228811.4:c.277C>T	12.37:g.10999790G>A	ENSP00000228811:p.Arg93*	Somatic		Capture	SOLID	Phase_IV	10891057	A8KA69|F5H0D7|Q8NFB3	Nonsense_Mutation	SNP	ENST00000228811.4	37	CCDS41756.1	SNP	40	Baylor	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	4.837|4.837	0.155590|0.155590	0.09236|0.09236	.|.	.|.	ENSG00000111215|ENSG00000111215	ENST00000228811|ENST00000540107	.|T	.|0.04360	.|3.64	1.63|1.63	-3.26|-3.26	0.05064|0.05064	.|.	3.053280|.	0.05590|.	U|.	0.574564|.	.|T	.|0.05456	.|0.0144	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.28650	.|-1.0037	.|6	0.02654|0.87932	T|D	1|0	.|.	4.026|4.026	0.09687|0.09687	0.0:0.3163:0.1915:0.4922|0.0:0.3163:0.1915:0.4922	.|.	.|.	.|.	.|.	X|M	93|35	.|ENSP00000443939:T35M	ENSP00000228811:R93X|ENSP00000443939:T35M	R|T	-|-	1|2	2|0	PRR4|PRR4	10891057|10891057	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.440000|-1.440000	0.02412|0.02412	-1.674000|-1.674000	0.01461|0.01461	-1.928000|-1.928000	0.00512|0.00512	CGA|ACG		0.542	PRR4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400049.1	NM_007244		Nonsense_Mutation
RANBP6	26953	hgsc.bcm.edu	37	9	6014121	6014123	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-23-1024-01	TCGA-23-1024-10	TTT	TTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr9:6014121_6014123delTTT	ENST00000259569.5	-	1	1495_1497	c.1485_1487delAAA	c.(1483-1488)aaaaat>aat	p.K495del	RANBP6_ENST00000485372.1_5'UTR	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	495					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K495delK(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GGAATGTAGATTTTTCACCATAC	0.379																																																1	Deletion - In frame(1)	ovary(1)	9																																								6004123	SO:0001651	inframe_deletion	26953			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.1485_1487delAAA	9.37:g.6014121_6014123delTTT	ENSP00000259569:p.Lys495del	Somatic		Capture	SOLID	Phase_IV	6004121	Q5T7X4|Q7Z3V2|Q96E78	In_Frame_Del	DEL	ENST00000259569.5	37	CCDS6467.1	DEL	52	Baylor																																																																																				0.379	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		In_Frame_Del
PTCH1	5727	hgsc.bcm.edu	37	9	98218666	98218666	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr9:98218666C>T	ENST00000331920.6	-	19	3497	c.3198G>A	c.(3196-3198)gaG>gaA	p.E1066E	PTCH1_ENST00000429896.2_Silent_p.E915E|PTCH1_ENST00000375274.2_Silent_p.E1065E|PTCH1_ENST00000430669.2_Silent_p.E1000E|PTCH1_ENST00000418258.1_Silent_p.E915E|PTCH1_ENST00000421141.1_Silent_p.E915E|PTCH1_ENST00000437951.1_Silent_p.E1000E	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1066					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.V1057_L1102del(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TGCCGAACAGCTCGACCGTCA	0.627																																																1	Deletion - In frame(1)	central_nervous_system(1)	9											106.0	75.0	86.0					9																	98218666		2203	4300	6503	97258487	SO:0001819	synonymous_variant	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3198G>A	9.37:g.98218666C>T		Somatic		Capture	SOLID	Phase_IV	97258487	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1	SNP	28	Baylor																																																																																				0.627	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264		Silent
