#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
IFI44	10561	broad.mit.edu	37	1	79116109	79116109	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr1:79116109A>G	ENST00000370747.4	+	2	314	c.229A>G	c.(229-231)Atc>Gtc	p.I77V	IFI44_ENST00000545124.1_Intron|IFI44_ENST00000495254.1_Intron	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	77					response to virus (GO:0009615)	cytoplasm (GO:0005737)		p.I77V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						GTATGCTTCCATCATCCTTTT	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	135.0	134.0					1																	79116109		2203	4300	6503	78888697	SO:0001583	missense	10561			D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.229A>G	1.37:g.79116109A>G	ENSP00000359783:p.Ile77Val	Unknown		x	x	x	78888697	B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	37	CCDS688.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.656789	0.00779	.	.	ENSG00000137965	ENST00000370747	T	0.40756	1.02	3.03	-6.07	0.02158	TLDc (1);	0.948341	0.08700	N	0.906574	T	0.07638	0.0192	L	0.43923	1.385	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.33752	-0.9856	10	0.02654	T	1	4.0E-4	6.8065	0.23780	0.2654:0.0:0.5756:0.159	.	77;77	B7ZB11;Q8TCB0	.;IFI44_HUMAN	V	77	ENSP00000359783:I77V	ENSP00000359783:I77V	I	+	1	0	IFI44	78888697	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.675000	0.05227	-1.532000	0.01747	-1.451000	0.01035	ATC		0.348	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417		Missense_Mutation
KCNA3	3738	broad.mit.edu	37	1	111216396	111216396	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr1:111216396C>T	ENST00000369769.2	-	1	1259	c.1036G>A	c.(1036-1038)Gag>Aag	p.E346K		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	346					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)	p.E346K(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	TCGGCCAGCTCGGTACCCAGA	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											91.0	92.0	91.0					1																	111216396		2203	4300	6503	111017919	SO:0001583	missense	3738			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1036G>A	1.37:g.111216396C>T	ENSP00000358784:p.Glu346Lys	Unknown		x	x	x	111017919	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378057	0.61735	.	.	ENSG00000177272	ENST00000369769	D	0.98345	-4.88	5.47	5.47	0.80525	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.98779	0.9589	M	0.82630	2.6	0.80722	D	1	D	0.63046	0.992	P	0.60236	0.871	D	0.99474	1.0946	10	0.66056	D	0.02	.	19.3206	0.94237	0.0:1.0:0.0:0.0	.	346	P22001	KCNA3_HUMAN	K	346	ENSP00000358784:E346K	ENSP00000358784:E346K	E	-	1	0	KCNA3	111017919	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	7.727000	0.84838	2.573000	0.86826	0.655000	0.94253	GAG		0.547	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232		Missense_Mutation
IQGAP3	128239	broad.mit.edu	37	1	156503658	156503658	+	Nonsense_Mutation	SNP	C	C	A	rs550783446		TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr1:156503658C>A	ENST00000361170.2	-	31	3893	c.3883G>T	c.(3883-3885)Gag>Tag	p.E1295*		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1295					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.E1295*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCTGGTGCTCCAGCAACAGC	0.592																																																1	Substitution - Nonsense(1)	ovary(1)	1											62.0	51.0	55.0					1																	156503658		2203	4300	6503	154770282	SO:0001587	stop_gained	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3883G>T	1.37:g.156503658C>A	ENSP00000354451:p.Glu1295*	Unknown		x	x	x	154770282	Q5T3H8	Nonsense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	41	8.793662	0.98956	.	.	ENSG00000183856	ENST00000361170	.	.	.	4.99	4.99	0.66335	.	0.059563	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-25.7785	17.365	0.87360	0.0:1.0:0.0:0.0	.	.	.	.	X	1295	.	ENSP00000354451:E1295X	E	-	1	0	IQGAP3	154770282	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	7.609000	0.82925	2.757000	0.94681	0.462000	0.41574	GAG		0.592	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		Nonsense_Mutation
SEC16B	89866	broad.mit.edu	37	1	177917070	177917070	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr1:177917070C>G	ENST00000308284.6	-	13	1642	c.1553G>C	c.(1552-1554)gGa>gCa	p.G518A	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000464631.2_Missense_Mutation_p.G519A	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	518					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)		p.G519A(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTGCTTTTCTCCACAACACTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											42.0	44.0	43.0					1																	177917070		1913	4058	5971	176183693	SO:0001583	missense	89866			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1553G>C	1.37:g.177917070C>G	ENSP00000308339:p.Gly518Ala	Unknown		x	x	x	176183693	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	37	CCDS44281.1	SNP	30	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.00|16.00	2.998513|2.998513	0.54147|0.54147	.|.	.|.	ENSG00000120341|ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472;ENST00000464631|ENST00000527976	T;T|.	0.50813|.	2.33;0.73|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.67970|0.67970	0.2950|0.2950	L|L	0.42581|0.42581	1.335|1.335	0.49051|0.49051	D|D	0.999744|0.999744	P;B;P;B;B|.	0.48230|.	0.655;0.127;0.907;0.02;0.016|.	B;B;P;B;B|.	0.48654|.	0.405;0.132;0.585;0.044;0.083|.	T|T	0.63409|0.63409	-0.6644|-0.6644	10|5	0.24483|.	T|.	0.36|.	-25.5089|-25.5089	19.0314|19.0314	0.92959|0.92959	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	73;519;519;518;215|.	B1AM07;E9PK14;B1AM08;Q96JE7;Q96PW0|.	.;.;.;SC16B_HUMAN;.|.	A|C	518;202;233;519|101	ENSP00000308339:G518A;ENSP00000431727:G519A|.	ENSP00000239472:G233A|.	G|W	-|-	2|3	0|0	AL359075.1|AL359075.1	176183693|176183693	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.874000|0.874000	0.50279|0.50279	5.358000|5.358000	0.66064|0.66064	2.582000|2.582000	0.87167|0.87167	0.557000|0.557000	0.71058|0.71058	GGA|TGG		0.463	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127		Missense_Mutation
GFRA1	2674	broad.mit.edu	37	10	117971142	117971142	+	Splice_Site	SNP	C	C	A			TCGA-23-1027-01	TCGA-23-1027-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr10:117971142C>A	ENST00000355422.6	-	5	984		c.e5+1		GFRA1_ENST00000544592.1_Intron|GFRA1_ENST00000439649.3_Intron|GFRA1_ENST00000369236.1_Intron	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1						axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		AGTGAACTTACCTTGCTGAAA	0.433																																					Ovarian(128;329 1725 45498 46808 50759)											0			10											87.0	87.0	87.0					10																	117971142		1011	2118	3129	117961132	SO:0001630	splice_region_variant	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.433+1G>T	10.37:g.117971142C>A		Somatic		x	x	x	117961132	A8KA21|O15507|O43912	Splice_Site_SNP	SNP	ENST00000355422.6	37	CCDS44481.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183649	0.78677	.	.	ENSG00000151892	ENST00000439649	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1152	0.72394	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GFRA1	117961132	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.454000	0.52986	2.630000	0.89119	0.655000	0.94253	.		0.433	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	Intron	Splice_Site_SNP
EDRF1	26098	broad.mit.edu	37	10	127414256	127414256	+	Missense_Mutation	SNP	A	A	G	rs141672047	byFrequency	TCGA-23-1027-01	TCGA-23-1027-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr10:127414256A>G	ENST00000356792.4	+	6	873	c.641A>G	c.(640-642)aAt>aGt	p.N214S	C10orf137_ENST00000337623.3_Missense_Mutation_p.N214S	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.N214S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCCAGTATCAATGGTGATGGA	0.438													A|||	2	0.000399361	0.0	0.0014	5008	,	,		17029	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	10						A	SER/ASN,SER/ASN	0,4406		0,0,2203	60.0	56.0	57.0		641,641	4.8	1.0	10	dbSNP_134	57	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	C10orf137	NM_001202438.1,NM_015608.2	46,46	0,4,6499	GG,GA,AA		0.0465,0.0,0.0308	probably-damaging,probably-damaging	214/1239,214/1205	127414256	4,13002	2203	4300	6503	127404246	SO:0001583	missense	26098																														ENST00000356792.4:c.641A>G	10.37:g.127414256A>G	ENSP00000349244:p.Asn214Ser	Somatic		x	x	x	127404246	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	SNP	4	Broad	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	19.96	3.922572	0.73213	0.0	4.65E-4	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	N	0.14661	0.345	0.58432	D	0.999996	D;D;D	0.71674	0.998;0.996;0.998	D;D;D	0.76071	0.987;0.98;0.987	T	0.44559	-0.9320	9	0.10377	T	0.69	.	14.9034	0.70699	1.0:0.0:0.0:0.0	.	214;214;214	Q3B7T1;Q3B7T1-5;Q3B7T1-3	EDRF1_HUMAN;.;.	S	214	.	ENSP00000336727:N214S	N	+	2	0	C10orf137	127404246	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.641000	0.74324	2.177000	0.69029	0.528000	0.53228	AAT		0.438	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			Missense_Mutation
