#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCC1	4363	hgsc.bcm.edu	37	16	16130332	16130332	+	Silent	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr16:16130332G>A	ENST00000399410.3	+	7	856	c.681G>A	c.(679-681)ttG>ttA	p.L227L	ABCC1_ENST00000399408.2_Silent_p.L227L|ABCC1_ENST00000345148.5_Silent_p.L227L|ABCC1_ENST00000351154.5_Silent_p.L227L|ABCC1_ENST00000346370.5_Silent_p.L227L|ABCC1_ENST00000349029.5_Silent_p.L227L	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	227					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.L227L(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GCCCCAGGTTGATTGTCCGGG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	16											44.0	45.0	45.0					16																	16130332		1928	4134	6062	16037833	SO:0001819	synonymous_variant	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.681G>A	16.37:g.16130332G>A		Somatic		Capture	SOLID	Phase_IV	16037833	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Silent	SNP	ENST00000399410.3	37	CCDS42122.1	SNP	45	Baylor																																																																																				0.582	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		Silent
ACCSL	390110	hgsc.bcm.edu	37	11	44069679	44069679	+	Silent	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr11:44069679G>A	ENST00000378832.1	+	1	149	c.93G>A	c.(91-93)gaG>gaA	p.E31E		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	31					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)	p.E31E(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						AGCTGTTGGAGATAACGCTGC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	11											48.0	53.0	51.0					11																	44069679		2056	4209	6265	44026255	SO:0001819	synonymous_variant	390110				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.93G>A	11.37:g.44069679G>A		Somatic		Capture	SOLID	Phase_IV	44026255		Silent	SNP	ENST00000378832.1	37	CCDS41636.1	SNP	33	Baylor																																																																																				0.602	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854		Silent
CARNS1	57571	hgsc.bcm.edu	37	11	67191291	67191291	+	Missense_Mutation	SNP	C	C	A	rs558376931		TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr11:67191291C>A	ENST00000307823.3	+	9	2155	c.1703C>A	c.(1702-1704)gCg>gAg	p.A568E	CARNS1_ENST00000531040.1_Missense_Mutation_p.A665E|CARNS1_ENST00000423745.2_Missense_Mutation_p.A568E|CARNS1_ENST00000524740.1_3'UTR|CARNS1_ENST00000445895.2_Missense_Mutation_p.A691E	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	568	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GTAGAGGATGCGCCACAGTGC	0.642																																																0			11											43.0	47.0	46.0					11																	67191291		2168	4258	6426	66947867	SO:0001583	missense	57571				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.1703C>A	11.37:g.67191291C>A	ENSP00000308268:p.Ala568Glu	Somatic		Capture	SOLID	Phase_IV	66947867	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	37	CCDS44658.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193361	0.38707	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000423745;ENST00000445895	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.12	1.82	0.25136	ATP-grasp fold (1);ATP-grasp fold, DUF201-type (1);	0.753950	0.11642	N	0.543668	D	0.95242	0.8457	N	0.19112	0.55	0.09310	N	1	D;D	0.59357	0.979;0.985	P;P	0.60949	0.881;0.774	D	0.88812	0.3292	10	0.18276	T	0.48	-9.2588	9.6791	0.40059	0.0:0.4221:0.4944:0.0835	.	568;707	A5YM72;A5YM72-3	CRNS1_HUMAN;.	E	665;568;665;568;691	ENSP00000431670:A665E;ENSP00000308268:A568E;ENSP00000401519:A568E;ENSP00000389009:A691E	ENSP00000308268:A568E	A	+	2	0	CARNS1	66947867	0.006000	0.16342	0.083000	0.20561	0.866000	0.49608	0.062000	0.14389	0.457000	0.26962	0.549000	0.68633	GCG		0.642	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811		Missense_Mutation
BBX	56987	hgsc.bcm.edu	37	3	107435479	107435479	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1028-01	TCGA-23-1028-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr3:107435479T>C	ENST00000325805.8	+	5	475	c.188T>C	c.(187-189)cTa>cCa	p.L63P	BBX_ENST00000416476.2_Missense_Mutation_p.L63P|BBX_ENST00000402543.1_Missense_Mutation_p.L63P|BBX_ENST00000415149.2_Missense_Mutation_p.L63P|BBX_ENST00000406780.1_Missense_Mutation_p.L63P			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	63					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L63P(1)		breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GCCGATGGCCTAGAGCAAGAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											99.0	96.0	97.0					3																	107435479		2203	4300	6503	108918169	SO:0001583	missense	56987			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.188T>C	3.37:g.107435479T>C	ENSP00000319974:p.Leu63Pro	Somatic		Capture	SOLID	Phase_IV	108918169	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	SNP	53	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018213	0.35606	.	.	ENSG00000114439	ENST00000415149;ENST00000402543;ENST00000325805;ENST00000427402;ENST00000416476;ENST00000431630;ENST00000449335;ENST00000456817;ENST00000458458;ENST00000437908;ENST00000456419;ENST00000402163;ENST00000406780;ENST00000413213;ENST00000449271;ENST00000449213;ENST00000457496;ENST00000429270	D;D;D;D;D;D;D;D;D;D;D;D;D	0.98633	-4.57;-4.58;-4.58;-4.95;-5.04;-4.97;-4.96;-5.04;-4.57;-4.39;-1.72;-4.55;-4.56	5.06	3.9	0.45041	.	0.485693	0.21788	N	0.069112	D	0.97554	0.9199	N	0.17082	0.46	0.80722	D	1	B;B;B;D	0.76494	0.036;0.036;0.013;0.999	B;B;B;D	0.83275	0.01;0.01;0.028;0.996	D	0.96491	0.9364	10	0.42905	T	0.14	-7.0966	10.4348	0.44428	0.0:0.0771:0.0:0.9229	.	63;63;63;63	C9JA69;Q8WY36;A2RRM7;Q8WY36-2	.;BBX_HUMAN;.;.	P	63;63;63;63;63;93;63;63;63;63;63;63;63;63;63;63;63;63	ENSP00000408358:L63P;ENSP00000385317:L63P;ENSP00000319974:L63P;ENSP00000413320:L63P;ENSP00000403860:L63P;ENSP00000408297:L63P;ENSP00000413274:L63P;ENSP00000385518:L63P;ENSP00000385530:L63P;ENSP00000403806:L63P;ENSP00000406554:L63P;ENSP00000407662:L63P;ENSP00000414673:L63P	ENSP00000319974:L63P	L	+	2	0	BBX	108918169	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.682000	0.46934	2.028000	0.59812	0.377000	0.23210	CTA		0.408	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235		Missense_Mutation
BTBD9	114781	hgsc.bcm.edu	37	6	38561772	38561772	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr6:38561772G>A	ENST00000481247.1	-	3	668	c.517C>T	c.(517-519)Ctc>Ttc	p.L173F	BTBD9_ENST00000419706.2_Missense_Mutation_p.L114F|BTBD9_ENST00000314100.6_Missense_Mutation_p.L105F|BTBD9_ENST00000408958.1_Missense_Mutation_p.L105F|BTBD9_ENST00000403056.1_Missense_Mutation_p.L173F	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	173	BACK.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)					breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						TCACTTGAGAGGACTTCCTGA	0.383																																																0			6											162.0	161.0	161.0					6																	38561772		1919	4131	6050	38669750	SO:0001583	missense	114781				CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.517C>T	6.37:g.38561772G>A	ENSP00000418751:p.Leu173Phe	Somatic		Capture	SOLID	Phase_IV	38669750	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	ENST00000481247.1	37	CCDS47418.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002378	0.74932	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958;ENST00000497373	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	5.65	5.65	0.86999	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.82986	0.5156	M	0.74467	2.265	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.87578	0.973;0.998	D	0.83599	0.0127	10	0.87932	D	0	.	20.0822	0.97779	0.0:0.0:1.0:0.0	.	114;173	Q494V9;Q96Q07	.;BTBD9_HUMAN	F	105;173;114;173;105;105	ENSP00000323408:L105F;ENSP00000418751:L173F;ENSP00000415365:L114F;ENSP00000386121:L173F;ENSP00000386211:L105F;ENSP00000418201:L105F	ENSP00000323408:L105F	L	-	1	0	BTBD9	38669750	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.533000	0.67160	2.826000	0.97356	0.563000	0.77884	CTC		0.383	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733		Missense_Mutation
CAMK1	8536	hgsc.bcm.edu	37	3	9803325	9803325	+	Silent	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr3:9803325C>T	ENST00000256460.3	-	6	723	c.546G>A	c.(544-546)ccG>ccA	p.P182P	OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302036.7_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	182	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.P182P(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		CCACGTATCCCGGAGTTCCAC	0.602																																																1	Substitution - coding silent(1)	ovary(1)	3											68.0	71.0	70.0					3																	9803325		2203	4300	6503	9778325	SO:0001819	synonymous_variant	8536			L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.546G>A	3.37:g.9803325C>T		Somatic		Capture	SOLID	Phase_IV	9778325	Q3KPF6	Silent	SNP	ENST00000256460.3	37	CCDS2582.1	SNP	23	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.741	0.505513	0.12822	.	.	ENSG00000134072	ENST00000421120	.	.	.	4.78	-9.56	0.00566	.	.	.	.	.	T	0.33527	0.0866	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40365	-0.9567	4	.	.	.	-6.6674	1.7732	0.03016	0.291:0.3574:0.158:0.1937	.	.	.	.	R	29	.	.	G	-	1	0	CAMK1	9778325	0.000000	0.05858	0.851000	0.33527	0.709000	0.40893	-2.773000	0.00778	-1.818000	0.01218	-0.345000	0.07892	GGG		0.602	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656		Silent