RBM12B	389677	hgsc.bcm.edu	37	8	94746534	94746534	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr8:94746534G>A	ENST00000399300.2	-	3	2318	c.2105C>T	c.(2104-2106)cCc>cTc	p.P702L	RBM12B_ENST00000517700.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	702							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CTCCTCTGGGGGCCGCCTGAA	0.642																																																0			8											99.0	105.0	103.0					8																	94746534		1867	4081	5948	94815710	SO:0001583	missense	389677				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2105C>T	8.37:g.94746534G>A	ENSP00000382239:p.Pro702Leu	Somatic		Capture	SOLID	Phase_IV	94815710	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	37	CCDS43755.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879126	0.33162	.	.	ENSG00000183808	ENST00000399300	T	0.07908	3.15	4.7	-2.06	0.07298	.	.	.	.	.	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.38564	-0.9655	9	0.56958	D	0.05	3.2923	5.6449	0.17584	0.3965:0.0:0.4777:0.1258	.	702	Q8IXT5	RB12B_HUMAN	L	702	ENSP00000382239:P702L	ENSP00000382239:P702L	P	-	2	0	RBM12B	94815710	0.000000	0.05858	0.000000	0.03702	0.258000	0.26162	-0.101000	0.10973	-0.409000	0.07553	-0.136000	0.14681	CCC		0.642	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390		Missense_Mutation
RHOT1	55288	hgsc.bcm.edu	37	17	30526010	30526010	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:30526010C>T	ENST00000333942.6	+	12	1153	c.914C>T	c.(913-915)gCa>gTa	p.A305V	RHOT1_ENST00000583994.1_Missense_Mutation_p.A178V|RHOT1_ENST00000354266.3_Missense_Mutation_p.A284V|RHOT1_ENST00000580976.1_3'UTR|RHOT1_ENST00000581094.1_Missense_Mutation_p.A305V|RHOT1_ENST00000394692.2_Missense_Mutation_p.A305V|RHOT1_ENST00000545287.2_Missense_Mutation_p.A305V|RHOT1_ENST00000358365.3_Missense_Mutation_p.A305V	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	305	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A305V(1)		NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AATCATCATGCATATTTATTT	0.274																																																1	Substitution - Missense(1)	ovary(1)	17											70.0	69.0	69.0					17																	30526010		2202	4299	6501	27550123	SO:0001583	missense	55288			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.914C>T	17.37:g.30526010C>T	ENSP00000334724:p.Ala305Val	Somatic		Capture	SOLID	Phase_IV	27550123	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	37	CCDS32612.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017561	0.54576	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.51574	0.7;0.7;0.7	5.56	5.56	0.83823	EF hand associated, type-2 (1);	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	L	0.53780	1.695	0.80722	D	1	D;D;D;D	0.76494	0.969;0.997;0.989;0.999	P;D;P;D	0.71656	0.813;0.944;0.898;0.974	T	0.65520	-0.6148	10	0.87932	D	0	-9.2087	15.061	0.71955	0.0:0.8585:0.1415:0.0	.	305;305;305;305	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	V	305	ENSP00000351132:A305V;ENSP00000378184:A305V;ENSP00000334724:A305V	ENSP00000334724:A305V	A	+	2	0	RHOT1	27550123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.776000	0.68924	2.598000	0.87819	0.650000	0.86243	GCA		0.274	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307		Missense_Mutation
SESN2	83667	hgsc.bcm.edu	37	1	28599184	28599184	+	Silent	SNP	C	C	T	rs376476503		TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr1:28599184C>T	ENST00000253063.3	+	5	951	c.630C>T	c.(628-630)ttC>ttT	p.F210F		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	210					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.F210F(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCCTCCTTCGTGTTTGGCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	1						C		0,4406		0,0,2203	111.0	96.0	101.0		630	-6.5	0.5	1		101	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	SESN2	NM_031459.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		210/481	28599184	2,13004	2203	4300	6503	28471771	SO:0001819	synonymous_variant	83667			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.630C>T	1.37:g.28599184C>T		Somatic		Capture	SOLID	Phase_IV	28471771	Q5T7D0|Q96SI5	Silent	SNP	ENST00000253063.3	37	CCDS321.1	SNP	31	Baylor																																																																																				0.647	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1			Silent