EDRF1	26098	broad.mit.edu	37	10	127436444	127436444	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr10:127436444G>T	ENST00000356792.4	+	21	3218	c.2986G>T	c.(2986-2988)Gtc>Ttc	p.V996F	RP11-383C5.7_ENST00000593871.1_RNA|RP11-383C5.7_ENST00000594025.1_RNA|RP11-383C5.7_ENST00000449436.1_RNA|RP11-383C5.7_ENST00000602030.1_RNA|RP11-383C5.7_ENST00000600784.1_RNA|RP11-383C5.7_ENST00000601363.1_RNA|C10orf137_ENST00000337623.3_Missense_Mutation_p.V962F	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		996					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.V962F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGAGAAAGAAGTCAGTGAGGC	0.413																																																1	Substitution - Missense(1)	ovary(1)	10											120.0	114.0	116.0					10																	127436444		2203	4300	6503	127426434	SO:0001583	missense	26098																														ENST00000356792.4:c.2986G>T	10.37:g.127436444G>T	ENSP00000349244:p.Val996Phe	Unknown		x	x	x	127426434	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Missense_Mutation	SNP	ENST00000356792.4	37	CCDS55733.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931274	0.92389	.	.	ENSG00000107938	ENST00000356792;ENST00000337623	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.79787	0.4506	M	0.70595	2.14	0.80722	D	1	P;D;D	0.89917	0.937;0.994;1.0	P;D;D	0.85130	0.679;0.974;0.997	T	0.81446	-0.0929	9	0.87932	D	0	.	19.385	0.94553	0.0:0.0:1.0:0.0	.	996;343;962	Q3B7T1;Q5VZQ1;Q3B7T1-5	EDRF1_HUMAN;.;.	F	996;962	.	ENSP00000336727:V962F	V	+	1	0	C10orf137	127426434	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.360000	0.97119	2.561000	0.86390	0.650000	0.86243	GTC		0.413	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1			Missense_Mutation
PTPN5	84867	broad.mit.edu	37	11	18754173	18754173	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr11:18754173G>A	ENST00000358540.2	-	12	1725	c.1295C>T	c.(1294-1296)aCg>aTg	p.T432M	PTPN5_ENST00000396168.1_Missense_Mutation_p.T408M|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396166.3_5'Flank|PTPN5_ENST00000396167.2_Missense_Mutation_p.T400M|PTPN5_ENST00000477854.1_Missense_Mutation_p.T236M|PTPN5_ENST00000396170.1_Missense_Mutation_p.T400M|PTPN5_ENST00000396171.4_Missense_Mutation_p.T432M	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	432	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)	p.T432M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GTAATCCTCCGTGTGAATGAC	0.597											OREG0020824	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	11											183.0	167.0	172.0					11																	18754173		2199	4293	6492	18710749	SO:0001583	missense	84867			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1295C>T	11.37:g.18754173G>A	ENSP00000351342:p.Thr432Met	Somatic	728	x	x	x	18710749	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	37	CCDS7845.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780819	0.70222	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.29	5.29	0.74685	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.148856	0.45361	D	0.000375	T	0.78868	0.4351	N	0.11341	0.13	0.36430	D	0.864877	D;D	0.76494	0.993;0.999	P;P	0.53954	0.709;0.738	T	0.83295	-0.0031	10	0.42905	T	0.14	.	17.2991	0.87177	0.0:0.0:1.0:0.0	.	432;400	P54829;B3KXG7	PTN5_HUMAN;.	M	236;432;400;432;400;408	ENSP00000435056:T236M;ENSP00000351342:T432M;ENSP00000379473:T400M;ENSP00000379474:T432M;ENSP00000379470:T400M;ENSP00000379471:T408M	ENSP00000351342:T432M	T	-	2	0	PTPN5	18710749	1.000000	0.71417	0.967000	0.41034	0.988000	0.76386	5.970000	0.70431	2.767000	0.95098	0.655000	0.94253	ACG		0.597	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970		Missense_Mutation
FOLH1B	219595	broad.mit.edu	37	11	89409338	89409338	+	RNA	SNP	T	T	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr11:89409338T>A	ENST00000532352.1	+	0	1261							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						CTATAGAAGGTGAATATCGTT	0.343																																																1	Unknown(1)	ovary(1)	11											95.0	95.0	95.0					11																	89409338		2201	4296	6497	89048986			219595			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89409338T>A		Unknown		x	x	x	89048986		Splice_Site_SNP	SNP	ENST00000532352.1	37		SNP	59	Broad																																																																																				0.343	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		Splice_Site_SNP
CASP1	834	broad.mit.edu	37	11	104901070	104901070	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1027-01	TCGA-23-1027-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr11:104901070T>A	ENST00000533400.1	-	5	649	c.614A>T	c.(613-615)aAt>aTt	p.N205I	CASP1_ENST00000353247.5_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.N205I|CASP1_ENST00000393136.4_Missense_Mutation_p.N184I|CASP1_ENST00000527979.1_Missense_Mutation_p.N168I|CASP1_ENST00000598974.1_Missense_Mutation_p.N205I|CASP1_ENST00000528974.1_Missense_Mutation_p.N166I|CASP1_ENST00000526568.1_Missense_Mutation_p.N112I|CASP1_ENST00000594519.1_Missense_Mutation_p.N112I|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000534497.1_Missense_Mutation_p.N112I|CASP1_ENST00000525825.1_Missense_Mutation_p.N184I|CASP1_ENST00000593315.1_Missense_Mutation_p.N184I|CASP1_ENST00000446369.1_Missense_Mutation_p.N112I	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	205					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)	p.N205I(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	AGCAGTGAGATTTTTTTTCAC	0.378																																					NSCLC(41;1246 1743 4934)											1	Substitution - Missense(1)	ovary(1)	11											111.0	109.0	110.0					11																	104901070		2202	4299	6501	104406280	SO:0001583	missense	834			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.614A>T	11.37:g.104901070T>A	ENSP00000433138:p.Asn205Ile	Somatic		x	x	x	104406280	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	CCDS8330.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	.	12.68	2.011256	0.35511	.	.	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000446369;ENST00000393136;ENST00000525825;ENST00000534497;ENST00000528974	T;T;T;T;T;T;T;T;T;T	0.53857	3.71;3.71;3.71;3.71;3.71;0.6;3.71;3.71;0.6;3.71	4.37	3.23	0.37069	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.150098	0.56097	D	0.000026	T	0.74951	0.3784	M	0.92169	3.28	0.40834	D	0.98361	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.937;0.996;0.993;0.998;0.993;0.992	T	0.77384	-0.2608	10	0.87932	D	0	.	8.0487	0.30564	0.0:0.0992:0.0:0.9008	.	166;112;205;184;205;168;112	B4DVD8;P29466-4;A8K249;P29466-2;P29466;G3V169;P29466-3	.;.;.;.;CASP1_HUMAN;.;.	I	54;112;168;205;205;112;184;184;112;166	ENSP00000435536:N54I;ENSP00000434250:N112I;ENSP00000432340:N168I;ENSP00000433138:N205I;ENSP00000410076:N205I;ENSP00000403260:N112I;ENSP00000376844:N184I;ENSP00000434779:N184I;ENSP00000436875:N112I;ENSP00000434259:N166I	ENSP00000376844:N184I	N	-	2	0	CASP1	104406280	0.997000	0.39634	0.952000	0.39060	0.076000	0.17211	4.170000	0.58229	0.818000	0.34468	0.455000	0.32223	AAT		0.378	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292		Missense_Mutation
KRT72	140807	broad.mit.edu	37	12	52981578	52981578	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr12:52981578T>G	ENST00000537672.2	-	7	1157	c.1147A>C	c.(1147-1149)Aaa>Caa	p.K383Q	KRT72_ENST00000354310.4_Missense_Mutation_p.K341Q|KRT72_ENST00000293745.2_Missense_Mutation_p.K383Q|KRT72_ENST00000398066.3_Missense_Mutation_p.K195Q	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	383	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.K383Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CGGGCATCTTTCAGGGCGCAG	0.642																																																1	Substitution - Missense(1)	ovary(1)	12											58.0	55.0	56.0					12																	52981578		2203	4300	6503	51267845	SO:0001583	missense	140807			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1147A>C	12.37:g.52981578T>G	ENSP00000441160:p.Lys383Gln	Unknown		x	x	x	51267845	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	37	CCDS8833.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	16.11	3.028870	0.54790	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;T;D	0.88586	-2.4;-2.4;2.54;-2.4	4.92	4.92	0.64577	Filament (1);	0.000000	0.53938	D	0.000044	D	0.95290	0.8472	M	0.89904	3.07	0.36628	D	0.87611	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98243	1.0489	10	0.87932	D	0	.	15.2878	0.73843	0.0:0.0:0.0:1.0	.	341;383	B4DEI8;Q14CN4	.;K2C72_HUMAN	Q	383;383;341;195	ENSP00000441160:K383Q;ENSP00000293745:K383Q;ENSP00000346269:K341Q;ENSP00000446151:K195Q	ENSP00000293745:K383Q	K	-	1	0	KRT72	51267845	0.972000	0.33761	1.000000	0.80357	0.206000	0.24218	3.408000	0.52651	2.143000	0.66587	0.528000	0.53228	AAA		0.642	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747		Missense_Mutation
