#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
PRAMEF4	400735	broad.mit.edu	37	1	12939706	12939706	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:12939706C>G	ENST00000235349.5	-	4	1166	c.1096G>C	c.(1096-1098)Gac>Cac	p.D366H		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	366					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.D366H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACTTGGGAGTCTATGATGCCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	1											77.0	82.0	80.0					1																	12939706		1491	2670	4161	12862293	SO:0001583	missense	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1096G>C	1.37:g.12939706C>G	ENSP00000235349:p.Asp366His	Unknown		x	x	x	12862293	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	c	11.12	1.545189	0.27652	.	.	ENSG00000243073	ENST00000235349	T	0.13778	2.56	1.48	1.48	0.22813	.	0.119879	0.53938	D	0.000059	T	0.38453	0.1041	M	0.91249	3.19	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.07195	-1.0785	10	0.87932	D	0	.	6.4564	0.21932	0.0:1.0:0.0:0.0	.	366	O60810	PRAM4_HUMAN	H	366	ENSP00000235349:D366H	ENSP00000235349:D366H	D	-	1	0	PRAMEF4	12862293	0.006000	0.16342	0.088000	0.20740	0.017000	0.09413	1.044000	0.30329	1.137000	0.42214	0.400000	0.26472	GAC		0.502	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611		Missense_Mutation
IL12RB2	3595	broad.mit.edu	37	1	67816622	67816622	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:67816622G>A	ENST00000262345.1	+	9	1748	c.1108G>A	c.(1108-1110)Ggg>Agg	p.G370R	IL12RB2_ENST00000541374.1_Missense_Mutation_p.G370R|IL12RB2_ENST00000544434.1_Missense_Mutation_p.G370R|IL12RB2_ENST00000371000.1_Missense_Mutation_p.G370R	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	370	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.G370R(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						GCTGACAGGAGGGAAAGCCAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											128.0	112.0	117.0					1																	67816622		2203	4300	6503	67589210	SO:0001583	missense	3595			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1108G>A	1.37:g.67816622G>A	ENSP00000262345:p.Gly370Arg	Unknown		x	x	x	67589210	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	1.424	-0.572082	0.03882	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.54479	0.57;0.57;0.57;0.58	5.36	2.09	0.27110	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.828181	0.10925	N	0.618996	T	0.18509	0.0444	L	0.41824	1.3	0.09310	N	1	B;B;B;B	0.24258	0.002;0.1;0.003;0.001	B;B;B;B	0.21360	0.003;0.034;0.009;0.001	T	0.18967	-1.0320	10	0.41790	T	0.15	0.2096	3.073	0.06237	0.307:0.0:0.4857:0.2073	.	370;370;370;370	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	R	370	ENSP00000262345:G370R;ENSP00000360039:G370R;ENSP00000445276:G370R;ENSP00000442443:G370R	ENSP00000262345:G370R	G	+	1	0	IL12RB2	67589210	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.029000	0.13666	0.558000	0.29135	-0.182000	0.12963	GGG		0.468	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559		Missense_Mutation
ZNF697	90874	broad.mit.edu	37	1	120165502	120165502	+	Silent	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:120165502C>T	ENST00000421812.2	-	3	1583	c.1464G>A	c.(1462-1464)acG>acA	p.T488T		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T79T(1)|p.T488T(1)		ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GCTTCTCGCCCGTGTGCGTGC	0.652																																																2	Substitution - coding silent(2)	ovary(2)	1											27.0	31.0	29.0					1																	120165502		2202	4300	6502	119967025	SO:0001819	synonymous_variant	90874			AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1464G>A	1.37:g.120165502C>T		Unknown		x	x	x	119967025	Q96IT2	Silent	SNP	ENST00000421812.2	37	CCDS44202.1	SNP	23	Broad																																																																																				0.652	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286		Silent
ZBTB7B	51043	broad.mit.edu	37	1	154987599	154987599	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:154987599G>A	ENST00000368426.3	+	3	600	c.463G>A	c.(463-465)Gac>Aac	p.D155N	ZBTB7B_ENST00000417934.2_Missense_Mutation_p.D189N|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.D155N|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.D155N	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	155					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D155N(1)		endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGACGAGGATGACTGTGAGCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											40.0	41.0	40.0					1																	154987599		2198	4289	6487	153254223	SO:0001583	missense	51043			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.463G>A	1.37:g.154987599G>A	ENSP00000357411:p.Asp155Asn	Unknown		x	x	x	153254223	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	37	CCDS1081.