CCL17	6361	hgsc.bcm.edu	37	16	57449102	57449102	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1028-01	TCGA-23-1028-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr16:57449102T>A	ENST00000219244.4	+	3	309	c.180T>A	c.(178-180)gaT>gaA	p.D60E		NM_002987.2	NP_002978.1	Q92583	CCL17_HUMAN	chemokine (C-C motif) ligand 17	60					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)	p.D60E(1)		breast(1)|endometrium(1)|lung(2)|ovary(1)	5						GCTCCAGGGATGCCATCGTGT	0.617																																																1	Substitution - Missense(1)	ovary(1)	16											116.0	107.0	110.0					16																	57449102		2198	4300	6498	56006603	SO:0001583	missense	6361			D43767	CCDS10780.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000102970	ENSG00000102970		"""Chemokine ligands"", ""Endogenous ligands"""	10615	protein-coding gene	gene with protein product		601520	"""small inducible cytokine subfamily A (Cys-Cys), member 17"""	SCYA17		8702936, 9070951	Standard	NM_002987		Approved	TARC, ABCD-2	uc002elj.1	Q92583	OTTHUMG00000133468	ENST00000219244.4:c.180T>A	16.37:g.57449102T>A	ENSP00000219244:p.Asp60Glu	Somatic		Capture	SOLID	Phase_IV	56006603	A0N0Q9|Q2M287	Missense_Mutation	SNP	ENST00000219244.4	37	CCDS10780.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.024	-1.387485	0.01194	.	.	ENSG00000102970	ENST00000219244	T	0.04502	3.61	5.06	-10.1	0.00402	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.981306	0.08381	N	0.954619	T	0.01661	0.0053	.	.	.	0.19300	N	0.999978	B	0.21821	0.061	B	0.20767	0.031	T	0.39272	-0.9622	9	0.11182	T	0.66	-0.3954	0.9458	0.01365	0.2948:0.1868:0.3183:0.2001	.	60	Q92583	CCL17_HUMAN	E	60	ENSP00000219244:D60E	ENSP00000219244:D60E	D	+	3	2	CCL17	56006603	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.242000	0.00138	-3.797000	0.00105	-1.646000	0.00762	GAT		0.617	CCL17-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257344.1	NM_002987		Missense_Mutation
CCRL2	9034	hgsc.bcm.edu	37	3	46449636	46449636	+	Silent	SNP	C	C	T	rs200036183		TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr3:46449636C>T	ENST00000399036.3	+	2	418	c.66C>T	c.(64-66)agC>agT	p.S22S	CCRL2_ENST00000400882.2_Silent_p.S22S|CCRL2_ENST00000400880.3_Silent_p.S22S|RP11-24F11.2_ENST00000451485.1_RNA|CCRL2_ENST00000357392.4_Silent_p.S34S	NM_003965.4	NP_003956.2	O00421	CCRL2_HUMAN	chemokine (C-C motif) receptor-like 2	22					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CCR chemokine receptor binding (GO:0048020)|chemokine receptor activity (GO:0004950)|chemokine receptor binding (GO:0042379)	p.S22S(1)		lung(3)|ovary(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)		AACTGGAGAGCGATGAGGCAG	0.522													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20273	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						C	,	5,4233		0,5,2114	74.0	74.0	74.0		102,66	1.9	0.0	3		74	0,8458		0,0,4229	no	coding-synonymous,coding-synonymous	CCRL2	NM_001130910.1,NM_003965.4	,	0,5,6343	TT,TC,CC		0.0,0.118,0.0394	,	34/357,22/345	46449636	5,12691	2119	4229	6348	46424640	SO:0001819	synonymous_variant	9034			AF014958	CCDS43079.1, CCDS46814.1	3p21	2013-07-18	2013-07-18	2013-07-18	ENSG00000121797	ENSG00000121797		"""GPCR / Class A : Chemokine receptors : Atypical"""	1612	protein-coding gene	gene with protein product	"""atypical chemokine receptor 5"""	608379				9473515	Standard	NM_001130910		Approved	HCR, CRAM-B, CKRX, CRAM-A, ACKR5	uc003cpp.4	O00421	OTTHUMG00000156318	ENST00000399036.3:c.66C>T	3.37:g.46449636C>T		Somatic		Capture	SOLID	Phase_IV	46424640	B4DKQ8|O75307|Q4VBB0|Q6IPX0|Q7KYQ9|Q96KP5|Q9UPG0	Silent	SNP	ENST00000399036.3	37	CCDS43079.1	SNP	27	Baylor																																																																																				0.522	CCRL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343909.2			Silent
COMMD5	28991	hgsc.bcm.edu	37	8	146076705	146076705	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr8:146076705C>T	ENST00000305103.3	-	2	271	c.19G>A	c.(19-21)Gca>Aca	p.A7T	ZNF250_ENST00000543949.1_3'UTR|COMMD5_ENST00000450361.2_Missense_Mutation_p.A7T|AF235103.1_ENST00000578937.1_RNA|COMMD5_ENST00000402718.3_Missense_Mutation_p.A7T	NM_014066.3	NP_054785.2	Q9GZQ3	COMD5_HUMAN	COMM domain containing 5	7						nucleus (GO:0005634)		p.A7T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|ovary(1)|pancreas(1)	11	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			TATGGAGTTGCAGCCCCCACA	0.587																																																1	Substitution - Missense(1)	ovary(1)	8											65.0	68.0	67.0					8																	146076705		2203	4300	6503	146047509	SO:0001583	missense	28991			AK023070	CCDS6436.1	8q24.3	2006-11-06				ENSG00000170619			17902	protein-coding gene	gene with protein product		608216				15799966, 10918053	Standard	NM_014066		Approved	HT002, FLJ13008, HCaRG	uc003zem.3	Q9GZQ3		ENST00000305103.3:c.19G>A	8.37:g.146076705C>T	ENSP00000304544:p.Ala7Thr	Somatic		Capture	SOLID	Phase_IV	146047509	D3DWN7|Q9NVN6|Q9UHX5	Missense_Mutation	SNP	ENST00000305103.3	37	CCDS6436.1	SNP	25	Baylor	.	.	.	.	.	.	.	.	.	.	C	9.950	1.219767	0.22373	.	.	ENSG00000170619	ENST00000402718;ENST00000450361;ENST00000305103;ENST00000529143;ENST00000533270	T;T;T;T;T	0.36878	1.25;1.25;1.25;1.23;1.23	4.69	3.8	0.43715	.	0.216830	0.30820	N	0.008812	T	0.32194	0.0821	L	0.57536	1.79	0.50313	D	0.999863	B	0.33826	0.427	B	0.29176	0.099	T	0.17868	-1.0355	10	0.62326	D	0.03	-11.4731	10.3847	0.44132	0.1963:0.8037:0.0:0.0	.	7	Q9GZQ3	COMD5_HUMAN	T	7	ENSP00000385793:A7T;ENSP00000394331:A7T;ENSP00000304544:A7T;ENSP00000435552:A7T;ENSP00000433758:A7T	ENSP00000304544:A7T	A	-	1	0	COMMD5	146047509	0.006000	0.16342	0.006000	0.13384	0.257000	0.26127	0.094000	0.15107	1.078000	0.41014	0.557000	0.71058	GCA		0.587	COMMD5-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382962.1	NM_014066		Missense_Mutation
COMP	1311	hgsc.bcm.edu	37	19	18896323	18896324	+	Frame_Shift_Ins	INS	-	-	GA	rs577011338		TCGA-23-1028-01	TCGA-23-1028-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr19:18896323_18896324insGA	ENST00000222271.2	-	15	1745_1746	c.1701_1702insTC	c.(1699-1704)gacccafs	p.P568fs	COMP_ENST00000425807.1_Frame_Shift_Ins_p.P515fs|COMP_ENST00000542601.2_Frame_Shift_Ins_p.P535fs	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	568	Mediates cell survival and induction of the IAP family of survival proteins.|TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.P568fs*22(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GCCAGGCCTGGGTCGCTGTTCA	0.649																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								18757324	SO:0001589	frameshift_variant	1311			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1701_1702insTC	19.37:g.18896323_18896324insGA	ENSP00000222271:p.Pro568fs	Somatic		Capture	SOLID	Phase_IV	18757323	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Frame_Shift_Ins	INS	ENST00000222271.2	37	CCDS12385.1	INS	43	Baylor																																																																																				0.649	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095		Frame_Shift_Ins
CSPP1	79848	hgsc.bcm.edu	37	8	68105774	68105775	+	Frame_Shift_Ins	INS	-	-	G	rs560351612		TCGA-23-1028-01	TCGA-23-1028-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr8:68105774_68105775insG	ENST00000262210.5	+	28	3422_3423	c.3391_3392insG	c.(3391-3393)agafs	p.R1131fs	ARFGEF1_ENST00000520381.1_Intron|CSPP1_ENST00000521168.1_Intron|CSPP1_ENST00000412460.1_Frame_Shift_Ins_p.R786fs	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1166					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.V1132fs*4(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGATGAGCTTAGAGTGAGAAAT	0.376																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								68268329	SO:0001589	frameshift_variant	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3392dupG	8.37:g.68105775_68105775dupG	ENSP00000262210:p.Arg1131fs	Somatic		Capture	SOLID	Phase_IV	68268328	A6ND63|Q70F00|Q8TBC1	Frame_Shift_Ins	INS	ENST00000262210.5	37	CCDS43744.1	INS	15	Baylor																																																																																				0.376	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		Frame_Shift_Ins
CYFIP1	23191	hgsc.bcm.edu	37	15	22963843	22963843	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr15:22963843G>A	ENST00000313077.7	+	21	2482	c.2357G>A	c.(2356-2358)cGa>cAa	p.R786Q	CYFIP1_ENST00000560848.1_Missense_Mutation_p.R786Q|CYFIP1_ENST00000435939.2_Missense_Mutation_p.R355Q	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.R786Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCGATTGGACGATTTGAAAGT	0.443																																																1	Substitution - Missense(1)	ovary(1)	15											136.0	126.0	129.0					15																	22963843		2203	4300	6503	20515284	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2357G>A	15.37:g.22963843G>A	ENSP00000324549:p.Arg786Gln	Somatic		Capture	SOLID	Phase_IV	20515284		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	SNP	37	Baylor	.	.	.	.	.	.	.	.	.	.	G	30	5.056361	0.93793	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.23950	1.88;1.88	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000018	T	0.58623	0.2135	M	0.84433	2.695	0.80722	D	1	D;D;P	0.76494	0.999;0.973;0.952	D;B;P	0.75484	0.986;0.209;0.647	T	0.62704	-0.6798	10	0.66056	D	0.02	-12.9138	19.9036	0.96999	0.0:0.0:1.0:0.0	.	814;355;786	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	Q	786;814;355	ENSP00000324549:R786Q;ENSP00000405956:R355Q	ENSP00000324549:R786Q	R	+	2	0	CYFIP1	20515284	1.000000	0.71417	0.843000	0.33291	0.799000	0.45148	9.622000	0.98378	2.706000	0.92434	0.655000	0.94253	CGA		0.443	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608		Missense_Mutation
DNAH5	1767	hgsc.bcm.edu	37	5	13763005	13763005	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr5:13763005G>T	ENST00000265104.4	-	60	10211	c.10107C>A	c.(10105-10107)ttC>ttA	p.F3369L	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3369	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.F3369L(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTCTTTTGGGAATTGCTATG	0.368									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											56.0	54.0	55.0					5																	13763005		2203	4300	6503	13816005	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10107C>A	5.37:g.13763005G>T	ENSP00000265104:p.Phe3369Leu	Somatic		Capture	SOLID	Phase_IV	13816005	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095651	0.76870	.	.	ENSG00000039139	ENST00000265104	T	0.78003	-1.14	5.69	2.85	0.33270	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.89476	0.6726	H	0.96142	3.775	0.58432	D	0.999998	D	0.76494	0.999	D	0.77004	0.989	D	0.87559	0.2470	10	0.62326	D	0.03	.	6.1137	0.20114	0.4979:0.0:0.5021:0.0	.	3369	Q8TE73	DYH5_HUMAN	L	3369	ENSP00000265104:F3369L	ENSP00000265104:F3369L	F	-	3	2	DNAH5	13816005	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.372000	0.34261	0.702000	0.31825	0.561000	0.74099	TTC		0.368	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