NR1H4	9971	broad.mit.edu	37	12	100904651	100904652	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr12:100904651_100904652CC>AA	ENST00000551379.1	+	2	233_234	c.205_206CC>AA	c.(205-207)CCa>AAa	p.P69K	NR1H4_ENST00000549996.1_Missense_Mutation_p.P59K|NR1H4_ENST00000548884.1_Missense_Mutation_p.P59K|NR1H4_ENST00000188403.7_Missense_Mutation_p.P69K|NR1H4_ENST00000392986.3_Missense_Mutation_p.P59K			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	69					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.P59K(1)		NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	CCAAGTTCAACCACAGATTTCC	0.475																																																1	Substitution - Missense(1)	ovary(1)	12																																								99428783	SO:0001583	missense	9971			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	Exception_encountered	12.37:g.100904651_100904652delinsAA	ENSP00000447149:p.Pro69Lys	Unknown		x	x	x	99428782	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	DNP	ENST00000551379.1	37	CCDS55876.1	DNP	18	Broad																																																																																				0.475	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123		Missense_Mutation
ERCC5	2073	broad.mit.edu	37	13	103504612	103504612	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr13:103504612G>T	ENST00000355739.4	+	2	1656	c.233G>T	c.(232-234)gGg>gTg	p.G78V	ERCC5_ENST00000535557.1_Missense_Mutation_p.G78V|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.W503C	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	78	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)	p.G78V(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GTGTTTGATGGGGATGCTCCA	0.348			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	1	Substitution - Missense(1)	ovary(1)	13											125.0	124.0	124.0					13																	103504612		2203	4300	6503	102302613	SO:0001583	missense	2073	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.233G>T	13.37:g.103504612G>T	ENSP00000347978:p.Gly78Val	Unknown		x	x	x	102302613	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233701	0.79688	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000535557	T;T	0.73152	-0.72;-0.72	5.27	5.27	0.74061	XPG conserved site (1);XPG N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.91199	0.7227	H	0.99042	4.41	0.80722	D	1	P;B;D	0.89917	0.462;0.345;1.0	P;B;D	0.97110	0.539;0.197;1.0	D	0.94713	0.7894	10	0.72032	D	0.01	-25.6783	18.879	0.92350	0.0:0.0:1.0:0.0	.	78;78;503	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	V	503;78;78	ENSP00000347978:G78V;ENSP00000442117:G78V	ENSP00000347978:G78V	G	+	2	0	ERCC5	102302613	1.000000	0.71417	0.998000	0.56505	0.754000	0.42855	9.396000	0.97270	2.454000	0.82982	0.579000	0.79373	GGG		0.348	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1			Missense_Mutation
SERPINA10	51156	broad.mit.edu	37	14	94756388	94756388	+	Missense_Mutation	SNP	T	T	G	rs374100149		TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr14:94756388T>G	ENST00000393096.1	-	2	1008	c.543A>C	c.(541-543)ttA>ttC	p.L181F	SERPINA10_ENST00000554173.1_Missense_Mutation_p.L181F|SERPINA10_ENST00000261994.4_Missense_Mutation_p.L181F|SERPINA10_ENST00000554723.1_Missense_Mutation_p.L221F	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	181					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L181F(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		ACCTCTTGGATAAATTGAAGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	14											76.0	79.0	78.0					14																	94756388		2203	4300	6503	93826141	SO:0001583	missense	51156			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.543A>C	14.37:g.94756388T>G	ENSP00000376809:p.Leu181Phe	Unknown		x	x	x	93826141	A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	ENST00000393096.1	37	CCDS9923.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	4.481	0.089247	0.08632	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96	4.87	-9.73	0.00512	Serpin domain (3);	0.131690	0.29668	N	0.011514	T	0.71239	0.3316	L	0.55990	1.75	0.09310	N	0.999998	B	0.28258	0.205	B	0.22880	0.042	T	0.54695	-0.8255	10	0.62326	D	0.03	.	4.9267	0.13896	0.0899:0.4175:0.2868:0.2058	.	181	Q9UK55	ZPI_HUMAN	F	221;181;181;181	ENSP00000450896:L221F;ENSP00000376809:L181F;ENSP00000261994:L181F;ENSP00000450971:L181F	ENSP00000261994:L181F	L	-	3	2	SERPINA10	93826141	0.000000	0.05858	0.000000	0.03702	0.317000	0.28152	-1.529000	0.02223	-1.870000	0.01139	0.260000	0.18958	TTA		0.453	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186		Missense_Mutation
AHNAK2	113146	broad.mit.edu	37	14	105418758	105418758	+	Silent	SNP	T	T	C	rs372805671		TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr14:105418758T>C	ENST00000333244.5	-	7	3149	c.3030A>G	c.(3028-3030)gtA>gtG	p.V1010V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1010						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.V1010V(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGGGGCCGATACCCCGAACG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	14						C		7,3975		0,7,1984	229.0	247.0	241.0		3030	-7.1	0.0	14	dbSNP_134	241	0,8368		0,0,4184	no	coding-synonymous	AHNAK2	NM_138420.2		0,7,6168	CC,CT,TT		0.0,0.1758,0.0567		1010/5796	105418758	7,12343	1991	4184	6175	104489803	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3030A>G	14.37:g.105418758T>C		Unknown		x	x	x	104489803	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1	SNP	49	Broad																																																																																				0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Silent
ZNF48	197407	broad.mit.edu	37	16	30409787	30409787	+	Missense_Mutation	SNP	C	C	G	rs376605302		TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr16:30409787C>G	ENST00000320159.2	+	2	1592	c.1216C>G	c.(1216-1218)Ctg>Gtg	p.L406V	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	406	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L406V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CCCACCTCCTCTGGGCACCAG	0.672																																																1	Substitution - Missense(1)	ovary(1)	16						C	VAL/LEU,VAL/LEU,VAL/LEU,VAL/LEU	0,4390		0,0,2195	25.0	26.0	26.0		1216,847,1216,1216	4.4	1.0	16		26	1,8597		0,1,4298	no	missense,missense,missense,missense	ZNF48	NM_001214906.1,NM_001214907.1,NM_001214909.1,NM_152652.2	32,32,32,32	0,1,6493	GG,GC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	406/619,283/496,406/619,406/619	30409787	1,12987	2195	4299	6494	30317288	SO:0001583	missense	197407			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1216C>G	16.37:g.30409787C>G	ENSP00000324056:p.Leu406Val	Unknown		x	x	x	30317288	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	CCDS10679.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441156	0.43326	0.0	1.16E-4	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.08008	3.14	4.4	4.4	0.53042	.	0.000000	0.34046	N	0.004307	T	0.04407	0.0121	N	0.14661	0.345	0.27004	N	0.964847	P	0.41673	0.759	B	0.32289	0.143	T	0.32481	-0.9905	10	0.62326	D	0.03	-1.5242	9.9984	0.41913	0.2017:0.7983:0.0:0.0	.	406	Q96MX3	ZNF48_HUMAN	V	531;406	ENSP00000324056:L406V	ENSP00000324056:L406V	L	+	1	2	ZNF48	30317288	0.398000	0.25279	1.000000	0.80357	0.936000	0.57629	1.777000	0.38604	2.449000	0.82847	0.460000	0.39030	CTG		0.672	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652		Missense_Mutation
