#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
LEPRE1	64175	broad.mit.edu	37	1	43220616	43220616	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:43220616G>T	ENST00000296388.5	-	8	1320	c.1269C>A	c.(1267-1269)aaC>aaA	p.N423K	LEPRE1_ENST00000397054.3_Missense_Mutation_p.N423K|LEPRE1_ENST00000236040.4_Missense_Mutation_p.N423K			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	423					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)	p.N423K(1)		large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCTTCATAAGGTTCCCAATCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	1											108.0	98.0	101.0					1																	43220616		2203	4300	6503	42993203	SO:0001583	missense	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1269C>A	1.37:g.43220616G>T	ENSP00000296388:p.Asn423Lys	Unknown		x	x	x	42993203	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.223881|4.223881	0.79576|0.79576	.|.	.|.	ENSG00000117385|ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027|ENST00000447502	T;T;T|.	0.37058|.	1.26;1.22;1.47|.	5.57|5.57	3.65|3.65	0.41850|0.41850	.|.	0.306356|.	0.39020|.	N|.	0.001493|.	T|T	0.58623|0.58623	0.2135|0.2135	L|L	0.53249|0.53249	1.67|1.67	0.49915|0.49915	D|D	0.999831|0.999831	P;B;P|.	0.47545|.	0.897;0.376;0.605|.	P;B;B|.	0.45639|.	0.488;0.144;0.258|.	T|T	0.53070|0.53070	-0.8490|-0.8490	10|5	0.23891|.	T|.	0.37|.	-22.1698|-22.1698	9.1066|9.1066	0.36701|0.36701	0.0817:0.1483:0.7701:0.0|0.0817:0.1483:0.7701:0.0	.|.	423;288;423|.	Q32P28-3;B4DNM8;Q32P28|.	.;.;P3H1_HUMAN|.	K|T	423;423;423;288|15	ENSP00000380245:N423K;ENSP00000236040:N423K;ENSP00000296388:N423K|.	ENSP00000236040:N423K|.	N|P	-|-	3|1	2|0	LEPRE1|LEPRE1	42993203|42993203	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.978000|0.978000	0.69477|0.69477	2.954000|2.954000	0.49113|0.49113	0.668000|0.668000	0.31126|0.31126	0.462000|0.462000	0.41574|0.41574	AAC|CCT		0.562	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356		Missense_Mutation
LRRC7	57554	broad.mit.edu	37	1	70502241	70502241	+	Missense_Mutation	SNP	G	G	C	rs140092259		TCGA-23-1031-01	TCGA-23-1031-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:70502241G>C	ENST00000035383.5	+	18	2138	c.2108G>C	c.(2107-2109)cGg>cCg	p.R703P	LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Missense_Mutation_p.R708P	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	703						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.R703P(1)|p.R703L(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCTAATACCCGGGTTAAAGTG	0.453																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	1											117.0	128.0	124.0					1																	70502241		2203	4300	6503	70274829	SO:0001583	missense	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2108G>C	1.37:g.70502241G>C	ENSP00000035383:p.Arg703Pro	Somatic		x	x	x	70274829	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	37	CCDS645.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505082	0.26949	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.37584	1.19;1.26	6.07	6.07	0.98685	.	0.187127	0.48286	D	0.000188	T	0.11665	0.0284	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.06320	-1.0833	10	0.07990	T	0.79	.	12.7923	0.57541	0.0815:0.0:0.9185:0.0	.	703	Q96NW7	LRRC7_HUMAN	P	708;703;526	ENSP00000309245:R708P;ENSP00000035383:R703P	ENSP00000035383:R703P	R	+	2	0	LRRC7	70274829	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.587000	0.60991	2.890000	0.99128	0.650000	0.86243	CGG		0.453	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794		Missense_Mutation
ASTN1	460	broad.mit.edu	37	1	177000081	177000081	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:177000081G>T	ENST00000367654.3	-	4	1084	c.873C>A	c.(871-873)gaC>gaA	p.D291E	ASTN1_ENST00000424564.2_Missense_Mutation_p.D291E|ASTN1_ENST00000367657.3_Missense_Mutation_p.D291E|ASTN1_ENST00000281881.3_5'UTR|MIR488_ENST00000365739.2_RNA|ASTN1_ENST00000361833.2_Missense_Mutation_p.D291E	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	291					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.D291E(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GCTTGGCATTGTCACTTCCTG	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											102.0	103.0	103.0					1																	177000081		2203	4300	6503	175266704	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.873C>A	1.37:g.177000081G>T	ENSP00000356626:p.Asp291Glu	Unknown		x	x	x	175266704	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946652	0.53186	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.14893	2.47;2.89;2.89;2.47	5.76	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.23532	0.0569	L	0.27053	0.805	0.49483	D	0.999798	D;D;D	0.67145	0.996;0.99;0.99	D;D;D	0.77557	0.99;0.98;0.98	T	0.05289	-1.0894	10	0.08837	T	0.75	-36.3384	11.5906	0.50943	0.146:0.0:0.854:0.0	.	291;291;291	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	E	291	ENSP00000356629:D291E;ENSP00000354536:D291E;ENSP00000356626:D291E;ENSP00000395041:D291E	ENSP00000354536:D291E	D	-	3	2	ASTN1	175266704	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.101000	0.50283	1.428000	0.47296	0.655000	0.94253	GAC		0.418	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319		Missense_Mutation
OBSCN	84033	broad.mit.edu	37	1	228509746	228509746	+	Silent	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:228509746C>A	ENST00000422127.1	+	55	15248	c.15204C>A	c.(15202-15204)gcC>gcA	p.A5068A	OBSCN_ENST00000366707.4_Silent_p.A2702A|OBSCN_ENST00000366709.4_Silent_p.A2187A|OBSCN_ENST00000284548.11_Silent_p.A5068A|OBSCN_ENST00000570156.2_Silent_p.A6025A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5068					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.A5650A(2)|p.A5780A(1)|p.A5068A(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCACTGAGGCCCGCCAGGCGG	0.607																																																4	Substitution - coding silent(4)	lung(3)|ovary(1)	1											29.0	32.0	31.0					1																	228509746		2010	4167	6177	226576369	SO:0001819	synonymous_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15204C>A	1.37:g.228509746C>A		Unknown		x	x	x	226576369	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	SNP	22	Broad																																																																																				0.607	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		Silent
HIST3H2A	92815	broad.mit.edu	37	1	228645228	228645228	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:228645228C>T	ENST00000366695.2	-	1	332	c.291G>A	c.(289-291)ctG>ctA	p.L97L	HIST3H2BB_ENST00000369160.2_5'Flank	NM_033445.2	NP_254280.1	Q7L7L0	H2A3_HUMAN	histone cluster 3, H2a	97					nucleosome disassembly (GO:0006337)|UV-damage excision repair (GO:0070914)	extracellular vesicular exosome (GO:0070062)|nuclear nucleosome (GO:0000788)	DNA binding (GO:0003677)	p.L97L(1)		endometrium(1)|lung(3)|ovary(1)	5		Prostate(94;0.183)				CGCGGCCCAGCAGCTTGTTGA	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1											81.0	76.0	78.0					1																	228645228		2203	4299	6502	226711851	SO:0001819	synonymous_variant	92815			AY131974	CCDS1573.1	1q42.13	2011-01-27	2006-10-11		ENSG00000181218	ENSG00000181218		"""Histones / Replication-dependent"""	20507	protein-coding gene	gene with protein product		615015	"""histone 3, H2a"""			12408966	Standard	NM_033445		Approved	MGC3165	uc001hsy.3	Q7L7L0	OTTHUMG00000040046	ENST00000366695.2:c.291G>A	1.37:g.228645228C>T		Unknown		x	x	x	226711851	B2R4S4	Silent	SNP	ENST00000366695.2	37	CCDS1573.1	SNP	25	Broad																																																																																				0.657	HIST3H2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096598.1	NM_033445		Silent
RYR2	6262	broad.mit.edu	37	1	237947294	237947294	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:237947294C>T	ENST00000366574.2	+	90	12599	c.12282C>T	c.(12280-12282)atC>atT	p.I4094I	RYR2_ENST00000360064.6_Silent_p.I4100I|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Silent_p.I4078I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4094					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.I4092I(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CGAAGGACATCGGCTTCAACG	0.498																																																1	Substitution - coding silent(1)	ovary(1)	1											43.0	44.0	44.0					1																	237947294		2018	4199	6217	236013917	SO:0001819	synonymous_variant	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12282C>T	1.37:g.237947294C>T		Somatic		x	x	x	236013917	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1	SNP	31	Broad																																																																																				0.498	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		Silent
OR2M2	391194	broad.mit.edu	37	1	248343304	248343304	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr1:248343304A>G	ENST00000359682.2	+	1	17	c.17A>G	c.(16-18)cAg>cGg	p.Q6R		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q6R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TGGGAGAATCAGACCTTCAAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											198.0	195.0	196.0					1																	248343304		2203	4300	6503	246409927	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.17A>G	1.37:g.248343304A>G	ENSP00000352710:p.Gln6Arg	Unknown		x	x	x	246409927	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	12.92	2.082954	0.36758	.	.	ENSG00000198601	ENST00000359682	T	0.00262	8.4	1.44	1.44	0.22558	.	0.306691	0.17821	U	0.160853	T	0.00144	0.0004	L	0.41906	1.305	0.21290	N	0.999737	B	0.34264	0.446	B	0.35182	0.197	T	0.26573	-1.0099	10	0.52906	T	0.07	.	7.7689	0.28997	1.0:0.0:0.0:0.0	.	6	Q96R28	OR2M2_HUMAN	R	6	ENSP00000352710:Q6R	ENSP00000352710:Q6R	Q	+	2	0	OR2M2	246409927	0.000000	0.05858	0.062000	0.19696	0.564000	0.35744	0.030000	0.13688	0.651000	0.30788	0.248000	0.18094	CAG		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688		Missense_Mutation
C10orf113	387638	broad.mit.edu	37	10	21435304	21435304	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr10:21435304C>G	ENST00000534331.1	-	1	184	c.134G>C	c.(133-135)tGt>tCt	p.C45S	C10orf113_ENST00000377118.4_Missense_Mutation_p.C35S|NEBL_ENST00000417816.2_Intron|C10orf113_ENST00000529198.1_Missense_Mutation_p.C45S	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	45								p.C35S(2)		endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TTCAGCCACACAAGAAAAAAA	0.438																																																2	Substitution - Missense(2)	ovary(2)	10											156.0	139.0	145.0					10																	21435304		2203	4300	6503	21475310	SO:0001583	missense	387638				CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.134G>C	10.37:g.21435304C>G	ENSP00000433646:p.Cys45Ser	Unknown		x	x	x	21475310	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	37	CCDS31162.2	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510259	0.27036	.	.	ENSG00000204683	ENST00000534331;ENST00000529198;ENST00000377118	T;T	0.38401	1.14;1.14	5.71	-3.02	0.05446	.	.	.	.	.	T	0.15696	0.0378	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23261	-1.0193	9	0.87932	D	0	.	4.246	0.10672	0.2034:0.5007:0.2065:0.0895	.	45	Q5VZT2	CJ113_HUMAN	S	45;45;35	ENSP00000433646:C45S;ENSP00000366322:C35S	ENSP00000366322:C35S	C	-	2	0	C10orf113	21475310	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.616000	0.05591	-0.229000	0.09854	0.655000	0.94253	TGT		0.438	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896		Missense_Mutation
ARID5B	84159	broad.mit.edu	37	10	63850715	63850715	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr10:63850715A>T	ENST00000279873.7	+	10	1903	c.1493A>T	c.(1492-1494)gAa>gTa	p.E498V	ARID5B_ENST00000309334.5_Missense_Mutation_p.E255V	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	498					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)	p.E498V(1)		NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AAAAAAATAGAAGGGTATCAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	10											77.0	78.0	78.0					10																	63850715		2203	4300	6503	63520721	SO:0001583	missense	84159			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.1493A>T	10.37:g.63850715A>T	ENSP00000279873:p.Glu498Val	Unknown		x	x	x	63520721	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	12.08	1.829615	0.32329	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.50001	0.76;0.76	5.57	5.57	0.84162	.	0.196250	0.52532	D	0.000069	T	0.38532	0.1044	L	0.29908	0.895	0.47905	D	0.999542	P	0.35033	0.481	B	0.34038	0.174	T	0.27020	-1.0086	10	0.44086	T	0.13	-14.5936	16.0216	0.80499	1.0:0.0:0.0:0.0	.	498	Q14865	ARI5B_HUMAN	V	498;255	ENSP00000279873:E498V;ENSP00000308862:E255V	ENSP00000279873:E498V	E	+	2	0	ARID5B	63520721	1.000000	0.71417	0.996000	0.52242	0.422000	0.31414	6.258000	0.72487	2.242000	0.73789	0.533000	0.62120	GAA		0.463	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482		Missense_Mutation
NLRP14	338323	broad.mit.edu	37	11	7071013	7071013	+	Silent	SNP	A	A	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr11:7071013A>T	ENST00000299481.4	+	6	2581	c.2235A>T	c.(2233-2235)ggA>ggT	p.G745G		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	745					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.G745G(1)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GGGATAATGGAGTAAAGTCAT	0.373																																																1	Substitution - coding silent(1)	ovary(1)	11											205.0	189.0	194.0					11																	7071013		2201	4296	6497	7027589	SO:0001819	synonymous_variant	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2235A>T	11.37:g.7071013A>T		Unknown		x	x	x	7027589	Q7RTR6	Silent	SNP	ENST00000299481.4	37	CCDS7776.1	SNP	11	Broad																																																																																				0.373	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822		Silent
FNBP4	23360	broad.mit.edu	37	11	47755636	47755636	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr11:47755636A>C	ENST00000263773.5	-	10	1639	c.1627T>G	c.(1627-1629)Ttt>Gtt	p.F543V	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	543						nucleus (GO:0005634)		p.F543V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						ATGCCTAGAAACTCGAATTTA	0.323																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	110.0	111.0					11																	47755636		1836	4093	5929	47712212	SO:0001583	missense	23360			BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1627T>G	11.37:g.47755636A>C	ENSP00000263773:p.Phe543Val	Unknown		x	x	x	47712212	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	CCDS41644.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	26.3	4.721092	0.89205	.	.	ENSG00000109920	ENST00000263773	T	0.10573	2.86	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.23727	0.0574	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.01013	-1.1481	10	0.87932	D	0	-11.8796	16.542	0.84395	1.0:0.0:0.0:0.0	.	543	Q8N3X1	FNBP4_HUMAN	V	543	ENSP00000263773:F543V	ENSP00000263773:F543V	F	-	1	0	FNBP4	47712212	1.000000	0.71417	0.962000	0.40283	0.768000	0.43524	9.313000	0.96297	2.304000	0.77564	0.528000	0.53228	TTT		0.323	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3			Missense_Mutation
BARX2	8538	broad.mit.edu	37	11	129306818	129306818	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr11:129306818G>T	ENST00000281437.4	+	2	456	c.360G>T	c.(358-360)gaG>gaT	p.E120D	BARX2_ENST00000526127.1_5'UTR	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	120					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.E120D(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CCAGCAGCGAGTCAGAGACGG	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											37.0	43.0	41.0					11																	129306818		2201	4296	6497	128812028	SO:0001583	missense	8538			AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.360G>T	11.37:g.129306818G>T	ENSP00000281437:p.Glu120Asp	Unknown		x	x	x	128812028	O43518|Q6NT51	Missense_Mutation	SNP	ENST00000281437.4	37	CCDS8481.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965684	0.53507	.	.	ENSG00000043039	ENST00000281437	D	0.95622	-3.76	5.76	2.84	0.33178	Homeodomain-related (1);	0.099413	0.64402	D	0.000002	D	0.94817	0.8326	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	D	0.72625	0.978	D	0.91661	0.5342	10	0.22109	T	0.4	.	10.7435	0.46166	0.2139:0.0:0.7861:0.0	.	120	Q9UMQ3	BARX2_HUMAN	D	120	ENSP00000281437:E120D	ENSP00000281437:E120D	E	+	3	2	BARX2	128812028	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.177000	0.50871	0.763000	0.33175	0.655000	0.94253	GAG		0.667	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386153.1	NM_003658		Missense_Mutation
COPS7A	50813	broad.mit.edu	37	12	6838552	6838552	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:6838552A>G	ENST00000543155.1	+	5	949	c.467A>G	c.(466-468)tAc>tGc	p.Y156C	COPS7A_ENST00000542150.1_3'UTR|COPS7A_ENST00000229251.3_Missense_Mutation_p.Y156C|COPS7A_ENST00000534947.1_Missense_Mutation_p.Y156C|COPS7A_ENST00000534877.1_Missense_Mutation_p.Y156C|COPS7A_ENST00000539735.1_Missense_Mutation_p.Y156C|COPS7A_ENST00000538410.1_Missense_Mutation_p.Y156C	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A	156	PCI.				cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)		p.Y156C(1)		endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						GAGGTTGACTACAGCATCGGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	12											133.0	101.0	112.0					12																	6838552		2203	4300	6503	6708813	SO:0001583	missense	50813			AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.467A>G	12.37:g.6838552A>G	ENSP00000438115:p.Tyr156Cys	Unknown		x	x	x	6708813	A8K9A6|Q9NVX3|Q9UJW4	Missense_Mutation	SNP	ENST00000543155.1	37	CCDS8558.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	15.63	2.890508	0.52014	.	.	ENSG00000111652	ENST00000543155;ENST00000442593;ENST00000229251;ENST00000539735;ENST00000538410;ENST00000534947;ENST00000541866;ENST00000534877;ENST00000538753	.	.	.	5.39	5.39	0.77823	Proteasome component (PCI) domain (1);	0.057279	0.64402	D	0.000001	T	0.53417	0.1795	L	0.45470	1.425	0.50467	D	0.999879	P;B	0.36249	0.545;0.426	B;B	0.40659	0.191;0.336	T	0.55360	-0.8153	9	0.45353	T	0.12	-17.0141	10.627	0.45512	0.8568:0.0:0.0:0.1432	.	156;156	F5H248;Q9UBW8	.;CSN7A_HUMAN	C	156	.	ENSP00000229251:Y156C	Y	+	2	0	COPS7A	6708813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.741000	0.47426	2.043000	0.60533	0.533000	0.62120	TAC		0.607	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402740.1			Missense_Mutation
CD163	9332	broad.mit.edu	37	12	7640087	7640087	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:7640087T>C	ENST00000359156.4	-	8	2120	c.1918A>G	c.(1918-1920)Aaa>Gaa	p.K640E	CD163_ENST00000539632.1_5'Flank|CD163_ENST00000396620.3_Missense_Mutation_p.K673E|CD163_ENST00000541972.1_Missense_Mutation_p.K628E|CD163_ENST00000432237.2_Missense_Mutation_p.K640E	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	640	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.K640E(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CCATTTCCTTTTCCAAAACGT	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											153.0	139.0	144.0					12																	7640087		2203	4300	6503	7531354	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1918A>G	12.37:g.7640087T>C	ENSP00000352071:p.Lys640Glu	Somatic		x	x	x	7531354	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.592849	0.00864	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.14	3.97	0.46021	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.468250	0.23033	N	0.052706	T	0.15652	0.0377	N	0.11673	0.155	0.26106	N	0.980747	B;B;B	0.34147	0.305;0.008;0.438	B;B;B	0.36030	0.216;0.019;0.216	T	0.28681	-1.0036	10	0.02654	T	1	.	6.8806	0.24170	0.0:0.1766:0.0:0.8234	.	673;640;640	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	E	640;628;673;640	ENSP00000352071:K640E;ENSP00000444071:K628E;ENSP00000379863:K673E;ENSP00000403885:K640E	ENSP00000352071:K640E	K	-	1	0	CD163	7531354	0.000000	0.05858	1.000000	0.80357	0.135000	0.20990	-0.630000	0.05502	2.070000	0.61991	0.533000	0.62120	AAA		0.488	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416		Missense_Mutation