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	8.481	0.859686	0.17178	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.08546	3.1;3.1;3.08;3.1	3.52	3.52	0.40303	.	0.674290	0.14002	N	0.348038	T	0.01695	0.0054	L	0.27053	0.805	0.28733	N	0.902368	B;B;B	0.26081	0.141;0.141;0.141	B;B;B	0.18263	0.021;0.021;0.021	T	0.36286	-0.9754	10	0.06891	T	0.86	.	12.5916	0.56445	0.0:0.0:1.0:0.0	.	155;155;189	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	N	155;155;189;155	ENSP00000438647:D155N;ENSP00000357411:D155N;ENSP00000406286:D189N;ENSP00000292176:D155N	ENSP00000292176:D155N	D	+	1	0	ZBTB7B	153254223	0.167000	0.22975	1.000000	0.80357	0.991000	0.79684	1.112000	0.31172	1.796000	0.52611	0.462000	0.41574	GAC		0.637	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872		Missense_Mutation
RGS4	5999	broad.mit.edu	37	1	163044228	163044228	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:163044228C>T	ENST00000367909.6	+	5	836	c.496C>T	c.(496-498)Cgc>Tgc	p.R166C	RGS4_ENST00000421743.2_Missense_Mutation_p.R263C|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_Missense_Mutation_p.R148C|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000527809.1_Missense_Mutation_p.R148C	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	166	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.R166C(1)|p.R263S(1)|p.R166S(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						GGATTCCTACCGCCGCTTCCT	0.502																																					Ovarian(76;1257 1738 3039 6086)											3	Substitution - Missense(3)	lung(2)|ovary(1)	1											233.0	249.0	243.0					1																	163044228		2203	4300	6503	161310852	SO:0001583	missense	5999			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.496C>T	1.37:g.163044228C>T	ENSP00000356885:p.Arg166Cys	Somatic		x	x	x	161310852	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	37	CCDS1243.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844833	0.91197	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000527809;ENST00000367906	T;T;T;T	0.02067	4.47;4.47;4.47;4.47	4.84	4.84	0.62591	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.058915	0.64402	D	0.000002	T	0.05777	0.0151	L	0.54323	1.7	0.49389	D	0.999788	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.986	T	0.13629	-1.0502	9	0.87932	D	0	.	15.4794	0.75514	0.0:1.0:0.0:0.0	.	166;263	P49798;A7XA59	RGS4_HUMAN;.	C	263;166;148;148	ENSP00000397181:R263C;ENSP00000356885:R166C;ENSP00000433261:R148C;ENSP00000356882:R148C	ENSP00000356882:R148C	R	+	1	0	RGS4	161310852	0.990000	0.36364	0.998000	0.56505	0.991000	0.79684	4.564000	0.60830	2.501000	0.84356	0.591000	0.81541	CGC		0.502	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		Missense_Mutation
CNIH4	29097	broad.mit.edu	37	1	224548210	224548210	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:224548210C>T	ENST00000465271.1	+	2	158	c.83C>T	c.(82-84)tCt>tTt	p.S28F	CNIH4_ENST00000366858.3_Missense_Mutation_p.S28F|CNIH4_ENST00000366856.3_Missense_Mutation_p.S28F|CNIH4_ENST00000468318.1_Intron|CNIH4_ENST00000366857.5_Missense_Mutation_p.S28F	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4	28					intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.S28F(1)		kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		ATTACATTGTCTGATTTAGAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	1											58.0	58.0	58.0					1																	224548210		2197	4292	6489	222614833	SO:0001583	missense	29097				CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.83C>T	1.37:g.224548210C>T	ENSP00000420443:p.Ser28Phe	Unknown		x	x	x	222614833	A8K1Q8|B2R553|Q9H0X8	Missense_Mutation	SNP	ENST00000465271.1	37	CCDS1543.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203699	0.79127	.	.	ENSG00000143771	ENST00000465271;ENST00000366858;ENST00000366857;ENST00000366856	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.76083	0.3938	M	0.91249	3.19	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.82481	-0.0436	10	0.87932	D	0	8.0E-4	18.1717	0.89747	0.0:1.0:0.0:0.0	.	28	Q9P003	CNIH4_HUMAN	F	28	ENSP00000420443:S28F;ENSP00000355823:S28F;ENSP00000355822:S28F;ENSP00000355821:S28F	ENSP00000355821:S28F	S	+	2	0	CNIH4	222614833	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.812000	0.75226	2.481000	0.83766	0.491000	0.48974	TCT		0.303	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091754.1	NM_014184		Missense_Mutation