CES5A	221223	broad.mit.edu	37	16	55907868	55907868	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1027-01	TCGA-23-1027-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr16:55907868A>G	ENST00000290567.9	-	2	276	c.155T>C	c.(154-156)gTg>gCg	p.V52A	CES5A_ENST00000541580.1_Intron|CES5A_ENST00000319165.9_Missense_Mutation_p.V52A|CES5A_ENST00000520435.1_Missense_Mutation_p.V52A|CES5A_ENST00000521992.1_Missense_Mutation_p.V81A|CES5A_ENST00000518005.1_5'UTR	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	52						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)	p.V52A(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GTTCACAGGCACAGGGCTTCC	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											84.0	71.0	76.0					16																	55907868		2198	4300	6498	54465369	SO:0001583	missense	221223			AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.155T>C	16.37:g.55907868A>G	ENSP00000290567:p.Val52Ala	Somatic		x	x	x	54465369	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	10.44	1.351819	0.24512	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000290567;ENST00000520435	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.66	-10.1	0.00402	Carboxylesterase, type B (1);	0.885835	0.09708	N	0.766121	T	0.27933	0.0688	N	0.12920	0.275	0.09310	N	1	B;B	0.26081	0.017;0.141	B;B	0.23419	0.023;0.046	T	0.24693	-1.0153	10	0.08381	T	0.77	.	3.6099	0.08057	0.1205:0.1596:0.1377:0.5821	.	52;52	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	A	81;52;52;52	ENSP00000428864:V81A;ENSP00000324271:V52A;ENSP00000290567:V52A;ENSP00000428887:V52A	ENSP00000290567:V52A	V	-	2	0	CES5A	54465369	0.000000	0.05858	0.000000	0.03702	0.677000	0.39632	-0.212000	0.09319	-1.327000	0.02264	-0.320000	0.08662	GTG		0.612	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024		Missense_Mutation
CHRNB1	1140	broad.mit.edu	37	17	7358630	7358630	+	Silent	SNP	C	C	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr17:7358630C>T	ENST00000306071.2	+	9	1139	c.1072C>T	c.(1072-1074)Ctg>Ttg	p.L358L	CHRNB1_ENST00000536404.2_Silent_p.L286L|CHRNB1_ENST00000576360.1_Silent_p.L237L|CHRNB1_ENST00000575379.1_5'Flank	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	358					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)	p.L358L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	TCCGCTGTACCTGCGTCTAAA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	17											106.0	107.0	107.0					17																	7358630		2203	4300	6503	7299354	SO:0001819	synonymous_variant	1140			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.1072C>T	17.37:g.7358630C>T		Unknown		x	x	x	7299354	B7Z5H1|Q8IZ46|Q96FB8	Silent	SNP	ENST00000306071.2	37	CCDS11106.1	SNP	24	Broad																																																																																				0.532	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3			Silent
NF1	4763	broad.mit.edu	37	17	29654836	29654836	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1027-01	TCGA-23-1027-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr17:29654836G>C	ENST00000358273.4	+	38	5971	c.5588G>C	c.(5587-5589)gGc>gCc	p.G1863A	NF1_ENST00000356175.3_Missense_Mutation_p.G1842A|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1863					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.G1863A(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTTAATTTAGGCAGTTCTGAC	0.413			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											80.0	81.0	80.0					17																	29654836		2203	4300	6503	26678962	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5588G>C	17.37:g.29654836G>C	ENSP00000351015:p.Gly1863Ala	Somatic		x	x	x	26678962	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724556	0.89298	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;T;D	0.96967	-4.19;-0.11;-4.19	5.8	5.8	0.92144	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	L	0.54908	1.71	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.983	D;D;D	0.80764	0.989;0.994;0.938	D	0.97018	0.9741	10	0.41790	T	0.15	.	19.049	0.93034	0.0:0.0:1.0:0.0	.	892;1842;1863	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	A	1863;1842;1508	ENSP00000351015:G1863A;ENSP00000348498:G1842A;ENSP00000389907:G1508A	ENSP00000348498:G1842A	G	+	2	0	NF1	26678962	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.434000	0.97515	2.733000	0.93635	0.650000	0.86243	GGC		0.413	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Missense_Mutation
WNK4	65266	broad.mit.edu	37	17	40947736	40947736	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr17:40947736C>G	ENST00000246914.5	+	16	3137	c.3116C>G	c.(3115-3117)tCt>tGt	p.S1039C		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	1039					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)	p.S1027C(1)		NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCCACTCTCTCTGGTTCTCCA	0.572																																					Esophageal Squamous(6;201 374 4964 23855 42828)											1	Substitution - Missense(1)	ovary(1)	17											82.0	78.0	79.0					17																	40947736		2203	4300	6503	38201262	SO:0001583	missense	65266			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.3116C>G	17.37:g.40947736C>G	ENSP00000246914:p.Ser1039Cys	Unknown		x	x	x	38201262	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	CCDS11439.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	3.793	-0.043252	0.07452	.	.	ENSG00000126562	ENST00000246914	T	0.72615	-0.67	4.92	3.94	0.45596	.	0.145674	0.32258	N	0.006342	T	0.61837	0.2379	L	0.40543	1.245	0.19775	N	0.99996	B;B	0.24368	0.102;0.062	B;B	0.23852	0.049;0.01	T	0.59461	-0.7450	10	0.66056	D	0.02	-18.1643	12.2678	0.54689	0.0:0.6448:0.3552:0.0	.	1039;1039	Q96J92-3;Q96J92	.;WNK4_HUMAN	C	1039	ENSP00000246914:S1039C	ENSP00000246914:S1039C	S	+	2	0	WNK4	38201262	0.000000	0.05858	0.039000	0.18376	0.177000	0.22998	0.479000	0.22228	1.425000	0.47237	0.491000	0.48974	TCT		0.572	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1			Missense_Mutation
LPIN2	9663	broad.mit.edu	37	18	2951130	2951130	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr18:2951130C>G	ENST00000261596.4	-	4	751	c.513G>C	c.(511-513)caG>caC	p.Q171H	RP11-737O24.2_ENST00000584431.1_RNA|RP11-737O24.2_ENST00000581488.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	171					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)	p.Q171H(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CAGATGCGGCCTGCTCTTCCT	0.493																																																1	Substitution - Missense(1)	ovary(1)	18											185.0	151.0	163.0					18																	2951130		2203	4300	6503	2941130	SO:0001583	missense	9663			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.513G>C	18.37:g.2951130C>G	ENSP00000261596:p.Gln171His	Unknown		x	x	x	2941130	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907037	0.33628	.	.	ENSG00000101577	ENST00000261596;ENST00000455369	T	0.80738	-1.41	5.92	-0.266	0.12942	.	0.472448	0.24282	N	0.039897	T	0.68430	0.3000	L	0.53249	1.67	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.55724	-0.8096	10	0.44086	T	0.13	-11.0924	2.094	0.03663	0.1051:0.3003:0.2062:0.3884	.	171	Q92539	LPIN2_HUMAN	H	171	ENSP00000261596:Q171H	ENSP00000261596:Q171H	Q	-	3	2	LPIN2	2941130	0.000000	0.05858	0.012000	0.15200	0.874000	0.50279	-1.271000	0.02828	-0.111000	0.12001	0.655000	0.94253	CAG		0.493	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646		Missense_Mutation
PRX	57716	broad.mit.edu	37	19	40901791	40901791	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr19:40901791G>A	ENST00000324001.7	-	7	2738	c.2468C>T	c.(2467-2469)gCg>gTg	p.A823V	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	823					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A823V(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTCAGCACCCGCCTCGCCTGG	0.587																																																1	Substitution - Missense(1)	ovary(1)	19											92.0	82.0	85.0					19																	40901791		2202	4300	6502	45593631	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2468C>T	19.37:g.40901791G>A	ENSP00000326018:p.Ala823Val	Unknown		x	x	x	45593631	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	5.646	0.303864	0.10678	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01192	5.2	5.15	1.49	0.22878	.	0.297914	0.24107	N	0.041497	T	0.00784	0.0026	N	0.17082	0.46	0.09310	N	0.999999	B	0.23316	0.083	B	0.23018	0.043	T	0.49969	-0.8882	10	0.20519	T	0.43	-13.0857	5.0452	0.14480	0.2711:0.1659:0.5629:0.0	.	823	Q9BXM0	PRAX_HUMAN	V	823	ENSP00000326018:A823V	ENSP00000326018:A823V	A	-	2	0	PRX	45593631	0.061000	0.20836	0.784000	0.31847	0.310000	0.27922	0.457000	0.21875	1.165000	0.42670	0.655000	0.94253	GCG		0.587	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		Missense_Mutation
SIGLEC12	89858	broad.mit.edu	37	19	52003577	52003577	+	Intron	SNP	C	C	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr19:52003577C>A	ENST00000291707.3	-	2	483				SIGLEC12_ENST00000598614.1_Missense_Mutation_p.W17C	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GAGGGTCAGCCCAGCCCCCAC	0.607																																																0			19											43.0	39.0	40.0					19																	52003577		2203	4300	6503	56695389	SO:0001627	intron_variant	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.428-23G>T	19.37:g.52003577C>A		Unknown		x	x	x	56695389	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	SNP	22	Broad																																																																																				0.607	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003		Missense_Mutation