DDX47	51202	broad.mit.edu	37	12	12974601	12974601	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:12974601G>T	ENST00000358007.3	+	4	405	c.383G>T	c.(382-384)gGt>gTt	p.G128V	DDX47_ENST00000352940.4_Missense_Mutation_p.G128V	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	128	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.G128V(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		GTGATTGTAGGTGGAATTGAT	0.363																																																1	Substitution - Missense(1)	ovary(1)	12											139.0	140.0	140.0					12																	12974601		2203	4300	6503	12865868	SO:0001583	missense	51202			AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.383G>T	12.37:g.12974601G>T	ENSP00000350698:p.Gly128Val	Unknown		x	x	x	12865868	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	37	CCDS8655.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466888	0.63625	.	.	ENSG00000213782	ENST00000352940;ENST00000358007;ENST00000544400	T;T;T	0.61392	0.11;2.92;0.11	4.87	3.98	0.46160	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86134	0.5860	H	0.99642	4.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.91257	0.5034	10	0.87932	D	0	-6.3097	13.0998	0.59214	0.0785:0.0:0.9215:0.0	.	128;128;128	Q9H4E3;G5E955;Q9H0S4	.;.;DDX47_HUMAN	V	128;128;65	ENSP00000319578:G128V;ENSP00000350698:G128V;ENSP00000444000:G65V	ENSP00000319578:G128V	G	+	2	0	DDX47	12865868	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	4.746000	0.62133	1.281000	0.44480	0.555000	0.69702	GGT		0.363	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355		Missense_Mutation
C12orf40	283461	broad.mit.edu	37	12	40076823	40076823	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:40076823G>T	ENST00000324616.5	+	8	1251	c.1097G>T	c.(1096-1098)aGt>aTt	p.S366I	C12orf40_ENST00000405531.3_Missense_Mutation_p.S366I|C12orf40_ENST00000398716.1_Missense_Mutation_p.S289I	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	366								p.S366I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AATAAAACAAGTTATCCAGAA	0.323																																																1	Substitution - Missense(1)	ovary(1)	12											43.0	40.0	41.0					12																	40076823		1823	4066	5889	38363090	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1097G>T	12.37:g.40076823G>T	ENSP00000317671:p.Ser366Ile	Unknown		x	x	x	38363090	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	13.05	2.119897	0.37436	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.54866	0.55;0.55	5.04	0.134	0.14771	.	0.662123	0.14502	N	0.315652	T	0.48732	0.1516	L	0.32530	0.975	0.09310	N	1	P	0.52061	0.95	P	0.53809	0.735	T	0.39583	-0.9607	10	0.66056	D	0.02	.	7.4462	0.27213	0.5424:0.0:0.4576:0.0	.	366	Q86WS4	CL040_HUMAN	I	366;289;366	ENSP00000383897:S366I;ENSP00000317671:S366I	ENSP00000317671:S366I	S	+	2	0	C12orf40	38363090	0.000000	0.05858	0.001000	0.08648	0.591000	0.36615	-0.118000	0.10692	0.101000	0.17610	0.591000	0.81541	AGT		0.323	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599		Missense_Mutation
C12orf40	283461	broad.mit.edu	37	12	40114805	40114805	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:40114805T>G	ENST00000324616.5	+	13	1865	c.1711T>G	c.(1711-1713)Tgc>Ggc	p.C571G		NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	571								p.C571G(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						ACAGTTGCAGTGCAATTCAGC	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											95.0	90.0	92.0					12																	40114805		1922	4136	6058	38401072	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1711T>G	12.37:g.40114805T>G	ENSP00000317671:p.Cys571Gly	Unknown		x	x	x	38401072	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	T	10.88	1.474608	0.26511	.	.	ENSG00000180116	ENST00000324616	T	0.50277	0.75	4.95	0.83	0.18854	.	0.543405	0.18058	N	0.153036	T	0.29458	0.0734	L	0.32530	0.975	0.24512	N	0.994207	B	0.14012	0.009	B	0.16289	0.015	T	0.22068	-1.0227	10	0.62326	D	0.03	.	1.465	0.02404	0.2136:0.0941:0.159:0.5333	.	571	Q86WS4	CL040_HUMAN	G	571	ENSP00000317671:C571G	ENSP00000317671:C571G	C	+	1	0	C12orf40	38401072	0.000000	0.05858	0.077000	0.20336	0.012000	0.07955	-0.490000	0.06482	0.023000	0.15187	0.477000	0.44152	TGC		0.383	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599		Missense_Mutation
KRT79	338785	broad.mit.edu	37	12	53227730	53227730	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:53227730A>T	ENST00000330553.5	-	1	349	c.315T>A	c.(313-315)ttT>ttA	p.F105L		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	105	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)	p.F105L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AAGCAGGCCCAAACGTCTGCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	12											45.0	47.0	46.0					12																	53227730		2203	4300	6503	51513997	SO:0001583	missense	338785			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.315T>A	12.37:g.53227730A>T	ENSP00000328358:p.Phe105Leu	Unknown		x	x	x	51513997	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	0.027	-1.358942	0.01245	.	.	ENSG00000185640	ENST00000330553	T	0.76839	-1.05	4.02	-5.18	0.02840	.	0.131398	0.35067	N	0.003476	T	0.50786	0.1636	N	0.25789	0.76	0.20074	N	0.999937	B	0.02656	0.0	B	0.01281	0.0	T	0.45512	-0.9256	10	0.10902	T	0.67	.	3.3336	0.07093	0.6015:0.1865:0.1183:0.0936	.	105	Q5XKE5	K2C79_HUMAN	L	105	ENSP00000328358:F105L	ENSP00000328358:F105L	F	-	3	2	KRT79	51513997	0.003000	0.15002	0.207000	0.23584	0.017000	0.09413	-1.222000	0.02965	-0.901000	0.03891	-0.936000	0.02699	TTT		0.647	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834		Missense_Mutation
LRRIQ1	84125	broad.mit.edu	37	12	85500303	85500303	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:85500303T>C	ENST00000393217.2	+	15	3348	c.3287T>C	c.(3286-3288)cTt>cCt	p.L1096P		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1096								p.L1096P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TCTGTAGATCTTAAAAGTGCC	0.328																																																1	Substitution - Missense(1)	ovary(1)	12											110.0	110.0	110.0					12																	85500303		2203	4299	6502	84024434	SO:0001583	missense	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3287T>C	12.37:g.85500303T>C	ENSP00000376910:p.Leu1096Pro	Unknown		x	x	x	84024434	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	14.59	2.581955	0.46006	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.62105	0.05	4.79	4.79	0.61399	.	0.000000	0.64402	D	0.000006	T	0.77942	0.4206	M	0.75085	2.285	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.72982	0.92;0.979	T	0.81309	-0.0991	10	0.87932	D	0	.	14.7093	0.69215	0.0:0.0:0.0:1.0	.	1096;1071	Q96JM4;C9JI57	LRIQ1_HUMAN;.	P	1096;1071;1096	ENSP00000376910:L1096P	ENSP00000256007:L1096P	L	+	2	0	LRRIQ1	84024434	1.000000	0.71417	0.998000	0.56505	0.113000	0.19764	2.385000	0.44371	2.106000	0.64143	0.455000	0.32223	CTT		0.328	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165		Missense_Mutation
RPH3A	22895	broad.mit.edu	37	12	113285632	113285632	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:113285632A>T	ENST00000389385.4	+	5	712	c.215A>T	c.(214-216)gAg>gTg	p.E72V	RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000551052.1_Missense_Mutation_p.E68V|RPH3A_ENST00000420983.2_Missense_Mutation_p.E72V|RPH3A_ENST00000543106.2_Missense_Mutation_p.E72V|RPH3A_ENST00000415485.3_Missense_Mutation_p.E72V	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	72	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.E68V(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GAAGAGATGGAGCAGGAGCGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											86.0	69.0	75.0					12																	113285632		2203	4300	6503	111770015	SO:0001583	missense	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.215A>T	12.37:g.113285632A>T	ENSP00000374036:p.Glu72Val	Unknown		x	x	x	111770015	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503697	0.85176	.	.	ENSG00000089169	ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000420983	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02;-2.02	5.07	5.07	0.68467	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Rabphilin-3A effector, zinc-binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000008	D	0.92283	0.7552	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.92818	0.6270	9	.	.	.	.	14.1061	0.65091	1.0:0.0:0.0:0.0	.	72;72;68	B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	V	72;72;72;72;72;72;72;72;72;72;72;5;72;68;72;72;72	ENSP00000446570:E72V;ENSP00000449705:E72V;ENSP00000440384:E72V;ENSP00000446780:E72V;ENSP00000447306:E72V;ENSP00000446556:E72V;ENSP00000450382:E72V;ENSP00000449613:E72V;ENSP00000447505:E72V;ENSP00000449650:E72V;ENSP00000374036:E72V;ENSP00000448100:E5V;ENSP00000447083:E72V;ENSP00000448297:E68V;ENSP00000405357:E72V;ENSP00000450216:E72V;ENSP00000408889:E72V	.	E	+	2	0	RPH3A	111770015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.325000	0.90007	2.017000	0.59298	0.533000	0.62120	GAG		0.562	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		Missense_Mutation
CIT	11113	broad.mit.edu	37	12	120151400	120151400	+	Missense_Mutation	SNP	C	C	T	rs370080702		TCGA-23-1031-01	TCGA-23-1031-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:120151400C>T	ENST00000261833.7	-	33	4286	c.4234G>A	c.(4234-4236)Ggc>Agc	p.G1412S	CIT_ENST00000392521.2_Missense_Mutation_p.G1454S|CIT_ENST00000537607.1_5'UTR|MIR1178_ENST00000408396.1_RNA	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1412					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.G1440S(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCAGGCAAGCCGCAGGTGGCT	0.577																																																1	Substitution - Missense(1)	ovary(1)	12						C	SER/GLY,SER/GLY	0,4406		0,0,2203	89.0	77.0	81.0		4360,4234	6.1	1.0	12		81	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CIT	NM_001206999.1,NM_007174.2	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1454/2070,1412/2028	120151400	1,13005	2203	4300	6503	118635783	SO:0001583	missense	11113			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4234G>A	12.37:g.120151400C>T	ENSP00000261833:p.Gly1412Ser	Somatic		x	x	x	118635783	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	35	5.525819	0.96431	0.0	1.16E-4	ENSG00000122966	ENST00000392521;ENST00000261833	D;D	0.84516	-1.86;-1.86	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.93465	0.7915	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.993	D	0.93270	0.6651	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1454;1412;930	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	S	1454;1412	ENSP00000376306:G1454S;ENSP00000261833:G1412S	ENSP00000261833:G1412S	G	-	1	0	CIT	118635783	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.610000	0.82949	2.884000	0.98904	0.655000	0.94253	GGC		0.577	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174		Missense_Mutation
DIABLO	56616	broad.mit.edu	37	12	122693103	122693103	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr12:122693103G>T	ENST00000443649.3	-	7	1362	c.545C>A	c.(544-546)aCc>aAc	p.T182N	DIABLO_ENST00000464942.2_Missense_Mutation_p.T129N|DIABLO_ENST00000413918.1_Missense_Mutation_p.T138N|B3GNT4_ENST00000546192.1_3'UTR|DIABLO_ENST00000267169.6_Missense_Mutation_p.T129N|DIABLO_ENST00000353548.6_Missense_Mutation_p.T138N|B3GNT4_ENST00000545141.1_3'UTR|RP11-512M8.5_ENST00000535844.1_3'UTR	NM_019887.4	NP_063940.1	Q9NR28	DBLOH_HUMAN	diablo, IAP-binding mitochondrial protein	182					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)		p.T182N(4)		breast(1)|endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	7	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		ATTCCTGGCGGTTATAGAGGC	0.577																																																4	Substitution - Missense(4)	endometrium(3)|ovary(1)	12											63.0	54.0	57.0					12																	122693103		2203	4300	6503	121259056	SO:0001583	missense	56616			AF262240	CCDS9228.1, CCDS9229.1, CCDS73541.1	12q24.31	2011-08-02	2011-03-11		ENSG00000184047	ENSG00000184047			21528	protein-coding gene	gene with protein product	"""second mitochondria-derived activator of caspase"""	605219				12749848, 17237824, 21722859	Standard	NM_019887		Approved	SMAC, DIABLO-S, FLJ25049, FLJ10537, DFNA64	uc010tab.2	Q9NR28	OTTHUMG00000157014	ENST00000443649.3:c.545C>A	12.37:g.122693103G>T	ENSP00000398495:p.Thr182Asn	Unknown		x	x	x	121259056	B2RDQ0|Q6W3F3|Q96LV0|Q9BT11|Q9HAV6	Missense_Mutation	SNP	ENST00000443649.3	37	CCDS9228.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636528	0.67130	.	.	ENSG00000184047	ENST00000413918;ENST00000443649;ENST00000353548;ENST00000464942;ENST00000267169;ENST00000541273;ENST00000474004;ENST00000540535;ENST00000541656	T;T;T;T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.77	4.85	0.62838	Smac/DIABLO-like (1);	0.202673	0.51477	D	0.000095	D	0.84768	0.5545	M	0.76002	2.32	0.18873	N	0.999982	P;P;P	0.51449	0.945;0.945;0.888	P;P;P	0.54965	0.722;0.765;0.603	T	0.79383	-0.1826	10	0.72032	D	0.01	-3.627	15.3991	0.74823	0.0:0.2635:0.7365:0.0	.	138;182;129	Q6W3F3;Q9NR28;Q502X2	.;DBLOH_HUMAN;.	N	138;182;138;129;129;85;109;109;109	ENSP00000411638:T138N;ENSP00000398495:T182N;ENSP00000320343:T138N;ENSP00000442360:T129N;ENSP00000267169:T129N;ENSP00000440971:T85N;ENSP00000442669:T109N;ENSP00000441139:T109N;ENSP00000440653:T109N	ENSP00000267169:T129N	T	-	2	0	DIABLO	121259056	0.998000	0.40836	0.026000	0.17262	0.948000	0.59901	4.097000	0.57741	1.376000	0.46267	0.650000	0.86243	ACC		0.577	DIABLO-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347102.2	NM_019887		Missense_Mutation
PABPC3	5042	broad.mit.edu	37	13	25671197	25671197	+	Missense_Mutation	SNP	G	G	C	rs139504722		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr13:25671197G>C	ENST00000281589.3	+	1	898	c.861G>C	c.(859-861)agG>agC	p.R287S		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	287					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)	p.R287S(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AGCAAGATAGGATCACCAGAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	13						G	SER/ARG	0,4406		0,0,2203	187.0	180.0	182.0		861	0.9	1.0	13	dbSNP_134	182	1,8599	1.2+/-3.3	0,1,4299	no	missense	PABPC3	NM_030979.2	110	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	287/632	25671197	1,13005	2203	4300	6503	24569197	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.861G>C	13.37:g.25671197G>C	ENSP00000281589:p.Arg287Ser	Unknown		x	x	x	24569197	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189286	0.38707	0.0	1.16E-4	ENSG00000151846	ENST00000281589	T	0.29655	1.56	0.875	0.875	0.19130	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.45126	U	0.000389	T	0.45975	0.1369	M	0.88241	2.94	0.43175	D	0.994981	P	0.51240	0.943	P	0.54210	0.745	T	0.48502	-0.9030	10	0.87932	D	0	.	4.7628	0.13116	0.0:0.4037:0.5962:0.0	.	287	Q9H361	PABP3_HUMAN	S	287	ENSP00000281589:R287S	ENSP00000281589:R287S	R	+	3	2	PABPC3	24569197	1.000000	0.71417	0.983000	0.44433	0.693000	0.40251	0.640000	0.24705	0.759000	0.33084	0.313000	0.20887	AGG		0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979		Missense_Mutation
GPR12	2835	broad.mit.edu	37	13	27333719	27333719	+	Silent	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr13:27333719T>C	ENST00000381436.2	-	1	708	c.246A>G	c.(244-246)ctA>ctG	p.L82L	GPR12_ENST00000405846.3_Silent_p.L82L			P47775	GPR12_HUMAN	G protein-coupled receptor 12	82					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.L82L(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		GGCTGCCTATTAGCAGGAACA	0.522																																																1	Substitution - coding silent(1)	ovary(1)	13											88.0	89.0	89.0					13																	27333719		2203	4300	6503	26231719	SO:0001819	synonymous_variant	2835			U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.246A>G	13.37:g.27333719T>C		Somatic		x	x	x	26231719	Q5T8P3	Silent	SNP	ENST00000381436.2	37	CCDS9319.1	SNP	61	Broad																																																																																				0.522	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2			Silent
ESD	2098	broad.mit.edu	37	13	47361169	47361169	+	Silent	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr13:47361169C>A	ENST00000378720.3	-	4	326	c.144G>T	c.(142-144)ctG>ctT	p.L48L	ESD_ENST00000378697.1_Silent_p.L19L|ESD_ENST00000495654.1_5'UTR	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	48					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)	p.L48L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	AGAGCCAATACAGTGCAGGGC	0.338																																																1	Substitution - coding silent(1)	ovary(1)	13											80.0	73.0	76.0					13																	47361169		2203	4300	6503	46259170	SO:0001819	synonymous_variant	2098			M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.144G>T	13.37:g.47361169C>A		Unknown		x	x	x	46259170	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Silent	SNP	ENST00000378720.3	37	CCDS9404.1	SNP	17	Broad																																																																																				0.338	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1			Silent
KLF5	688	broad.mit.edu	37	13	73636580	73636580	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr13:73636580G>T	ENST00000377687.4	+	2	1379	c.843G>T	c.(841-843)atG>atT	p.M281I	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.M190I	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	281					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M281fs*43(1)|p.M281I(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		TCCAGGGCATGCCCCCTTGCA	0.512																																																2	Substitution - Missense(1)|Insertion - Frameshift(1)	ovary(1)|prostate(1)	13											108.0	94.0	99.0					13																	73636580		2203	4300	6503	72534581	SO:0001583	missense	688			D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.843G>T	13.37:g.73636580G>T	ENSP00000366915:p.Met281Ile	Somatic		x	x	x	72534581	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	CCDS9448.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	8.668	0.902090	0.17760	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.06608	3.43;3.28	5.94	5.05	0.67936	.	0.221845	0.56097	D	0.000028	T	0.02929	0.0087	N	0.04508	-0.205	0.33952	D	0.644536	B	0.02656	0.0	B	0.01281	0.0	T	0.39961	-0.9588	10	0.19147	T	0.46	.	8.9493	0.35779	0.0:0.2961:0.4766:0.2274	.	281	Q13887	KLF5_HUMAN	I	190;281;261	ENSP00000440407:M190I;ENSP00000366915:M281I	ENSP00000366915:M281I	M	+	3	0	KLF5	72534581	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.599000	0.36751	2.816000	0.96949	0.561000	0.74099	ATG		0.512	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1			Missense_Mutation
TEP1	7011	broad.mit.edu	37	14	20851948	20851948	+	Missense_Mutation	SNP	G	G	T	rs376720161		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr14:20851948G>T	ENST00000262715.5	-	25	3704	c.3664C>A	c.(3664-3666)Ctg>Atg	p.L1222M	TEP1_ENST00000556935.1_Missense_Mutation_p.L1114M|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1222	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)	p.L1222M(1)		NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGGCCACGCAGATAGGTACAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	14											38.0	41.0	40.0					14																	20851948		2203	4300	6503	19921788	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3664C>A	14.37:g.20851948G>T	ENSP00000262715:p.Leu1222Met	Unknown		x	x	x	19921788	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055214	0.55325	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	D;D	0.86627	-2.15;-2.15	5.84	4.94	0.65067	NACHT nucleoside triphosphatase (1);	0.076754	0.53938	D	0.000055	D	0.92057	0.7483	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.91151	0.4953	10	0.46703	T	0.11	-12.984	11.3734	0.49713	0.0854:0.0:0.9146:0.0	.	1114;572;1222	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	M	1222;1222;1114	ENSP00000262715:L1222M;ENSP00000452574:L1114M	ENSP00000262715:L1222M	L	-	1	2	TEP1	19921788	0.992000	0.36948	1.000000	0.80357	0.878000	0.50629	2.871000	0.48459	2.760000	0.94817	0.655000	0.94253	CTG		0.587	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110		Missense_Mutation