DNAH5	1767	hgsc.bcm.edu	37	5	13868012	13868012	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr5:13868012C>A	ENST00000265104.4	-	25	4028	c.3924G>T	c.(3922-3924)aaG>aaT	p.K1308N	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1308	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K1308N(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTGCCAGCAGCTTCTCCCAAG	0.428									Kartagener syndrome																																							1	Substitution - Missense(1)	ovary(1)	5											124.0	106.0	112.0					5																	13868012		2203	4300	6503	13921012	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3924G>T	5.37:g.13868012C>A	ENSP00000265104:p.Lys1308Asn	Somatic		Capture	SOLID	Phase_IV	13921012	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.751	0.921381	0.17982	.	.	ENSG00000039139	ENST00000265104	T	0.23348	1.91	5.12	3.35	0.38373	.	0.000000	0.85682	D	0.000000	T	0.18718	0.0449	L	0.52011	1.625	0.49798	D	0.999827	B	0.18610	0.029	B	0.21151	0.033	T	0.07790	-1.0754	10	0.15499	T	0.54	.	4.6134	0.12413	0.1441:0.5523:0.0:0.3036	.	1308	Q8TE73	DYH5_HUMAN	N	1308	ENSP00000265104:K1308N	ENSP00000265104:K1308N	K	-	3	2	DNAH5	13921012	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	0.879000	0.28146	0.578000	0.29487	-0.136000	0.14681	AAG		0.428	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		Missense_Mutation
DSCAM	1826	hgsc.bcm.edu	37	21	41414566	41414566	+	Silent	SNP	A	A	G			TCGA-23-1028-01	TCGA-23-1028-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr21:41414566A>G	ENST00000400454.1	-	32	5895	c.5418T>C	c.(5416-5418)agT>agC	p.S1806S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1806					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGGAGGAGGCACTTTCTGTGG	0.522																																					Melanoma(134;970 1778 1785 21664 32388)											0			21											145.0	136.0	139.0					21																	41414566		2132	4246	6378	40336436	SO:0001819	synonymous_variant	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5418T>C	21.37:g.41414566A>G		Somatic		Capture	SOLID	Phase_IV	40336436	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1	SNP	6	Baylor																																																																																				0.522	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		Silent
FRY	10129	hgsc.bcm.edu	37	13	32731510	32731510	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1028-01	TCGA-23-1028-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr13:32731510G>C	ENST00000380250.3	+	16	2248	c.1752G>C	c.(1750-1752)caG>caC	p.Q584H		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	584						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q584H(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTAATGTACAGATGTTAAACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	13											117.0	108.0	111.0					13																	32731510		1893	4109	6002	31629510	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1752G>C	13.37:g.32731510G>C	ENSP00000369600:p.Gln584His	Somatic		Capture	SOLID	Phase_IV	31629510	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987652	0.35036	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	T	0.26660	1.72	5.41	1.81	0.25067	.	0.060066	0.64402	D	0.000002	T	0.40247	0.1109	L	0.58810	1.83	0.80722	D	1	P	0.46859	0.885	P	0.58130	0.833	T	0.18555	-1.0333	10	0.87932	D	0	.	11.9427	0.52909	0.1788:0.0:0.8212:0.0	.	584	Q5TBA9	FRY_HUMAN	H	584;512	ENSP00000369600:Q584H	ENSP00000267067:Q512H	Q	+	3	2	FRY	31629510	1.000000	0.71417	0.998000	0.56505	0.234000	0.25298	3.460000	0.53028	0.091000	0.17302	-2.789000	0.00116	CAG		0.363	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037		Missense_Mutation
GPR113	165082	hgsc.bcm.edu	37	2	26535951	26535951	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:26535951G>C	ENST00000311519.1	-	10	1512	c.1513C>G	c.(1513-1515)Cca>Gca	p.P505A	GPR113_ENST00000333478.6_Missense_Mutation_p.P306A|GPR113_ENST00000421160.2_Missense_Mutation_p.P436A|GPR113_ENST00000541401.1_Missense_Mutation_p.P108A|GPR113_ENST00000459892.1_5'UTR	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	505					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P306T(1)|p.P306A(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGATCTGTGGCACCTCCTCA	0.587																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	2											101.0	88.0	93.0					2																	26535951		2203	4300	6503	26389455	SO:0001583	missense	165082			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1513C>G	2.37:g.26535951G>C	ENSP00000307831:p.Pro505Ala	Somatic		Capture	SOLID	Phase_IV	26389455	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	SNP	42	Baylor	.	.	.	.	.	.	.	.	.	.	G	10.38	1.332838	0.24167	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.06687	3.27;3.27;3.27;3.27	5.82	4.03	0.46877	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.16727	0.0402	L	0.55481	1.735	0.80722	D	1	P;B;P;B	0.46142	0.846;0.007;0.873;0.007	B;B;P;B	0.56088	0.41;0.017;0.791;0.017	T	0.01136	-1.1440	9	0.35671	T	0.21	-5.0457	9.1166	0.36762	0.1683:0.0:0.8317:0.0	.	436;306;505;108	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	A	108;306;436;505	ENSP00000445729:P108A;ENSP00000327396:P306A;ENSP00000388537:P436A;ENSP00000307831:P505A	ENSP00000307831:P505A	P	-	1	0	GPR113	26389455	0.989000	0.36119	0.506000	0.27664	0.087000	0.18053	2.512000	0.45485	0.817000	0.34445	0.655000	0.94253	CCA		0.587	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835		Missense_Mutation
HAS2	3037	hgsc.bcm.edu	37	8	122641020	122641020	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr8:122641020C>A	ENST00000303924.4	-	2	1098	c.561G>T	c.(559-561)tgG>tgT	p.W187C		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	187					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)	p.W187*(1)|p.W187C(1)	HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TTTTTCCACCCCATTTTTGCA	0.463																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(1)|lung(1)	8											232.0	210.0	217.0					8																	122641020		2203	4300	6503	122710201	SO:0001583	missense	3037			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.561G>T	8.37:g.122641020C>A	ENSP00000306991:p.Trp187Cys	Somatic		Capture	SOLID	Phase_IV	122710201	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	CCDS6335.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113366	0.77210	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.59364	0.27	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.78572	0.4304	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77598	-0.2528	10	0.54805	T	0.06	-11.0399	20.5827	0.99408	0.0:1.0:0.0:0.0	.	187	Q92819	HAS2_HUMAN	C	187	ENSP00000306991:W187C	ENSP00000306991:W187C	W	-	3	0	HAS2	122710201	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.772000	0.85439	2.941000	0.99782	0.655000	0.94253	TGG		0.463	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		Missense_Mutation
IL16	3603	hgsc.bcm.edu	37	15	81571970	81571970	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr15:81571970C>A	ENST00000302987.4	+	7	936	c.936C>A	c.(934-936)caC>caA	p.H312Q	IL16_ENST00000394660.2_Missense_Mutation_p.H312Q			Q14005	IL16_HUMAN	interleukin 16	312	Interaction with GRIN2A.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.H312Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						TGTGCAGCCACCTGTCTCCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	15											37.0	39.0	38.0					15																	81571970		1963	4154	6117	79359025	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.936C>A	15.37:g.81571970C>A	ENSP00000302935:p.His312Gln	Somatic		Capture	SOLID	Phase_IV	79359025	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	10.78	1.447758	0.26074	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000355368;ENST00000302987	T;T	0.10192	2.9;2.9	4.95	1.93	0.25924	PDZ/DHR/GLGF (1);	0.442661	0.19316	N	0.117271	T	0.08223	0.0205	L	0.44542	1.39	0.54753	D	0.999983	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.24977	-1.0145	10	0.21014	T	0.42	.	6.241	0.20791	0.0:0.5049:0.3192:0.1759	.	312;312	Q14005;Q14005-2	IL16_HUMAN;.	Q	312;312;144;312	ENSP00000378155:H312Q;ENSP00000302935:H312Q	ENSP00000302935:H312Q	H	+	3	2	IL16	79359025	0.356000	0.24930	0.942000	0.38095	0.948000	0.59901	0.540000	0.23191	0.235000	0.21160	0.585000	0.79938	CAC		0.617	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217		Missense_Mutation
IL6R	3570	hgsc.bcm.edu	37	1	154420632	154420632	+	Silent	SNP	G	G	T			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr1:154420632G>T	ENST00000368485.3	+	7	1418	c.981G>T	c.(979-981)gtG>gtT	p.V327V	IL6R_ENST00000344086.4_Silent_p.V327V|IL6R_ENST00000507256.1_3'UTR	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	327					acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)	p.V327V(1)	IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	AGAACGAGGTGTCCACCCCCA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	1											108.0	107.0	107.0					1																	154420632		2203	4300	6503	152687256	SO:0001819	synonymous_variant	3570			X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.981G>T	1.37:g.154420632G>T		Somatic		Capture	SOLID	Phase_IV	152687256	A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Silent	SNP	ENST00000368485.3	37	CCDS1067.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.356	-0.131454	0.06753	.	.	ENSG00000160712	ENST00000476006;ENST00000515190	.	.	.	3.33	1.4	0.22301	.	.	.	.	.	T	0.10208	0.0250	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31081	-0.9956	4	.	.	.	12.1515	4.869	0.13622	0.1237:0.2178:0.6585:0.0	.	.	.	.	F	266;130	.	.	C	+	2	0	IL6R	152687256	0.003000	0.15002	0.000000	0.03702	0.150000	0.21749	1.105000	0.31086	0.390000	0.25115	0.655000	0.94253	TGT		0.542	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565		Silent
IQGAP3	128239	hgsc.bcm.edu	37	1	156496299	156496299	+	Silent	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr1:156496299G>A	ENST00000361170.2	-	38	4885	c.4875C>T	c.(4873-4875)aaC>aaT	p.N1625N	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1625					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.N1625N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAAACTTCTTGTTGAGGAGGA	0.493																																																1	Substitution - coding silent(1)	ovary(1)	1											109.0	91.0	97.0					1																	156496299		2203	4300	6503	154762923	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4875C>T	1.37:g.156496299G>A		Somatic		Capture	SOLID	Phase_IV	154762923	Q5T3H8	Silent	SNP	ENST00000361170.2	37	CCDS1144.1	SNP	48	Baylor																																																																																				0.493	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229		Silent