ARID4B	51742	broad.mit.edu	37	1	235345429	235345429	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr1:235345429C>T	ENST00000264183.3	-	20	3302	c.2805G>A	c.(2803-2805)tgG>tgA	p.W935*	ARID4B_ENST00000494543.1_5'Flank|ARID4B_ENST00000366603.2_Nonsense_Mutation_p.W935*|ARID4B_ENST00000349213.3_Nonsense_Mutation_p.W849*	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	935					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.W935*(2)		NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTTTTTTAGGCCACTGTCCCT	0.463																																																2	Substitution - Nonsense(2)	ovary(2)	1											65.0	69.0	68.0					1																	235345429		2203	4300	6503	233412052	SO:0001587	stop_gained	51742			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2805G>A	1.37:g.235345429C>T	ENSP00000264183:p.Trp935*	Somatic		x	x	x	233412052	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	SNP	26	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.628944|4.628944	0.87560|0.87560	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.76343|.	0.3974|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76971|.	-0.2761|.	3|.	.|0.51188	.|T	.|0.08	-4.2182|-4.2182	18.7115|18.7115	0.91658|0.91658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	335|935;849;935;935	.|.	.|ENSP00000264183:W935X	G|W	-|-	2|3	0|0	ARID4B|ARID4B	233412052|233412052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.763000|0.763000	0.43281|0.43281	7.320000|7.320000	0.79064|0.79064	2.654000|2.654000	0.90174|0.90174	0.585000|0.585000	0.79938|0.79938	GGC|TGG		0.463	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374		Nonsense_Mutation
ITIH5	80760	broad.mit.edu	37	10	7618800	7618800	+	Missense_Mutation	SNP	C	C	G	rs529874492		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr10:7618800C>G	ENST00000256861.6	-	10	1672	c.1594G>C	c.(1594-1596)Gcc>Ccc	p.A532P	ITIH5_ENST00000446830.2_Missense_Mutation_p.A314P|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Missense_Mutation_p.A532P|ITIH5_ENST00000298441.6_Missense_Mutation_p.A318P|ITIH5_ENST00000397146.2_Missense_Mutation_p.A532P	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	532					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A532P(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTGTTGCTGGCGGTGACCTCC	0.567																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	81.0	83.0					10																	7618800		2203	4300	6503	7658806	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1594G>C	10.37:g.7618800C>G	ENSP00000256861:p.Ala532Pro	Unknown		x	x	x	7658806	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510844	0.85389	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.13089	2.62;2.62;2.62;2.62;2.62	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.42108	0.1188	.	.	.	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.36065	-0.9763	9	0.87932	D	0	-34.9461	19.1863	0.93645	0.0:1.0:0.0:0.0	.	532;532;318	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	P	532;532;318;314;532	ENSP00000256861:A532P;ENSP00000380333:A532P;ENSP00000298441:A318P;ENSP00000387969:A314P;ENSP00000380332:A532P	ENSP00000256861:A532P	A	-	1	0	ITIH5	7658806	1.000000	0.71417	0.989000	0.46669	0.855000	0.48748	7.380000	0.79704	2.516000	0.84829	0.462000	0.41574	GCC		0.567	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		Missense_Mutation
ANKRD30A	91074	broad.mit.edu	37	10	37430973	37430973	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr10:37430973T>A	ENST00000602533.1	+	7	1079	c.980T>A	c.(979-981)aTc>aAc	p.I327N	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.I327N|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.I327N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	383					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I327N(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCTAGGAAGATCGCATGGGAG	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											114.0	112.0	112.0					10																	37430973		1841	4094	5935	37470979	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.980T>A	10.37:g.37430973T>A	ENSP00000473551:p.Ile327Asn	Unknown		x	x	x	37470979	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	.	10.22	1.289020	0.23478	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.39997	1.15;1.05	0.104	0.104	0.14531	.	.	.	.	.	T	0.21841	0.0526	N	0.08118	0	0.09310	N	1	P	0.39520	0.676	B	0.39738	0.308	T	0.13282	-1.0515	8	0.59425	D	0.04	.	.	.	.	.	383	Q9BXX3	AN30A_HUMAN	N	327	ENSP00000354432:I327N;ENSP00000363792:I327N	ENSP00000354432:I327N	I	+	2	0	ANKRD30A	37470979	0.978000	0.34361	0.266000	0.24541	0.267000	0.26476	1.253000	0.32886	0.149000	0.19098	0.147000	0.16070	ATC		0.433	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		Missense_Mutation