PNN	5411	broad.mit.edu	37	14	39650221	39650221	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr14:39650221T>A	ENST00000216832.4	+	9	1375	c.1308T>A	c.(1306-1308)gaT>gaA	p.D436E	PNN_ENST00000557680.1_Intron	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	436	Glu-rich.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.D436E(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		TTGAGCCAGATAAAGAATGTA	0.383																																																1	Substitution - Missense(1)	ovary(1)	14											63.0	67.0	66.0					14																	39650221		2203	4300	6503	38719972	SO:0001583	missense	5411			U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.1308T>A	14.37:g.39650221T>A	ENSP00000216832:p.Asp436Glu	Unknown		x	x	x	38719972	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	CCDS9671.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	5.569	0.289901	0.10567	.	.	ENSG00000100941	ENST00000216832	T	0.35421	1.31	5.9	1.24	0.21308	.	0.537042	0.21477	N	0.073897	T	0.08403	0.0209	N	0.01297	-0.9	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32052	-0.9921	10	0.02654	T	1	-11.0169	3.249	0.06807	0.1621:0.0705:0.3469:0.4205	.	436	Q9H307	PININ_HUMAN	E	436	ENSP00000216832:D436E	ENSP00000216832:D436E	D	+	3	2	PNN	38719972	0.997000	0.39634	1.000000	0.80357	0.990000	0.78478	0.327000	0.19663	1.022000	0.39626	0.528000	0.53228	GAT		0.383	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687		Missense_Mutation
NAA30	122830	broad.mit.edu	37	14	57858245	57858245	+	Silent	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr14:57858245C>A	ENST00000556492.1	+	2	724	c.570C>A	c.(568-570)tcC>tcA	p.S190S	NAA30_ENST00000555166.1_Intron|NAA30_ENST00000554703.1_Intron	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	190					metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.S190S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						TGTCTTCGTCCCTGACCGCCG	0.642																																																1	Substitution - coding silent(1)	ovary(1)	14											27.0	34.0	32.0					14																	57858245		2200	4293	6493	56927998	SO:0001819	synonymous_variant	122830			AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.570C>A	14.37:g.57858245C>A		Unknown		x	x	x	56927998	Q0IIN2	Silent	SNP	ENST00000556492.1	37	CCDS32088.1	SNP	22	Broad																																																																																				0.642	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412925.1	NM_001011713		Silent
KIAA0586	9786	broad.mit.edu	37	14	58938975	58938975	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr14:58938975A>G	ENST00000556134.1	+	19	2841	c.2567A>G	c.(2566-2568)gAt>gGt	p.D856G	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.D827G|KIAA0586_ENST00000261244.5_Missense_Mutation_p.D795G|KIAA0586_ENST00000354386.6_Missense_Mutation_p.D924G	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	856					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.D924G(1)		endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACTAACTTTGATGAAATAATC	0.338																																																1	Substitution - Missense(1)	ovary(1)	14											54.0	51.0	52.0					14																	58938975		1816	4065	5881	58008728	SO:0001583	missense	9786			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2567A>G	14.37:g.58938975A>G	ENSP00000452351:p.Asp856Gly	Somatic		x	x	x	58008728	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	19.11	3.763629	0.69878	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.76	5.76	0.90799	.	0.289314	0.34700	N	0.003749	T	0.65688	0.2715	.	.	.	0.32386	N	0.55394	P;D;D;D;D;D	0.71674	0.925;0.961;0.993;0.998;0.961;0.961	P;P;D;D;P;P	0.81914	0.691;0.691;0.91;0.995;0.691;0.691	T	0.75728	-0.3216	9	0.72032	D	0.01	.	9.3411	0.38080	0.8403:0.0:0.0:0.1597	.	731;731;924;795;856;827	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	G	924;856;827;795;731	ENSP00000346359:D924G;ENSP00000452351:D856G;ENSP00000399427:D827G;ENSP00000261244:D795G	ENSP00000261244:D795G	D	+	2	0	KIAA0586	58008728	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.688000	0.46984	2.191000	0.70037	0.482000	0.46254	GAT		0.338	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749		Missense_Mutation
GPR176	11245	broad.mit.edu	37	15	40093611	40093611	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:40093611G>T	ENST00000561100.1	-	3	2135	c.1270C>A	c.(1270-1272)Ccc>Acc	p.P424T	GPR176_ENST00000560729.1_5'Flank|GPR176_ENST00000543580.1_Missense_Mutation_p.P379T|GPR176_ENST00000299092.3_Missense_Mutation_p.P423T|RP11-37C7.1_ENST00000558616.1_RNA	NM_007223.1	NP_009154.1	Q14439	GP176_HUMAN	G protein-coupled receptor 176	424					G-protein coupled receptor signaling pathway (GO:0007186)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.P424T(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)	23		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		GTGCTCAGGGGTGGGGCAGAG	0.582																																																1	Substitution - Missense(1)	ovary(1)	15											129.0	129.0	129.0					15																	40093611		2203	4300	6503	37880903	SO:0001583	missense	11245			BC067106	CCDS10051.1, CCDS61588.1, CCDS61589.1	15q14-q15.1	2012-08-21			ENSG00000166073	ENSG00000166073		"""GPCR / Class A : Orphans"""	32370	protein-coding gene	gene with protein product		612183				7893747	Standard	NM_007223		Approved	Gm1012	uc010uck.2	Q14439	OTTHUMG00000129873	ENST00000561100.1:c.1270C>A	15.37:g.40093611G>T	ENSP00000453076:p.Pro424Thr	Unknown		x	x	x	37880903	Q6NXF6	Missense_Mutation	SNP	ENST00000561100.1	37	CCDS10051.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269149	0.40095	.	.	ENSG00000166073	ENST00000299092;ENST00000543580	T	0.81163	-1.46	6.17	6.17	0.99709	.	0.166440	0.53938	D	0.000045	T	0.80747	0.4682	L	0.43923	1.385	0.48632	D	0.999682	P	0.41214	0.742	P	0.45119	0.47	T	0.75772	-0.3200	10	0.27785	T	0.31	-16.8021	20.8794	0.99867	0.0:0.0:1.0:0.0	.	424	Q14439	GP176_HUMAN	T	424;379	ENSP00000439361:P379T	ENSP00000299092:P424T	P	-	1	0	GPR176	37880903	1.000000	0.71417	0.790000	0.31976	0.044000	0.14063	7.787000	0.85759	2.941000	0.99782	0.655000	0.94253	CCC		0.582	GPR176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252117.2	NM_007223		Missense_Mutation
TYRO3	7301	broad.mit.edu	37	15	41859592	41859592	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:41859592C>G	ENST00000263798.3	+	7	1042	c.818C>G	c.(817-819)gCt>gGt	p.A273G	TYRO3_ENST00000559066.1_Missense_Mutation_p.A228G	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	273	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A265G(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAAGTCCTGGCTGTTGTGGTC	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											79.0	84.0	82.0					15																	41859592		2203	4300	6503	39646884	SO:0001583	missense	7301			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.818C>G	15.37:g.41859592C>G	ENSP00000263798:p.Ala273Gly	Unknown		x	x	x	39646884	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230476	0.58777	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.57595	0.39	4.64	4.64	0.57946	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42172	D	0.000741	T	0.44603	0.1301	L	0.33485	1.01	0.41357	D	0.987407	P	0.45428	0.858	B	0.42462	0.388	T	0.44559	-0.9320	10	0.41790	T	0.15	-10.0747	14.5246	0.67878	0.0:1.0:0.0:0.0	.	273	Q06418	TYRO3_HUMAN	G	205;273	ENSP00000263798:A273G	ENSP00000263798:A273G	A	+	2	0	TYRO3	39646884	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.131000	0.57970	2.417000	0.82017	0.655000	0.94253	GCT		0.597	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2			Missense_Mutation
EPB42	2038	broad.mit.edu	37	15	43498730	43498730	+	Silent	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:43498730G>C	ENST00000441366.2	-	10	1641	c.1416C>G	c.(1414-1416)gcC>gcG	p.A472A	EPB42_ENST00000540029.1_Silent_p.A394A|EPB42_ENST00000300215.3_Silent_p.A502A|EPB42_ENST00000563128.1_5'Flank	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	472					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)	p.A502A(1)		endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		ACAGAGGACTGGCAGTCTCGA	0.542																																																1	Substitution - coding silent(1)	ovary(1)	15											176.0	166.0	169.0					15																	43498730		2203	4299	6502	41286022	SO:0001819	synonymous_variant	2038			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.1416C>G	15.37:g.43498730G>C		Unknown		x	x	x	41286022	Q4KKX0|Q4VB97	Silent	SNP	ENST00000441366.2	37	CCDS45249.1	SNP	47	Broad																																																																																				0.542	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119		Silent
SPG11	80208	broad.mit.edu	37	15	44952718	44952718	+	Silent	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:44952718A>G	ENST00000261866.7	-	2	370	c.354T>C	c.(352-354)ttT>ttC	p.F118F	SPG11_ENST00000558319.1_Silent_p.F118F|SPG11_ENST00000535302.2_Silent_p.F118F|SPG11_ENST00000427534.2_Silent_p.F118F|SPG11_ENST00000559193.1_Silent_p.F118F	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	118					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.F118F(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CTTTCAAATTAAATTCATAGA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	15											148.0	142.0	144.0					15																	44952718		2198	4298	6496	42740010	SO:0001819	synonymous_variant	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.354T>C	15.37:g.44952718A>G		Unknown		x	x	x	42740010	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Silent	SNP	ENST00000261866.7	37	CCDS10112.1	SNP	13	Broad																																																																																				0.388	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1			Silent
SLC28A2	9153	broad.mit.edu	37	15	45557851	45557851	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:45557851T>C	ENST00000347644.3	+	9	916	c.851T>C	c.(850-852)gTa>gCa	p.V284A	CTD-2651B20.3_ENST00000560344.1_RNA|CTD-2651B20.3_ENST00000561404.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	284					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)	p.V284A(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	GTGCAATGGGTAGTTCAGAAG	0.468																																					NSCLC(92;493 1501 26361 28917 47116)											1	Substitution - Missense(1)	ovary(1)	15											236.0	184.0	202.0					15																	45557851		2198	4298	6496	43345143	SO:0001583	missense	9153			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.851T>C	15.37:g.45557851T>C	ENSP00000315006:p.Val284Ala	Unknown		x	x	x	43345143	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	ENST00000347644.3	37	CCDS10121.1	SNP	57	Broad	.	.	.	.	.	.	.	.	.	.	T	16.39	3.109449	0.56398	.	.	ENSG00000137860	ENST00000347644	T	0.31769	1.48	5.41	4.29	0.51040	Nucleoside recognition (1);	0.530450	0.19665	N	0.108893	T	0.43897	0.1268	M	0.73372	2.23	0.29571	N	0.849921	P	0.46621	0.881	P	0.52481	0.7	T	0.44221	-0.9342	10	0.54805	T	0.06	-1.1696	9.3912	0.38374	0.0:0.0846:0.0:0.9154	.	284	O43868	S28A2_HUMAN	A	284	ENSP00000315006:V284A	ENSP00000315006:V284A	V	+	2	0	SLC28A2	43345143	0.931000	0.31567	0.110000	0.21437	0.640000	0.38277	5.610000	0.67668	0.909000	0.36697	-0.250000	0.11733	GTA		0.468	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212		Missense_Mutation
AQP9	366	broad.mit.edu	37	15	58465355	58465355	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr15:58465355G>C	ENST00000219919.4	+	3	697	c.327G>C	c.(325-327)caG>caC	p.Q109H	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000558772.1_Missense_Mutation_p.Q44H|AQP9_ENST00000536493.1_Missense_Mutation_p.Q109H	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	109					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.Q109H(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TGGGAGCCCAGTTCTTGGGAG	0.478																																																1	Substitution - Missense(1)	ovary(1)	15											174.0	176.0	176.0					15																	58465355		2192	4292	6484	56252647	SO:0001583	missense	366			AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.327G>C	15.37:g.58465355G>C	ENSP00000219919:p.Gln109His	Unknown		x	x	x	56252647	Q9NP32	Missense_Mutation	SNP	ENST00000219919.4	37	CCDS10165.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868783	0.72065	.	.	ENSG00000103569	ENST00000219919;ENST00000536493	T;T	0.48522	0.81;0.81	5.33	5.33	0.75918	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	T	0.82107	0.4965	H	0.99689	4.705	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.88639	0.3174	10	0.87932	D	0	-2.1556	12.9189	0.58220	0.0834:0.0:0.9166:0.0	.	109	O43315	AQP9_HUMAN	H	109	ENSP00000219919:Q109H;ENSP00000441390:Q109H	ENSP00000219919:Q109H	Q	+	3	2	AQP9	56252647	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.918000	0.48829	2.771000	0.95319	0.561000	0.74099	CAG		0.478	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980		Missense_Mutation
CLDN6	9074	broad.mit.edu	37	16	3065620	3065620	+	Missense_Mutation	SNP	G	G	C	rs201867140		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:3065620G>C	ENST00000396925.1	-	3	831	c.403C>G	c.(403-405)Ccc>Gcc	p.P135A	TNFRSF12A_ENST00000573001.1_5'Flank|CLDN6_ENST00000572154.1_Intron|CLDN6_ENST00000328796.4_Missense_Mutation_p.P135A			P56747	CLD6_HUMAN	claudin 6	135					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.P135A(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CAGCACACGGGGATTAGCGTC	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											29.0	30.0	30.0					16																	3065620		2198	4298	6496	3005621	SO:0001583	missense	9074			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.403C>G	16.37:g.3065620G>C	ENSP00000380131:p.Pro135Ala	Unknown		x	x	x	3005621	B3KQP9|D3DUA5	Missense_Mutation	SNP	ENST00000396925.1	37	CCDS10488.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813801	0.32053	.	.	ENSG00000184697	ENST00000396925;ENST00000328796	D;D	0.84370	-1.84;-1.84	4.76	4.76	0.60689	.	0.137318	0.48767	D	0.000164	D	0.86653	0.5984	L	0.57130	1.785	0.42923	D	0.994294	P	0.39903	0.694	P	0.47786	0.557	D	0.85306	0.1076	10	0.33940	T	0.23	.	15.6364	0.76958	0.0:0.0:1.0:0.0	.	135	P56747	CLD6_HUMAN	A	135	ENSP00000380131:P135A;ENSP00000328674:P135A	ENSP00000328674:P135A	P	-	1	0	CLDN6	3005621	1.000000	0.71417	0.958000	0.39756	0.025000	0.11179	4.086000	0.57664	2.638000	0.89438	0.655000	0.94253	CCC		0.612	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250988.1	NM_021195		Missense_Mutation
ADCY9	115	broad.mit.edu	37	16	4016249	4016249	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:4016249T>C	ENST00000294016.3	-	11	4127	c.3589A>G	c.(3589-3591)Atg>Gtg	p.M1197V		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1197	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.M1197V(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTGGTGTCCATCCTGCTGGCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	16											124.0	109.0	114.0					16																	4016249		2197	4300	6497	3956250	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3589A>G	16.37:g.4016249T>C	ENSP00000294016:p.Met1197Val	Somatic		x	x	x	3956250	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118524	0.77323	.	.	ENSG00000162104	ENST00000294016	T	0.34472	1.36	5.67	5.67	0.87782	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.70885	0.3275	M	0.94142	3.5	0.58432	D	0.999991	D	0.71674	0.998	D	0.80764	0.994	T	0.80221	-0.1472	10	0.87932	D	0	.	16.2014	0.82084	0.0:0.0:0.0:1.0	.	1197	O60503	ADCY9_HUMAN	V	1197	ENSP00000294016:M1197V	ENSP00000294016:M1197V	M	-	1	0	ADCY9	3956250	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.281000	0.76405	0.533000	0.62120	ATG		0.622	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1			Missense_Mutation
ZC3H7A	29066	broad.mit.edu	37	16	11861400	11861400	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:11861400G>C	ENST00000396516.2	-	12	1592	c.1395C>G	c.(1393-1395)aaC>aaG	p.N465K	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.N465K			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	465						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N465K(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TATGATCTATGTTAGCATGGT	0.289																																																1	Substitution - Missense(1)	ovary(1)	16											111.0	109.0	110.0					16																	11861400		2196	4299	6495	11768901	SO:0001583	missense	29066			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1395C>G	16.37:g.11861400G>C	ENSP00000379773:p.Asn465Lys	Unknown		x	x	x	11768901	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435223	0.25813	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.09817	2.94;2.94	5.77	4.68	0.58851	Zinc finger, C2H2-like (1);	0.309628	0.40640	N	0.001056	T	0.09512	0.0234	L	0.44542	1.39	0.80722	D	1	B;B	0.18166	0.026;0.002	B;B	0.19391	0.025;0.002	T	0.14144	-1.0483	10	0.13470	T	0.59	.	9.9899	0.41865	0.8582:0.0:0.1418:0.0	.	186;465	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	K	465	ENSP00000347999:N465K;ENSP00000379773:N465K	ENSP00000347999:N465K	N	-	3	2	ZC3H7A	11768901	0.981000	0.34729	0.936000	0.37596	0.797000	0.45037	1.753000	0.38359	1.002000	0.39104	-0.600000	0.04104	AAC		0.289	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153		Missense_Mutation
GDE1	51573	broad.mit.edu	37	16	19528413	19528413	+	Silent	SNP	A	A	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:19528413A>T	ENST00000353258.3	-	2	540	c.360T>A	c.(358-360)acT>acA	p.T120T		NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	120	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)	p.T120T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						CAGTCCCATCAGTCGTCCTAT	0.438																																																1	Substitution - coding silent(1)	ovary(1)	16											188.0	158.0	168.0					16																	19528413		2197	4300	6497	19435914	SO:0001819	synonymous_variant	51573				CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.360T>A	16.37:g.19528413A>T		Unknown		x	x	x	19435914	O43334|Q6PKF7|Q7KYR4	Silent	SNP	ENST00000353258.3	37	CCDS10578.1	SNP	7	Broad																																																																																				0.438	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641		Silent
DNAH3	55567	broad.mit.edu	37	16	21031085	21031085	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:21031085C>G	ENST00000261383.3	-	41	5882	c.5883G>C	c.(5881-5883)tgG>tgC	p.W1961C	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1961					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.W1961C(1)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGCCACGGTCCACACCAAGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	16											118.0	106.0	110.0					16																	21031085		2201	4300	6501	20938586	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5883G>C	16.37:g.21031085C>G	ENSP00000261383:p.Trp1961Cys	Unknown		x	x	x	20938586	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516689	0.85495	.	.	ENSG00000158486	ENST00000261383	T	0.26518	1.73	5.58	5.58	0.84498	.	0.209750	0.44097	D	0.000493	T	0.71913	0.3396	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84701	0.0728	10	0.87932	D	0	.	19.6338	0.95721	0.0:1.0:0.0:0.0	.	1961	Q8TD57	DYH3_HUMAN	C	1961	ENSP00000261383:W1961C	ENSP00000261383:W1961C	W	-	3	0	DNAH3	20938586	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.558000	0.82253	2.648000	0.89879	0.558000	0.71614	TGG		0.483	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		Missense_Mutation
CNOT1	23019	broad.mit.edu	37	16	58579273	58579273	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr16:58579273T>G	ENST00000317147.5	-	30	4461	c.4129A>C	c.(4129-4131)Aat>Cat	p.N1377H	CNOT1_ENST00000441024.2_Missense_Mutation_p.N1377H|CNOT1_ENST00000569240.1_Missense_Mutation_p.N1372H|CNOT1_ENST00000245138.4_Missense_Mutation_p.N228H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1377	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.N1377H(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ACTGTTGGATTCAGAGTAATG	0.473																																																1	Substitution - Missense(1)	ovary(1)	16											246.0	201.0	216.0					16																	58579273		2198	4300	6498	57136774	SO:0001583	missense	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4129A>C	16.37:g.58579273T>G	ENSP00000320949:p.Asn1377His	Unknown		x	x	x	57136774	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	17.90	3.501374	0.64298	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.52754	0.68;0.65	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.60457	0.2270	L	0.55743	1.74	0.80722	D	1	B;D;P;P	0.71674	0.157;0.998;0.559;0.506	B;D;B;B	0.68039	0.086;0.955;0.22;0.234	T	0.55360	-0.8153	10	0.15952	T	0.53	.	15.5087	0.75764	0.0:0.0:0.0:1.0	.	228;1377;1377;1372	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	H	1377;228;1372;1377	ENSP00000320949:N1377H;ENSP00000413113:N1377H	ENSP00000245138:N228H	N	-	1	0	CNOT1	57136774	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.437000	0.80417	2.057000	0.61298	0.533000	0.62120	AAT		0.473	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284		Missense_Mutation