SIGLEC11	114132	hgsc.bcm.edu	37	19	50461967	50461967	+	Silent	SNP	T	T	G			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr19:50461967T>G	ENST00000447370.2	-	7	1386	c.1296A>C	c.(1294-1296)ggA>ggC	p.G432G	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Silent_p.G432G	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	432	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.G420G(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		AGGTGAACTCTCCTTCGTGCT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	19											76.0	73.0	74.0					19																	50461967		2203	4300	6503	55153779	SO:0001819	synonymous_variant	114132			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1296A>C	19.37:g.50461967T>G		Somatic		Capture	SOLID	Phase_IV	55153779		Silent	SNP	ENST00000447370.2	37	CCDS12790.2	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	4.752	0.139859	0.09083	.	.	ENSG00000161640	ENST00000426971	T	0.22134	1.97	3.1	-2.34	0.06704	.	.	.	.	.	T	0.12390	0.0301	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	T	0.34976	-0.9807	5	.	.	.	.	4.3254	0.11038	0.0:0.1785:0.2711:0.5504	.	.	.	.	A	422	ENSP00000398891:E422A	.	E	-	2	0	SIGLEC11	55153779	0.000000	0.05858	0.002000	0.10522	0.068000	0.16541	-1.907000	0.01589	-0.647000	0.05444	0.454000	0.30748	GAG		0.667	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		Silent
SLC28A1	9154	hgsc.bcm.edu	37	15	85447460	85447460	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr15:85447460T>A	ENST00000286749.3	+	6	684	c.594T>A	c.(592-594)caT>caA	p.H198Q	SLC28A1_ENST00000537216.1_Missense_Mutation_p.H198Q|SLC28A1_ENST00000537703.1_Missense_Mutation_p.H120Q|SLC28A1_ENST00000394573.1_Missense_Mutation_p.H198Q|SLC28A1_ENST00000538177.1_Missense_Mutation_p.H198Q|SLC28A1_ENST00000537624.1_Missense_Mutation_p.H198Q			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	198					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.H198Q(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GCTCAAAGCATCATTGCGCAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	15											143.0	126.0	132.0					15																	85447460		2203	4299	6502	83248464	SO:0001583	missense	9154			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.594T>A	15.37:g.85447460T>A	ENSP00000286749:p.His198Gln	Somatic		Capture	SOLID	Phase_IV	83248464	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	CCDS10334.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086483	0.36855	.	.	ENSG00000156222	ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58	4.38	0.789	0.18607	Na dependent nucleoside transporter (1);	0.110552	0.64402	D	0.000007	T	0.31949	0.0813	M	0.81802	2.56	0.47123	D	0.999329	D;B;D;B;P	0.76494	0.994;0.133;0.999;0.132;0.954	D;B;D;B;D	0.77557	0.94;0.138;0.99;0.314;0.94	T	0.02244	-1.1189	10	0.87932	D	0	-0.2747	6.1629	0.20373	0.0:0.3185:0.0:0.6815	.	198;198;198;120;198	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337	.;.;.;.;S28A1_HUMAN	Q	198;198;198;198;198;120	ENSP00000440546:H198Q;ENSP00000443752:H198Q;ENSP00000444700:H198Q;ENSP00000286749:H198Q;ENSP00000378074:H198Q;ENSP00000443764:H120Q	ENSP00000286749:H198Q	H	+	3	2	SLC28A1	83248464	0.992000	0.36948	0.759000	0.31340	0.566000	0.35808	0.586000	0.23894	-0.019000	0.14055	0.529000	0.55759	CAT		0.587	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			Missense_Mutation
SLFN11	91607	hgsc.bcm.edu	37	17	33679891	33679891	+	Silent	SNP	T	T	A			TCGA-23-1024-01	TCGA-23-1024-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:33679891T>A	ENST00000394566.1	-	7	2462	c.2190A>T	c.(2188-2190)atA>atT	p.I730I	SLFN11_ENST00000308377.4_Silent_p.I730I	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	730					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.I730I(1)		autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CATTGCGAACTATTCTGGTGA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	17											141.0	140.0	141.0					17																	33679891		2203	4300	6503	30704004	SO:0001819	synonymous_variant	91607			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.2190A>T	17.37:g.33679891T>A		Somatic		Capture	SOLID	Phase_IV	30704004	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1	SNP	53	Baylor																																																																																				0.438	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270		Silent