ITGA8	8516	hgsc.bcm.edu	37	10	15720743	15720743	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr10:15720743C>A	ENST00000378076.3	-	5	961	c.608G>T	c.(607-609)gGa>gTa	p.G203V		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	203					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)	p.G203V(1)		NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						CAGACTAAATCCTGCTTGGCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	10											92.0	96.0	94.0					10																	15720743		2203	4300	6503	15760749	SO:0001583	missense	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.608G>T	10.37:g.15720743C>A	ENSP00000367316:p.Gly203Val	Somatic		Capture	SOLID	Phase_IV	15760749	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953068	0.92660	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.20463	2.07	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.63200	0.2491	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75668	-0.3238	10	0.87932	D	0	.	19.6746	0.95926	0.0:1.0:0.0:0.0	.	203;203	F5H818;P53708	.;ITA8_HUMAN	V	203	ENSP00000367316:G203V	ENSP00000367316:G203V	G	-	2	0	ITGA8	15760749	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.676000	0.74498	2.654000	0.90174	0.655000	0.94253	GGA		0.363	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638		Missense_Mutation
KCNB1	3745	hgsc.bcm.edu	37	20	47990775	47990775	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr20:47990775C>A	ENST00000371741.4	-	2	1488	c.1322G>T	c.(1321-1323)aGg>aTg	p.R441M		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	441					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GCTGCCATTCCTCTTGGCTCT	0.473																																																0			20											144.0	135.0	138.0					20																	47990775		2203	4300	6503	47424182	SO:0001583	missense	3745			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1322G>T	20.37:g.47990775C>A	ENSP00000360806:p.Arg441Met	Somatic		Capture	SOLID	Phase_IV	47424182	Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	CCDS13418.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400019	0.62177	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	D	0.96830	-4.14	5.77	5.77	0.91146	.	0.101916	0.64402	D	0.000007	D	0.97932	0.9320	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	D	0.98266	1.0501	10	0.87932	D	0	.	19.9576	0.97228	0.0:1.0:0.0:0.0	.	441	Q14721	KCNB1_HUMAN	M	441;396	ENSP00000360806:R441M	ENSP00000360806:R441M	R	-	2	0	KCNB1	47424182	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.986000	0.70563	2.884000	0.98904	0.655000	0.94253	AGG		0.473	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975		Missense_Mutation
KIAA1841	84542	hgsc.bcm.edu	37	2	61315323	61315324	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-23-1028-01	TCGA-23-1028-10	TG	TG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:61315323_61315324delTG	ENST00000402291.1	+	9	1161_1162	c.920_921delTG	c.(919-921)ctgfs	p.L307fs	KIAA1841_ENST00000453873.1_Frame_Shift_Del_p.L307fs|KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000356719.2_Frame_Shift_Del_p.L307fs|KIAA1841_ENST00000295031.5_Frame_Shift_Del_p.L307fs	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	307								p.F308fs*1(1)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			ATTGAAAGACTGTTTGATCCTG	0.302																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								61168828	SO:0001589	frameshift_variant	84542			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.920_921delTG	2.37:g.61315323_61315324delTG	ENSP00000385579:p.Leu307fs	Somatic		Capture	SOLID	Phase_IV	61168827	Q49AF0|Q6ZND0|Q96JI6	Frame_Shift_Del	DEL	ENST00000402291.1	37	CCDS46296.1	DEL	55	Baylor																																																																																				0.302	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506		Frame_Shift_Del
KRT27	342574	hgsc.bcm.edu	37	17	38936007	38936008	+	Frame_Shift_Ins	INS	-	-	A			TCGA-23-1028-01	TCGA-23-1028-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr17:38936007_38936008insA	ENST00000301656.3	-	4	830_831	c.790_791insT	c.(790-792)tacfs	p.Y264fs	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27									p.Y264fs*29(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				GAGGGCTTCGTACTCAGCTCGC	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								36189534	SO:0001589	frameshift_variant	342574			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.791dupT	17.37:g.38936008_38936008dupA	ENSP00000301656:p.Tyr264fs	Somatic		Capture	SOLID	Phase_IV	36189533		Frame_Shift_Ins	INS	ENST00000301656.3	37	CCDS11375.1	INS	57	Baylor																																																																																				0.629	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537		Frame_Shift_Ins
LRP1	4035	hgsc.bcm.edu	37	12	57552345	57552345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1028-01	TCGA-23-1028-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr12:57552345C>A	ENST00000243077.3	+	11	2188	c.1722C>A	c.(1720-1722)taC>taA	p.Y574*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	574					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.Y574*(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCTTCATCTACTTTGCCGACA	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	12											94.0	78.0	83.0					12																	57552345		2203	4300	6503	55838612	SO:0001587	stop_gained	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1722C>A	12.37:g.57552345C>A	ENSP00000243077:p.Tyr574*	Somatic		Capture	SOLID	Phase_IV	55838612	Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	43	9.927459	0.99298	.	.	ENSG00000123384	ENST00000243077	.	.	.	4.3	2.49	0.30216	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5353	0.33360	0.0:0.8088:0.0:0.1912	.	.	.	.	X	574	.	ENSP00000243077:Y574X	Y	+	3	2	LRP1	55838612	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.465000	0.45075	0.772000	0.33382	0.561000	0.74099	TAC		0.582	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332		Nonsense_Mutation
LRRC36	55282	hgsc.bcm.edu	37	16	67405071	67405071	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr16:67405071G>A	ENST00000329956.6	+	9	1439	c.1420G>A	c.(1420-1422)Gga>Aga	p.G474R	LRRC36_ENST00000541146.1_5'UTR|LRRC36_ENST00000435835.3_Missense_Mutation_p.G353R|LRRC36_ENST00000563189.1_Missense_Mutation_p.G353R|LRRC36_ENST00000290940.7_Missense_Mutation_p.G206R	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	474										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		ATCGAAGAGAGGATTCAAATG	0.468																																																0			16											148.0	134.0	139.0					16																	67405071		2198	4300	6498	65962572	SO:0001583	missense	55282			BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.1420G>A	16.37:g.67405071G>A	ENSP00000329943:p.Gly474Arg	Somatic		Capture	SOLID	Phase_IV	65962572	A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	ENST00000329956.6	37	CCDS32467.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412642	0.83340	.	.	ENSG00000159708	ENST00000329956;ENST00000290940;ENST00000435835	T;T;T	0.58797	2.63;0.31;0.98	5.84	5.84	0.93424	.	0.217769	0.32161	N	0.006485	T	0.72028	0.3410	L	0.53249	1.67	0.36969	D	0.893727	D;D;D;D	0.89917	0.989;0.989;1.0;0.989	D;D;D;P	0.75484	0.939;0.939;0.986;0.85	T	0.76984	-0.2756	10	0.87932	D	0	-11.5594	15.638	0.76970	0.0:0.0:1.0:0.0	.	353;206;353;474	B7Z7B3;Q9NV11;Q1X8D7-2;Q1X8D7	.;.;.;LRC36_HUMAN	R	474;206;353	ENSP00000329943:G474R;ENSP00000290940:G206R;ENSP00000411122:G353R	ENSP00000290940:G206R	G	+	1	0	LRRC36	65962572	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.749000	0.62155	2.779000	0.95612	0.655000	0.94253	GGA		0.468	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421770.1	NM_018296		Missense_Mutation
MAP3K10	4294	hgsc.bcm.edu	37	19	40720904	40720904	+	Missense_Mutation	SNP	G	G	A	rs368709344		TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr19:40720904G>A	ENST00000253055.3	+	10	2858	c.2570G>A	c.(2569-2571)cGc>cAc	p.R857H		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	857					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)	p.R857H(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GACTTCCCCCGCCTGCCCGAC	0.677																																																1	Substitution - Missense(1)	ovary(1)	19						G	HIS/ARG	1,4363		0,1,2181	20.0	19.0	20.0		2570	3.5	1.0	19		20	0,8512		0,0,4256	no	missense	MAP3K10	NM_002446.3	29	0,1,6437	AA,AG,GG		0.0,0.0229,0.0078	benign	857/955	40720904	1,12875	2182	4256	6438	45412744	SO:0001583	missense	4294			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2570G>A	19.37:g.40720904G>A	ENSP00000253055:p.Arg857His	Somatic		Capture	SOLID	Phase_IV	45412744	Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	37	CCDS12549.1	SNP	38	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.55	2.272036	0.40194	2.29E-4	0.0	ENSG00000130758	ENST00000253055	T	0.78364	-1.17	4.5	3.46	0.39613	.	0.113352	0.64402	N	0.000009	T	0.69984	0.3172	L	0.52573	1.65	0.44890	D	0.9979	B	0.14438	0.01	B	0.08055	0.003	T	0.66548	-0.5896	10	0.45353	T	0.12	.	10.269	0.43473	0.0975:0.0:0.9025:0.0	.	857	Q02779	M3K10_HUMAN	H	857	ENSP00000253055:R857H	ENSP00000253055:R857H	R	+	2	0	MAP3K10	45412744	1.000000	0.71417	0.999000	0.59377	0.550000	0.35303	5.602000	0.67612	1.117000	0.41842	0.511000	0.50034	CGC		0.677	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446		Missense_Mutation
MCCC2	64087	hgsc.bcm.edu	37	5	70900297	70900297	+	Splice_Site	SNP	T	T	C			TCGA-23-1028-01	TCGA-23-1028-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr5:70900297T>C	ENST00000340941.6	+	6	753		c.e6+2		MCCC2_ENST00000510895.2_Splice_Site|MCCC2_ENST00000509358.2_Splice_Site|MCCC2_ENST00000323375.8_Splice_Site	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.?(1)		endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ATTGCACAGGTAATTTTTCAT	0.358																																																1	Unknown(1)	ovary(1)	5											92.0	87.0	88.0					5																	70900297		2203	4300	6503	70936053	SO:0001630	splice_region_variant	64087			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.624+2T>C	5.37:g.70900297T>C		Somatic		Capture	SOLID	Phase_IV	70936053	A6NIY9|Q96C27|Q9Y4L7	Splice_Site_SNP	SNP	ENST00000340941.6	37	CCDS34184.1	SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098115	0.56183	.	.	ENSG00000131844	ENST00000340941;ENST00000509358;ENST00000323375	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7865	0.69808	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MCCC2	70936053	1.000000	0.71417	0.997000	0.53966	0.632000	0.37999	7.430000	0.80321	2.182000	0.69389	0.456000	0.33151	.		0.358	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		Intron	Splice_Site_SNP