DLG4	1742	broad.mit.edu	37	17	7097030	7097030	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:7097030C>T	ENST00000399506.2	-	15	1738	c.1547G>A	c.(1546-1548)cGa>cAa	p.R516Q	DLG4_ENST00000399510.2_Missense_Mutation_p.R559Q|DLG4_ENST00000302955.6_Missense_Mutation_p.R513Q			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	516					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)	p.R559Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CGAGTCTTCTCGACCTGGTGG	0.612																																																1	Substitution - Missense(1)	ovary(1)	17											64.0	73.0	70.0					17																	7097030		2007	4176	6183	7037754	SO:0001583	missense	1742			U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1547G>A	17.37:g.7097030C>T	ENSP00000382425:p.Arg516Gln	Unknown		x	x	x	7037754	B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	ENST00000399506.2	37		SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017973	0.35606	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	D;D;D	0.82167	-1.58;-1.58;-1.58	5.2	5.2	0.72013	Src homology-3 domain (1);	.	.	.	.	T	0.80549	0.4644	N	0.16368	0.405	0.52099	D	0.999943	B;B;B;D	0.71674	0.003;0.003;0.092;0.998	B;B;B;D	0.79784	0.006;0.006;0.042;0.993	T	0.74312	-0.3706	9	0.12103	T	0.63	.	9.6178	0.39704	0.0:0.908:0.0:0.092	.	556;516;513;559	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	Q	516;513;559;559;456;559	ENSP00000382425:R516Q;ENSP00000307471:R513Q;ENSP00000382428:R559Q	ENSP00000293813:R559Q	R	-	2	0	DLG4	7037754	0.984000	0.35163	1.000000	0.80357	0.974000	0.67602	0.892000	0.28322	2.722000	0.93159	0.655000	0.94253	CGA		0.612	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365		Missense_Mutation
TEKT3	64518	broad.mit.edu	37	17	15234415	15234415	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:15234415T>A	ENST00000395930.1	-	3	674	c.488A>T	c.(487-489)gAg>gTg	p.E163V	TEKT3_ENST00000338696.2_Missense_Mutation_p.E163V	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	163					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.E163V(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TTCATCCAACTCATGAATGAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	17											171.0	156.0	161.0					17																	15234415		2203	4300	6503	15175140	SO:0001583	missense	64518			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.488A>T	17.37:g.15234415T>A	ENSP00000379263:p.Glu163Val	Unknown		x	x	x	15175140	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	37	CCDS11169.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	25.8	4.672804	0.88445	.	.	ENSG00000125409	ENST00000395930;ENST00000338696	T;T	0.02944	4.1;4.1	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.22360	0.0539	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.05533	-1.0879	10	0.87932	D	0	-4.9219	16.1054	0.81216	0.0:0.0:0.0:1.0	.	163	Q9BXF9	TEKT3_HUMAN	V	163	ENSP00000379263:E163V;ENSP00000343995:E163V	ENSP00000343995:E163V	E	-	2	0	TEKT3	15175140	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.655000	0.83696	2.266000	0.75297	0.533000	0.62120	GAG		0.418	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898		Missense_Mutation
GID4	79018	broad.mit.edu	37	17	17962265	17962265	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:17962265C>T	ENST00000268719.4	+	4	863	c.690C>T	c.(688-690)taC>taT	p.Y230Y		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	230								p.Y230Y(1)									ATGGAGACTACGTCTTCATGA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	17											74.0	67.0	70.0					17																	17962265		2203	4300	6503	17902990	SO:0001819	synonymous_variant	79018			AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.690C>T	17.37:g.17962265C>T		Unknown		x	x	x	17902990	Q8TEB5|Q9BW50	Silent	SNP	ENST00000268719.4	37	CCDS11190.1	SNP	19	Broad																																																																																				0.463	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132071.2	NM_024052		Silent
RHOT1	55288	broad.mit.edu	37	17	30529839	30529839	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:30529839G>C	ENST00000333942.6	+	15	1491	c.1252G>C	c.(1252-1254)Gtg>Ctg	p.V418L	RHOT1_ENST00000545287.2_Missense_Mutation_p.V418L|RHOT1_ENST00000354266.3_Missense_Mutation_p.V397L|RHOT1_ENST00000583994.1_Missense_Mutation_p.V291L|RHOT1_ENST00000394692.2_Missense_Mutation_p.V418L|RHOT1_ENST00000358365.3_Missense_Mutation_p.V418L|RHOT1_ENST00000581094.1_Missense_Mutation_p.V418L	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	418	Miro 2.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V418L(1)		NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TCAAAGAAATGTGTTCAGATG	0.318																																																1	Substitution - Missense(1)	ovary(1)	17											98.0	106.0	103.0					17																	30529839		2203	4299	6502	27553952	SO:0001583	missense	55288			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1252G>C	17.37:g.30529839G>C	ENSP00000334724:p.Val418Leu	Unknown		x	x	x	27553952	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	37	CCDS32612.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118385	0.56505	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.21543	2.0;2.0;2.0	5.47	5.47	0.80525	MIRO (1);	0.000000	0.85682	D	0.000000	T	0.57066	0.2028	M	0.89968	3.075	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;0.999;0.997	D;P;D;D	0.91635	0.999;0.831;0.967;0.919	T	0.66160	-0.5993	10	0.87932	D	0	-8.0249	19.3261	0.94262	0.0:0.0:1.0:0.0	.	418;418;418;418	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	L	418	ENSP00000351132:V418L;ENSP00000378184:V418L;ENSP00000334724:V418L	ENSP00000334724:V418L	V	+	1	0	RHOT1	27553952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.728000	0.98792	2.569000	0.86673	0.585000	0.79938	GTG		0.318	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307		Missense_Mutation
GGNBP2	79893	broad.mit.edu	37	17	34943520	34943520	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:34943520G>C	ENST00000304718.4	+	13	2051	c.1735G>C	c.(1735-1737)Gat>Cat	p.D579H		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	579					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.D579H(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		CAAGACCAAAGATACACATCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	17											150.0	142.0	145.0					17																	34943520		2203	4300	6503	32017633	SO:0001583	missense	79893			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1735G>C	17.37:g.34943520G>C	ENSP00000307617:p.Asp579His	Unknown		x	x	x	32017633	B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	ENST00000304718.4	37	CCDS11314.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059505	0.76074	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.93	5.93	0.95920	.	0.209202	0.49305	D	0.000156	T	0.59101	0.2169	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60414	-0.7268	9	0.26408	T	0.33	-20.9135	18.5243	0.90965	0.0:0.0:1.0:0.0	.	579	Q9H3C7	GGNB2_HUMAN	H	579	.	ENSP00000307617:D579H	D	+	1	0	GGNBP2	32017633	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.763000	0.74955	2.815000	0.96918	0.561000	0.74099	GAT		0.458	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835		Missense_Mutation
CCR10	2826	broad.mit.edu	37	17	40832606	40832606	+	Silent	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:40832606T>C	ENST00000332438.4	-	2	73	c.54A>G	c.(52-54)gaA>gaG	p.E18E	CTD-3193K9.4_ENST00000593139.1_RNA|CNTNAP1_ENST00000264638.4_5'Flank|CTD-3193K9.3_ENST00000592440.1_RNA|CCR10_ENST00000591765.1_5'UTR	NM_016602.2	NP_057686.2	P46092	CCR10_HUMAN	chemokine (C-C motif) receptor 10	18					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)	p.E18E(1)		lung(1)|ovary(1)|skin(1)	3		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)		ATGCGTCCTCTTCATCCCCAG	0.597																																																1	Substitution - coding silent(1)	ovary(1)	17											39.0	36.0	37.0					17																	40832606		2176	4261	6437	38086132	SO:0001819	synonymous_variant	2826			AF215981	CCDS11435.1	17q21.1-q21.3	2012-08-08	2004-11-12	2004-11-12	ENSG00000184451	ENSG00000184451		"""GPCR / Class A : Chemokine receptors : C-C motif"""	4474	protein-coding gene	gene with protein product		600240	"""G protein-coupled receptor 2"""	GPR2		7851889	Standard	NM_016602		Approved		uc002iax.4	P46092	OTTHUMG00000132301	ENST00000332438.4:c.54A>G	17.37:g.40832606T>C		Unknown		x	x	x	38086132	Q4V749|Q6T7X2|Q9NZG2	Silent	SNP	ENST00000332438.4	37	CCDS11435.1	SNP	56	Broad																																																																																				0.597	CCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255406.1	NM_016602		Silent
KIF2B	84643	broad.mit.edu	37	17	51901684	51901684	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:51901684G>C	ENST00000268919.4	+	1	1446	c.1290G>C	c.(1288-1290)caG>caC	p.Q430H		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	430	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q430H(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CAGTGTTCCAGATCATCCTGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	17											80.0	64.0	69.0					17																	51901684		2203	4300	6503	49256683	SO:0001583	missense	84643			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1290G>C	17.37:g.51901684G>C	ENSP00000268919:p.Gln430His	Unknown		x	x	x	49256683	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817943	0.32145	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.18502	2.21	5.73	3.75	0.43078	Kinesin, motor domain (5);	0.000000	0.42682	D	0.000678	T	0.46132	0.1377	M	0.88512	2.96	0.43930	D	0.996583	D	0.89917	1.0	D	0.77004	0.989	T	0.53078	-0.8489	10	0.66056	D	0.02	.	12.1358	0.53970	0.1393:0.0:0.8607:0.0	.	430	Q8N4N8	KIF2B_HUMAN	H	430;318	ENSP00000268919:Q430H	ENSP00000268919:Q430H	Q	+	3	2	KIF2B	49256683	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	2.822000	0.48073	0.885000	0.36088	-0.140000	0.14226	CAG		0.502	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559		Missense_Mutation
RNF213	57674	broad.mit.edu	37	17	78319618	78319618	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:78319618A>C	ENST00000582970.1	+	29	7626	c.7483A>C	c.(7483-7485)Ata>Cta	p.I2495L	RNF213_ENST00000508628.2_Missense_Mutation_p.I2544L|RNF213_ENST00000336301.6_Missense_Mutation_p.I568L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2495					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I568L(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AACGGAAGCTATAAGCTGTAT	0.488																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	105.0	109.0					17																	78319618		2203	4300	6503	75934213	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.7483A>C	17.37:g.78319618A>C	ENSP00000464087:p.Ile2495Leu	Unknown		x	x	x	75934213	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	3.715	-0.058742	0.07317	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.43294	0.95;1.13	5.42	-3.78	0.04333	ATPase, AAA+ type, core (1);	0.754197	0.12618	N	0.453260	T	0.33000	0.0848	L	0.40543	1.245	0.09310	N	0.999994	B	0.15141	0.012	B	0.18263	0.021	T	0.13656	-1.0501	10	0.30854	T	0.27	.	16.4445	0.83913	0.479:0.0:0.521:0.0	.	568	Q63HN8	RN213_HUMAN	L	2495;2544;568	ENSP00000425956:I2495L;ENSP00000338218:I568L	ENSP00000338218:I568L	I	+	1	0	RNF213	75934213	0.013000	0.17824	0.000000	0.03702	0.009000	0.06853	0.254000	0.18314	-1.027000	0.03325	-2.200000	0.00306	ATA		0.488	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		Missense_Mutation
CEP192	55125	broad.mit.edu	37	18	13114130	13114130	+	Splice_Site	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr18:13114130G>C	ENST00000325971.8	+	40	6974	c.5381G>C	c.(5380-5382)aGc>aCc	p.S1794T	CEP192_ENST00000430049.2_Splice_Site_p.S1915T|CEP192_ENST00000540847.2_3'UTR|CEP192_ENST00000506447.1_Splice_Site_p.S2390T			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1794					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.S1794T(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TCTGTATAGAGCATCGAAGCA	0.343																																																1	Substitution - Missense(1)	ovary(1)	18											104.0	105.0	104.0					18																	13114130		2203	4300	6503	13104130	SO:0001630	splice_region_variant	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5380-1G>C	18.37:g.13114130G>C		Unknown		x	x	x	13104130	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217351	0.39201	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.06933	3.24;3.24;3.25	5.19	4.31	0.51392	.	0.183652	0.48286	D	0.000183	T	0.09379	0.0231	M	0.64997	1.995	0.29641	N	0.844723	B;B;B;P	0.40476	0.091;0.01;0.041;0.718	B;B;B;B	0.32762	0.037;0.01;0.011;0.152	T	0.09335	-1.0679	10	0.41790	T	0.15	-1.2489	12.7765	0.57451	0.0819:0.0:0.9181:0.0	.	1915;2390;394;992	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	T	2390;1794;1794;1915;394	ENSP00000427550:S2390T;ENSP00000317156:S1794T;ENSP00000389190:S1915T	ENSP00000317156:S1794T	S	+	2	0	CEP192	13104130	1.000000	0.71417	0.659000	0.29680	0.017000	0.09413	5.524000	0.67105	2.433000	0.82419	0.455000	0.32223	AGC		0.343	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	Missense_Mutation	Missense_Mutation
DSG3	1830	broad.mit.edu	37	18	29046617	29046617	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr18:29046617C>T	ENST00000257189.4	+	11	1619	c.1536C>T	c.(1534-1536)tcC>tcT	p.S512S		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	512					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S512S(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGGTTGTCTCCGCTAGAACAC	0.448																																																1	Substitution - coding silent(1)	ovary(1)	18											141.0	126.0	131.0					18																	29046617		2203	4300	6503	27300615	SO:0001819	synonymous_variant	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1536C>T	18.37:g.29046617C>T		Unknown		x	x	x	27300615	A8K2V2	Silent	SNP	ENST00000257189.4	37	CCDS11898.1	SNP	23	Broad																																																																																				0.448	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		Silent
RFX2	5990	broad.mit.edu	37	19	6002737	6002737	+	Missense_Mutation	SNP	C	C	G	rs140937075		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:6002737C>G	ENST00000303657.5	-	14	1794	c.1645G>C	c.(1645-1647)Gtg>Ctg	p.V549L	RFX2_ENST00000592546.1_Missense_Mutation_p.V524L|RFX2_ENST00000359161.3_Missense_Mutation_p.V549L|CTC-232P5.1_ENST00000587836.1_RNA	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	549					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.V549L(1)		breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GTCACCTGCACGTTGGCAAAG	0.662																																					Colon(38;171 817 19800 47433 48051)											1	Substitution - Missense(1)	ovary(1)	19											101.0	73.0	82.0					19																	6002737		2203	4300	6503	5953737	SO:0001583	missense	5990				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1645G>C	19.37:g.6002737C>G	ENSP00000306335:p.Val549Leu	Unknown		x	x	x	5953737	A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	37	CCDS12157.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	33	5.279661	0.95489	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.46819	0.86	4.74	4.74	0.60224	.	0.126937	0.52532	N	0.000065	T	0.64011	0.2560	M	0.75777	2.31	0.80722	D	1	D;P	0.55605	0.972;0.952	P;P	0.55871	0.786;0.687	T	0.70260	-0.4921	10	0.87932	D	0	-39.3134	16.6557	0.85227	0.0:1.0:0.0:0.0	.	524;549	P48378-2;P48378	.;RFX2_HUMAN	L	549;524;336	ENSP00000306335:V549L	ENSP00000306335:V549L	V	-	1	0	RFX2	5953737	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.552000	0.82192	2.323000	0.78572	0.655000	0.94253	GTG		0.662	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	NM_000635		Missense_Mutation
CTXN1	404217	broad.mit.edu	37	19	7990283	7990283	+	Silent	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:7990283C>G	ENST00000318978.4	-	2	360	c.141G>C	c.(139-141)gtG>gtC	p.V47V	CTD-3193O13.8_ENST00000594308.1_RNA|TIMM44_ENST00000598968.1_5'Flank	NM_206833.3	NP_996664.1	P60606	CTXN1_HUMAN	cortexin 1	47						integral component of membrane (GO:0016021)		p.V47V(1)		ovary(1)	1						GCACGCAGCGCACCATCAACA	0.711																																																1	Substitution - coding silent(1)	ovary(1)	19											23.0	24.0	24.0					19																	7990283		2184	4292	6476	7896283	SO:0001819	synonymous_variant	404217			AK098834	CCDS12191.1	19p13.2	2012-10-02			ENSG00000178531	ENSG00000178531			31108	protein-coding gene	gene with protein product		600135					Standard	NM_206833		Approved	FLJ25968	uc002miy.4	P60606		ENST00000318978.4:c.141G>C	19.37:g.7990283C>G		Unknown		x	x	x	7896283		Silent	SNP	ENST00000318978.4	37	CCDS12191.1	SNP	25	Broad																																																																																				0.711	CTXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461614.1			Silent
MUC16	94025	broad.mit.edu	37	19	9074946	9074946	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:9074946G>C	ENST00000397910.4	-	3	12703	c.12500C>G	c.(12499-12501)gCt>gGt	p.A4167G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4169	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A4167G(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CGAGGTTGTAGCATGGATAGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											157.0	146.0	149.0					19																	9074946		1977	4165	6142	8935946	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12500C>G	19.37:g.9074946G>C	ENSP00000381008:p.Ala4167Gly	Somatic		x	x	x	8935946	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	g	6.470	0.454876	0.12283	.	.	ENSG00000181143	ENST00000397910	T	0.26660	1.72	1.49	-1.17	0.09648	.	.	.	.	.	T	0.12944	0.0314	L	0.29908	0.895	.	.	.	P	0.52061	0.95	B	0.36766	0.232	T	0.20107	-1.0285	8	0.87932	D	0	.	3.5646	0.07895	0.0:0.2806:0.4345:0.2849	.	4167	B5ME49	.	G	4167	ENSP00000381008:A4167G	ENSP00000381008:A4167G	A	-	2	0	MUC16	8935946	0.000000	0.05858	0.000000	0.03702	0.408000	0.30992	-3.077000	0.00615	-0.215000	0.10063	0.313000	0.20887	GCT		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		Missense_Mutation
PRKCSH	5589	broad.mit.edu	37	19	11547013	11547013	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:11547013C>T	ENST00000589838.1	+	1	75	c.75C>T	c.(73-75)ctC>ctT	p.L25L	PRKCSH_ENST00000587327.1_Silent_p.L25L|snoU13_ENST00000459022.1_RNA|CCDC151_ENST00000586836.1_5'Flank|PRKCSH_ENST00000592741.1_Silent_p.L25L|PRKCSH_ENST00000252455.2_Silent_p.L25L|CCDC151_ENST00000545100.1_5'Flank|CCDC151_ENST00000591179.1_5'Flank|PRKCSH_ENST00000591462.1_Silent_p.L25L|PRKCSH_ENST00000412601.1_Silent_p.L25L|CCDC151_ENST00000356392.4_5'Flank			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	25					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.L25L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GCGTCTCCCTCACCAGTGAGT	0.617											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	19											35.0	30.0	31.0					19																	11547013		2197	4290	6487	11408013	SO:0001819	synonymous_variant	5589				CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.75C>T	19.37:g.11547013C>T		Unknown	673	x	x	x	11408013	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1	SNP	29	Broad																																																																																				0.617	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1			Silent
PGLYRP2	114770	broad.mit.edu	37	19	15579505	15579505	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:15579505G>T	ENST00000340880.4	-	5	2180	c.1700C>A	c.(1699-1701)cCa>cAa	p.P567Q	PGLYRP2_ENST00000292609.4_3'UTR	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	567					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.P567Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						CAGGGTCCTTGGGGGTGGCTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											111.0	117.0	115.0					19																	15579505		1939	4136	6075	15440505	SO:0001583	missense	114770			AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1700C>A	19.37:g.15579505G>T	ENSP00000345968:p.Pro567Gln	Unknown		x	x	x	15440505	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	37	CCDS12330.2	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	9.393	1.076087	0.20227	.	.	ENSG00000161031	ENST00000340880	T	0.04194	3.68	3.26	-3.16	0.05217	.	.	.	.	.	T	0.02727	0.0082	L	0.40543	1.245	0.09310	N	1	P	0.39964	0.697	B	0.32289	0.143	T	0.44620	-0.9316	9	0.12430	T	0.62	.	4.3242	0.11032	0.4268:0.1696:0.4036:0.0	.	567	Q96PD5	PGRP2_HUMAN	Q	567	ENSP00000345968:P567Q	ENSP00000345968:P567Q	P	-	2	0	PGLYRP2	15440505	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.878000	0.04192	-0.511000	0.06514	-0.133000	0.14855	CCA		0.507	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890		Missense_Mutation