NLRP11	204801	broad.mit.edu	37	19	56303709	56303709	+	Missense_Mutation	SNP	G	G	A	rs374529395		TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr19:56303709G>A	ENST00000589093.1	-	7	2564	c.2471C>T	c.(2470-2472)aCg>aTg	p.T824M	NLRP11_ENST00000592953.1_Missense_Mutation_p.T725M|NLRP11_ENST00000589824.2_Missense_Mutation_p.T770M|NLRP11_ENST00000360133.3_Missense_Mutation_p.T770M|NLRP11_ENST00000443188.1_Missense_Mutation_p.T824M			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	824							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.T824M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAAGGGAAACGTCACATGCAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	19						G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	200.0	176.0	184.0		2471	-4.4	0.0	19		184	0,8600		0,0,4300	no	missense	NLRP11	NM_145007.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	824/1034	56303709	1,13005	2203	4300	6503	60995521	SO:0001583	missense	204801			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2471C>T	19.37:g.56303709G>A	ENSP00000466285:p.Thr824Met	Unknown		x	x	x	60995521	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	4.126	0.021719	0.08006	2.27E-4	0.0	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.53640	0.61;0.61	2.18	-4.36	0.03645	.	.	.	.	.	T	0.31327	0.0793	L	0.43152	1.355	0.09310	N	1	P;P	0.42993	0.695;0.797	B;B	0.37601	0.129;0.254	T	0.13926	-1.0491	9	0.72032	D	0.01	.	4.3745	0.11263	0.4516:0.3414:0.207:0.0	.	824;770	P59045;P59045-2	NAL11_HUMAN;.	M	824;770	ENSP00000409898:T824M;ENSP00000353251:T770M	ENSP00000353251:T770M	T	-	2	0	NLRP11	60995521	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.565000	0.05929	-1.536000	0.01738	-0.909000	0.02823	ACG		0.488	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007		Missense_Mutation
ANTXR1	84168	broad.mit.edu	37	2	69297801	69297801	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr2:69297801G>C	ENST00000303714.4	+	4	641	c.319G>C	c.(319-321)Gaa>Caa	p.E107Q	ANTXR1_ENST00000409349.3_Missense_Mutation_p.E107Q|ANTXR1_ENST00000409829.3_Missense_Mutation_p.E107Q	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	107	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)	p.E107Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						TCAAGGCCTAGAAGAACTCCA	0.353									Familial Infantile Hemangioma																																							1	Substitution - Missense(1)	ovary(1)	2											89.0	90.0	89.0					2																	69297801		2203	4300	6503	69151305	SO:0001583	missense	84168	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.319G>C	2.37:g.69297801G>C	ENSP00000301945:p.Glu107Gln	Unknown		x	x	x	69151305	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Missense_Mutation	SNP	ENST00000303714.4	37	CCDS1892.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.44	2.534873	0.45073	.	.	ENSG00000169604	ENST00000303714;ENST00000409829;ENST00000409349	T;T;T	0.67171	-0.25;-0.25;-0.25	6.03	6.03	0.97812	von Willebrand factor, type A (3);	0.046520	0.85682	D	0.000000	T	0.52141	0.1716	N	0.16266	0.395	0.48087	D	0.999582	B;B;B;B	0.28350	0.103;0.05;0.176;0.208	B;B;B;B	0.22753	0.041;0.019;0.036;0.024	T	0.46965	-0.9153	10	0.31617	T	0.26	-20.7668	18.0507	0.89347	0.0:0.0:1.0:0.0	.	107;107;107;107	Q9H6X2;Q9H6X2-2;Q9H6X2-4;Q9H6X2-3	ANTR1_HUMAN;.;.;.	Q	107	ENSP00000301945:E107Q;ENSP00000387058:E107Q;ENSP00000386494:E107Q	ENSP00000301945:E107Q	E	+	1	0	ANTXR1	69151305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.316000	0.65815	2.861000	0.98227	0.655000	0.94253	GAA		0.353	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208		Missense_Mutation
ZAP70	7535	broad.mit.edu	37	2	98351001	98351001	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1027-01	TCGA-23-1027-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr2:98351001A>G	ENST00000264972.5	+	9	1123	c.908A>G	c.(907-909)gAc>gGc	p.D303G	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000451498.2_5'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.D177G	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	303	Interdomain B.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.D303G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						ACGTCCCCAGACAAACCGCGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	2											78.0	70.0	73.0					2																	98351001		2203	4300	6503	97717433	SO:0001583	missense	7535			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.908A>G	2.37:g.98351001A>G	ENSP00000264972:p.Asp303Gly	Somatic		x	x	x	97717433	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	CCDS33254.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	8.554	0.876262	0.17395	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	T;T	0.72725	-0.67;-0.68	5.01	2.62	0.31277	.	0.882685	0.09610	N	0.778961	T	0.52403	0.1732	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35251	-0.9796	10	0.23302	T	0.38	.	6.9697	0.24642	0.7297:0.0:0.2703:0.0	.	177;303	P43403-3;P43403	.;ZAP70_HUMAN	G	303;177	ENSP00000264972:D303G;ENSP00000411141:D177G	ENSP00000264972:D303G	D	+	2	0	ZAP70	97717433	0.474000	0.25886	0.009000	0.14445	0.093000	0.18481	0.561000	0.23515	0.459000	0.27016	-0.290000	0.09829	GAC		0.627	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1			Missense_Mutation
SF3B1	23451	broad.mit.edu	37	2	198257819	198257819	+	Silent	SNP	C	C	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr2:198257819C>T	ENST00000335508.6	-	24	3724	c.3633G>A	c.(3631-3633)ttG>ttA	p.L1211L		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1211					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.L1211L(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CATAGTTCAACAAGTGATTCA	0.458			Mis		myelodysplastic syndrome																																		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	1	Substitution - coding silent(1)	ovary(1)	2											123.0	107.0	113.0					2																	198257819		2203	4300	6503	197966064	SO:0001819	synonymous_variant	23451			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3633G>A	2.37:g.198257819C>T		Unknown		x	x	x	197966064	E9PCH3	Silent	SNP	ENST00000335508.6	37	CCDS33356.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	8.958	0.969800	0.18659	.	.	ENSG00000115524	ENST00000424674	.	.	.	5.39	2.55	0.30701	.	.	.	.	.	T	0.59004	0.2162	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53858	-0.8379	4	.	.	.	.	9.9261	0.41494	0.0:0.774:0.0:0.226	.	.	.	.	Y	227	.	.	C	-	2	0	SF3B1	197966064	0.999000	0.42202	0.968000	0.41197	0.976000	0.68499	0.736000	0.26130	0.645000	0.30675	0.491000	0.48974	TGT		0.458	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			Silent
SH3BP4	23677	broad.mit.edu	37	2	235951181	235951181	+	Missense_Mutation	SNP	C	C	T	rs201649104	byFrequency	TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr2:235951181C>T	ENST00000409212.1	+	4	2275	c.1768C>T	c.(1768-1770)Cgg>Tgg	p.R590W	SH3BP4_ENST00000344528.4_Missense_Mutation_p.R590W|SH3BP4_ENST00000392011.2_Missense_Mutation_p.R590W			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	590					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.R590W(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CTTCACGCTGCGGGTTCAGGT	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		16573	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2											60.0	64.0	63.0					2																	235951181		2203	4300	6503	235615920	SO:0001583	missense	23677			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1768C>T	2.37:g.235951181C>T	ENSP00000386862:p.Arg590Trp	Unknown		x	x	x	235615920	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	SNP	27	Broad	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.17	3.046344	0.55110	.	.	ENSG00000130147	ENST00000392011;ENST00000409212;ENST00000344528	T;T;T	0.11385	2.78;2.78;2.78	5.08	-3.25	0.05079	.	0.046951	0.85682	D	0.000000	T	0.28200	0.0696	M	0.71036	2.16	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00662	-1.1621	10	0.66056	D	0.02	-43.9534	15.9145	0.79500	0.5148:0.4852:0.0:0.0	.	590;590	A8K594;Q9P0V3	.;SH3B4_HUMAN	W	590	ENSP00000375867:R590W;ENSP00000386862:R590W;ENSP00000340237:R590W	ENSP00000340237:R590W	R	+	1	2	SH3BP4	235615920	0.893000	0.30496	0.843000	0.33291	0.965000	0.64279	0.305000	0.19254	-0.955000	0.03636	0.655000	0.94253	CGG		0.587	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1			Missense_Mutation