MFSD6	54842	hgsc.bcm.edu	37	2	191301317	191301317	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1028-01	TCGA-23-1028-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:191301317T>G	ENST00000392328.1	+	3	886	c.562T>G	c.(562-564)Ttc>Gtc	p.F188V	MFSD6_ENST00000281416.7_Missense_Mutation_p.F188V	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	188					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.F188V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CTTTACCTCTTTCCTCACCAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											82.0	91.0	87.0					2																	191301317		2203	4300	6503	191009562	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.562T>G	2.37:g.191301317T>G	ENSP00000376141:p.Phe188Val	Somatic		Capture	SOLID	Phase_IV	191009562	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	CCDS2306.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	0.147	-1.095460	0.01858	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.29142	1.58;1.58	5.29	-0.272	0.12919	Major facilitator superfamily domain, general substrate transporter (1);	0.928689	0.09281	N	0.823667	T	0.17323	0.0416	L	0.36672	1.1	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.33317	-0.9873	10	0.12766	T	0.61	-0.0482	1.6266	0.02724	0.1695:0.3953:0.1743:0.2608	.	188	Q6ZSS7	MFSD6_HUMAN	V	188	ENSP00000376141:F188V;ENSP00000281416:F188V	ENSP00000281416:F188V	F	+	1	0	MFSD6	191009562	0.185000	0.23213	0.018000	0.16275	0.247000	0.25773	0.319000	0.19522	0.047000	0.15862	0.528000	0.53228	TTC		0.433	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1			Missense_Mutation
MYEOV	26579	hgsc.bcm.edu	37	11	69063572	69063572	+	Missense_Mutation	SNP	A	A	G	rs17856376	byFrequency	TCGA-23-1028-01	TCGA-23-1028-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr11:69063572A>G	ENST00000308946.3	+	3	1105	c.655A>G	c.(655-657)Atg>Gtg	p.M219V	MYEOV_ENST00000535407.1_Missense_Mutation_p.M161V|MYEOV_ENST00000441339.2_Missense_Mutation_p.M219V	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	219				M -> V (in Ref. 3; AAH11815). {ECO:0000305}.						endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		GGCACTCTGCATGACCCTGGC	0.637													A|||	1163	0.232228	0.5461	0.0865	5008	,	,		17519	0.2183		0.0596	False		,,,				2504	0.1033															0			11						A	VAL/MET	2052,2348	567.8+/-382.2	475,1102,623	92.0	91.0	91.0		655	-2.9	0.0	11	dbSNP_123	91	560,8028	151.3+/-206.1	22,516,3756	yes	missense	MYEOV	NM_138768.2	21	497,1618,4379	GG,GA,AA		6.5207,46.6364,20.1109	benign	219/314	69063572	2612,10376	2200	4294	6494	68820148	SO:0001583	missense	26579			AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.655A>G	11.37:g.69063572A>G	ENSP00000308330:p.Met219Val	Somatic		Capture	SOLID	Phase_IV	68820148	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	SNP	8	Baylor	465	0.2129120879120879	240	0.4878048780487805	29	0.08011049723756906	152	0.26573426573426573	44	0.05804749340369393	A	1.216	-0.628404	0.03610	0.466364	0.065207	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.19669	2.13;2.13;2.13	1.44	-2.88	0.05682	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46693	-0.9173	8	0.87932	D	0	.	6.1583	0.20350	0.4925:0.0:0.5075:0.0	rs17856376	219	Q96EZ4	MYEOV_HUMAN	V	219;219;161	ENSP00000412482:M219V;ENSP00000308330:M219V;ENSP00000438100:M161V	ENSP00000308330:M219V	M	+	1	0	MYEOV	68820148	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.125000	0.10579	-1.138000	0.02884	-0.589000	0.04120	ATG		0.637	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1			Missense_Mutation
KAT6B	23522	hgsc.bcm.edu	37	10	76781770	76781770	+	Silent	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr10:76781770C>T	ENST00000287239.4	+	16	3642	c.3153C>T	c.(3151-3153)agC>agT	p.S1051S	KAT6B_ENST00000372724.1_Silent_p.S759S|RP11-77G23.5_ENST00000436608.1_RNA|KAT6B_ENST00000372711.1_Silent_p.S868S|RP11-77G23.2_ENST00000413431.1_RNA|KAT6B_ENST00000372714.1_Silent_p.S759S|KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372725.1_Silent_p.S759S	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1051					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S1051S(1)									CCCCGGAGAGCCGGCCAGTCA	0.512											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	10											37.0	39.0	39.0					10																	76781770		2203	4300	6503	76451776	SO:0001819	synonymous_variant	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3153C>T	10.37:g.76781770C>T		Somatic	1170	Capture	SOLID	Phase_IV	76451776	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1	SNP	26	Baylor																																																																																				0.512	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		Silent
KAT6B	23522	hgsc.bcm.edu	37	10	76781906	76781908	+	In_Frame_Del	DEL	GAA	GAA	-	rs72074375|rs144154275|rs371512199|rs79644703|rs559824889|rs71929101	byFrequency	TCGA-23-1028-01	TCGA-23-1028-10	GAA	GAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr10:76781906_76781908delGAA	ENST00000287239.4	+	16	3778_3780	c.3289_3291delGAA	c.(3289-3291)gaadel	p.E1104del	KAT6B_ENST00000372724.1_In_Frame_Del_p.E812del|RP11-77G23.5_ENST00000436608.1_RNA|KAT6B_ENST00000372711.1_In_Frame_Del_p.E921del|RP11-77G23.2_ENST00000413431.1_RNA|KAT6B_ENST00000372714.1_In_Frame_Del_p.E812del|KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372725.1_In_Frame_Del_p.E812del	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1104	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1097E(4)|p.E1097delE(1)									ggaagaagaggaagaagaagaag	0.448											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		2297	0.458666	0.8464	0.2867	5008	,	,		18417	0.373		0.1133	False		,,,				2504	0.5															5	Substitution - coding silent(4)|Deletion - In frame(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)	10																																								76451914	SO:0001651	inframe_deletion	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3289_3291delGAA	10.37:g.76781915_76781917delGAA	ENSP00000287239:p.Glu1104del	Somatic	1170	Capture	SOLID	Phase_IV	76451912	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	In_Frame_Del	DEL	ENST00000287239.4	37	CCDS7345.1	DEL	41	Baylor																																																																																				0.448	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330		In_Frame_Del
NCR2	9436	hgsc.bcm.edu	37	6	41304034	41304034	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr6:41304034G>C	ENST00000373089.5	+	2	350	c.262G>C	c.(262-264)Gat>Cat	p.D88H	NCR2_ENST00000373083.4_Missense_Mutation_p.D88H|NCR2_ENST00000373086.3_Missense_Mutation_p.D88H	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	88	Ig-like.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.D88H(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					GGACGACCCTGATGCTGGCTT	0.512																																																1	Substitution - Missense(1)	ovary(1)	6											79.0	75.0	76.0					6																	41304034		2203	4300	6503	41412012	SO:0001583	missense	9436			AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.262G>C	6.37:g.41304034G>C	ENSP00000362181:p.Asp88His	Somatic		Capture	SOLID	Phase_IV	41412012	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Missense_Mutation	SNP	ENST00000373089.5	37	CCDS4855.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.489	1.100204	0.20552	.	.	ENSG00000096264	ENST00000373083;ENST00000373089;ENST00000373086	T;T;T	0.66638	-0.22;-0.22;-0.22	4.39	-3.89	0.04193	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32882	0.0844	L	0.33339	1.005	0.09310	N	1	B;B;B	0.18741	0.03;0.03;0.005	B;B;B	0.21917	0.037;0.037;0.01	T	0.43556	-0.9384	9	0.51188	T	0.08	.	11.4161	0.49954	0.8363:0.0:0.1637:0.0	.	88;88;88	O95944-3;O95944-2;O95944	.;.;NCTR2_HUMAN	H	88	ENSP00000362175:D88H;ENSP00000362181:D88H;ENSP00000362178:D88H	ENSP00000362175:D88H	D	+	1	0	NCR2	41412012	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-1.493000	0.02298	-0.712000	0.04988	0.655000	0.94253	GAT		0.512	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3			Missense_Mutation
NF1	4763	hgsc.bcm.edu	37	17	29654578	29654581	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-23-1028-01	TCGA-23-1028-10	TCTT	TCTT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr17:29654578_29654581delTCTT	ENST00000358273.4	+	38	5713_5716	c.5330_5333delTCTT	c.(5329-5334)gtctttfs	p.VF1777fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.VF1756fs|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1777	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.F1778fs*1(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGGCAATCAGTCTTTCTAAATGAC	0.456			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17	GRCh37	CI032156	NF1	I																																				26678707	SO:0001589	frameshift_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5330_5333delTCTT	17.37:g.29654578_29654581delTCTT	ENSP00000351015:p.Val1777fs	Somatic		Capture	SOLID	Phase_IV	26678704	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1	DEL	58	Baylor																																																																																				0.456	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Frame_Shift_Del
POM121	9883	hgsc.bcm.edu	37	7	72420389	72420393	+	3'UTR	DEL	GGTTC	GGTTC	-			TCGA-23-1028-01	TCGA-23-1028-10	GGTTC	GGTTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr7:72420389_72420393delGGTTC	ENST00000395270.1	+	0	5421_5425				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.N66fs*7(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACTCACCCTTGGTTCTTCAGAAGAG	0.541																																																1	Deletion - Frameshift(1)	ovary(1)	7																																								72058329	SO:0001624	3_prime_UTR_variant	260294			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*1384GGTTC>-	7.37:g.72420389_72420393delGGTTC		Somatic		Capture	SOLID	Phase_IV	72058325	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Frame_Shift_Del	DEL	ENST00000395270.1	37	CCDS59059.1	DEL	47	Baylor																																																																																				0.541	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1			Frame_Shift_Del