DLG5	9231	broad.mit.edu	37	10	79595499	79595499	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr10:79595499A>C	ENST00000372391.2	-	8	1624	c.1619T>G	c.(1618-1620)aTc>aGc	p.I540S	DLG5_ENST00000372388.2_Missense_Mutation_p.I540S	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	540					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.I540S(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CCCATACCGGATGCTGTCACG	0.607																																																1	Substitution - Missense(1)	ovary(1)	10											72.0	57.0	62.0					10																	79595499		2203	4300	6503	79265505	SO:0001583	missense	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.1619T>G	10.37:g.79595499A>C	ENSP00000361467:p.Ile540Ser	Unknown		x	x	x	79265505	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222518	0.79464	.	.	ENSG00000151208	ENST00000372391;ENST00000372388	T;T	0.08102	3.13;3.19	5.8	5.8	0.92144	.	0.000000	0.39834	N	0.001249	T	0.26882	0.0658	L	0.59436	1.845	0.49213	D	0.99976	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.997;0.996;0.994	T	0.00423	-1.1748	10	0.87932	D	0	.	16.1549	0.81657	1.0:0.0:0.0:0.0	.	430;540;540	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	S	540	ENSP00000361467:I540S;ENSP00000361464:I540S	ENSP00000361464:I540S	I	-	2	0	DLG5	79265505	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	8.887000	0.92456	2.209000	0.71365	0.533000	0.62120	ATC		0.607	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			Missense_Mutation
ZNF518A	9849	broad.mit.edu	37	10	97916860	97916860	+	RNA	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr10:97916860C>T	ENST00000534948.1	+	0	1638							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P261S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGGTACTTTTCCCTTCACTTG	0.343																																																1	Substitution - Missense(1)	ovary(1)	10											88.0	85.0	86.0					10																	97916860		1888	4115	6003	97906850			9849			AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97916860C>T		Unknown		x	x	x	97906850	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37		SNP	30	Broad																																																																																				0.343	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803		Missense_Mutation
LOXL4	84171	broad.mit.edu	37	10	100015394	100015394	+	Missense_Mutation	SNP	C	C	G	rs199622385		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr10:100015394C>G	ENST00000260702.3	-	10	1681	c.1531G>C	c.(1531-1533)Ggg>Cgg	p.G511R	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	511	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.G511R(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		TGCACCGGCCCGTGCCTCTGG	0.682																																																1	Substitution - Missense(1)	ovary(1)	10											54.0	55.0	55.0					10																	100015394		2203	4299	6502	100005384	SO:0001583	missense	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1531G>C	10.37:g.100015394C>G	ENSP00000260702:p.Gly511Arg	Unknown		x	x	x	100005384	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	37	CCDS7473.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995168	0.74703	.	.	ENSG00000138131	ENST00000260702	T	0.35605	1.3	5.25	5.25	0.73442	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.216095	0.49916	D	0.000138	T	0.57681	0.2070	M	0.76328	2.33	0.44345	D	0.997235	D	0.76494	0.999	D	0.71414	0.973	T	0.60979	-0.7155	10	0.66056	D	0.02	.	11.9075	0.52721	0.0:0.9192:0.0:0.0808	.	511	Q96JB6	LOXL4_HUMAN	R	511	ENSP00000260702:G511R	ENSP00000260702:G511R	G	-	1	0	LOXL4	100005384	0.962000	0.33011	0.998000	0.56505	0.961000	0.63080	2.423000	0.44705	2.456000	0.83038	0.561000	0.74099	GGG		0.682	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211		Missense_Mutation
SLC6A5	9152	broad.mit.edu	37	11	20649563	20649563	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:20649563T>C	ENST00000525748.1	+	9	1706	c.1433T>C	c.(1432-1434)tTa>tCa	p.L478S		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	478					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.L478S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	TTCTTCTCTTTATCTGCTGCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											133.0	122.0	126.0					11																	20649563		2203	4300	6503	20606139	SO:0001583	missense	9152			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1433T>C	11.37:g.20649563T>C	ENSP00000434364:p.Leu478Ser	Unknown		x	x	x	20606139	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1	SNP	61	Broad	.	.	.	.	.	.	.	.	.	.	T	20.5	3.997567	0.74818	.	.	ENSG00000165970	ENST00000525748	T	0.80033	-1.33	5.65	5.65	0.86999	.	0.075804	0.53938	D	0.000054	D	0.92567	0.7639	H	0.94847	3.59	0.52501	D	0.999952	D	0.89917	1.0	D	0.87578	0.998	D	0.94488	0.7699	10	0.87932	D	0	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	478	Q9Y345	SC6A5_HUMAN	S	478	ENSP00000434364:L478S	ENSP00000434364:L478S	L	+	2	0	SLC6A5	20606139	0.994000	0.37717	0.199000	0.23439	0.997000	0.91878	4.967000	0.63722	2.279000	0.76181	0.533000	0.62120	TTA		0.483	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211		Missense_Mutation