PPP6R2	9701	broad.mit.edu	37	22	50857872	50857872	+	Silent	SNP	C	C	T			TCGA-23-1027-01	TCGA-23-1027-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr22:50857872C>T	ENST00000216061.5	+	9	1196	c.826C>T	c.(826-828)Ctg>Ttg	p.L276L	PPP6R2_ENST00000359139.3_Silent_p.L276L|PPP6R2_ENST00000395741.3_Silent_p.L277L|PPP6R2_ENST00000395744.3_Silent_p.L276L			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	276						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.L276L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						ACTCACCTTGCTGGAAACCAG	0.552																																																1	Substitution - coding silent(1)	ovary(1)	22											99.0	81.0	87.0					22																	50857872		2203	4300	6503	49204738	SO:0001819	synonymous_variant	9701			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.826C>T	22.37:g.50857872C>T		Somatic		x	x	x	49204738	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Silent	SNP	ENST00000216061.5	37		SNP	28	Broad																																																																																				0.552	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678		Silent
DNAH1	25981	broad.mit.edu	37	3	52357823	52357823	+	Splice_Site	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr3:52357823G>A	ENST00000420323.2	+	3	594		c.e3-1			NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1						cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.?(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTTGGTTTCAGGAGGTATGTC	0.622																																																1	Unknown(1)	ovary(1)	3											48.0	49.0	49.0					3																	52357823		1916	4132	6048	52332863	SO:0001630	splice_region_variant	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.334-1G>A	3.37:g.52357823G>A		Unknown		x	x	x	52332863	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Splice_Site_SNP	SNP	ENST00000420323.2	37	CCDS46842.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633947	0.29068	.	.	ENSG00000114841	ENST00000420323	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1855	0.86866	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH1	52332863	1.000000	0.71417	0.960000	0.40013	0.038000	0.13279	5.952000	0.70282	2.650000	0.89964	0.655000	0.94253	.		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	Intron	Splice_Site_SNP
ARGFX	503582	broad.mit.edu	37	3	121304901	121304901	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr3:121304901G>T	ENST00000334384.3	+	4	412	c.402G>T	c.(400-402)aaG>aaT	p.K134N		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K134N(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		TCAAATTGAAGAAGCAGCAGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	3											83.0	80.0	81.0					3																	121304901		2203	4300	6503	122787591	SO:0001583	missense	503582				CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.402G>T	3.37:g.121304901G>T	ENSP00000335578:p.Lys134Asn	Unknown		x	x	x	122787591		Missense_Mutation	SNP	ENST00000334384.3	37	CCDS33834.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889861	0.52014	.	.	ENSG00000186103	ENST00000334384	D	0.98313	-4.86	3.17	2.3	0.28687	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.717195	0.11854	N	0.523099	D	0.98036	0.9353	M	0.86343	2.81	0.09310	N	1	P	0.47841	0.901	P	0.49683	0.619	D	0.94358	0.7585	10	0.87932	D	0	-4.2254	6.5352	0.22350	0.1356:0.0:0.8644:0.0	.	134	A6NJG6	ARGFX_HUMAN	N	134	ENSP00000335578:K134N	ENSP00000335578:K134N	K	+	3	2	ARGFX	122787591	0.017000	0.18338	0.022000	0.16811	0.399000	0.30720	1.225000	0.32551	0.908000	0.36671	-0.254000	0.11334	AAG		0.517	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659		Missense_Mutation
ANXA5	308	broad.mit.edu	37	4	122592792	122592792	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr4:122592792C>G	ENST00000296511.5	-	10	916	c.631G>C	c.(631-633)Gac>Cac	p.D211H	ANXA5_ENST00000501272.2_Missense_Mutation_p.D151H|ANXA5_ENST00000515017.1_Missense_Mutation_p.D111H	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	211					blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)	p.D211H(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						ATGTACTTGTCAAACACTAGA	0.368																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)											1	Substitution - Missense(1)	ovary(1)	4											109.0	101.0	103.0					4																	122592792		2203	4299	6502	122812242	SO:0001583	missense	308			U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.631G>C	4.37:g.122592792C>G	ENSP00000296511:p.Asp211His	Unknown		x	x	x	122812242	D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Missense_Mutation	SNP	ENST00000296511.5	37	CCDS3720.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737480	0.69304	.	.	ENSG00000164111	ENST00000296511;ENST00000512232;ENST00000501272;ENST00000515017	T;T;T	0.03496	3.91;3.91;3.91	5.45	5.45	0.79879	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	L	0.58101	1.795	0.80722	D	1	P;D;D;D	0.89917	0.468;0.999;1.0;0.996	B;D;D;D	0.77004	0.165;0.972;0.989;0.972	T	0.00073	-1.2125	10	0.62326	D	0.03	.	18.8902	0.92397	0.0:1.0:0.0:0.0	.	111;151;211;211	D6RBE9;D6RBL5;E7ENQ5;P08758	.;.;.;ANXA5_HUMAN	H	211;211;151;111	ENSP00000296511:D211H;ENSP00000424106:D151H;ENSP00000424199:D111H	ENSP00000296511:D211H	D	-	1	0	ANXA5	122812242	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.252000	0.72447	2.559000	0.86315	0.591000	0.81541	GAC		0.368	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256636.2	NM_001154		Missense_Mutation
BAG6	7917	broad.mit.edu	37	6	31607358	31607358	+	Silent	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:31607358G>A	ENST00000375964.6	-	24	3535	c.3222C>T	c.(3220-3222)gcC>gcT	p.A1074A	BAG6_ENST00000439687.2_Intron|BAG6_ENST00000404765.2_Silent_p.A1104A|BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000375976.4_Silent_p.A1068A|BAG6_ENST00000362049.6_Intron|BAG6_ENST00000211379.5_Silent_p.A1068A	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	1074					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)	p.A1068A(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						GCCGAGCTCCGGCTGCCTTAG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	6											37.0	41.0	40.0					6																	31607358		2203	4300	6503	31715337	SO:0001819	synonymous_variant	7917			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.3222C>T	6.37:g.31607358G>A		Unknown		x	x	x	31715337	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	CCDS47403.1	SNP	39	Broad																																																																																				0.657	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703		Silent
RXRB	6257	broad.mit.edu	37	6	33165606	33165606	+	Silent	SNP	C	C	T			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:33165606C>T	ENST00000374680.3	-	4	964	c.753G>A	c.(751-753)aaG>aaA	p.K251K	RXRB_ENST00000544186.1_Silent_p.K61K|SLC39A7_ENST00000374675.3_5'Flank|RXRB_ENST00000374685.4_Silent_p.K251K|RNY4P10_ENST00000365571.1_RNA|RXRB_ENST00000413614.2_Silent_p.K155K	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	251					cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.K251K(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TCCGCTGGCGCTTGTCCACTG	0.577																																																1	Substitution - coding silent(1)	ovary(1)	6											79.0	66.0	71.0					6																	33165606		1511	2709	4220	33273584	SO:0001819	synonymous_variant	6257			M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.753G>A	6.37:g.33165606C>T		Unknown		x	x	x	33273584	P28703|Q59G65|Q5JP92|Q5STQ1	Silent	SNP	ENST00000374680.3	37	CCDS4768.1	SNP	28	Broad																																																																																				0.577	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976		Silent