OAS3	4940	hgsc.bcm.edu	37	12	113379415	113379415	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr12:113379415G>T	ENST00000228928.7	+	2	397	c.218G>T	c.(217-219)tGt>tTt	p.C73F	OAS3_ENST00000546638.1_Intron|OAS3_ENST00000548514.1_Missense_Mutation_p.C73F|RP1-71H24.1_ENST00000552784.1_RNA|OAS3_ENST00000551007.1_Missense_Mutation_p.C73F	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	73	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)	p.C73F(1)		breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						AAGGGTGGCTGTGATTCTGAA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											84.0	87.0	86.0					12																	113379415		1936	4122	6058	111863798	SO:0001583	missense	4940			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.218G>T	12.37:g.113379415G>T	ENSP00000228928:p.Cys73Phe	Somatic		Capture	SOLID	Phase_IV	111863798	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	37	CCDS44981.1	SNP	48	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174679	0.38413	.	.	ENSG00000111331	ENST00000228928;ENST00000551007;ENST00000548514;ENST00000323881	T;T;T	0.07021	3.23;3.23;3.23	3.69	0.583	0.17417	2-5-oligoadenylate synthetase, N-terminal (1);2-5-oligoadenylate synthetase, conserved site (1);	.	.	.	.	T	0.20129	0.0484	L	0.61218	1.895	0.09310	N	1	P;D;D	0.76494	0.561;0.999;0.999	B;D;D	0.74348	0.086;0.983;0.977	T	0.08066	-1.0740	9	0.87932	D	0	.	5.5372	0.17018	0.1207:0.4202:0.4591:0.0	.	73;73;73	Q9Y6K5;F8VS35;F8VWK9	OAS3_HUMAN;.;.	F	73	ENSP00000228928:C73F;ENSP00000449299:C73F;ENSP00000448388:C73F	ENSP00000228928:C73F	C	+	2	0	OAS3	111863798	0.001000	0.12720	0.000000	0.03702	0.928000	0.56348	-0.050000	0.11904	0.007000	0.14760	0.561000	0.74099	TGT		0.542	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1			Missense_Mutation
OR6T1	219874	hgsc.bcm.edu	37	11	123814385	123814385	+	Missense_Mutation	SNP	C	C	T	rs368321030		TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr11:123814385C>T	ENST00000321252.2	-	1	195	c.161G>A	c.(160-162)cGc>cAc	p.R54H		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R54H(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TATGTGCAGGCGTTGGTCTAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	11						T	HIS/ARG	0,4404		0,0,2202	133.0	123.0	126.0		161	-1.4	0.0	11		126	1,8597	1.2+/-3.3	0,1,4298	no	missense	OR6T1	NM_001005187.1	29	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign	54/324	123814385	1,13001	2202	4299	6501	123319595	SO:0001583	missense	219874			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.161G>A	11.37:g.123814385C>T	ENSP00000325203:p.Arg54His	Somatic		Capture	SOLID	Phase_IV	123319595	Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	37	CCDS31700.1	SNP	27	Baylor	.	.	.	.	.	.	.	.	.	.	c	0.018	-1.475526	0.01035	0.0	1.16E-4	ENSG00000181499	ENST00000321252	T	0.00476	7.15	4.26	-1.42	0.08913	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00241	0.0007	N	0.21583	0.68	0.09310	N	1	B	0.21225	0.053	B	0.17979	0.02	T	0.37384	-0.9708	9	0.02654	T	1	-19.5441	4.9088	0.13811	0.0:0.3514:0.1601:0.4885	.	54	Q8NGN1	OR6T1_HUMAN	H	54	ENSP00000325203:R54H	ENSP00000325203:R54H	R	-	2	0	OR6T1	123319595	0.000000	0.05858	0.002000	0.10522	0.028000	0.11728	-2.850000	0.00732	-0.266000	0.09339	-0.119000	0.15052	CGC		0.493	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	NM_001005187		Missense_Mutation
PAFAH2	5051	hgsc.bcm.edu	37	1	26299186	26299186	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr1:26299186C>T	ENST00000374282.3	-	10	1126	c.947G>A	c.(946-948)aGt>aAt	p.S316N	PAFAH2_ENST00000374284.1_Missense_Mutation_p.S316N	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	316					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)	p.S316N(1)		NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		GTCAGTTTGACTCCGATGAAC	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	56.0	57.0					1																	26299186		2203	4300	6503	26171773	SO:0001583	missense	5051			D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.947G>A	1.37:g.26299186C>T	ENSP00000363400:p.Ser316Asn	Somatic		Capture	SOLID	Phase_IV	26171773	D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	ENST00000374282.3	37	CCDS270.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.84	1.757475	0.31137	.	.	ENSG00000158006	ENST00000374282;ENST00000374284	T;T	0.48522	0.81;0.81	5.68	4.77	0.60923	.	0.068000	0.64402	N	0.000007	T	0.33147	0.0853	N	0.21508	0.67	0.39705	D	0.971247	B	0.19331	0.035	B	0.20767	0.031	T	0.13548	-1.0505	10	0.27082	T	0.32	-7.3595	11.7053	0.51593	0.0:0.9174:0.0:0.0826	.	316	Q99487	PAFA2_HUMAN	N	316	ENSP00000363400:S316N;ENSP00000363402:S316N	ENSP00000363400:S316N	S	-	2	0	PAFAH2	26171773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.735000	0.55044	1.419000	0.47118	0.555000	0.69702	AGT		0.498	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019544.1	NM_000437		Missense_Mutation
PHKG2	5261	hgsc.bcm.edu	37	16	30768418	30768418	+	Silent	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr16:30768418G>A	ENST00000563588.1	+	10	1460	c.1221G>A	c.(1219-1221)taG>taA	p.*407*	PHKG2_ENST00000424889.3_Intron|PHKG2_ENST00000328273.7_Silent_p.*411*	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	0					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.*407*(1)		ovary(1)|skin(1)	2			Colorectal(24;0.198)			TGCTGGGCTAGGACCTCAACC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	16											53.0	59.0	57.0					16																	30768418		2193	4299	6492	30675919	SO:0001819	synonymous_variant	5261			S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.1221G>A	16.37:g.30768418G>A		Somatic		Capture	SOLID	Phase_IV	30675919	A8K0C7|B4DEB7|E9PEU3|P11800	Silent	SNP	ENST00000563588.1	37	CCDS10690.1	SNP	35	Baylor																																																																																				0.592	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255531.2	NM_000294		Silent
GSAP	54103	hgsc.bcm.edu	37	7	76950105	76950105	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr7:76950105C>T	ENST00000257626.7	-	26	2104	c.2026G>A	c.(2026-2028)Gtt>Att	p.V676I	GSAP_ENST00000440473.1_5'UTR|GSAP_ENST00000441833.2_5'UTR	NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	676					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)	p.V676I(1)									ATGTGAAAAACTGCAAATTCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	73.0	73.0					7																	76950105		1912	4129	6041	76788041	SO:0001583	missense	54103				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.2026G>A	7.37:g.76950105C>T	ENSP00000257626:p.Val676Ile	Somatic		Capture	SOLID	Phase_IV	76788041	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944624	0.73672	.	.	ENSG00000186088	ENST00000257626;ENST00000415112	T;T	0.32272	1.46;1.46	5.76	4.88	0.63580	.	0.127905	0.53938	N	0.000045	T	0.39759	0.1090	M	0.67953	2.075	0.80722	D	1	P	0.46859	0.885	P	0.48189	0.57	T	0.22871	-1.0204	10	0.41790	T	0.15	.	11.9472	0.52934	0.0:0.9184:0.0:0.0816	.	676	A4D1B5	GSAP_HUMAN	I	676;129	ENSP00000257626:V676I;ENSP00000396230:V129I	ENSP00000257626:V676I	V	-	1	0	PION	76788041	0.956000	0.32656	0.883000	0.34634	0.896000	0.52359	2.075000	0.41538	1.423000	0.47198	0.655000	0.94253	GTT		0.423	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439		Missense_Mutation
PLXNC1	10154	hgsc.bcm.edu	37	12	94641843	94641843	+	Silent	SNP	G	G	T			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr12:94641843G>T	ENST00000258526.4	+	13	2802	c.2553G>T	c.(2551-2553)gtG>gtT	p.V851V		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	851					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.V851V(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GGTATCGGGTGGAATCCGAGG	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											86.0	78.0	81.0					12																	94641843		2203	4300	6503	93165974	SO:0001819	synonymous_variant	10154			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2553G>T	12.37:g.94641843G>T		Somatic		Capture	SOLID	Phase_IV	93165974	Q59H25	Silent	SNP	ENST00000258526.4	37	CCDS9049.1	SNP	47	Baylor																																																																																				0.507	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			Silent
PRTN3	5657	hgsc.bcm.edu	37	19	847909	847909	+	Silent	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr19:847909C>T	ENST00000234347.5	+	5	757	c.711C>T	c.(709-711)gcC>gcT	p.A237A	PRTN3_ENST00000544537.2_Silent_p.A196A	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	237	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A237A(1)		lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGGGTAGCCCTCTACGTGG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											70.0	53.0	59.0					19																	847909		2202	4300	6502	798909	SO:0001819	synonymous_variant	5657				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.711C>T	19.37:g.847909C>T		Somatic		Capture	SOLID	Phase_IV	798909	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Silent	SNP	ENST00000234347.5	37	CCDS32860.1	SNP	22	Baylor																																																																																				0.652	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457888.2	NM_002777		Silent
RAD51	5888	hgsc.bcm.edu	37	15	41001312	41001312	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr15:41001312C>T	ENST00000267868.3	+	5	701	c.433C>T	c.(433-435)Cag>Tag	p.Q145*	RAD51_ENST00000532743.1_Nonsense_Mutation_p.Q146*|RAD51_ENST00000423169.2_Nonsense_Mutation_p.Q145*|RAD51_ENST00000382643.3_Nonsense_Mutation_p.Q146*|RAD51_ENST00000557850.1_Intron	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	145					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.Q145*(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		TGTCACCTGCCAGGTGAGCTG	0.438								Homologous recombination																																								1	Substitution - Nonsense(1)	ovary(1)	15											84.0	79.0	80.0					15																	41001312		2203	4300	6503	38788604	SO:0001587	stop_gained	5888			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.433C>T	15.37:g.41001312C>T	ENSP00000267868:p.Gln145*	Somatic		Capture	SOLID	Phase_IV	38788604	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Nonsense_Mutation	SNP	ENST00000267868.3	37	CCDS10062.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	38	6.717808	0.97784	.	.	ENSG00000051180	ENST00000527860;ENST00000423169;ENST00000267868;ENST00000532743;ENST00000382643	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.7379	19.4904	0.95048	0.0:1.0:0.0:0.0	.	.	.	.	X	145;145;145;146;146	.	ENSP00000267868:Q145X	Q	+	1	0	RAD51	38788604	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.618000	0.83043	2.708000	0.92522	0.561000	0.74099	CAG		0.438	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252358.1	NM_002875, NM_133487		Nonsense_Mutation