LRRC4C	57689	broad.mit.edu	37	11	40137798	40137798	+	Silent	SNP	A	A	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:40137798A>C	ENST00000278198.2	-	2	2008	c.45T>G	c.(43-45)ggT>ggG	p.G15G	LRRC4C_ENST00000528697.1_Silent_p.G15G|LRRC4C_ENST00000530763.1_Silent_p.G15G|LRRC4C_ENST00000527150.1_Silent_p.G15G			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	15					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.G15G(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TAAACCTAGGACCTATCATTA	0.473																																																1	Substitution - coding silent(1)	ovary(1)	11											101.0	101.0	101.0					11																	40137798		2203	4300	6503	40094374	SO:0001819	synonymous_variant	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.45T>G	11.37:g.40137798A>C		Unknown		x	x	x	40094374	A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	CCDS31464.1	SNP	10	Broad																																																																																				0.473	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		Silent
OR5L1	219437	broad.mit.edu	37	11	55579783	55579783	+	Missense_Mutation	SNP	G	G	C	rs61735738	byFrequency	TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:55579783G>C	ENST00000333973.2	+	1	930	c.841G>C	c.(841-843)Gtg>Ctg	p.V281L		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V281L(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CTACACAGTCGTGATTCCTAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											66.0	62.0	63.0					11																	55579783		2200	4296	6496	55336359	SO:0001583	missense	219437			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.841G>C	11.37:g.55579783G>C	ENSP00000335529:p.Val281Leu	Unknown		x	x	x	55336359	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	CCDS31509.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	g	12.87	2.067051	0.36470	.	.	ENSG00000186117	ENST00000333973	T	0.00227	8.5	4.12	0.896	0.19253	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000237	T	0.00300	0.0009	L	0.53780	1.695	0.09310	N	1	P	0.49447	0.924	P	0.57720	0.826	T	0.47799	-0.9089	10	0.66056	D	0.02	-35.2853	5.4059	0.16320	0.1862:0.0:0.564:0.2498	.	281	Q8NGL2	OR5L1_HUMAN	L	281	ENSP00000335529:V281L	ENSP00000335529:V281L	V	+	1	0	OR5L1	55336359	0.001000	0.12720	0.361000	0.25849	0.295000	0.27426	0.156000	0.16382	0.736000	0.32559	0.428000	0.28381	GTG		0.453	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738		Missense_Mutation
LPXN	9404	broad.mit.edu	37	11	58317325	58317325	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:58317325T>C	ENST00000395074.2	-	7	764	c.676A>G	c.(676-678)Atg>Gtg	p.M226V	LPXN_ENST00000528489.1_Missense_Mutation_p.M206V|LPXN_ENST00000528954.1_Missense_Mutation_p.M231V	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	226	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)	p.M226V(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GTCTGGTTCATTGCTGTCAGC	0.488																																																1	Substitution - Missense(1)	ovary(1)	11											98.0	84.0	89.0					11																	58317325		2201	4295	6496	58073901	SO:0001583	missense	9404			AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.676A>G	11.37:g.58317325T>C	ENSP00000378512:p.Met226Val	Unknown		x	x	x	58073901	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	ENST00000395074.2	37	CCDS7969.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	15.89	2.967186	0.53507	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.87103	-2.21;-2.21	5.95	4.82	0.62117	Zinc finger, LIM-type (5);	0.099080	0.64402	D	0.000001	D	0.88127	0.6353	L	0.59912	1.85	0.50467	D	0.999873	P;P;B	0.52463	0.883;0.953;0.425	P;P;B	0.52031	0.688;0.621;0.304	D	0.87634	0.2518	10	0.66056	D	0.02	.	9.8141	0.40842	0.2741:0.0:0.0:0.7259	.	206;231;226	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	V	231;226	ENSP00000431284:M231V;ENSP00000378512:M226V	ENSP00000378512:M226V	M	-	1	0	LPXN	58073901	0.359000	0.24955	0.998000	0.56505	0.987000	0.75469	0.592000	0.23984	1.058000	0.40530	-0.327000	0.08410	ATG		0.488	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394709.1	NM_004811		Missense_Mutation