SMPDL3B	27293	hgsc.bcm.edu	37	1	28282473	28282473	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr1:28282473C>T	ENST00000373894.3	+	7	1076	c.885C>T	c.(883-885)agC>agT	p.S295S	SMPDL3B_ENST00000373888.4_Silent_p.S295S|RP11-460I13.2_ENST00000448015.1_RNA|SMPDL3B_ENST00000549094.1_Silent_p.S247S	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	295					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.S295S(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		TCCCCATAAGCGCCATGTTCA	0.567																																																1	Substitution - coding silent(1)	ovary(1)	1											75.0	68.0	70.0					1																	28282473		2203	4300	6503	28155060	SO:0001819	synonymous_variant	27293			Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.885C>T	1.37:g.28282473C>T		Somatic		Capture	SOLID	Phase_IV	28155060	B7ZB35|Q5T0Z0|Q96CB7	Silent	SNP	ENST00000373894.3	37	CCDS30655.1	SNP	27	Baylor																																																																																				0.567	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011170.1	NM_014474		Silent
SOS1	6654	hgsc.bcm.edu	37	2	39213013	39213013	+	Silent	SNP	G	G	C			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr2:39213013G>C	ENST00000426016.1	-	24	4040	c.3954C>G	c.(3952-3954)tcC>tcG	p.S1318S	SOS1_ENST00000395038.2_Silent_p.S1303S|SOS1_ENST00000402219.2_Silent_p.S1318S			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1318					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1318S(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CTCTGTGCATGGATGGGTGTG	0.488									Noonan syndrome																																							1	Substitution - coding silent(1)	ovary(1)	2											270.0	229.0	243.0					2																	39213013		2203	4300	6503	39066517	SO:0001819	synonymous_variant	6654	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3954C>G	2.37:g.39213013G>C		Somatic		Capture	SOLID	Phase_IV	39066517	A8K2G3|B4DXG2	Silent	SNP	ENST00000426016.1	37	CCDS1802.1	SNP	47	Baylor																																																																																				0.488	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633		Silent
SMYD1	150572	hgsc.bcm.edu	37	2	88387456	88387456	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr2:88387456C>T	ENST00000419482.2	+	3	475	c.390C>T	c.(388-390)gaC>gaT	p.D130D	SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000444564.2_Silent_p.D130D	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	130	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.D130D(1)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						TGTCCGTGGACGACTTGCAGA	0.662																																																1	Substitution - coding silent(1)	prostate(1)	2											98.0	80.0	86.0					2																	88387456		2203	4300	6503	88168571	SO:0001819	synonymous_variant	150572			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.390C>T	2.37:g.88387456C>T		Somatic		Capture	SOLID	Phase_IV	88168571	A0AV30|A6NE13	Silent	SNP	ENST00000419482.2	37	CCDS33240.1	SNP	19	Baylor																																																																																				0.662	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915		Silent
TMEM185A	84548	hgsc.bcm.edu	37	X	148690459	148690459	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1024-01	TCGA-23-1024-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chrX:148690459A>T	ENST00000316916.8	-	3	582	c.278T>A	c.