EFHC1	114327	broad.mit.edu	37	6	52329846	52329846	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:52329846A>C	ENST00000371068.5	+	6	1173	c.1070A>C	c.(1069-1071)gAg>gCg	p.E357A	EFHC1_ENST00000538167.1_Missense_Mutation_p.E338A|EFHC1_ENST00000433625.2_Missense_Mutation_p.E266A	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	357	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.		E -> K (in dbSNP:rs505760).			axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)	p.E357A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					TATTACAAAGAGAAGTTTGGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	6											93.0	85.0	88.0					6																	52329846		2203	4300	6503	52437805	SO:0001583	missense	114327			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1070A>C	6.37:g.52329846A>C	ENSP00000360107:p.Glu357Ala	Unknown		x	x	x	52437805	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	37	CCDS4942.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	13.89	2.370828	0.42003	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.69175	-0.13;-0.38;-0.34	5.38	4.2	0.49525	Uncharacterised domain DM10 (2);	0.615460	0.19068	N	0.123572	T	0.36880	0.0983	L	0.29908	0.895	0.30424	N	0.777787	B;B;B	0.28636	0.218;0.015;0.035	B;B;B	0.33620	0.167;0.007;0.027	T	0.18555	-1.0333	10	0.24483	T	0.36	-10.8625	12.5017	0.55960	0.8603:0.1397:0.0:0.0	.	338;266;357	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	A	357;266;338	ENSP00000360107:E357A;ENSP00000416492:E266A;ENSP00000444521:E338A	ENSP00000360107:E357A	E	+	2	0	EFHC1	52437805	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	4.300000	0.59079	0.862000	0.35528	0.477000	0.44152	GAG		0.393	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100		Missense_Mutation
RIMS1	22999	broad.mit.edu	37	6	73108726	73108726	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:73108726G>A	ENST00000521978.1	+	33	4790	c.4790G>A	c.(4789-4791)cGa>cAa	p.R1597Q	RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000348717.5_Missense_Mutation_p.R1380Q|RIMS1_ENST00000414192.2_Missense_Mutation_p.R124Q|RIMS1_ENST00000425662.2_Missense_Mutation_p.R665Q|RIMS1_ENST00000538414.1_Missense_Mutation_p.R403Q|RIMS1_ENST00000491071.2_Missense_Mutation_p.R1386Q|RIMS1_ENST00000517960.1_Missense_Mutation_p.R1380Q|RIMS1_ENST00000518273.1_Missense_Mutation_p.R1276Q|RIMS1_ENST00000517827.1_Missense_Mutation_p.R731Q|RIMS1_ENST00000520567.1_Missense_Mutation_p.R1247Q|RIMS1_ENST00000401910.3_Missense_Mutation_p.R917Q|RIMS1_ENST00000522291.1_Missense_Mutation_p.R1196Q|RIMS1_ENST00000264839.7_Missense_Mutation_p.R1446Q|RIMS1_ENST00000523963.1_Missense_Mutation_p.R722Q	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1597	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)	p.R1597Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGAATTGCACGAAAAACCCTT	0.353																																																1	Substitution - Missense(1)	ovary(1)	6											121.0	118.0	119.0					6																	73108726		1831	4085	5916	73165447	SO:0001583	missense	22999			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4790G>A	6.37:g.73108726G>A	ENSP00000428417:p.Arg1597Gln	Unknown		x	x	x	73165447	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.708477|5.708477	0.96821|0.96821	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000517827;ENST00000370420;ENST00000538414;ENST00000414192	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.69806	.|-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43;-0.43	5.37|5.37	5.37|5.37	0.77165|0.77165	.|C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.000000	.|0.52532	.|D	.|0.000064	T|T	0.82079|0.82079	0.4959|0.4959	M|M	0.84683|0.84683	2.71|2.71	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|0.992;0.844;0.997;0.998;0.994;1.0;0.991;1.0;0.994;0.991;0.993;0.999;0.997	.|P;P;D;P;P;D;P;D;P;P;D;D;D	.|0.73708	.|0.869;0.718;0.981;0.851;0.824;0.972;0.846;0.972;0.824;0.893;0.926;0.978;0.949	D|D	0.84239|0.84239	0.0471|0.0471	5|10	.|0.72032	.|D	.|0.01	-20.9392|-20.9392	19.4549|19.4549	0.94884|0.94884	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|221;403;731;722;1446;917;1196;500;1276;1380;673;1386;1597	.|B7Z6K9;B7Z7W2;B7Z3S3;E9PHF5;E9PHR1;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.;.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN	K|Q	515|1386;1446;1386;1380;1276;1196;1446;1380;1276;1247;1196;1597;917;722;665;731;645;403;124	.|ENSP00000430101:R1386Q;ENSP00000275037:R1380Q;ENSP00000264839:R1446Q;ENSP00000429959:R1380Q;ENSP00000430408:R1276Q;ENSP00000430502:R1247Q;ENSP00000430932:R1196Q;ENSP00000428417:R1597Q;ENSP00000385649:R917Q;ENSP00000428328:R722Q;ENSP00000411235:R665Q;ENSP00000428367:R731Q;ENSP00000359448:R645Q;ENSP00000439730:R403Q;ENSP00000402273:R124Q	.|ENSP00000264839:R1446Q	E|R	+|+	1|2	0|0	RIMS1|RIMS1	73165447|73165447	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.733000|9.733000	0.98818|0.98818	2.662000|2.662000	0.90505|0.90505	0.655000|0.655000	0.94253|0.94253	GAA|CGA		0.353	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			Missense_Mutation
GRIK2	2898	broad.mit.edu	37	6	102483297	102483297	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:102483297G>A	ENST00000421544.1	+	14	2657	c.2167G>A	c.(2167-2169)Gaa>Aaa	p.E723K	GRIK2_ENST00000369134.4_Missense_Mutation_p.E674K|GRIK2_ENST00000318991.6_Missense_Mutation_p.E723K|GRIK2_ENST00000413795.1_Missense_Mutation_p.E723K|GRIK2_ENST00000369138.1_Missense_Mutation_p.E723K|GRIK2_ENST00000369137.3_Missense_Mutation_p.E647K	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	723					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E723K(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AAGTAATGAAGAAGGAATCCA	0.413																																																2	Substitution - Missense(2)	ovary(2)	6											145.0	144.0	144.0					6																	102483297		2203	4299	6502	102589990	SO:0001583	missense	2898				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2167G>A	6.37:g.102483297G>A	ENSP00000397026:p.Glu723Lys	Unknown		x	x	x	102589990	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	35	5.555595	0.96514	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51	5.46	5.46	0.80206	Ionotropic glutamate receptor (2);	0.093842	0.64402	D	0.000001	T	0.23688	0.0573	L	0.47190	1.495	0.80722	D	1	D;D;D	0.55172	0.963;0.97;0.963	P;D;P	0.65443	0.893;0.935;0.893	T	0.00664	-1.1620	10	0.59425	D	0.04	.	19.301	0.94144	0.0:0.0:1.0:0.0	.	723;723;723	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	K	723;723;723;647;723;674;498	ENSP00000397026:E723K;ENSP00000405596:E723K;ENSP00000358134:E723K;ENSP00000358133:E647K;ENSP00000313276:E723K;ENSP00000358130:E674K	ENSP00000313276:E723K	E	+	1	0	GRIK2	102589990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.555000	0.86185	0.655000	0.94253	GAA		0.413	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1			Missense_Mutation
HACE1	57531	broad.mit.edu	37	6	105280966	105280966	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr6:105280966G>A	ENST00000262903.4	-	6	761	c.485C>T	c.(484-486)gCc>gTc	p.A162V	HACE1_ENST00000369125.2_Missense_Mutation_p.A162V|RP11-809N15.2_ENST00000422930.2_RNA	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	162					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.A162V(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CTGCCCCATGGCATCCTCAAC	0.468																																																1	Substitution - Missense(1)	ovary(1)	6											177.0	141.0	153.0					6																	105280966		2203	4300	6503	105387659	SO:0001583	missense	57531			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.485C>T	6.37:g.105280966G>A	ENSP00000262903:p.Ala162Val	Unknown		x	x	x	105387659	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777884	0.90195	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000524020	T;T;T	0.71222	-0.55;-0.55;1.57	4.96	4.96	0.65561	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	L	0.35793	1.09	0.80722	D	1	P;D	0.59767	0.856;0.986	B;P	0.58970	0.381;0.849	T	0.71699	-0.4514	10	0.48119	T	0.1	.	18.207	0.89858	0.0:0.0:1.0:0.0	.	162;162	E9PGP0;Q8IYU2	.;HACE1_HUMAN	V	162;162;128	ENSP00000262903:A162V;ENSP00000358121:A162V;ENSP00000427901:A128V	ENSP00000262903:A162V	A	-	2	0	HACE1	105387659	1.000000	0.71417	0.946000	0.38457	0.981000	0.71138	9.392000	0.97252	2.296000	0.77279	0.557000	0.71058	GCC		0.468	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095		Missense_Mutation