SLC22A25	387601	broad.mit.edu	37	11	62996901	62996901	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:62996901A>G	ENST00000306494.6	-	1	223	c.224T>C	c.(223-225)aTc>aCc	p.I75T	SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.I75T(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						TGGGATGGAGATTCTCAGGAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	11											137.0	124.0	129.0					11																	62996901		2201	4298	6499	62753477	SO:0001583	missense	387601			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.224T>C	11.37:g.62996901A>G	ENSP00000307443:p.Ile75Thr	Unknown		x	x	x	62753477		Missense_Mutation	SNP	ENST00000306494.6	37	CCDS31592.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	14.81	2.646546	0.47258	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.34859	1.34	3.54	3.54	0.40534	Major facilitator superfamily domain (1);	0.737600	0.12650	N	0.450490	T	0.59905	0.2228	M	0.86805	2.84	0.80722	D	1	D;D	0.69078	0.982;0.997	P;P	0.62649	0.889;0.905	T	0.62205	-0.6903	10	0.72032	D	0.01	.	8.8801	0.35370	1.0:0.0:0.0:0.0	.	73;75	A4IF29;Q6T423	.;S22AP_HUMAN	T	75	ENSP00000307443:I75T	ENSP00000307443:I75T	I	-	2	0	SLC22A25	62753477	0.971000	0.33674	0.994000	0.49952	0.586000	0.36452	2.601000	0.46249	1.389000	0.46526	0.240000	0.17902	ATC		0.517	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352		Missense_Mutation
SSH3	54961	broad.mit.edu	37	11	67079285	67079285	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr11:67079285C>T	ENST00000308127.4	+	14	2085	c.1907C>T	c.(1906-1908)tCc>tTc	p.S636F	SSH3_ENST00000308298.7_Missense_Mutation_p.S371F|SSH3_ENST00000376757.5_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	636					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S636F(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CCCTGCATTTCCTCTACGCCC	0.677																																																1	Substitution - Missense(1)	ovary(1)	11											67.0	57.0	60.0					11																	67079285		2200	4295	6495	66835861	SO:0001583	missense	54961			AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1907C>T	11.37:g.67079285C>T	ENSP00000312081:p.Ser636Phe	Unknown		x	x	x	66835861	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	7.853	0.724414	0.15439	.	.	ENSG00000172830	ENST00000308127;ENST00000308298	T;T	0.38722	3.6;1.12	4.72	1.52	0.23074	.	1.089060	0.07056	N	0.832883	T	0.33147	0.0853	N	0.24115	0.695	0.09310	N	0.999998	P;P	0.40794	0.729;0.61	P;B	0.45138	0.471;0.28	T	0.30446	-0.9978	10	0.87932	D	0	-2.4481	3.5705	0.07916	0.17:0.5649:0.1659:0.0992	.	490;636	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	F	636;371	ENSP00000312081:S636F;ENSP00000310055:S371F	ENSP00000312081:S636F	S	+	2	0	SSH3	66835861	0.047000	0.20315	0.202000	0.23494	0.006000	0.05464	0.803000	0.27083	0.510000	0.28216	0.561000	0.74099	TCC		0.677	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276		Missense_Mutation
LRRK2	120892	broad.mit.edu	37	12	40693019	40693019	+	Nonsense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:40693019T>A	ENST00000298910.7	+	25	3514	c.3456T>A	c.(3454-3456)tgT>tgA	p.C1152*	LRRK2_ENST00000343742.2_Nonsense_Mutation_p.C1152*	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1152					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.C1152*(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTGAGGCTTGTCCTAAAGTGG	0.428																																																2	Substitution - Nonsense(2)	ovary(2)	12											180.0	192.0	188.0					12																	40693019		2203	4300	6503	38979286	SO:0001587	stop_gained	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3456T>A	12.37:g.40693019T>A	ENSP00000298910:p.Cys1152*	Somatic		x	x	x	38979286	A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	SNP	58	Broad	.	.	.	.	.	.	.	.	.	.	T	43	9.916263	0.99294	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.12	2.72	0.32119	.	0.051760	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.757	0.28930	0.0:0.2337:0.0:0.7663	.	.	.	.	X	1152	.	ENSP00000298910:C1152X	C	+	3	2	LRRK2	38979286	0.979000	0.34478	1.000000	0.80357	0.987000	0.75469	0.735000	0.26115	0.738000	0.32606	0.260000	0.18958	TGT		0.428	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513		Nonsense_Mutation
CLLU1	574028	broad.mit.edu	37	12	92818613	92818613	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:92818613T>G	ENST00000378485.1	+	1	879	c.157T>G	c.(157-159)Tct>Gct	p.S53A	CLLU1OS_ENST00000378487.2_Intron|CLLU1OS_ENST00000538965.1_Intron|CLLU1_ENST00000472839.2_Intron|RP11-693J15.4_ENST00000508671.1_RNA	NM_001025233.1	NP_001020404.1	Q5K131	CLLU1_HUMAN	chronic lymphocytic leukemia up-regulated 1	53						cytoplasm (GO:0005737)		p.S53A(1)		NS(1)|breast(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TTATTTATTTTCTCAAAACAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	12											36.0	34.0	35.0					12																	92818613		1793	4054	5847	91342744	SO:0001583	missense	574028			AJ845162		12q22	2012-04-19			ENSG00000257127	ENSG00000257127			29841	protein-coding gene	gene with protein product						19726446	Standard	NR_027932		Approved		uc001tcg.1	Q5K131	OTTHUMG00000170103	ENST00000378485.1:c.157T>G	12.37:g.92818613T>G	ENSP00000367746:p.Ser53Ala	Unknown		x	x	x	91342744		Missense_Mutation	SNP	ENST00000378485.1	37		SNP	62	Broad	.	.	.	.	.	.	.	.	.	.	T	3.802	-0.041578	0.07452	.	.	ENSG00000257127	ENST00000378485	T	0.52295	0.67	2.22	1.0	0.19881	.	.	.	.	.	T	0.25938	0.0632	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.22521	-1.0214	7	0.87932	D	0	.	4.2089	0.10502	0.0:0.178:0.0:0.822	.	.	.	.	A	53	ENSP00000367746:S53A	ENSP00000367746:S53A	S	+	1	0	AC063949.1	91342744	0.112000	0.22096	0.055000	0.19348	0.014000	0.08584	0.645000	0.24782	0.268000	0.21939	0.523000	0.50628	TCT		0.303	CLLU1-003	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000366643.1	NM_001025233		Missense_Mutation