PROSER3	148137	broad.mit.edu	37	19	36255763	36255763	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:36255763C>T	ENST00000544099.1	+	6	615	c.552C>T	c.(550-552)caC>caT	p.H184H	C19orf55_ENST00000396908.4_Silent_p.H184H			Q2NL68	PRSR3_HUMAN		184								p.H184H(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGAACCTCCACACATGGAACT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	19											34.0	41.0	39.0					19																	36255763		2098	4225	6323	40947603	SO:0001819	synonymous_variant	148137																														ENST00000544099.1:c.552C>T	19.37:g.36255763C>T		Unknown		x	x	x	40947603	Q8NDI3|Q8WWC8|Q96NL4	Silent	SNP	ENST00000544099.1	37		SNP	17	Broad																																																																																				0.622	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2			Silent
HKR1	284459	broad.mit.edu	37	19	37853136	37853136	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:37853136C>T	ENST00000324411.4	+	6	708	c.439C>T	c.(439-441)Cct>Tct	p.P147S	HKR1_ENST00000586897.1_3'UTR|HKR1_ENST00000544914.1_5'UTR|HKR1_ENST00000392153.3_Missense_Mutation_p.P128S|HKR1_ENST00000591471.1_5'UTR|HKR1_ENST00000541583.2_Missense_Mutation_p.P86S|HKR1_ENST00000589392.1_Missense_Mutation_p.P129S|HKR1_ENST00000591134.1_Intron	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	147					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P147S(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGCAGGAAATCCTCTCCACCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	19											82.0	82.0	82.0					19																	37853136		2203	4300	6503	42544976	SO:0001583	missense	284459			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.439C>T	19.37:g.37853136C>T	ENSP00000315505:p.Pro147Ser	Unknown		x	x	x	42544976	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	2.100	-0.406185	0.04832	.	.	ENSG00000181666	ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T	0.05649	3.57;3.52;3.41	2.71	2.71	0.32032	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.80722	D	1	B;B;B;B	0.30482	0.18;0.228;0.281;0.18	B;B;B;B	0.29862	0.025;0.108;0.025;0.025	T	0.47898	-0.9081	9	0.09338	T	0.73	0.8199	11.6642	0.51364	0.0:1.0:0.0:0.0	.	86;128;147;129	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	S	86;128;183;147;86	ENSP00000375994:P128S;ENSP00000315505:P147S;ENSP00000438261:P86S	ENSP00000315505:P147S	P	+	1	0	HKR1	42544976	0.000000	0.05858	0.551000	0.28230	0.666000	0.39218	0.505000	0.22642	1.821000	0.53095	0.650000	0.86243	CCT		0.478	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		Missense_Mutation
CATSPERG	57828	broad.mit.edu	37	19	38861335	38861335	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:38861335C>T	ENST00000409235.3	+	29	3498	c.3383C>T	c.(3382-3384)tCt>tTt	p.S1128F	CATSPERG_ENST00000410018.1_Missense_Mutation_p.S1088F|CATSPERG_ENST00000215069.4_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	1128					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.S768F(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						AGCATGCCGTCTCTGAGACAT	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											152.0	137.0	142.0					19																	38861335		2203	4300	6503	43553175	SO:0001583	missense	57828			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.3383C>T	19.37:g.38861335C>T	ENSP00000386962:p.Ser1128Phe	Unknown		x	x	x	43553175	A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	37	CCDS12514.2	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712933	0.48517	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410	T;T	0.28895	1.6;1.59	3.25	3.25	0.37280	.	2.847580	0.01174	N	0.006938	T	0.45657	0.1353	N	0.24115	0.695	0.39799	D	0.97254	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.44937	-0.9295	10	0.87932	D	0	-0.7155	10.2829	0.43550	0.0:1.0:0.0:0.0	.	1128;1088	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	F	1088;1128;1128	ENSP00000387057:S1088F;ENSP00000386962:S1128F	ENSP00000386962:S1128F	S	+	2	0	CATSPERG	43553175	0.002000	0.14202	0.024000	0.17045	0.021000	0.10359	1.010000	0.29898	2.136000	0.66102	0.484000	0.47621	TCT		0.537	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185		Missense_Mutation
CALM3	808	broad.mit.edu	37	19	47112395	47112395	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr19:47112395G>C	ENST00000291295.9	+	6	634	c.435G>C	c.(433-435)atG>atC	p.M145I	CALM3_ENST00000391918.2_Missense_Mutation_p.M109I|CTB-12A17.3_ENST00000597609.1_RNA|CALM3_ENST00000596362.1_Missense_Mutation_p.M145I|CALM3_ENST00000594523.1_Missense_Mutation_p.M109I|CALM3_ENST00000599839.1_Missense_Mutation_p.M109I|CALM3_ENST00000477244.1_3'UTR|CALM3_ENST00000597743.1_Missense_Mutation_p.M79I|CALM3_ENST00000598871.1_Missense_Mutation_p.M109I	NM_005184.2	NP_005175.2	P62158	CALM_HUMAN	calmodulin 3 (phosphorylase kinase, delta)	145	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)	p.M145I(1)		breast(1)|cervix(2)|endometrium(1)|lung(1)|ovary(1)	6		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	TTGTACAGATGATGACTGCAA	0.602																																																1	Substitution - Missense(1)	ovary(1)	19											53.0	47.0	49.0					19																	47112395		2203	4300	6503	51804235	SO:0001583	missense	808				CCDS33061.1	19q13.2-q13.3	2013-02-25			ENSG00000160014	ENSG00000160014		"""EF-hand domain containing"", ""Endogenous ligands"""	1449	protein-coding gene	gene with protein product	"""prepro-calmodulin 3"""	114183					Standard	NM_005184		Approved	PHKD	uc002pew.3	P62158	OTTHUMG00000133517	ENST00000291295.9:c.435G>C	19.37:g.47112395G>C	ENSP00000291295:p.Met145Ile	Somatic		x	x	x	51804235	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Missense_Mutation	SNP	ENST00000291295.9	37	CCDS33061.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771055	0.49680	.	.	ENSG00000160014	ENST00000291295;ENST00000391918	T	0.57107	0.42	4.86	4.86	0.63082	.	0.094831	0.46758	N	0.000269	T	0.38746	0.1052	N	0.03071	-0.42	0.80722	D	1	.	.	.	.	.	.	T	0.54357	-0.8306	8	0.87932	D	0	-20.9666	15.5217	0.75871	0.0:0.0:1.0:0.0	.	.	.	.	I	145	ENSP00000291295:M145I	ENSP00000291295:M145I	M	+	3	0	CALM3	51804235	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.652000	0.98499	2.507000	0.84556	0.655000	0.94253	ATG		0.602	CALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257483.2			Missense_Mutation
AC113607.3	0	broad.mit.edu	37	2	905896	905896	+	RNA	SNP	T	T	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:905896T>A	ENST00000427019.1	-	0	1178																		p.H17L(1)									CTGCGTCTGGTGTTTCAGTTC	0.602																																																1	Substitution - Missense(1)	ovary(1)	2											179.0	172.0	174.0					2																	905896		1969	4149	6118	895896			391343																															2.37:g.905896T>A		Unknown		x	x	x	895896		Missense_Mutation	SNP	ENST00000427019.1	37		SNP	59	Broad																																																																																				0.602	AC113607.3-001	KNOWN	basic	antisense	antisense	OTTHUMT00000322408.1			Missense_Mutation
BIRC6	57448	broad.mit.edu	37	2	32690187	32690187	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:32690187C>G	ENST00000421745.2	+	26	5445	c.5311C>G	c.(5311-5313)Caa>Gaa	p.Q1771E		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1771					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.Q1743E(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ACATTTTCTTCAACCTCCGCC	0.343																																					Pancreas(94;175 1509 16028 18060 45422)											1	Substitution - Missense(1)	ovary(1)	2											55.0	55.0	55.0					2																	32690187		2203	4299	6502	32543691	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.5311C>G	2.37:g.32690187C>G	ENSP00000393596:p.Gln1771Glu	Unknown		x	x	x	32543691	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865899	0.71949	.	.	ENSG00000115760	ENST00000421745	T	0.73897	-0.79	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.82651	0.5083	L	0.47716	1.5	0.80722	D	1	P	0.49447	0.924	P	0.62298	0.9	T	0.80865	-0.1191	10	0.48119	T	0.1	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	1771	Q9NR09	BIRC6_HUMAN	E	1771	ENSP00000393596:Q1771E	ENSP00000393596:Q1771E	Q	+	1	0	BIRC6	32543691	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.818000	0.86416	2.810000	0.96702	0.650000	0.86243	CAA		0.343	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252		Missense_Mutation
PUS10	150962	broad.mit.edu	37	2	61180218	61180218	+	Nonsense_Mutation	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:61180218C>A	ENST00000316752.6	-	15	1483	c.1222G>T	c.(1222-1224)Gaa>Taa	p.E408*	PUS10_ENST00000407787.1_Nonsense_Mutation_p.E408*	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	408					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)	p.E408*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			GTCTTTTCTTCTTCACCTTCT	0.318																																																1	Substitution - Nonsense(1)	ovary(1)	2											283.0	266.0	271.0					2																	61180218		2203	4300	6503	61033722	SO:0001587	stop_gained	150962			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.1222G>T	2.37:g.61180218C>A	ENSP00000326003:p.Glu408*	Unknown		x	x	x	61033722	Q5JPJ5|Q96MI8	Nonsense_Mutation	SNP	ENST00000316752.6	37	CCDS1865.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.933441	0.97116	.	.	ENSG00000162927	ENST00000316752;ENST00000407787	.	.	.	5.65	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-7.9721	14.5491	0.68054	0.0:0.9296:0.0:0.0704	.	.	.	.	X	408	.	ENSP00000326003:E408X	E	-	1	0	PUS10	61033722	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.432000	0.66514	1.405000	0.46838	0.484000	0.47621	GAA		0.318	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709		Nonsense_Mutation
ADD2	119	broad.mit.edu	37	2	70900428	70900428	+	Intron	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:70900428C>G	ENST00000264436.4	-	15	2186				ADD2_ENST00000407644.2_Intron|ADD2_ENST00000355733.3_Missense_Mutation_p.G591A	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)	p.G591A(1)		autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CACGGCCGGACCAGAGCCTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	68.0	69.0					2																	70900428		2203	4300	6503	70753936	SO:0001627	intron_variant	119			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1742-290G>C	2.37:g.70900428C>G		Unknown		x	x	x	70753936	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.726951	0.00694	.	.	ENSG00000075340	ENST00000355733	T	0.06449	3.3	1.9	-0.317	0.12736	.	.	.	.	.	T	0.02230	0.0069	.	.	.	0.09310	N	1	B	0.15930	0.015	B	0.17098	0.017	T	0.46652	-0.9176	8	0.06625	T	0.88	.	2.6268	0.04932	0.0:0.4609:0.3114:0.2277	.	591	P35612-3	.	A	591	ENSP00000347972:G591A	ENSP00000347972:G591A	G	-	2	0	ADD2	70753936	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.256000	0.08757	-0.096000	0.12329	0.650000	0.86243	GGT		0.542	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617		Missense_Mutation
CNTNAP5	129684	broad.mit.edu	37	2	125530421	125530421	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:125530421T>C	ENST00000431078.1	+	17	2940	c.2576T>C	c.(2575-2577)gTg>gCg	p.V859A		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	859	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.V859A(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AATGGTCCTGTGGAGCTTGTA	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											181.0	168.0	172.0					2																	125530421		1942	4141	6083	125246891	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2576T>C	2.37:g.125530421T>C	ENSP00000399013:p.Val859Ala	Unknown		x	x	x	125246891	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	t	5.608	0.296954	0.10622	.	.	ENSG00000155052	ENST00000431078	T	0.76578	-1.03	5.49	4.31	0.51392	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.477600	0.04600	N	0.398417	T	0.63094	0.2482	N	0.20445	0.575	0.09310	N	1	B	0.24823	0.112	B	0.30716	0.119	T	0.54649	-0.8262	10	0.06365	T	0.9	.	4.2645	0.10757	0.0:0.16:0.1837:0.6563	.	859	Q8WYK1	CNTP5_HUMAN	A	859	ENSP00000399013:V859A	ENSP00000399013:V859A	V	+	2	0	CNTNAP5	125246891	0.015000	0.18098	0.003000	0.11579	0.056000	0.15407	2.075000	0.41538	0.904000	0.36572	0.524000	0.50904	GTG		0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			Missense_Mutation
MYO7B	4648	broad.mit.edu	37	2	128384886	128384886	+	Splice_Site	SNP	G	G	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:128384886G>T	ENST00000409816.2	+	31	4414		c.e31+1		MYO7B_ENST00000389524.4_Splice_Site|RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000409090.1_Splice_Site|MYO7B_ENST00000428314.1_Splice_Site			Q6PIF6	MYO7B_HUMAN	myosin VIIB							extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V1458L(1)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCACCAACAGGTGCGGGCCCT	0.592																																																1	Substitution - Missense(1)	ovary(1)	2											33.0	34.0	34.0					2																	128384886		1924	4113	6037	128101356	SO:0001630	splice_region_variant	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.4382+1G>T	2.37:g.128384886G>T		Unknown		x	x	x	128101356	Q14786|Q8TEE1	Splice_Site_SNP	SNP	ENST00000409816.2	37	CCDS46405.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|g	13.71|13.71	2.317594|2.317594	0.40996|0.40996	.|.	.|.	ENSG00000169994|ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816;ENST00000409090|ENST00000272666	.|.	.|.	.|.	4.78|4.78	4.78|4.78	0.61160|0.61160	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62380	.|0.2423	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.55134	.|-0.8188	.|5	.|0.13470	.|T	.|0.59	.|.	17.9827|17.9827	0.89146|0.89146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|L	-1|311	.|.	.|ENSP00000272666:V311L	.|V	+|+	.|1	.|0	MYO7B|MYO7B	128101356|128101356	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.156000|0.156000	0.22039|0.22039	9.148000|9.148000	0.94652|0.94652	2.488000|2.488000	0.83962|0.83962	0.561000|0.561000	0.74099|0.74099	.|GTG		0.592	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	Intron	Splice_Site_SNP
MFSD6	54842	broad.mit.edu	37	2	191301408	191301408	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:191301408C>G	ENST00000392328.1	+	3	977	c.653C>G	c.(652-654)cCa>cGa	p.P218R	MFSD6_ENST00000281416.7_Missense_Mutation_p.P218R	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	218					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P218R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CCAACAGCTCCAAACATGAAC	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	89.0	88.0					2																	191301408		2203	4300	6503	191009653	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.653C>G	2.37:g.191301408C>G	ENSP00000376141:p.Pro218Arg	Unknown		x	x	x	191009653	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	CCDS2306.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.228069	0.00280	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.30714	1.52;1.52	5.54	-3.39	0.04868	Major facilitator superfamily domain, general substrate transporter (1);	2.133840	0.01337	N	0.011446	T	0.19327	0.0464	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16630	-1.0396	10	0.13853	T	0.58	5.0121	8.3519	0.32307	0.1217:0.3248:0.0:0.5535	.	218	Q6ZSS7	MFSD6_HUMAN	R	218	ENSP00000376141:P218R;ENSP00000281416:P218R	ENSP00000281416:P218R	P	+	2	0	MFSD6	191009653	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.118000	0.15605	-0.729000	0.04875	-1.761000	0.00669	CCA		0.453	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1			Missense_Mutation
CHPF	79586	broad.mit.edu	37	2	220405747	220405748	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:220405747_220405748GG>AT	ENST00000243776.6	-	3	1236_1237	c.988_989CC>AT	c.(988-990)CCt>ATt	p.P330I	TMEM198_ENST00000373883.3_5'Flank|TMEM198_ENST00000344458.2_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.P168I	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	330					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.P330I(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CATGTGCACAGGGTCACGCACA	0.604																																																1	Substitution - Missense(1)	ovary(1)	2																																								220113992	SO:0001583	missense	79586			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.988_989delinsAT	2.37:g.220405747_220405748delinsAT	ENSP00000243776:p.Pro330Ile	Unknown		x	x	x	220113991	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	DNP	ENST00000243776.6	37	CCDS2443.1	DNP	35	Broad																																																																																				0.604	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536		Missense_Mutation
PTMA	5757	broad.mit.edu	37	2	232573422	232573422	+	Silent	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:232573422A>G	ENST00000341369.7	+	1	197	c.6A>G	c.(4-6)tcA>tcG	p.S2S	PTMA_ENST00000410064.1_5'Flank|PTMA_ENST00000409321.1_Splice_Site|PTMA_ENST00000409683.1_Silent_p.S2S|MGC4771_ENST00000595658.1_5'Flank|PTMA_ENST00000466801.1_Intron|PTMA_ENST00000409115.3_Silent_p.S2S	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	2					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.S2S(1)		lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		CCACCATGTCAGACGCAGCCG	0.667																																																1	Substitution - coding silent(1)	ovary(1)	2											18.0	20.0	19.0					2																	232573422		1620	3624	5244	232281666	SO:0001819	synonymous_variant	5757				CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.6A>G	2.37:g.232573422A>G		Unknown		x	x	x	232281666	Q15249|Q15592	Silent	SNP	ENST00000341369.7	37	CCDS42833.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	15.40	2.821600	0.50633	.	.	ENSG00000187514	ENST00000409321	.	.	.	3.36	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7665	0.28982	0.5807:0.4193:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTMA	232281666	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.424000	0.34848	0.441000	0.26529	0.459000	0.35465	.		0.667	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332553.1			Silent
INPP5D	3635	broad.mit.edu	37	2	233986823	233986823	+	Missense_Mutation	SNP	G	G	A	rs369614981		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:233986823G>A	ENST00000359570.5	+	3	205	c.205G>A	c.(205-207)Gaa>Aaa	p.E69K	INPP5D_ENST00000474278.1_3'UTR|INPP5D_ENST00000538935.1_Missense_Mutation_p.E69K			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	69	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)	p.E69K(1)		central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TCAGGCATCCGAAGGCGTCTC	0.522																																					NSCLC(82;1215 1426 16163 20348 41018)											1	Substitution - Missense(1)	ovary(1)	2						G	LYS/GLU,LYS/GLU	0,4164		0,0,2082	105.0	108.0	107.0		205,205	5.5	1.0	2		107	1,8413		0,1,4206	no	missense,missense	INPP5D	NM_001017915.1.dup,NM_005541.3.dup	56,56	0,1,6288	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging	69/233,69/232	233986823	1,12577	2082	4207	6289	233695067	SO:0001583	missense	3635			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.205G>A	2.37:g.233986823G>A	ENSP00000352575:p.Glu69Lys	Unknown		x	x	x	233695067	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37		SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	g	18.23	3.578852	0.65878	0.0	1.19E-4	ENSG00000168918	ENST00000422935;ENST00000451407;ENST00000359570;ENST00000538935	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	5.52	5.52	0.82312	SH2 motif (4);	0.103067	0.64402	D	0.000003	D	0.94525	0.8237	.	.	.	0.42755	D	0.993785	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95044	0.8181	9	0.72032	D	0.01	.	16.4165	0.83743	0.0:0.0:1.0:0.0	.	69;69	Q92835-2;Q92835	.;SHIP1_HUMAN	K	69	ENSP00000409018:E69K;ENSP00000415253:E69K;ENSP00000352575:E69K;ENSP00000441010:E69K	ENSP00000352575:E69K	E	+	1	0	INPP5D	233695067	1.000000	0.71417	0.965000	0.40720	0.099000	0.18886	7.532000	0.81985	2.593000	0.87608	0.645000	0.84053	GAA		0.522	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915		Missense_Mutation