(277-279)cTc>cAc	p.L93H	TMEM185A_ENST00000536359.1_Missense_Mutation_p.L34H|TMEM185A_ENST00000507237.1_Missense_Mutation_p.L93H	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	93						dendrite (GO:0030425)|integral component of membrane (GO:0016021)		p.L93H(1)		kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CATCAACAAGAGCAAGTGGAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	X											170.0	150.0	157.0					X																	148690459		2202	4299	6501	148498255	SO:0001583	missense	84548			AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.278T>A	X.37:g.148690459A>T	ENSP00000359449:p.Leu93His	Somatic		Capture	SOLID	Phase_IV	148498255	B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Missense_Mutation	SNP	ENST00000316916.8	37	CCDS14689.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.5	4.300025	0.81136	.	.	ENSG00000155984	ENST00000316916;ENST00000536359;ENST00000507237;ENST00000511776	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.55353	0.1915	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.76071	0.982;0.959;0.987	T	0.60094	-0.7330	10	0.72032	D	0.01	-16.1468	13.6613	0.62368	1.0:0.0:0.0:0.0	.	93;34;93	Q8NFB2;F5H5U0;E7EMM1	T185A_HUMAN;.;.	H	93;34;93;34	ENSP00000359449:L93H;ENSP00000443119:L34H;ENSP00000427766:L93H;ENSP00000428659:L34H	ENSP00000359449:L93H	L	-	2	0	TMEM185A	148498255	1.000000	0.71417	0.913000	0.36048	0.932000	0.56968	8.901000	0.92560	1.821000	0.53095	0.417000	0.27973	CTC		0.468	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058710.4	NM_032508		Missense_Mutation
SCTR	6344	hgsc.bcm.edu	37	2	120194651	120194652	+	IGR	INS	-	-	GTGTGC	rs3217464|rs201433053|rs201077606	byFrequency	TCGA-23-1024-01	TCGA-23-1024-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr2:120194651_120194652insGTGTGC	ENST00000019103.5	-	0	1865				TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_In_Frame_Ins_p.70_70T>SVP|TMEM37_ENST00000409826.1_In_Frame_Ins_p.82_82T>SVP	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)	p.T70>SVP(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	CACCAACCAGACGATCTGCTTC	0.668														4489	0.896366	0.9705	0.8386	5008	,	,		15646	0.8919		0.8748	False		,,,				2504	0.864															1	Complex - insertion inframe(1)	ovary(1)	2								4023,213		1924,175,19						3.4	0.6		dbSNP_126	56	6958,1218		3018,922,148	no	coding	TMEM37	NM_183240.2		4942,1097,167	A1A1,A1R,RR		14.8973,5.0283,11.5292				10981,1431				119911122	SO:0001628	intergenic_variant	140738				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194651_120194652insGTGTGC		Somatic		Capture	SOLID	Phase_IV	119911121	Q12961|Q13213|Q53T00	In_Frame_Ins	INS	ENST00000019103.5	37	CCDS2127.1	INS	10	Baylor																																																																																				0.668	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2			In_Frame_Ins
TP53	7157	hgsc.bcm.edu	37	17	7579362	7579363	+	Frame_Shift_Ins	INS	-	-	ACCGT	rs587783063		TCGA-23-1024-01	TCGA-23-1024-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr17:7579362_7579363insACCGT	ENST00000269305.4	-	4	513_514	c.324_325insACGGT	c.(322-327)ggtttcfs	p.F109fs	TP53_ENST00000455263.2_Frame_Shift_Ins_p.F109fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.F109fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.F109fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.F109fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Ins_p.F109fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	109	Interaction with HIPK1. {ECO:0000250}.|Interaction with WWOX.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> L (in a sporadic cancer; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q100fs*37(3)|p.G59fs*23(3)|p.F109fs*16(3)|p.G108_F109delGF(2)|p.G108del(2)|p.F109_R110delFR(2)|p.V73fs*9(1)|p.G108G(1)|p.G105_T125del21(1)|p.?_?ins?(1)|p.Y107fs*44(1)|p.W91fs*13(1)|p.Y103_G112>C(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.Y107fs*38(1)|p.F109V(1)|p.Y103_L111>L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCAGACGGAAACCGTAGCTGC	0.614		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	35	Deletion - Frameshift(12)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(3)|Complex - deletion inframe(2)|Insertion - In frame(1)|Substitution - Missense(1)|Substitution - coding silent(1)	ovary(6)|breast(6)|upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|lung(3)|central_nervous_system(2)|liver(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)	17																																								7520088	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.320_324dupACGGT	17.37:g.7579363_7579367dupACCGT	ENSP00000269305:p.Phe109fs	Somatic		Capture	SOLID	Phase_IV	7520087	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1	INS	1	Baylor																																																																																				0.614	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Frame_Shift_Ins