RASAL1	8437	broad.mit.edu	37	12	113542007	113542007	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:113542007C>T	ENST00000261729.5	-	18	2239	c.1924G>A	c.(1924-1926)Gac>Aac	p.D642N	RASAL1_ENST00000548055.1_Missense_Mutation_p.D643N|RASAL1_ENST00000446861.3_Missense_Mutation_p.D614N|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000546530.1_Missense_Mutation_p.D644N			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	642	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)	p.D642N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						CCCGTGCCGTCCTGCGTCACC	0.687																																																1	Substitution - Missense(1)	ovary(1)	12											29.0	25.0	26.0					12																	113542007		2200	4300	6500	112026390	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1924G>A	12.37:g.113542007C>T	ENSP00000261729:p.Asp642Asn	Unknown		x	x	x	112026390	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279364	0.59758	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	D;D;T;D	0.93133	-3.17;-3.17;-0.74;-3.17	4.7	3.58	0.41010	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.418838	0.25183	N	0.032517	D	0.90086	0.6903	L	0.43152	1.355	0.44142	D	0.996939	B;B;B;B;B;B	0.20052	0.004;0.018;0.022;0.041;0.029;0.018	B;B;B;B;B;B	0.26202	0.014;0.011;0.02;0.067;0.062;0.011	D	0.88356	0.2984	10	0.54805	T	0.06	.	12.66	0.56809	0.0:0.8985:0.0:0.1015	.	643;643;656;644;642;614	B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;RASL1_HUMAN;.	N	644;642;614;643	ENSP00000450244:D644N;ENSP00000261729:D642N;ENSP00000395920:D614N;ENSP00000448510:D643N	ENSP00000261729:D642N	D	-	1	0	RASAL1	112026390	1.000000	0.71417	0.966000	0.40874	0.961000	0.63080	2.820000	0.48057	2.139000	0.66308	0.484000	0.47621	GAC		0.687	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		Missense_Mutation
TPCN1	53373	broad.mit.edu	37	12	113729438	113729438	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:113729438C>T	ENST00000335509.6	+	24	2298	c.1984C>T	c.(1984-1986)Cac>Tac	p.H662Y	TPCN1_ENST00000550785.1_Missense_Mutation_p.H734Y|TPCN1_ENST00000541517.1_Missense_Mutation_p.H734Y|TPCN1_ENST00000392569.4_Missense_Mutation_p.H594Y	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	662					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)	p.H662Y(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						TCAGACCTCCCACTGGAGCCG	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											66.0	51.0	56.0					12																	113729438		2202	4300	6502	112213821	SO:0001583	missense	53373			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.1984C>T	12.37:g.113729438C>T	ENSP00000335300:p.His662Tyr	Unknown		x	x	x	112213821	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	37	CCDS31908.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613430	0.66672	.	.	ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569	D;D;D;D	0.97256	-4.31;-4.31;-4.31;-4.31	5.61	5.61	0.85477	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.94853	0.8337	N	0.12961	0.28	0.58432	D	0.999999	D;P	0.63880	0.993;0.727	P;B	0.55112	0.769;0.308	D	0.91340	0.5096	10	0.02654	T	1	-48.8822	20.0018	0.97417	0.0:1.0:0.0:0.0	.	734;662	Q9ULQ1-3;Q9ULQ1	.;TPC1_HUMAN	Y	662;734;734;594	ENSP00000335300:H662Y;ENSP00000448083:H734Y;ENSP00000438125:H734Y;ENSP00000376350:H594Y	ENSP00000335300:H662Y	H	+	1	0	TPCN1	112213821	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.364000	0.79526	2.793000	0.96121	0.655000	0.94253	CAC		0.592	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901		Missense_Mutation