UGT1A1	54658	broad.mit.edu	37	2	234669456	234669456	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:234669456C>T	ENST00000608383.1	+	1	523	c.523C>T	c.(523-525)Ctg>Ttg	p.L175L	UGT1A6_ENST00000406651.1_Intron|UGT1A8_ENST00000305208.5_Silent_p.L175L|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000360418.3_Silent_p.L175L|UGT1A10_ENST00000373445.1_Intron|UGT1A3_ENST00000482026.1_Intron			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	175			L -> Q (in CN2; has low residual bilirubin glucuronidation activity of about 4.6% of that of the wild-type protein). {ECO:0000269|PubMed:11013440, ECO:0000269|PubMed:11370628, ECO:0000269|PubMed:7989595}.		acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CTTGCATGCACTGCCATGCAG	0.547																																																0			2											158.0	146.0	150.0					2																	234669456		2203	4300	6503	234334195	SO:0001819	synonymous_variant	54658			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.523C>T	2.37:g.234669456C>T		Unknown		x	x	x	234334195	A6NJC3|B8K286	Silent	SNP	ENST00000608383.1	37	CCDS2510.1	SNP	20	Broad																																																																																				0.547	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	protein_coding				Silent
FARP2	9855	broad.mit.edu	37	2	242396290	242396291	+	Silent	DNP	AG	AG	TC			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr2:242396290_242396291AG>TC	ENST00000264042.3	+	14	1710_1711	c.1540_1541AG>TC	c.(1540-1542)AGt>TCt	p.S514S	FARP2_ENST00000373287.4_Silent_p.S514S|FARP2_ENST00000545004.1_Silent_p.S514S	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	514					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S514S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CCCTGTCCTCAGTGATGCTGGC	0.639																																																1	Substitution - coding silent(1)	ovary(1)	2																																								242044964	SO:0001819	synonymous_variant	9855			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	Exception_encountered	2.37:g.242396290_242396291delinsTC		Unknown		x	x	x	242044963	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	DNP	ENST00000264042.3	37	CCDS33424.1	DNP	7	Broad																																																																																				0.639	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1			Silent
DPM1	8813	broad.mit.edu	37	20	49575039	49575039	+	Missense_Mutation	SNP	G	G	T	rs201392536	byFrequency	TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr20:49575039G>T	ENST00000371588.5	-	1	48	c.22C>A	c.(22-24)Cgt>Agt	p.R8S	DPM1_ENST00000371582.4_Missense_Mutation_p.R8S|MOCS3_ENST00000244051.1_5'Flank|DPM1_ENST00000371583.5_Missense_Mutation_p.R8S|DPM1_ENST00000466152.1_5'UTR	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit	8					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)	p.R8S(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						CGAGGACTACGACTGACTTCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	20											60.0	57.0	58.0					20																	49575039		2203	4300	6503	49008446	SO:0001583	missense	8813			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742	ENST00000371588.5:c.22C>A	20.37:g.49575039G>T	ENSP00000360644:p.Arg8Ser	Unknown		x	x	x	49008446	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	SNP	37	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.11|13.11	2.140017|2.140017	0.37728|0.37728	.|.	.|.	ENSG00000000419|ENSG00000000419	ENST00000371588;ENST00000371582;ENST00000449701;ENST00000371583;ENST00000413082|ENST00000371584	D;D;D;D|.	0.86366|.	-2.11;-2.11;-2.1;-1.67|.	5.48|5.48	-0.0705|-0.0705	0.13747|0.13747	.|.	0.655088|.	0.13930|.	N|.	0.352988|.	T|.	0.19604|.	0.0471|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|.	0.26883|.	-1.0090|.	9|.	.|.	.|.	.|.	0.2886|0.2886	12.4827|12.4827	0.55854|0.55854	0.0:0.5174:0.3582:0.1244|0.0:0.5174:0.3582:0.1244	.|.	8|.	O60762|.	DPM1_HUMAN|.	S|X	8|7	ENSP00000360644:R8S;ENSP00000360638:R8S;ENSP00000360639:R8S;ENSP00000394921:R8S|.	.|.	R|S	-|-	1|2	0|0	DPM1|DPM1	49008446|49008446	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.222000|-0.222000	0.09190|0.09190	-0.224000|-0.224000	0.09928|0.09928	-0.156000|-0.156000	0.13503|0.13503	CGT|TCG		0.572	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859		Missense_Mutation
CTCFL	140690	broad.mit.edu	37	20	56078560	56078560	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr20:56078560A>G	ENST00000608263.1	-	9	2433	c.1772T>C	c.(1771-1773)aTc>aCc	p.I591T	CTCFL_ENST00000608440.1_Missense_Mutation_p.I591T|CTCFL_ENST00000429804.3_Missense_Mutation_p.I541T|CTCFL_ENST00000243914.3_Missense_Mutation_p.I591T|CTCFL_ENST00000423479.3_Missense_Mutation_p.I591T|CTCFL_ENST00000433949.3_Missense_Mutation_p.I386T|CTCFL_ENST00000371196.2_Missense_Mutation_p.I591T|CTCFL_ENST00000609232.1_Missense_Mutation_p.I591T|CTCFL_ENST00000502686.2_Missense_Mutation_p.I329T	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	591					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)	p.I591T(1)		NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			TTCCTTCAGGATGGTCTGCTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	20											207.0	177.0	187.0					20																	56078560		2203	4300	6503	55511966	SO:0001583	missense	140690				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1772T>C	20.37:g.56078560A>G	ENSP00000476783:p.Ile591Thr	Unknown		x	x	x	55511966	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	1.714	-0.498316	0.04291	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686	T;T;T;T;T;T	0.09817	2.94;2.98;2.98;3.15;3.01;3.04	2.65	-5.29	0.02747	.	.	.	.	.	T	0.03520	0.0101	N	0.08118	0	0.09310	N	0.999998	B;B;B;B;B	0.12630	0.0;0.0;0.003;0.006;0.006	B;B;B;B;B	0.12156	0.0;0.0;0.007;0.007;0.005	T	0.42085	-0.9472	9	0.10111	T	0.7	2.7444	4.1714	0.10331	0.1734:0.5643:0.1194:0.1429	.	591;541;591;591;591	A6XGM2;E7EUE3;A1L4C6;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	T	591;591;591;541;591;329	ENSP00000415579:I591T;ENSP00000243914:I591T;ENSP00000360239:I591T;ENSP00000415329:I541T;ENSP00000392034:I591T;ENSP00000437999:I329T	ENSP00000243914:I591T	I	-	2	0	CTCFL	55511966	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.067000	0.03451	-2.017000	0.00944	0.402000	0.26972	ATC		0.502	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618		Missense_Mutation
OSBP2	23762	broad.mit.edu	37	22	31091221	31091221	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr22:31091221G>C	ENST00000332585.6	+	1	429	c.325G>C	c.(325-327)Gag>Cag	p.E109Q	OSBP2_ENST00000407373.1_Intron|OSBP2_ENST00000403222.3_Intron|OSBP2_ENST00000446658.2_Missense_Mutation_p.E109Q|OSBP2_ENST00000382310.3_Missense_Mutation_p.E109Q	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	109					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)	p.E109Q(2)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						GCCGGGGTCAGAGTCAAGCTC	0.682																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	22											29.0	38.0	35.0					22																	31091221		2082	4215	6297	29421221	SO:0001583	missense	23762				CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.325G>C	22.37:g.31091221G>C	ENSP00000332576:p.Glu109Gln	Unknown		x	x	x	29421221	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450274	0.43531	.	.	ENSG00000184792	ENST00000332585;ENST00000382310;ENST00000446658	T;T;T	0.35236	1.38;1.32;1.38	3.23	3.23	0.37069	.	15.719100	0.00166	N	0.000000	T	0.24812	0.0602	N	0.14661	0.345	0.24843	N	0.99245	B;B;B	0.34214	0.442;0.165;0.165	B;B;B	0.26517	0.07;0.051;0.051	T	0.21280	-1.0250	10	0.45353	T	0.12	.	10.1948	0.43047	0.0:0.0:0.8007:0.1993	.	109;109;109	B4DFA8;Q0VF99;Q969R2	.;.;OSBP2_HUMAN	Q	109	ENSP00000332576:E109Q;ENSP00000371747:E109Q;ENSP00000392080:E109Q	ENSP00000332576:E109Q	E	+	1	0	OSBP2	29421221	0.002000	0.14202	0.170000	0.22879	0.258000	0.26162	1.010000	0.29898	2.131000	0.65755	0.655000	0.94253	GAG		0.682	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321547.2	NM_030758		Missense_Mutation
TMPRSS6	164656	broad.mit.edu	37	22	37466555	37466555	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr22:37466555T>G	ENST00000346753.3	-	15	1953	c.1837A>C	c.(1837-1839)Ata>Cta	p.I613L	TMPRSS6_ENST00000381792.2_Missense_Mutation_p.I604L|TMPRSS6_ENST00000406725.1_Missense_Mutation_p.I604L|TMPRSS6_ENST00000406856.1_Missense_Mutation_p.I604L	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	613	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GCAGCTGTTATCACCCAGCGG	0.662																																																0			22											72.0	77.0	75.0					22																	37466555		2203	4299	6502	35796501	SO:0001583	missense	164656			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1837A>C	22.37:g.37466555T>G	ENSP00000334962:p.Ile613Leu	Unknown		x	x	x	35796501	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Missense_Mutation	SNP	ENST00000346753.3	37	CCDS13941.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	15.03	2.711327	0.48517	.	.	ENSG00000187045	ENST00000381792;ENST00000346753;ENST00000406725;ENST00000406856	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.44	-0.872	0.10638	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.446931	0.21289	N	0.077010	T	0.51007	0.1649	N	0.00793	-1.18	0.27359	N	0.956021	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.005	T	0.51434	-0.8706	10	0.39692	T	0.17	.	6.0643	0.19854	0.0:0.3816:0.2545:0.364	.	604;613	Q8IU80-5;Q8IU80	.;TMPS6_HUMAN	L	604;613;604;604	ENSP00000371211:I604L;ENSP00000334962:I613L;ENSP00000385453:I604L;ENSP00000384964:I604L	ENSP00000334962:I613L	I	-	1	0	TMPRSS6	35796501	0.967000	0.33354	0.281000	0.24762	0.992000	0.81027	0.670000	0.25157	0.068000	0.16574	-0.353000	0.07706	ATA		0.662	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609		Missense_Mutation
SAMM50	25813	broad.mit.edu	37	22	44371986	44371986	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr22:44371986G>A	ENST00000350028.4	+	8	857	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	SAMM50_ENST00000396202.3_Missense_Mutation_p.E24K	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	234					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)		p.E234K(1)		endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CGTATGGCGAGAACTGGGCTG	0.488																																																1	Substitution - Missense(1)	ovary(1)	22											96.0	85.0	89.0					22																	44371986		2203	4300	6503	42703319	SO:0001583	missense	25813			AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.700G>A	22.37:g.44371986G>A	ENSP00000345445:p.Glu234Lys	Somatic		x	x	x	42703319	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	ENST00000350028.4	37	CCDS14055.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.665439	0.96745	.	.	ENSG00000100347	ENST00000350028;ENST00000396202	T;T	0.39787	1.06;1.06	5.3	5.3	0.74995	Bacterial surface antigen (D15) (1);	0.000000	0.85682	D	0.000000	T	0.59609	0.2206	M	0.64997	1.995	0.80722	D	1	P;D	0.76494	0.877;0.999	P;D	0.70935	0.678;0.971	T	0.52019	-0.8631	10	0.21540	T	0.41	-35.5749	16.4643	0.84073	0.0:0.0:1.0:0.0	.	39;234	B3KUE6;Q9Y512	.;SAM50_HUMAN	K	234;24	ENSP00000345445:E234K;ENSP00000379505:E24K	ENSP00000345445:E234K	E	+	1	0	SAMM50	42703319	1.000000	0.71417	0.968000	0.41197	0.963000	0.63663	9.060000	0.93907	2.647000	0.89833	0.561000	0.74099	GAA		0.488	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318898.2	NM_015380		Missense_Mutation
LHFPL4	375323	broad.mit.edu	37	3	9547805	9547805	+	Silent	SNP	C	C	T	rs550580684	byFrequency	TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:9547805C>T	ENST00000287585.6	-	3	774	c.489G>A	c.(487-489)acG>acA	p.T163T		NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	176						integral component of membrane (GO:0016021)		p.T163T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					AGTACTTCCCCGTCTTGGCCC	0.622																																																1	Substitution - coding silent(1)	ovary(1)	3											152.0	122.0	132.0					3																	9547805		2203	4300	6503	9522805	SO:0001819	synonymous_variant	375323			AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.489G>A	3.37:g.9547805C>T		Unknown		x	x	x	9522805	A1L383|A4D0Q5	Silent	SNP	ENST00000287585.6	37	CCDS33691.1	SNP	23	Broad																																																																																				0.622	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	NM_198560		Silent
ATP2B2	491	broad.mit.edu	37	3	10491053	10491053	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:10491053G>A	ENST00000352432.4	-	1	244	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C	ATP2B2_ENST00000343816.4_Missense_Mutation_p.R59C|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R59C|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R59C|ATP2B2_ENST00000383800.4_Missense_Mutation_p.R59C			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	59					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.R59C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GTTTTGAGGCGCCGGCAGATG	0.567																																					Ovarian(125;1619 1709 15675 19819 38835)											1	Substitution - Missense(1)	ovary(1)	3											74.0	69.0	71.0					3																	10491053		2203	4300	6503	10466053	SO:0001583	missense	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.175C>T	3.37:g.10491053G>A	ENSP00000324172:p.Arg59Cys	Unknown		x	x	x	10466053	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587878	0.86851	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000342354	T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39	4.9	4.9	0.64082	ATPase, P-type cation-transporter, N-terminal (2);	0.071490	0.56097	D	0.000023	D	0.91369	0.7277	M	0.92923	3.36	0.80722	D	1	D;D;D	0.71674	0.984;0.994;0.998	P;P;D	0.66716	0.681;0.766;0.946	D	0.93420	0.6776	10	0.72032	D	0.01	-24.0908	15.5665	0.76298	0.0:0.0:1.0:0.0	.	59;71;59	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	C	59;59;59;59;59;25;59	ENSP00000324172:R59C;ENSP00000373311:R59C;ENSP00000380267:R59C;ENSP00000353414:R59C;ENSP00000344677:R59C	ENSP00000342954:R59C	R	-	1	0	ATP2B2	10466053	0.959000	0.32827	1.000000	0.80357	0.988000	0.76386	2.144000	0.42197	2.275000	0.75901	0.462000	0.41574	CGC		0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		Missense_Mutation
AZI2	64343	broad.mit.edu	37	3	28380074	28380074	+	Silent	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:28380074G>A	ENST00000479665.1	-	3	780	c.249C>T	c.(247-249)tcC>tcT	p.S83S	AZI2_ENST00000334100.6_Silent_p.S83S|AZI2_ENST00000457172.1_Silent_p.S83S|AZI2_ENST00000420543.2_Silent_p.S83S|AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	83	Homodimerization. {ECO:0000250}.				dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)		p.S83S(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						CTCGTCCCACGGAACTTGTTT	0.348																																																1	Substitution - coding silent(1)	ovary(1)	3											118.0	105.0	109.0					3																	28380074		2202	4300	6502	28355078	SO:0001819	synonymous_variant	64343			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.249C>T	3.37:g.28380074G>A		Unknown		x	x	x	28355078	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Silent	SNP	ENST00000479665.1	37	CCDS2647.1	SNP	39	Broad																																																																																				0.348	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252998.2	NM_203326		Silent
NPHP3	27031	broad.mit.edu	37	3	132433930	132433930	+	Splice_Site	SNP	T	T	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:132433930T>A	ENST00000337331.5	-	5	1042	c.956A>T	c.(955-957)aAg>aTg	p.K319M	NPHP3_ENST00000476742.1_5'UTR|NPHP3_ENST00000326682.8_Splice_Site_p.K319M	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	319					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)		p.K319M(1)		NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TATCCTCACCTTAAGGAAAAG	0.323																																																1	Substitution - Missense(1)	ovary(1)	3											63.0	64.0	64.0					3																	132433930		2203	4299	6502	133916620	SO:0001630	splice_region_variant	27031			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.957+1A>T	3.37:g.132433930T>A		Unknown		x	x	x	133916620	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	20.8	4.046826	0.75846	.	.	ENSG00000113971	ENST00000326682;ENST00000337331	D;D	0.93953	-3.32;-3.22	6.17	4.84	0.62591	.	0.142072	0.64402	D	0.000007	D	0.91168	0.7218	L	0.46157	1.445	0.80722	D	1	P	0.52170	0.951	P	0.45971	0.499	D	0.91623	0.5312	10	0.87932	D	0	-19.8451	10.9812	0.47494	0.0:0.1089:0.0:0.8911	.	319	Q7Z494	NPHP3_HUMAN	M	319	ENSP00000319909:K319M;ENSP00000338766:K319M	ENSP00000319909:K319M	K	-	2	0	NPHP3	133916620	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.340000	0.43974	2.371000	0.80710	0.533000	0.62120	AAG		0.323	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	Missense_Mutation	Missense_Mutation
TSC22D2	9819	broad.mit.edu	37	3	150127730	150127730	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:150127730C>G	ENST00000361875.3	+	1	1609	c.593C>G	c.(592-594)tCc>tGc	p.S198C	TSC22D2_ENST00000361136.2_Missense_Mutation_p.S198C	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	198					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S198C(1)		cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTGACTAGATCCGGGGATTGC	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											89.0	90.0	90.0					3																	150127730		2203	4300	6503	151610420	SO:0001583	missense	9819			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.593C>G	3.37:g.150127730C>G	ENSP00000354543:p.Ser198Cys	Unknown		x	x	x	151610420	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	20.3	3.972572	0.74246	.	.	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.33438	1.41;1.42	4.08	4.08	0.47627	.	0.129947	0.31370	N	0.007780	T	0.35451	0.0932	N	0.22421	0.69	0.47374	D	0.999407	D;D	0.69078	0.997;0.983	P;P	0.56474	0.799;0.635	T	0.26467	-1.0102	10	0.52906	T	0.07	.	15.9027	0.79392	0.0:1.0:0.0:0.0	.	198;198	O75157-2;O75157	.;T22D2_HUMAN	C	198	ENSP00000354543:S198C;ENSP00000354893:S198C	ENSP00000354893:S198C	S	+	2	0	TSC22D2	151610420	1.000000	0.71417	0.993000	0.49108	0.863000	0.49368	5.303000	0.65738	1.833000	0.53350	0.650000	0.86243	TCC		0.597	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779		Missense_Mutation
MUC4	4585	broad.mit.edu	37	3	195516252	195516252	+	Silent	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr3:195516252G>C	ENST00000463781.3	-	2	2658	c.2199C>G	c.(2197-2199)tcC>tcG	p.S733S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.S733S|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	738					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S733S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACCTGTTTTGGAAAGTGACG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	3											113.0	126.0	122.0					3																	195516252		2134	4246	6380	197000647	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2199C>G	3.37:g.195516252G>C		Unknown		x	x	x	197000647	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1	SNP	47	Broad																																																																																				0.617	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406		Silent
UGT2B10	7365	broad.mit.edu	37	4	69682127	69682127	+	Silent	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr4:69682127T>C	ENST00000265403.7	+	1	417	c.390T>C	c.(388-390)gtT>gtC	p.V130V	UGT2B10_ENST00000458688.2_Silent_p.V130V	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	130					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.V130V(1)		endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						AAGATGTAGTTTCAAATAAGA	0.328																																					Melanoma(133;755 1763 25578 26334 46021)											1	Substitution - coding silent(1)	ovary(1)	4											48.0	52.0	51.0					4																	69682127		2161	4274	6435	69716716	SO:0001819	synonymous_variant	7365			X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.390T>C	4.37:g.69682127T>C		Somatic		x	x	x	69716716	A8K9M3|B4DPP1|Q14CR8	Silent	SNP	ENST00000265403.7	37		SNP	64	Broad																																																																																				0.328	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365169.1	NM_001075		Silent