RAD9A	5883	hgsc.bcm.edu	37	11	67164680	67164680	+	Silent	SNP	C	C	T	rs543261832		TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr11:67164680C>T	ENST00000307980.2	+	10	996	c.903C>T	c.(901-903)gaC>gaT	p.D301D	RAD9A_ENST00000535644.1_3'UTR|PPP1CA_ENST00000532446.1_5'Flank|RNU6-1238P_ENST00000517215.1_RNA	NM_001243224.1|NM_004584.2	NP_001230153.1|NP_004575.1	Q99638	RAD9A_HUMAN	RAD9 homolog A (S. pombe)	301	Sufficient for interaction with ABL1.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|enzyme binding (GO:0019899)|exodeoxyribonuclease III activity (GO:0008853)|histone deacetylase binding (GO:0042826)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			lung(7)|upper_aerodigestive_tract(1)	8			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			TTGCCAATGACGACATTGACT	0.612								Other conserved DNA damage response genes					C|||	1	0.000199681	0.0	0.0014	5008	,	,		12478	0.0		0.0	False		,,,				2504	0.0															0			11											60.0	55.0	57.0					11																	67164680		2200	4295	6495	66921256	SO:0001819	synonymous_variant	5883			U53174	CCDS8159.1	11q13.1-q13.2	2008-02-05	2003-07-21	2003-07-23	ENSG00000172613	ENSG00000172613			9827	protein-coding gene	gene with protein product		603761	"""RAD9 (S. pombe) homolog"""	RAD9		8943031	Standard	NM_004584		Approved		uc001okr.3	Q99638	OTTHUMG00000167670	ENST00000307980.2:c.903C>T	11.37:g.67164680C>T		Somatic		Capture	SOLID	Phase_IV	66921256	B2RCZ8|Q6FI29|Q96C41	Silent	SNP	ENST00000307980.2	37	CCDS8159.1	SNP	19	Baylor																																																																																				0.612	RAD9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395481.2	NM_004584		Silent
RASAL1	8437	hgsc.bcm.edu	37	12	113565669	113565671	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-23-1028-01	TCGA-23-1028-10	GTC	GTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr12:113565669_113565671delGTC	ENST00000261729.5	-	5	559_561	c.244_246delGAC	c.(244-246)gacdel	p.D82del	RASAL1_ENST00000546530.1_In_Frame_Del_p.D82del|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000446861.3_In_Frame_Del_p.D82del|RASAL1_ENST00000548055.1_In_Frame_Del_p.D82del			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	82	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						TGCCGATGATGTCGTCGTGCCTG	0.67																																																0			12																																								112050054	SO:0001651	inframe_deletion	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.244_246delGAC	12.37:g.113565672_113565674delGTC	ENSP00000261729:p.Asp82del	Somatic		Capture	SOLID	Phase_IV	112050052	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	In_Frame_Del	DEL	ENST00000261729.5	37	CCDS9165.1	DEL	48	Baylor																																																																																				0.670	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		In_Frame_Del
RNF25	64320	hgsc.bcm.edu	37	2	219528823	219528823	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1028-01	TCGA-23-1028-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:219528823T>C	ENST00000295704.2	-	10	1677	c.1237A>G	c.(1237-1239)Agg>Ggg	p.R413G		NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25	413					positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R413G(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCGAGTCCTGCGGGGTGGG	0.652																																																1	Substitution - Missense(1)	ovary(1)	2											65.0	82.0	76.0					2																	219528823		2203	4300	6503	219237067	SO:0001583	missense	64320				CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077	ENST00000295704.2:c.1237A>G	2.37:g.219528823T>C	ENSP00000295704:p.Arg413Gly	Somatic		Capture	SOLID	Phase_IV	219237067	A8K0D6|Q53HQ5|Q9H874	Missense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	17.11	3.304821	0.60305	.	.	ENSG00000163481	ENST00000295704	T	0.51325	0.71	5.37	5.37	0.77165	.	0.162339	0.56097	D	0.000038	T	0.37598	0.1009	L	0.29908	0.895	0.40020	D	0.975391	P	0.42871	0.792	B	0.40329	0.326	T	0.27088	-1.0084	10	0.38643	T	0.18	-9.6402	13.2425	0.60006	0.0:0.0:0.0:1.0	.	413	Q96BH1	RNF25_HUMAN	G	413	ENSP00000295704:R413G	ENSP00000295704:R413G	R	-	1	2	RNF25	219237067	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.423000	0.34837	2.254000	0.74563	0.533000	0.62120	AGG		0.652	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453		Missense_Mutation
FAM227A	646851	hgsc.bcm.edu	37	22	38995892	38995892	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr22:38995892delG	ENST00000535113.1	-	14	1859	c.1256delC	c.(1255-1257)tcafs	p.S419fs	FAM227A_ENST00000355830.6_Frame_Shift_Del_p.S414fs|FAM227A_ENST00000406767.2_Frame_Shift_Del_p.S414fs|FAM227A_ENST00000540952.1_5'UTR	NM_001013647.1	NP_001013669.1	F5H4B4	F227A_HUMAN	family with sequence similarity 227, member A	419								p.S413fs*1(1)									GAAGAGGTTTGAAGTCAGCTC	0.418																																																1	Deletion - Frameshift(1)	ovary(1)	22											83.0	66.0	71.0					22																	38995892		692	1591	2283	37325838	SO:0001589	frameshift_variant	646851					22q13.1	2012-07-04			ENSG00000184949	ENSG00000184949			44197	protein-coding gene	gene with protein product							Standard	NM_001013647		Approved		uc011anw.1	F5H4B4	OTTHUMG00000151133	ENST00000535113.1:c.1256delC	22.37:g.38995892delG	ENSP00000445093:p.Ser419fs	Somatic		Capture	SOLID	Phase_IV	37325838	B0QY52|B7Z7C6|Q5TG08	Frame_Shift_Del	DEL	ENST00000535113.1	37		DEL	45	Baylor																																																																																				0.418	FAM227A-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001013647		Frame_Shift_Del
SIX6	4990	hgsc.bcm.edu	37	14	60976473	60976473	+	Silent	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr14:60976473C>T	ENST00000327720.5	+	1	805	c.357C>T	c.(355-357)ttC>ttT	p.F119F		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	119					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		GGAAGAAGTTCCCGCTGCCGC	0.602																																																0			14											57.0	58.0	57.0					14																	60976473		2203	4300	6503	60046226	SO:0001819	synonymous_variant	4990			AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.357C>T	14.37:g.60976473C>T		Somatic		Capture	SOLID	Phase_IV	60046226	Q6NT42|Q9P1X8	Silent	SNP	ENST00000327720.5	37	CCDS9747.1	SNP	30	Baylor																																																																																				0.602	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2			Silent
SLCO6A1	133482	hgsc.bcm.edu	37	5	101709112	101709112	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr5:101709112G>T	ENST00000506729.1	-	13	2275	c.2104C>A	c.(2104-2106)Cca>Aca	p.P702T	SLCO6A1_ENST00000379810.1_Missense_Mutation_p.P449T|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.P702T|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.P449T|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.P640T			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	702						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P702T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GTTACATCTGGGAAGTCAGTG	0.308																																																1	Substitution - Missense(1)	ovary(1)	5											140.0	141.0	141.0					5																	101709112		2202	4298	6500	101737011	SO:0001583	missense	133482			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.2104C>A	5.37:g.101709112G>T	ENSP00000421339:p.Pro702Thr	Somatic		Capture	SOLID	Phase_IV	101737011	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	2.994	-0.207574	0.06180	.	.	ENSG00000205359	ENST00000506729;ENST00000511588;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.41400	1.01;1.01;1.07;1.0;1.0	3.34	-2.3	0.06785	.	6.813090	0.00397	N	0.000042	T	0.30448	0.0765	L	0.36672	1.1	0.09310	N	1	P;B;B	0.36837	0.571;0.286;0.435	B;B;B	0.38712	0.28;0.082;0.145	T	0.05852	-1.0860	10	0.16896	T	0.51	.	2.6766	0.05083	0.3627:0.0:0.2901:0.3472	.	640;449;702	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	T	702;8;702;640;449;449	ENSP00000421339:P702T;ENSP00000369135:P702T;ENSP00000373671:P640T;ENSP00000421990:P449T;ENSP00000369138:P449T	ENSP00000369135:P702T	P	-	1	0	SLCO6A1	101737011	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.530000	0.02221	-0.563000	0.06078	-0.355000	0.07637	CCA		0.308	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488		Missense_Mutation
TAF1B	9014	hgsc.bcm.edu	37	2	10045024	10045024	+	Frame_Shift_Del	DEL	G	G	-	rs396190	byFrequency	TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:10045024delG	ENST00000263663.5	+	9	1032	c.844delG	c.(844-846)gtafs	p.V282fs	TAF1B_ENST00000396242.3_Frame_Shift_Del_p.V27fs	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	282	C-terminal cyclin fold.		V -> I (in dbSNP:rs396190). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7801123}.		gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)	p.V282fs*1(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAAAAAAACAGTAGAAGTTGG	0.338																																																1	Deletion - Frameshift(1)	ovary(1)	2											81.0	70.0	74.0					2																	10045024		2203	4300	6503	9962475	SO:0001589	frameshift_variant	9014			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.844delG	2.37:g.10045024delG	ENSP00000263663:p.Val282fs	Somatic		Capture	SOLID	Phase_IV	9962475	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	ENST00000263663.5	37	CCDS33143.1	DEL	36	Baylor																																																																																				0.338	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680		Frame_Shift_Del