TRH	7200	hgsc.bcm.edu	37	3	129695772	129695772	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1024-01	TCGA-23-1024-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr3:129695772G>T	ENST00000302649.3	+	3	969	c.442G>T	c.(442-444)Gtc>Ttc	p.V148F	TRH_ENST00000507066.1_Missense_Mutation_p.V144F	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	148					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)	p.V148F(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						TGCATATGCTGTCCCGAAGCG	0.607																																					Esophageal Squamous(60;321 1330 17401 41911)											1	Substitution - Missense(1)	ovary(1)	3											50.0	48.0	48.0					3																	129695772		2203	4300	6503	131178462	SO:0001583	missense	7200				CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.442G>T	3.37:g.129695772G>T	ENSP00000303452:p.Val148Phe	Somatic		Capture	SOLID	Phase_IV	131178462	B2R8R1|Q2TB83	Missense_Mutation	SNP	ENST00000302649.3	37	CCDS3066.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.871	-0.027929	0.07589	.	.	ENSG00000170893	ENST00000302649;ENST00000507066	T;T	0.54675	0.56;0.56	4.98	0.731	0.18277	.	1.135550	0.06324	N	0.704960	T	0.39145	0.1067	N	0.17631	0.505	0.09310	N	0.999999	B	0.13145	0.007	B	0.14578	0.011	T	0.30119	-0.9989	10	0.35671	T	0.21	-1.6823	11.0788	0.48047	0.0869:0.0:0.7685:0.1446	.	148	P20396	TRH_HUMAN	F	148;144	ENSP00000303452:V148F;ENSP00000426522:V144F	ENSP00000303452:V148F	V	+	1	0	TRH	131178462	0.002000	0.14202	0.020000	0.16555	0.211000	0.24417	-0.251000	0.08818	-0.105000	0.12132	0.591000	0.81541	GTC		0.607	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	NM_007117		Missense_Mutation
VN1R5	317705	hgsc.bcm.edu	37	1	247420027	247420027	+	IGR	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr1:247420027C>T								RP11-488L18.8 (14902 upstream) : Y_RNA (38109 downstream)																							CTGTTTTTCACACTAATGACT	0.463																																																0			1											241.0	225.0	230.0					1																	247420027		1903	4129	6032	245486650	SO:0001628	intergenic_variant	317705																															1.37:g.247420027C>T		Somatic		Capture	SOLID	Phase_IV	245486650		Missense_Mutation	SNP		37		SNP	17	Baylor																																																																																			0	0.463									Missense_Mutation
ZNF789	285989	hgsc.bcm.edu	37	7	99081750	99081750	+	Silent	SNP	C	C	T			TCGA-23-1024-01	TCGA-23-1024-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1024-01	TCGA-23-1024-10	g.chr7:99081750C>T	ENST00000331410.5	+	4	519	c.249C>T	c.(247-249)tcC>tcT	p.S83S	ZNF789_ENST00000448667.1_Silent_p.S76S|ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_3'UTR	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S83S(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GGAAGGCTTCCGGTAGTGCTT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	7											110.0	105.0	107.0					7																	99081750		2203	4300	6503	98919686	SO:0001819	synonymous_variant	285989			AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.249C>T	7.37:g.99081750C>T		Somatic		Capture	SOLID	Phase_IV	98919686	A4D282|A6NH61|Q6ZMZ9	Silent	SNP	ENST00000331410.5	37	CCDS34693.1	SNP	23	Baylor																																																																																				0.542	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336266.1	NM_213603		Silent