PPP3CA	5530	broad.mit.edu	37	4	102004363	102004363	+	Silent	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10			G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr4:102004363G>C	ENST00000394854.3	-	7	1523	c.840C>G	c.(838-840)gcC>gcG	p.A280A	PPP3CA_ENST00000523694.2_Silent_p.A213A|PPP3CA_ENST00000323055.6_Silent_p.A280A|PPP3CA_ENST00000394853.4_Silent_p.A280A|PPP3CA_ENST00000507176.1_Silent_p.A182A|PPP3CA_ENST00000512215.1_Intron	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	280	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)	p.A280A(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GGGCTTCGTGGGCTCGGAGTA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	4											274.0	286.0	282.0					4																	102004363		2203	4300	6503	102223386	SO:0001819	synonymous_variant	5530				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.840C>G	4.37:g.102004363G>C		Somatic		x	x	x	102223386	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Silent	SNP	ENST00000394854.3	37	CCDS34037.1	SNP	43	Broad																																																																																				0.433	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944		Silent
PCDHGA12	26025	broad.mit.edu	37	5	140812614	140812614	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr5:140812614C>T	ENST00000252085.3	+	1	2430	c.2288C>T	c.(2287-2289)tCg>tTg	p.S763L	PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	763					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S763L(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCACGGACTCGCGGAAGAGT	0.597																																																2	Substitution - Missense(2)	ovary(2)	5											108.0	112.0	110.0					5																	140812614		2203	4300	6503	140792798	SO:0001583	missense	26025			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2288C>T	5.37:g.140812614C>T	ENSP00000252085:p.Ser763Leu	Unknown		x	x	x	140792798	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920170	0.52653	.	.	ENSG00000253159	ENST00000252085	T	0.54071	0.59	4.99	4.99	0.66335	.	.	.	.	.	T	0.80281	0.4594	M	0.93375	3.41	0.25915	N	0.983184	D;D	0.89917	1.0;1.0	D;D	0.77004	0.988;0.989	T	0.75491	-0.3299	9	0.72032	D	0.01	.	17.2178	0.86949	0.0:1.0:0.0:0.0	.	763;763	O60330-2;O60330	.;PCDGC_HUMAN	L	763	ENSP00000252085:S763L	ENSP00000252085:S763L	S	+	2	0	PCDHGA12	140792798	1.000000	0.71417	0.185000	0.23176	0.054000	0.15201	6.400000	0.73252	2.472000	0.83506	0.655000	0.94253	TCG		0.597	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735		Missense_Mutation
HIST1H3J	8356	broad.mit.edu	37	6	27858544	27858544	+	Silent	SNP	G	G	C	rs547660432	byFrequency	TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:27858544G>C	ENST00000359303.2	-	1	26	c.27C>G	c.(25-27)cgC>cgG	p.R9R	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003535.2	NP_003526.1	P68431	H31_HUMAN	histone cluster 1, H3j	9					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.R9R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	8						CGGTAGACTTGCGAGCTGTCT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	6											30.0	33.0	32.0					6																	27858544		2195	4290	6485	27966523	SO:0001819	synonymous_variant	8356			Z83737	CCDS4638.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197153	ENSG00000197153		"""Histones / Replication-dependent"""	4774	protein-coding gene	gene with protein product		602817	"""H3 histone family, member J"", ""histone 1, H3j"""	H3FJ		9439656, 12408966	Standard	NM_003535		Approved	H3/j	uc003nka.3	P68431	OTTHUMG00000016185	ENST00000359303.2:c.27C>G	6.37:g.27858544G>C		Unknown		x	x	x	27966523	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000359303.2	37	CCDS4638.1	SNP	46	Broad																																																																																				0.572	HIST1H3J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043453.2	NM_003535		Silent
RPP21	79897	broad.mit.edu	37	6	30314294	30314294	+	Silent	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:30314294C>A	ENST00000442966.2	+	4	340	c.327C>A	c.(325-327)ctC>ctA	p.L109L	RPP21_ENST00000433076.2_Silent_p.L117L|RPP21_ENST00000428040.2_Silent_p.L132L|RPP21_ENST00000436442.2_Silent_p.L109L|TRIM39-RPP21_ENST00000513556.1_Silent_p.L370L			Q9H633	RPP21_HUMAN	ribonuclease P/MRP 21kDa subunit	109					response to drug (GO:0042493)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonuclease P activity (GO:0004526)	p.L109L(1)		endometrium(2)|ovary(1)|prostate(1)	4						GGCATTTACTCTGGGGAGACA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	6											58.0	55.0	56.0					6																	30314294		2203	4300	6503	30422273	SO:0001819	synonymous_variant	79897			AK026291	CCDS4679.1, CCDS56409.1, CCDS56410.1	6p21.32	2012-05-21	2007-06-26	2004-03-19	ENSG00000241370	ENSG00000241370			21300	protein-coding gene	gene with protein product		612524	"""chromosome 6 open reading frame 135"", ""ribonuclease P 21kDa subunit"""	C6orf135			Standard	NM_001199120		Approved	FLJ22638, Em:AB014085.3		Q9H633	OTTHUMG00000031220	ENST00000442966.2:c.327C>A	6.37:g.30314294C>A		Unknown		x	x	x	30422273	A2AAZ8|B0S834|B0S835|Q5JPL9|Q5JPM1|Q5STF8|Q5STF9|Q5STG2|Q5SU41|Q5SU42|Q86Y49|Q86Y50|Q86Y51|Q96F16	Silent	SNP	ENST00000442966.2	37	CCDS4679.1	SNP	32	Broad																																																																																				0.597	RPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076451.2	NM_024839		Silent
XPO5	57510	broad.mit.edu	37	6	43492278	43492278	+	Silent	SNP	G	G	A	rs556276524		TCGA-23-1031-01	TCGA-23-1031-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:43492278G>A	ENST00000265351.7	-	31	3618	c.3408C>T	c.(3406-3408)ccC>ccT	p.P1136P	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	1136					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)	p.P1136P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TCTGCAGGGAGGGGTTTAAAA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	6											131.0	133.0	132.0					6																	43492278		1913	4114	6027	43600256	SO:0001819	synonymous_variant	57510			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.3408C>T	6.37:g.43492278G>A		Somatic		x	x	x	43600256	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	ENST00000265351.7	37	CCDS47430.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434400	0.25813	.	.	ENSG00000124571	ENST00000455285	.	.	.	6.06	-1.62	0.08372	.	0.000000	0.85682	D	0.000000	T	0.10252	0.0251	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.10660	-1.0620	6	0.07813	T	0.8	-16.9434	2.1829	0.03879	0.2497:0.0818:0.3946:0.2739	.	.	.	.	L	251	.	ENSP00000387384:P251L	P	-	2	0	XPO5	43600256	0.438000	0.25602	0.994000	0.49952	0.996000	0.88848	-0.220000	0.09215	-0.067000	0.12976	0.655000	0.94253	CCT		0.502	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750		Silent
EYS	346007	broad.mit.edu	37	6	66115118	66115118	+	Missense_Mutation	SNP	C	C	G	rs80095433	byFrequency	TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:66115118C>G	ENST00000370621.3	-	6	1531	c.1005G>C	c.(1003-1005)gaG>gaC	p.E335D	EYS_ENST00000370618.3_Missense_Mutation_p.E335D|EYS_ENST00000393380.2_Missense_Mutation_p.E335D|EYS_ENST00000370616.2_Missense_Mutation_p.E335D|EYS_ENST00000342421.5_Missense_Mutation_p.E335D|EYS_ENST00000503581.1_Missense_Mutation_p.E335D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	335	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.E335D(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CTAATGAAAACTCACTGACAT	0.333																																																1	Substitution - Missense(1)	ovary(1)	6											121.0	121.0	121.0					6																	66115118		2203	4300	6503	66171839	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1005G>C	6.37:g.66115118C>G	ENSP00000359655:p.Glu335Asp	Unknown		x	x	x	66171839	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	2.664	-0.279155	0.05642	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;T;T;T	0.86694	-2.16;-2.16;-2.16;1.45;1.45;1.45	4.89	-3.98	0.04082	.	.	.	.	.	T	0.58119	0.2100	L	0.42581	1.335	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.002;0.004;0.003	T	0.40869	-0.9540	9	0.29301	T	0.29	.	1.8166	0.03102	0.1702:0.2802:0.1096:0.4401	.	335;335;335	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	D	335	ENSP00000424243:E335D;ENSP00000359655:E335D;ENSP00000359650:E335D;ENSP00000377042:E335D;ENSP00000341818:E335D;ENSP00000359652:E335D	ENSP00000341818:E335D	E	-	3	2	EYS	66171839	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.429000	0.02437	-1.075000	0.03129	-1.363000	0.01210	GAG		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050		Missense_Mutation
IMPG1	3617	broad.mit.edu	37	6	76660659	76660659	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:76660659G>A	ENST00000369950.3	-	13	1633	c.1444C>T	c.(1444-1446)Ccc>Tcc	p.P482S	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.P482S(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TCACTGGTGGGGATGGTGAGC	0.488																																					Pancreas(37;839 1141 2599 26037)											1	Substitution - Missense(1)	ovary(1)	6											175.0	167.0	170.0					6																	76660659		2203	4300	6503	76717379	SO:0001583	missense	3617			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1444C>T	6.37:g.76660659G>A	ENSP00000358966:p.Pro482Ser	Unknown		x	x	x	76717379		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	SNP	43	Broad	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137820	0.56936	.	.	ENSG00000112706	ENST00000369950	T	0.34275	1.37	5.6	2.79	0.32731	.	0.101557	0.44097	N	0.000490	T	0.20373	0.0490	M	0.63843	1.955	0.80722	D	1	P	0.37330	0.59	B	0.40602	0.334	T	0.02983	-1.1086	10	0.52906	T	0.07	.	6.4715	0.22011	0.0712:0.1317:0.6602:0.1369	.	482	Q17R60	IMPG1_HUMAN	S	482	ENSP00000358966:P482S	ENSP00000358966:P482S	P	-	1	0	IMPG1	76717379	0.883000	0.30277	0.029000	0.17559	0.110000	0.19582	2.132000	0.42083	0.278000	0.22164	-0.156000	0.13503	CCC		0.488	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563		Missense_Mutation
ELOVL4	6785	broad.mit.edu	37	6	80631376	80631376	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:80631376C>A	ENST00000369816.4	-	4	807	c.507G>T	c.(505-507)tgG>tgT	p.W169C		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	169					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.W169C(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	TTCCAATCCACCACAAGGTAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	6											142.0	132.0	135.0					6																	80631376		2203	4300	6503	80688095	SO:0001583	missense	6785			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.507G>T	6.37:g.80631376C>A	ENSP00000358831:p.Trp169Cys	Unknown		x	x	x	80688095	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	ENST00000369816.4	37	CCDS4992.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205045	0.79127	.	.	ENSG00000118402	ENST00000369816	T	0.20738	2.05	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.23249	0.0562	L	0.52364	1.645	0.80722	D	1	P	0.40681	0.727	P	0.49085	0.6	T	0.00747	-1.1583	10	0.51188	T	0.08	-7.0251	18.0115	0.89225	0.0:1.0:0.0:0.0	.	169	Q9GZR5	ELOV4_HUMAN	C	169	ENSP00000358831:W169C	ENSP00000358831:W169C	W	-	3	0	ELOVL4	80688095	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.558000	0.86282	0.591000	0.81541	TGG		0.378	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1			Missense_Mutation
HTR1E	3354	broad.mit.edu	37	6	87725323	87725323	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:87725323G>C	ENST00000305344.5	+	2	974	c.271G>C	c.(271-273)Ggg>Cgg	p.G91R		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	91					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.G91R(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	CTGGAAGCTTGGGTACTTCCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	6											151.0	129.0	137.0					6																	87725323		2203	4300	6503	87782042	SO:0001583	missense	3354				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.271G>C	6.37:g.87725323G>C	ENSP00000307766:p.Gly91Arg	Unknown		x	x	x	87782042	E1P503|Q9P1Y1	Missense_Mutation	SNP	ENST00000305344.5	37	CCDS5006.1	SNP	47	Broad	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481000	0.63849	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	T;T	0.50548	0.74;0.74	4.57	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000013	T	0.71978	0.3404	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81033	-0.1116	10	0.72032	D	0.01	.	17.3338	0.87274	0.0:0.0:1.0:0.0	.	91	P28566	5HT1E_HUMAN	R	91	ENSP00000307766:G91R;ENSP00000358597:G91R	ENSP00000307766:G91R	G	+	1	0	HTR1E	87782042	1.000000	0.71417	0.989000	0.46669	0.570000	0.35934	9.219000	0.95173	2.085000	0.62840	0.404000	0.27445	GGG		0.562	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865		Missense_Mutation
TIAM2	26230	broad.mit.edu	37	6	155458322	155458322	+	Silent	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr6:155458322C>A	ENST00000461783.3	+	7	2479	c.1206C>A	c.(1204-1206)tcC>tcA	p.S402S	TIAM2_ENST00000318981.5_Silent_p.S402S|TIAM2_ENST00000529824.2_Silent_p.S402S|TIAM2_ENST00000456144.1_Silent_p.S402S|TIAM2_ENST00000360366.4_Silent_p.S402S|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	402					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S402S(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGCCGAGGTCCAAGGAGGGCA	0.517																																																1	Substitution - coding silent(1)	ovary(1)	6											82.0	73.0	76.0					6																	155458322		2203	4300	6503	155500014	SO:0001819	synonymous_variant	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1206C>A	6.37:g.155458322C>A		Unknown		x	x	x	155500014	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	37	CCDS34558.1	SNP	21	Broad																																																																																				0.517	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454		Silent
CPVL	54504	broad.mit.edu	37	7	29070326	29070326	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:29070326G>C	ENST00000409850.1	-	16	1833	c.1187C>G	c.(1186-1188)aCa>aGa	p.T396R	CPVL_ENST00000396276.3_Missense_Mutation_p.T396R|CPVL_ENST00000265394.5_Missense_Mutation_p.T396R			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	396						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)	p.T396R(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						GGAGCGCTCTGTCAGGGCAGC	0.463																																																1	Substitution - Missense(1)	ovary(1)	7											121.0	120.0	120.0					7																	29070326		2203	4300	6503	29036851	SO:0001583	missense	54504			AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.1187C>G	7.37:g.29070326G>C	ENSP00000387164:p.Thr396Arg	Unknown		x	x	x	29036851	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	ENST00000409850.1	37	CCDS5419.1	SNP	48	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.51|13.51	2.257303|2.257303	0.39896|0.39896	.|.	.|.	ENSG00000106066|ENSG00000106066	ENST00000432534|ENST00000265394;ENST00000396276;ENST00000455893;ENST00000409850	.|D;D;D;D	.|0.87029	.|-2.2;-2.2;-2.2;-2.2	5.71|5.71	3.92|3.92	0.45320|0.45320	.|.	.|0.097095	.|0.64402	.|D	.|0.000001	D|D	0.95389|0.95389	0.8503|0.8503	H|H	0.97315|0.97315	3.98|3.98	0.54753|0.54753	D|D	0.999987|0.999987	.|D	.|0.89917	.|1.0	.|D	.|0.77557	.|0.99	D|D	0.95341|0.95341	0.8438|0.8438	5|10	.|0.87932	.|D	.|0	-16.4966|-16.4966	11.384|11.384	0.49773|0.49773	0.1485:0.0:0.8515:0.0|0.1485:0.0:0.8515:0.0	.|.	.|396	.|Q9H3G5	.|CPVL_HUMAN	E|R	99|396;396;61;396	.|ENSP00000265394:T396R;ENSP00000379572:T396R;ENSP00000403580:T61R;ENSP00000387164:T396R	.|ENSP00000265394:T396R	D|T	-|-	3|2	2|0	CPVL|CPVL	29036851|29036851	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.042000|0.042000	0.13812|0.13812	4.655000|4.655000	0.61476|0.61476	0.770000|0.770000	0.33336|0.33336	-0.224000|-0.224000	0.12420|0.12420	GAC|ACA		0.463	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029		Missense_Mutation
UPP1	7378	broad.mit.edu	37	7	48147874	48147874	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:48147874C>T	ENST00000331803.4	+	10	1476	c.853C>T	c.(853-855)Cgc>Tgc	p.R285C	UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000429491.2_Missense_Mutation_p.R148C|UPP1_ENST00000395564.4_Missense_Mutation_p.R285C|UPP1_ENST00000341253.4_Missense_Mutation_p.R285C			Q16831	UPP1_HUMAN	uridine phosphorylase 1	285					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)	p.R285C(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	CAGCAGCCCTCGCAATGTGCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											80.0	78.0	79.0					7																	48147874		2203	4300	6503	48114399	SO:0001583	missense	7378			AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.853C>T	7.37:g.48147874C>T	ENSP00000330032:p.Arg285Cys	Unknown		x	x	x	48114399	D3DVM4|Q15362	Missense_Mutation	SNP	ENST00000331803.4	37	CCDS5507.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037003	0.35893	.	.	ENSG00000183696	ENST00000331803;ENST00000341253;ENST00000395564;ENST00000429491	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.4	4.52	0.55395	Nucleoside phosphorylase domain (1);	0.100830	0.64402	D	0.000002	T	0.26955	0.0660	N	0.03608	-0.345	0.38416	D	0.946044	P;P	0.35468	0.503;0.503	B;B	0.41332	0.354;0.354	T	0.37572	-0.9700	10	0.54805	T	0.06	-19.0387	13.4262	0.61026	0.0:0.9245:0.0:0.0755	.	148;285	Q86Y75;Q16831	.;UPP1_HUMAN	C	285;285;285;148	ENSP00000330032:R285C;ENSP00000342878:R285C;ENSP00000378931:R285C;ENSP00000406224:R148C	ENSP00000330032:R285C	R	+	1	0	UPP1	48114399	1.000000	0.71417	0.002000	0.10522	0.008000	0.06430	5.710000	0.68392	1.279000	0.44446	-0.143000	0.13931	CGC		0.622	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364		Missense_Mutation
KIAA1324L	222223	broad.mit.edu	37	7	86541404	86541404	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:86541404C>T	ENST00000450689.2	-	15	2338	c.2153G>A	c.(2152-2154)aGt>aAt	p.S718N	KIAA1324L_ENST00000416314.1_Missense_Mutation_p.S551N|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.S647N|KIAA1324L_ENST00000490995.1_5'Flank|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.S478N	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	718						integral component of membrane (GO:0016021)		p.S478N(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CCCACATAAACTGATATTGAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											131.0	123.0	126.0					7																	86541404		2203	4300	6503	86379340	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2153G>A	7.37:g.86541404C>T	ENSP00000413445:p.Ser718Asn	Unknown		x	x	x	86379340	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932537	0.73442	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	T;T;T;T	0.33438	1.66;1.41;4.37;1.43	5.82	5.82	0.92795	Mannose-6-phosphate receptor, binding (1);	0.037481	0.85682	D	0.000000	T	0.58836	0.2150	M	0.82630	2.6	0.80722	D	1	P;D;D	0.76494	0.92;0.999;0.999	P;D;D	0.63283	0.615;0.913;0.913	T	0.60301	-0.7290	10	0.51188	T	0.08	.	19.0848	0.93200	0.0:1.0:0.0:0.0	.	718;478;551	A8MWY0;A8MWY0-2;B4DJV3	K132L_HUMAN;.;.	N	718;478;647;551	ENSP00000413445:S718N;ENSP00000297222:S478N;ENSP00000397377:S647N;ENSP00000402390:S551N	ENSP00000297222:S478N	S	-	2	0	KIAA1324L	86379340	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.751000	0.94390	0.650000	0.86243	AGT		0.413	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748		Missense_Mutation
CTTNBP2	83992	broad.mit.edu	37	7	117386110	117386110	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:117386110C>G	ENST00000160373.3	-	13	3483	c.3392G>C	c.(3391-3393)aGc>aCc	p.S1131T		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1131					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.S1131T(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTCTTGCAAGCTTCCTTCTGG	0.393											OREG0003442	type=REGULATORY REGION|Gene=CTTNBP2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				1	Substitution - Missense(1)	ovary(1)	7											152.0	137.0	142.0					7																	117386110		2203	4300	6503	117173346	SO:0001583	missense	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3392G>C	7.37:g.117386110C>G	ENSP00000160373:p.Ser1131Thr	Unknown	1480	x	x	x	117173346	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	SNP	28	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.18|19.18	3.778072|3.778072	0.70107|0.70107	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.61742	.|0.08	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|0.067229	.|0.85682	.|D	.|0.000000	T|T	0.67363|0.67363	0.2885|0.2885	M|M	0.71920|0.71920	2.185|2.185	0.49915|0.49915	D|D	0.999836|0.999836	.|P	.|0.50617	.|0.937	.|P	.|0.48654	.|0.585	T|T	0.65282|0.65282	-0.6206|-0.6206	5|10	.|0.38643	.|T	.|0.18	-13.2714|-13.2714	20.5827|20.5827	0.99408|0.99408	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1131	.|Q8WZ74	.|CTTB2_HUMAN	N|T	618|1131	.|ENSP00000160373:S1131T	.|ENSP00000160373:S1131T	K|S	-|-	3|2	2|0	CTTNBP2|CTTNBP2	117173346|117173346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.938000|5.938000	0.70170|0.70170	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	AAG|AGC		0.393	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427		Missense_Mutation