TOB1	10140	hgsc.bcm.edu	37	17	48941049	48941050	+	Frame_Shift_Ins	INS	-	-	A			TCGA-23-1028-01	TCGA-23-1028-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr17:48941049_48941050insA	ENST00000268957.3	-	3	757_758	c.329_330insT	c.(328-330)aagfs	p.K110fs	TOB1_ENST00000499247.2_Frame_Shift_Ins_p.K110fs|TOB1_ENST00000509385.1_5'UTR|TOB1-AS1_ENST00000416263.3_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	110					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)	p.K110fs*7(1)		breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CGTAAAGCACCTTCACTGGTCC	0.421											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(144;643 1919 24513 29423 40686)											1	Insertion - Frameshift(1)	ovary(1)	17																																								46296049	SO:0001589	frameshift_variant	10140			D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.329_330insT	17.37:g.48941049_48941050insA	ENSP00000268957:p.Lys110fs	Somatic	958	Capture	SOLID	Phase_IV	46296048	B2R9T0|D3DTY3|Q4KMQ0	Frame_Shift_Ins	INS	ENST00000268957.3	37	CCDS11576.1	INS	24	Baylor																																																																																				0.421	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1			Frame_Shift_Ins
TOP2A	7153	hgsc.bcm.edu	37	17	38569218	38569219	+	Frame_Shift_Ins	INS	-	-	CATGT			TCGA-23-1028-01	TCGA-23-1028-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr17:38569218_38569219insCATGT	ENST00000423485.1	-	7	739_740	c.581_582insACATG	c.(580-582)tggfs	p.W194fs		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	194					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TATTATCCATCCATGTCTATGG	0.332																																																0			17																																								35822745	SO:0001589	frameshift_variant	7153				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.577_581dupACATG	17.37:g.38569219_38569223dupCATGT	ENSP00000411532:p.Trp194fs	Somatic		Capture	SOLID	Phase_IV	35822744	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Frame_Shift_Ins	INS	ENST00000423485.1	37	CCDS45672.1	INS	30	Baylor																																																																																				0.332	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			Frame_Shift_Ins
TP53	7157	hgsc.bcm.edu	37	17	7577532	7577532	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1028-01	TCGA-23-1028-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr17:7577532G>A	ENST00000269305.4	-	7	938	c.749C>T	c.(748-750)cCc>cTc	p.P250L	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.P250L|TP53_ENST00000445888.2_Missense_Mutation_p.P250L|TP53_ENST00000359597.4_Missense_Mutation_p.P250L|TP53_ENST00000420246.2_Missense_Mutation_p.P250L|TP53_ENST00000455263.2_Missense_Mutation_p.P250L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	250	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P250L(45)|p.0?(8)|p.?(5)|p.P250H(4)|p.P250F(3)|p.P250N(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.N247_P250delNRRP(1)|p.R249_P250delRP(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTGAGGATGGGCCTCCGGTT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	80	Substitution - Missense(56)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(1)	large_intestine(14)|lung(10)|breast(10)|upper_aerodigestive_tract(5)|biliary_tract(5)|skin(5)|ovary(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|oesophagus(3)|liver(2)|urinary_tract(1)|eye(1)|peritoneum(1)|pancreas(1)|thyroid(1)	17	GRCh37	CM973401	TP53	M							154.0	112.0	126.0					17																	7577532		2203	4300	6503	7518257	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.749C>T	17.37:g.7577532G>A	ENSP00000269305:p.Pro250Leu	Somatic		Capture	SOLID	Phase_IV	7518257	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504438	0.85176	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.996;0.998;0.998;1.0	D	0.96045	0.9027	10	0.87932	D	0	-1.5308	15.3618	0.74483	0.0:0.0:1.0:0.0	.	250;250;250;250;250	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	L	250;250;250;250;250;250;239;118	ENSP00000410739:P250L;ENSP00000352610:P250L;ENSP00000269305:P250L;ENSP00000398846:P250L;ENSP00000391127:P250L;ENSP00000391478:P250L;ENSP00000425104:P118L	ENSP00000269305:P250L	P	-	2	0	TP53	7518257	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.601000	0.98297	2.564000	0.86499	0.462000	0.41574	CCC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
TRNAU1AP	54952	hgsc.bcm.edu	37	1	28897732	28897732	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1028-01	TCGA-23-1028-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr1:28897732G>C	ENST00000373830.3	+	7	601	c.575G>C	c.(574-576)aGc>aCc	p.S192T		NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1	192	Tyr-rich.				selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S192T(1)		breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						TACAGTTATAGCTACAACCAG	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											184.0	153.0	164.0					1																	28897732		2203	4300	6503	28770319	SO:0001583	missense	54952				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653	ENST00000373830.3:c.575G>C	1.37:g.28897732G>C	ENSP00000362936:p.Ser192Thr	Somatic		Capture	SOLID	Phase_IV	28770319	Q86SU7	Missense_Mutation	SNP	ENST00000373830.3	37	CCDS324.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	9.643	1.139406	0.21205	.	.	ENSG00000180098	ENST00000373830	T	0.23348	1.91	5.87	3.95	0.45737	.	0.317040	0.40818	N	0.001018	T	0.10294	0.0252	N	0.08118	0	0.27978	N	0.936126	B	0.20052	0.041	B	0.16722	0.016	T	0.25779	-1.0122	10	0.12766	T	0.61	.	5.67	0.17717	0.1441:0.1803:0.6756:0.0	.	192	Q9NX07	TSAP1_HUMAN	T	192	ENSP00000362936:S192T	ENSP00000362936:S192T	S	+	2	0	TRNAU1AP	28770319	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.033000	0.49743	1.437000	0.47472	0.655000	0.94253	AGC		0.428	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010346.1	NM_017846		Missense_Mutation
TSEN34	79042	hgsc.bcm.edu	37	19	54696097	54696097	+	Silent	SNP	T	T	C			TCGA-23-1028-01	TCGA-23-1028-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr19:54696097T>C	ENST00000396383.1	+	4	929	c.618T>C	c.(616-618)tcT>tcC	p.S206S	MBOAT7_ENST00000338624.6_5'Flank|TSEN34_ENST00000429671.2_Silent_p.S206S|CTD-3093M3.1_ENST00000594382.1_lincRNA|MBOAT7_ENST00000431666.2_5'Flank|MBOAT7_ENST00000391754.1_5'Flank|MBOAT7_ENST00000245615.1_5'Flank|TSEN34_ENST00000302937.4_Silent_p.S206S|TSEN34_ENST00000396388.2_Silent_p.S206S|MBOAT7_ENST00000474910.1_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	206					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GTGTCCAGTCTAAAGACTGGC	0.652																																					Esophageal Squamous(37;841 964 4869 42824)											0			19											49.0	53.0	52.0					19																	54696097		1867	4078	5945	59387909	SO:0001819	synonymous_variant	79042			AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.618T>C	19.37:g.54696097T>C		Somatic		Capture	SOLID	Phase_IV	59387909	A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Silent	SNP	ENST00000396383.1	37	CCDS42609.1	SNP	53	Baylor																																																																																				0.652	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075		Silent
UBL7	84993	hgsc.bcm.edu	37	15	74743861	74743861	+	Splice_Site	SNP	C	C	T			TCGA-23-1028-01	TCGA-23-1028-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr15:74743861C>T	ENST00000567435.1	-	5	851	c.388G>A	c.(388-390)Gtc>Atc	p.V130I	UBL7_ENST00000565335.1_Splice_Site_p.V130I|UBL7_ENST00000564488.1_Splice_Site_p.V130I|UBL7_ENST00000395081.2_Splice_Site_p.V130I|UBL7_ENST00000361351.4_Splice_Site_p.V130I			Q96S82	UBL7_HUMAN	ubiquitin-like 7	130								p.V130I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						ATCTTAAAGACCTGCAGGAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	15											92.0	86.0	88.0					15																	74743861		2197	4296	6493	72530914	SO:0001630	splice_region_variant	84993			BC007913	CCDS10263.1	15q23	2014-03-06	2014-03-06		ENSG00000138629	ENSG00000138629			28221	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived ubiquitin-like"", "" ubiquitin-like protein SB132"""	609748	"""ubiquitin-like 7 (bone marrow stromal cell-derived)"""			12644319	Standard	NM_201265		Approved	BMSC-UbP, MGC14421	uc002axy.1	Q96S82	OTTHUMG00000139001	ENST00000567435.1:c.388-1G>A	15.37:g.74743861C>T		Somatic		Capture	SOLID	Phase_IV	72530914	D3DW57|Q96I03	Missense_Mutation	SNP	ENST00000567435.1	37	CCDS10263.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.9	4.469087	0.84533	.	.	ENSG00000138629	ENST00000361351;ENST00000395081	T;T	0.46063	0.88;0.88	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	L	0.50333	1.59	0.58432	D	0.999998	P;P	0.47604	0.761;0.898	B;P	0.47891	0.441;0.56	T	0.27400	-1.0075	10	0.23302	T	0.38	-13.7446	18.9062	0.92462	0.0:1.0:0.0:0.0	.	170;130	D3DW56;Q96S82	.;UBL7_HUMAN	I	130	ENSP00000354883:V130I;ENSP00000378518:V130I	ENSP00000354883:V130I	V	-	1	0	UBL7	72530914	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.892000	0.69790	2.517000	0.84864	0.563000	0.77884	GTC		0.522	UBL7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419627.1	NM_032907, NM_201265	Missense_Mutation	Missense_Mutation
ZDBF2	57683	hgsc.bcm.edu	37	2	207174848	207174848	+	Frame_Shift_Del	DEL	A	A	-			TCGA-23-1028-01	TCGA-23-1028-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1028-01	TCGA-23-1028-10	g.chr2:207174848delA	ENST00000374423.3	+	5	5982	c.5596delA	c.(5596-5598)aaafs	p.K1867fs		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1867							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.V1868fs*46(1)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CTGTGAGACCAAAAAAGTTTC	0.418																																																1	Deletion - Frameshift(1)	ovary(1)	2											67.0	64.0	65.0					2																	207174848		1893	4115	6008	206883093	SO:0001589	frameshift_variant	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5596delA	2.37:g.207174848delA	ENSP00000363545:p.Lys1867fs	Somatic		Capture	SOLID	Phase_IV	206883093	Q6ZNP7|Q6ZSN8	Frame_Shift_Del	DEL	ENST00000374423.3	37	CCDS46501.1	DEL	5	Baylor																																																																																				0.418	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		Frame_Shift_Del