SBDS	51119	broad.mit.edu	37	7	66456236	66456236	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1027-01	TCGA-23-1027-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr7:66456236T>A	ENST00000246868.2	-	4	695	c.512A>T	c.(511-513)cAc>cTc	p.H171L		NM_016038.2	NP_057122.2	Q9Y3A5	SBDS_HUMAN	Shwachman-Bodian-Diamond syndrome	171					bone marrow development (GO:0048539)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|inner cell mass cell proliferation (GO:0001833)|leukocyte chemotaxis (GO:0030595)|mature ribosome assembly (GO:0042256)|mitotic spindle stabilization (GO:0043148)|ribosomal large subunit biogenesis (GO:0042273)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)	p.H171L(1)		cervix(1)|endometrium(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7						AAGCCTCATGTGAGCACGTTC	0.383			Gene Conversion			"""AML, MDS"""			Shwachman-Diamond syndrome																													yes	Rec		Schwachman-Diamond syndrome	7	7q11	51119	Shwachman-Bodian-Diamond syndrome protein		L	1	Substitution - Missense(1)	ovary(1)	7											127.0	108.0	114.0					7																	66456236		2203	4300	6503	66093671	SO:0001583	missense	51119	Familial Cancer Database	Shwachman syndrome, Shwachman-Bodian syndrome, Congenital Lipomatosis of the Pancreas	AF151855	CCDS5537.1	7q11.22	2014-09-17			ENSG00000126524	ENSG00000126524			19440	protein-coding gene	gene with protein product		607444				12496757	Standard	NM_016038		Approved	CGI-97, FLJ10917, SDS, SWDS	uc003tvm.1	Q9Y3A5	OTTHUMG00000023165	ENST00000246868.2:c.512A>T	7.37:g.66456236T>A	ENSP00000246868:p.His171Leu	Somatic		x	x	x	66093671	A8K0P4|Q96FX0|Q9NV53	Missense_Mutation	SNP	ENST00000246868.2	37	CCDS5537.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	16.26	3.073284	0.55646	.	.	ENSG00000126524	ENST00000246868	D	0.95788	-3.81	5.04	5.04	0.67666	Ribosome maturation protein SBDS, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	L	0.56769	1.78	0.80722	D	1	B	0.18310	0.027	B	0.27380	0.079	D	0.91656	0.5338	10	0.49607	T	0.09	-24.4632	12.7832	0.57489	0.0:0.0:0.0:1.0	.	171	Q9Y3A5	SBDS_HUMAN	L	171	ENSP00000246868:H171L	ENSP00000246868:H171L	H	-	2	0	SBDS	66093671	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	7.163000	0.77524	2.134000	0.65973	0.454000	0.30748	CAC		0.383	SBDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251746.2	NM_016038		Missense_Mutation
ATP5J2	9551	broad.mit.edu	37	7	99057761	99057761	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr7:99057761C>G	ENST00000292475.3	-	2	276	c.87G>C	c.(85-87)tgG>tgC	p.W29C	ATP5J2-PTCD1_ENST00000437572.1_Intron|ATP5J2_ENST00000449683.1_Missense_Mutation_p.W33C|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.W23C|ATP5J2_ENST00000466753.1_Intron|PTCD1_ENST00000555673.1_Missense_Mutation_p.W23C|ATP5J2_ENST00000394186.3_Missense_Mutation_p.W23C|ATP5J2_ENST00000544611.1_Missense_Mutation_p.W23C|ATP5J2_ENST00000488775.1_Missense_Mutation_p.W23C|ATP5J2_ENST00000359832.4_Missense_Mutation_p.W29C	NM_004889.3	NP_004880.1	P56134	ATPK_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2	29					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|nucleus (GO:0005634)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	transmembrane transporter activity (GO:0022857)	p.W29C(1)		large_intestine(1)|ovary(1)	2	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCATCAAGATCCAGCTTGGCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											173.0	189.0	184.0					7																	99057761		2203	4300	6503	98895697	SO:0001583	missense	9551			AF047436	CCDS5665.1, CCDS34692.1, CCDS47653.1, CCDS47654.1	7q22.1	2012-10-12	2010-06-11		ENSG00000241468	ENSG00000241468		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	848	protein-coding gene	gene with protein product	"""F1Fo-ATPase synthase f subunit"", ""ATP synthase f chain, mitochondrial"", ""F1Fo-ATP synthase complex Fo membrane domain f subunit"""		"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2"""			9653160	Standard	NM_004889		Approved	F1Fo-ATPase, ATP5JL		P56134	OTTHUMG00000154609	ENST00000292475.3:c.87G>C	7.37:g.99057761C>G	ENSP00000292475:p.Trp29Cys	Somatic		x	x	x	98895697	C9J8H9|F8W7V3|O76079|Q6IBB3|Q96L83|Q9BTI8	Missense_Mutation	SNP	ENST00000292475.3	37	CCDS5665.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464416	0.84425	.	.	ENSG00000106246;ENSG00000248919;ENSG00000241468;ENSG00000241468;ENSG00000241468;ENSG00000241468;ENSG00000241468;ENSG00000241468	ENST00000555673;ENST00000413834;ENST00000449683;ENST00000359832;ENST00000292475;ENST00000544611;ENST00000488775;ENST00000394186	D;D;T;T	0.93366	-3.21;-3.21;2.58;2.58	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.96093	0.8727	M	0.62088	1.915	0.58432	D	0.999999	D;D;B;B;B	0.89917	1.0;1.0;0.109;0.345;0.189	D;D;B;B;B	0.91635	0.999;0.999;0.166;0.429;0.182	D	0.96457	0.9338	10	0.66056	D	0.02	.	18.0577	0.89368	0.0:1.0:0.0:0.0	.	23;29;23;29;23	G3V325;F8W7V3;C9J8H9;P56134;P56134-2	.;.;.;ATPK_HUMAN;.	C	23;23;33;29;29;23;23;23	ENSP00000450995:W23C;ENSP00000400168:W23C;ENSP00000407540:W33C;ENSP00000377740:W23C	ENSP00000292475:W29C	W	-	3	0	ATP5J2;ATP5J2-PTCD1;PTCD1	98895697	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	6.847000	0.75404	2.376000	0.81061	0.462000	0.41574	TGG		0.468	ATP5J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336263.1	NM_004889		Missense_Mutation
GPR37	2861	broad.mit.edu	37	7	124404008	124404008	+	Splice_Site	SNP	C	C	G			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr7:124404008C>G	ENST00000303921.2	-	1	1673	c.1023G>C	c.(1021-1023)gaG>gaC	p.E341D		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	341					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.E341D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAGGCATTACCTCTATATAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	7											143.0	158.0	153.0					7																	124404008		2203	4300	6503	124191244	SO:0001630	splice_region_variant	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1023+1G>C	7.37:g.124404008C>G		Unknown		x	x	x	124191244	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814407	0.90790	.	.	ENSG00000170775	ENST00000303921	T	0.36157	1.27	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.50718	0.1632	L	0.38838	1.175	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.35649	-0.9780	9	.	.	.	-35.7224	18.0126	0.89229	0.0:1.0:0.0:0.0	.	341	O15354	GPR37_HUMAN	D	341	ENSP00000306449:E341D	.	E	-	3	2	GPR37	124191244	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.645000	0.83430	2.727000	0.93392	0.643000	0.83706	GAG		0.502	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	Missense_Mutation	Missense_Mutation
KIAA1147	57189	broad.mit.edu	37	7	141363999	141363999	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr7:141363999T>C	ENST00000536163.1	-	8	1144	c.1145A>G	c.(1144-1146)aAc>aGc	p.N382S	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Missense_Mutation_p.N278S	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	382								p.N382S(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					TTCACAAGGGTTGTAGTCTTC	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											65.0	72.0	70.0					7																	141363999		2063	4194	6257	141010468	SO:0001583	missense	57189			AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.1145A>G	7.37:g.141363999T>C	ENSP00000445768:p.Asn382Ser	Unknown		x	x	x	141010468	Q9ULS3	Missense_Mutation	SNP	ENST00000536163.1	37	CCDS47726.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	8.635	0.894500	0.17613	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	6.07	-9.17	0.00691	.	0.366403	0.34002	N	0.004351	T	0.19406	0.0466	N	0.22421	0.69	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.09574	-1.0668	9	0.21540	T	0.41	-10.3646	11.4712	0.50270	0.0:0.4909:0.2718:0.2373	.	382	A4D1U4	LCHN_HUMAN	S	382;278	.	ENSP00000297761:N382S	N	-	2	0	KIAA1147	141010468	0.399000	0.25287	0.469000	0.27204	0.982000	0.71751	-0.378000	0.07446	-1.559000	0.01688	-0.256000	0.11100	AAC		0.567	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1			Missense_Mutation
COL22A1	169044	broad.mit.edu	37	8	139697506	139697506	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1027-01	TCGA-23-1027-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1027-01	TCGA-23-1027-10	g.chr8:139697506T>C	ENST00000303045.6	-	38	3358	c.2912A>G	c.(2911-2913)gAt>gGt	p.D971G	COL22A1_ENST00000435777.1_Missense_Mutation_p.D971G|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	971	Collagen-like 8.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D971G(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGCACCAGGATCTCCCCTGGG	0.602										HNSCC(7;0.00092)																																						1	Substitution - Missense(1)	ovary(1)	8											44.0	45.0	45.0					8																	139697506		2203	4300	6503	139766688	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2912A>G	8.37:g.139697506T>C	ENSP00000303153:p.Asp971Gly	Unknown		x	x	x	139766688	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	7.620	0.676703	0.14841	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93426	-3.22;-3.22	4.63	4.63	0.57726	.	0.486110	0.17081	U	0.187785	D	0.92616	0.7654	M	0.82716	2.605	0.26440	N	0.975786	P;P	0.47253	0.869;0.892	B;B	0.42555	0.271;0.391	D	0.86547	0.1832	10	0.24483	T	0.36	.	10.4009	0.44229	0.0:0.0:0.0:1.0	.	971;971	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	G	971;971;684	ENSP00000303153:D971G;ENSP00000387655:D971G	ENSP00000303153:D971G	D	-	2	0	COL22A1	139766688	0.286000	0.24305	0.570000	0.28473	0.152000	0.21847	2.375000	0.44283	1.958000	0.56883	0.363000	0.22086	GAT		0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257		Missense_Mutation