IQUB	154865	broad.mit.edu	37	7	123152133	123152133	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:123152133C>A	ENST00000466202.1	-	2	838	c.262G>T	c.(262-264)Gtt>Ttt	p.V88F	IQUB_ENST00000324698.6_Missense_Mutation_p.V88F|IQUB_ENST00000434450.1_Missense_Mutation_p.V88F|IQUB_ENST00000488987.1_Intron	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	88					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)		p.V88F(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						GTATATGAAACTTGTCTTGGT	0.398																																																1	Substitution - Missense(1)	ovary(1)	7											238.0	202.0	214.0					7																	123152133		2203	4300	6503	122939369	SO:0001583	missense	154865			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.262G>T	7.37:g.123152133C>A	ENSP00000417769:p.Val88Phe	Unknown		x	x	x	122939369	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742963	0.30865	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.48522	1.83;1.83;0.81	5.1	2.13	0.27403	.	11.468500	0.00481	N	0.000138	T	0.34600	0.0903	N	0.19112	0.55	0.09310	N	1	B;B;B	0.33379	0.41;0.32;0.214	B;B;B	0.35510	0.204;0.192;0.07	T	0.19877	-1.0292	10	0.30854	T	0.27	.	4.1337	0.10160	0.1796:0.6169:0.0:0.2034	.	88;88;88	A1A4Z1;Q8NA54-2;Q8NA54	.;.;IQUB_HUMAN	F	88	ENSP00000417769:V88F;ENSP00000324882:V88F;ENSP00000388498:V88F	ENSP00000324882:V88F	V	-	1	0	IQUB	122939369	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.088000	0.11198	0.347000	0.23924	-0.355000	0.07637	GTT		0.398	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827		Missense_Mutation
TTC26	79989	broad.mit.edu	37	7	138831941	138831941	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr7:138831941C>T	ENST00000464848.1	+	6	530	c.450C>T	c.(448-450)gtC>gtT	p.V150V	TTC26_ENST00000430935.1_Silent_p.V150V|TTC26_ENST00000474035.2_Silent_p.V150V|TTC26_ENST00000495038.1_Intron|TTC26_ENST00000343187.4_Silent_p.V119V|TTC26_ENST00000481482.1_3'UTR|TTC26_ENST00000478836.2_Intron			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	150					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)		p.V150V(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						TTCAGGATGTCACAGAAGATC	0.343																																																1	Substitution - coding silent(1)	ovary(1)	7											119.0	118.0	118.0					7																	138831941		2203	4300	6503	138482481	SO:0001819	synonymous_variant	79989			AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.450C>T	7.37:g.138831941C>T		Unknown		x	x	x	138482481	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Silent	SNP	ENST00000464848.1	37	CCDS5852.1	SNP	29	Broad																																																																																				0.343	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926		Silent
DUSP4	1846	broad.mit.edu	37	8	29203023	29203023	+	Intron	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr8:29203023G>A	ENST00000240100.2	-	1	823				DUSP4_ENST00000240101.2_Silent_p.N8N	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4						endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		ACTGGCTTCCGTTGGAGTGAA	0.532																																																0			8											137.0	136.0	136.0					8																	29203023		2203	4300	6503	29258942	SO:0001627	intron_variant	1846			U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.433+4339C>T	8.37:g.29203023G>A		Somatic		x	x	x	29258942	B2RBU5|D3DSU4|G5E930|Q13524	Silent	SNP	ENST00000240100.2	37	CCDS6072.1	SNP	40	Broad																																																																																				0.532	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257249.1	NM_001394		Silent
ZFPM2	23414	broad.mit.edu	37	8	106813579	106813579	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10			C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr8:106813579C>G	ENST00000407775.2	+	8	1519	c.1269C>G	c.(1267-1269)agC>agG	p.S423R	ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S154R|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S291R|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S291R	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	423					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S423R(1)		NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTCCCCAGAGCCAAAAGGCCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	8											63.0	64.0	64.0					8																	106813579		1964	4169	6133	106882755	SO:0001583	missense	23414			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1269C>G	8.37:g.106813579C>G	ENSP00000384179:p.Ser423Arg	Somatic		x	x	x	106882755	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872511	0.51695	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20881	2.04;2.52;2.52;3.72	5.97	4.13	0.48395	.	0.168138	0.64402	D	0.000003	T	0.26268	0.0641	L	0.43152	1.355	0.58432	D	0.999997	D	0.57899	0.981	P	0.55161	0.77	T	0.01935	-1.1244	10	0.27785	T	0.31	.	8.295	0.31980	0.1182:0.7038:0.1142:0.0638	.	423	Q8WW38	FOG2_HUMAN	R	423;291;291;154	ENSP00000384179:S423R;ENSP00000430757:S291R;ENSP00000428720:S291R;ENSP00000367733:S154R	ENSP00000367733:S154R	S	+	3	2	ZFPM2	106882755	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	2.085000	0.41634	1.495000	0.48549	0.655000	0.94253	AGC		0.488	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1			Missense_Mutation
SLA	6503	broad.mit.edu	37	8	134072434	134072434	+	5'UTR	SNP	G	G	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr8:134072434G>A	ENST00000338087.5	-	0	791				SLA_ENST00000517648.1_Missense_Mutation_p.S8L|TG_ENST00000220616.4_Intron|SLA_ENST00000524345.1_Intron|TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_Intron|TG_ENST00000519543.1_Intron|SLA_ENST00000518565.1_5'UTR|SLA_ENST00000427060.2_Missense_Mutation_p.S31L|SLA_ENST00000395352.3_Missense_Mutation_p.S8L	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor						positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			GGCCGCTGGTGATGCCCAGAG	0.582																																																0			8											80.0	82.0	81.0					8																	134072434		2203	4300	6503	134141616	SO:0001623	5_prime_UTR_variant	6503				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.-29C>T	8.37:g.134072434G>A		Unknown		x	x	x	134141616	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	ENST00000338087.5	37	CCDS6370.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	3.202	-0.163568	0.06502	.	.	ENSG00000155926	ENST00000427060;ENST00000395352;ENST00000517648	T;T;T	0.76968	-1.06;-1.06;2.4	4.38	3.49	0.39957	.	.	.	.	.	T	0.61123	0.2322	.	.	.	0.09310	N	1	B	0.24186	0.099	B	0.19391	0.025	T	0.44283	-0.9338	8	0.16896	T	0.51	.	9.8704	0.41170	0.0:0.0:0.7965:0.2035	.	8	B7Z4J2	.	L	31;8;8	ENSP00000394049:S31L;ENSP00000378759:S8L;ENSP00000428559:S8L	ENSP00000378759:S8L	S	-	2	0	SLA	134141616	0.028000	0.19301	0.001000	0.08648	0.002000	0.02628	1.707000	0.37888	1.185000	0.42971	0.563000	0.77884	TCA		0.582	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378771.1			Missense_Mutation
CNTFR	1271	broad.mit.edu	37	9	34564662	34564662	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr9:34564662C>G	ENST00000378980.3	-	4	547	c.254G>C	c.(253-255)gGc>gCc	p.G85A	CNTFR_ENST00000351266.4_Missense_Mutation_p.G85A	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	85	Ig-like C2-type.				brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)	p.G85A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		GGCGTAGAGGCCACTGTGGCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	9											93.0	76.0	82.0					9																	34564662		2203	4300	6503	34554662	SO:0001583	missense	1271			M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.254G>C	9.37:g.34564662C>G	ENSP00000368265:p.Gly85Ala	Unknown		x	x	x	34554662	Q5U050	Missense_Mutation	SNP	ENST00000378980.3	37	CCDS6558.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294838	0.81025	.	.	ENSG00000122756	ENST00000378980;ENST00000351266;ENST00000417345	D;D;T	0.88354	-2.37;-2.37;0.86	5.26	5.26	0.73747	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94318	0.8174	M	0.80422	2.495	0.39396	D	0.966500	D	0.76494	0.999	D	0.80764	0.994	D	0.94182	0.7433	9	0.48119	T	0.1	.	16.3749	0.83382	0.0:1.0:0.0:0.0	.	85	P26992	CNTFR_HUMAN	A	85	ENSP00000368265:G85A;ENSP00000242338:G85A;ENSP00000388082:G85A	ENSP00000242338:G85A	G	-	2	0	CNTFR	34554662	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	5.677000	0.68142	2.453000	0.82957	0.467000	0.42956	GGC		0.642	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052176.1			Missense_Mutation
TLN1	7094	broad.mit.edu	37	9	35699450	35699450	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr9:35699450C>A	ENST00000314888.9	-	51	7130	c.6777G>T	c.(6775-6777)caG>caT	p.Q2259H	TLN1_ENST00000540444.1_Missense_Mutation_p.Q2147H	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2259					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.Q2259H(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGCTTGGCTTCTGCAGGGTCT	0.562																																																1	Substitution - Missense(1)	ovary(1)	9											119.0	98.0	105.0					9																	35699450		2203	4300	6503	35689450	SO:0001583	missense	7094			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6777G>T	9.37:g.35699450C>A	ENSP00000316029:p.Gln2259His	Unknown		x	x	x	35689450	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050305	0.36181	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69561	-0.41;-0.41	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.68439	0.3001	M	0.73217	2.22	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.62562	-0.6828	10	0.30854	T	0.27	-16.6827	20.0609	0.97674	0.0:1.0:0.0:0.0	.	2259	Q9Y490	TLN1_HUMAN	H	2259;2147	ENSP00000316029:Q2259H;ENSP00000442981:Q2147H	ENSP00000316029:Q2259H	Q	-	3	2	TLN1	35689450	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.357000	0.34090	2.755000	0.94549	0.655000	0.94253	CAG		0.562	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289		Missense_Mutation
SMC5	23137	broad.mit.edu	37	9	72939036	72939036	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr9:72939036T>C	ENST00000361138.5	+	17	2432	c.2374T>C	c.(2374-2376)Tct>Cct	p.S792P		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	792					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.S792P(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TATGGCCGCATCTTCACAACT	0.323																																																1	Substitution - Missense(1)	ovary(1)	9											70.0	75.0	73.0					9																	72939036		2203	4294	6497	72128856	SO:0001583	missense	23137			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.2374T>C	9.37:g.72939036T>C	ENSP00000354957:p.Ser792Pro	Unknown		x	x	x	72128856	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	17.38	3.376210	0.61735	.	.	ENSG00000198887	ENST00000361138	T	0.18810	2.19	5.79	1.53	0.23141	RecF/RecN/SMC (1);	0.369709	0.30676	N	0.009116	T	0.27663	0.0680	L	0.48642	1.525	0.09310	N	1	D	0.67145	0.996	P	0.61800	0.894	T	0.02698	-1.1122	10	0.44086	T	0.13	-8.6914	4.8897	0.13721	0.3888:0.0:0.2248:0.3864	.	792	Q8IY18	SMC5_HUMAN	P	792	ENSP00000354957:S792P	ENSP00000354957:S792P	S	+	1	0	SMC5	72128856	0.041000	0.20044	0.397000	0.26308	0.123000	0.20343	1.475000	0.35409	0.964000	0.38108	0.482000	0.46254	TCT		0.323	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110		Missense_Mutation
RGS3	5998	broad.mit.edu	37	9	116224456	116224456	+	Silent	SNP	C	C	T			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr9:116224456C>T	ENST00000374140.2	+	4	599	c.390C>T	c.(388-390)atC>atT	p.I130I	RGS3_ENST00000350696.5_Silent_p.I130I|RGS3_ENST00000317613.6_5'Flank	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	130					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.I26I(1)		cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GGAAGAGGATCACGCATGCCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	9											75.0	78.0	77.0					9																	116224456		2078	4217	6295	115264277	SO:0001819	synonymous_variant	5998			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.390C>T	9.37:g.116224456C>T		Unknown		x	x	x	115264277	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Silent	SNP	ENST00000374140.2	37	CCDS43869.1	SNP	29	Broad																																																																																				0.537	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790		Silent
SUPT20HL2	170067	broad.mit.edu	37	X	24329672	24329672	+	IGR	SNP	A	A	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chrX:24329672A>C								AC096509.1 (24878 upstream) : AC004552.1 (37253 downstream)														p.V630V(1)									TGCACCCCAAAACCTGGGCTC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	X											15.0	15.0	15.0					X																	24329672		1567	3578	5145	24239593	SO:0001628	intergenic_variant	170067																															X.37:g.24329672A>C		Unknown		x	x	x	24239593		Silent	SNP		37		SNP	1	Broad																																																																																			0	0.627									Silent
ZCCHC5	203430	broad.mit.edu	37	X	77913139	77913139	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chrX:77913139C>G	ENST00000321110.1	-	2	1074	c.779G>C	c.(778-780)aGt>aCt	p.S260T		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	260							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S260T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TCTCATGTAACTATACAGCTG	0.512																																																1	Substitution - Missense(1)	ovary(1)	X											31.0	28.0	29.0					X																	77913139		2203	4300	6503	77799795	SO:0001583	missense	203430			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.779G>C	X.37:g.77913139C>G	ENSP00000316794:p.Ser260Thr	Unknown		x	x	x	77799795	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	CCDS14440.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.753266	0.00663	.	.	ENSG00000179300	ENST00000321110	T	0.17054	2.3	3.29	1.36	0.22044	.	0.506319	0.15351	U	0.266951	T	0.09113	0.0225	L	0.31752	0.955	0.18873	N	0.999984	P	0.52842	0.956	B	0.41374	0.355	T	0.19745	-1.0296	10	0.16896	T	0.51	.	3.4394	0.07458	0.0:0.5691:0.264:0.1669	.	260	Q8N8U3	ZCHC5_HUMAN	T	260	ENSP00000316794:S260T	ENSP00000316794:S260T	S	-	2	0	ZCCHC5	77799795	0.001000	0.12720	0.396000	0.26296	0.071000	0.16799	0.227000	0.17795	0.213000	0.20722	0.513000	0.50165	AGT		0.512	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		Missense_Mutation
RPL10	6134	broad.mit.edu	37	X	153629100	153629100	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chrX:153629100A>C	ENST00000369817.2	+	8	1126	c.550A>C	c.(550-552)Atg>Ctg	p.M184L	RPL10_ENST00000406022.2_Missense_Mutation_p.M133L|RPL10_ENST00000424325.2_Missense_Mutation_p.M184L|SNORA70_ENST00000384436.1_RNA			P27635	RL10_HUMAN	ribosomal protein L10	184					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.M184L(1)		large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATTTGAAGACATGGTGGCTGA	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											45.0	44.0	44.0					X																	153629100		2203	4297	6500	153282294	SO:0001583	missense	6134			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.550A>C	X.37:g.153629100A>C	ENSP00000358832:p.Met184Leu	Unknown		x	x	x	153282294	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	37	CCDS14746.1	SNP	8	Broad	.	.	.	.	.	.	.	.	.	.	A	8.449	0.852582	0.17106	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000406022	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.46	4.81	4.81	0.61882	.	0.051625	0.64402	U	0.000001	T	0.44808	0.1311	N	0.11818	0.18	0.51767	D	0.999939	B	0.02656	0.0	B	0.06405	0.002	T	0.38929	-0.9638	10	0.02654	T	1	-6.7664	7.9578	0.30053	0.7948:0.2052:0.0:0.0	.	184	P27635	RL10_HUMAN	L	184;184;184;184;133	ENSP00000358832:M184L;ENSP00000413436:M184L;ENSP00000341730:M184L;ENSP00000385621:M133L	ENSP00000341730:M184L	M	+	1	0	RPL10	153282294	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	5.194000	0.65125	1.589000	0.49982	0.486000	0.48141	ATG		0.537	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577514	7577522	+	In_Frame_Del	DEL	GTGATGATG	GTGATGATG	-	rs587781433		TCGA-23-1031-01	TCGA-23-1031-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr17:7577514_7577522delGTGATGATG	ENST00000269305.4	-	7	948_956	c.759_767delCATCATCAC	c.(757-768)accatcatcaca>aca	p.253_256TIIT>T	TP53_ENST00000455263.2_In_Frame_Del_p.253_256TIIT>T|TP53_ENST00000420246.2_In_Frame_Del_p.253_256TIIT>T|TP53_ENST00000359597.4_In_Frame_Del_p.253_256TIIT>T|TP53_ENST00000445888.2_In_Frame_Del_p.253_256TIIT>T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_In_Frame_Del_p.253_256TIIT>T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	253	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> D (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|I -> F (in a sporadic cancer; somatic mutation).|I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> M (in a sporadic cancer; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|T -> A (in sporadic cancers; somatic mutation).|T -> I (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> N (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I255F(20)|p.I255S(10)|p.0?(8)|p.I254V(7)|p.I254F(7)|p.I255del(7)|p.I255T(7)|p.I255N(7)|p.I254S(6)|p.I254fs*10(5)|p.L252_I254delLTI(4)|p.I255fs*90(4)|p.T256fs*89(4)|p.I251_T253delILT(4)|p.I254T(3)|p.I254N(3)|p.I254D(3)|p.T256A(3)|p.I255fs*9(3)|p.I255V(3)|p.T256fs*8(2)|p.T253_I255del(2)|p.T253T(2)|p.T253fs*91(2)|p.I254del(2)|p.T256I(2)|p.T256K(2)|p.I255I(2)|p.T256S(2)|p.L252_T253delLT(1)|p.T256fs*90(1)|p.P250_T253delPILT(1)|p.T256del(1)|p.I254I(1)|p.?(1)|p.I254fs*7(1)|p.T253del(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)|p.T256fs*87(1)|p.I255fs*8(1)|p.I254fs*91(1)|p.I255M(1)|p.T256P(1)|p.T256fs*17(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTTCCAGTGTGATGATGGTGAGGATGG	0.584		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	152	Substitution - Missense(87)|Deletion - In frame(25)|Deletion - Frameshift(14)|Insertion - Frameshift(12)|Whole gene deletion(8)|Substitution - coding silent(5)|Unknown(1)	haematopoietic_and_lymphoid_tissue(21)|breast(20)|large_intestine(19)|oesophagus(14)|lung(14)|upper_aerodigestive_tract(11)|ovary(10)|central_nervous_system(8)|pancreas(7)|liver(6)|bone(5)|stomach(4)|urinary_tract(3)|endometrium(2)|skin(2)|prostate(2)|thyroid(1)|soft_tissue(1)|peritoneum(1)|kidney(1)	17	GRCh37	CM951232	TP53	M																																				7518247	SO:0001651	inframe_deletion	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.759_767delCATCATCAC	17.37:g.7577514_7577522delGTGATGATG	ENSP00000269305:p.Thr253_Ile255del	Unknown		Capture	Illumina GAIIx	Phase_I	7518239	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	48	Broad																																																																																				0.584	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		In_Frame_Del
PSAT1	29968	broad.mit.edu	37	9	80943096	80943102	+	Frame_Shift_Del	DEL	AGGGCAT	AGGGCAT	-	rs200973599		TCGA-23-1031-01	TCGA-23-1031-10			-	AGGGCAT	AGGGCAT	AGGGCAT	Unknown	Valid	Somatic	Phase_I	WXS	none			Illumina GAIIx	TCGA-23-1031-01	TCGA-23-1031-10	g.chr9:80943096_80943102delAGGGCAT	ENST00000376588.3	+	8	1067_1073	c.999_1005delAGGGCAT	c.(997-1005)aaagggcatfs	p.KGH333fs	PSAT1_ENST00000347159.2_Intron	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	333					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)	p.H335fs*25(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						TGTCCTTGAAAGGGCATAGGTGAGTAC	0.377																																					Colon(34;187 791 10662 18313 37609)											1	Deletion - Frameshift(1)	ovary(1)	9																																								80132922	SO:0001589	frameshift_variant	29968			BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.999_1005delAGGGCAT	9.37:g.80943096_80943102delAGGGCAT	ENSP00000365773:p.Lys333fs	Somatic		Capture	Illumina GAIIx	Phase_I	80132916	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Frame_Shift_Del	DEL	ENST00000376588.3	37	CCDS6660.1	DEL	3	Broad																																																																																				0.377	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154		Frame_Shift_Del