WSB2	55884	broad.mit.edu	37	12	118472046	118472046	+	Silent	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:118472046T>C	ENST00000315436.3	-	9	1311	c.1170A>G	c.(1168-1170)ccA>ccG	p.P390P	WSB2_ENST00000542304.1_Silent_p.P165P|WSB2_ENST00000536738.1_5'Flank|WSB2_ENST00000535496.1_Silent_p.P392P|WSB2_ENST00000441406.2_Silent_p.P407P|WSB2_ENST00000544233.1_Silent_p.P180P	NM_001278557.1|NM_018639.3	NP_001265486.1|NP_061109.1	Q9NYS7	WSB2_HUMAN	WD repeat and SOCS box containing 2	390	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.P390P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTTGGGGATTGGCAGTGCTA	0.468																																																1	Substitution - coding silent(1)	ovary(1)	12											248.0	210.0	223.0					12																	118472046		2203	4300	6503	116956429	SO:0001819	synonymous_variant	55884			AF038187	CCDS9186.1, CCDS61251.1, CCDS61252.1	12q24.23	2013-01-09	2011-01-25		ENSG00000176871	ENSG00000176871		"""WD repeat domain containing"""	19222	protein-coding gene	gene with protein product			"""WD repeat and SOCS box-containing 2"""			12076535	Standard	NM_018639		Approved	SBA2, MGC10210	uc001twr.2	Q9NYS7	OTTHUMG00000168885	ENST00000315436.3:c.1170A>G	12.37:g.118472046T>C		Unknown		x	x	x	116956429	B4DIE6|B4DPV6|Q9NRX9	Silent	SNP	ENST00000315436.3	37	CCDS9186.1	SNP	63	Broad																																																																																				0.468	WSB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401515.1	NM_018639		Silent
RPLP0	6175	broad.mit.edu	37	12	120635197	120635197	+	Silent	SNP	A	A	G	rs200799516		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr12:120635197A>G	ENST00000551150.1	-	6	1035	c.720T>C	c.(718-720)tcT>tcC	p.S240S	RPLP0_ENST00000392514.4_Silent_p.S240S|RPLP0_ENST00000313104.5_Silent_p.S178S|RPLP0_ENST00000228306.4_Silent_p.S240S|RPLP0_ENST00000552292.1_Silent_p.S30S|RPLP0_ENST00000546989.1_Silent_p.S204S|RPLP0_ENST00000550296.1_5'Flank|GCN1L1_ENST00000300648.6_5'Flank			P05388	RLA0_HUMAN	ribosomal protein, large, P0	240					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.S240S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGTTGATGATAGAATGGGGTA	0.507																																																1	Substitution - coding silent(1)	ovary(1)	12											68.0	57.0	61.0					12																	120635197		2203	4297	6500	119119580	SO:0001819	synonymous_variant	6175			AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.720T>C	12.37:g.120635197A>G		Unknown		x	x	x	119119580	Q3B7A4|Q9BVK4	Silent	SNP	ENST00000551150.1	37	CCDS9193.1	SNP	15	Broad																																																																																				0.507	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403448.3	NM_053275		Silent
MTUS2	23281	broad.mit.edu	37	13	29599284	29599284	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1032-01	TCGA-23-1032-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr13:29599284G>T	ENST00000431530.3	+	1	537	c.479G>T	c.(478-480)aGg>aTg	p.R160M		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	150						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.R160M(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TTGGCTAAAAGGGATGCTGAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											104.0	106.0	106.0					13																	29599284		2038	4200	6238	28497284	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.479G>T	13.37:g.29599284G>T	ENSP00000392057:p.Arg160Met	Somatic		x	x	x	28497284	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	g	12.98	2.101026	0.37048	.	.	ENSG00000132938	ENST00000431530	T	0.15017	2.46	5.22	3.07	0.35406	.	0.450854	0.19397	N	0.115275	T	0.27169	0.0666	L	0.47716	1.5	0.19300	N	0.999971	D	0.65815	0.995	P	0.60415	0.874	T	0.05022	-1.0911	9	.	.	.	.	9.0708	0.36491	0.2149:0.0:0.7851:0.0	.	150	Q5JR59	MTUS2_HUMAN	M	160	ENSP00000392057:R160M	.	R	+	2	0	MTUS2	28497284	0.755000	0.28372	0.012000	0.15200	0.048000	0.14542	1.010000	0.29898	0.351000	0.24027	0.655000	0.94253	AGG		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		Missense_Mutation
HMGB1	3146	broad.mit.edu	37	13	31037343	31037343	+	Splice_Site	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr13:31037343C>T	ENST00000405805.1	-	3	1237		c.e3+1		HMGB1_ENST00000339872.4_Splice_Site|HMGB1_ENST00000399494.1_Splice_Site|HMGB1_ENST00000341423.5_Splice_Site|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399489.1_Splice_Site|HMGB1_ENST00000326004.4_Splice_Site			P09429	HMGB1_HUMAN	high mobility group box 1						apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)	p.?(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		AAGATACTCACGGAGGCCTCT	0.418																																																1	Unknown(1)	ovary(1)	13											105.0	120.0	115.0					13																	31037343		2203	4300	6503	29935343	SO:0001630	splice_region_variant	3146			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.296+1G>A	13.37:g.31037343C>T		Somatic		x	x	x	29935343	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Splice_Site_SNP	SNP	ENST00000405805.1	37	CCDS9335.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388734	0.82902	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399489;ENST00000399494;ENST00000426225;ENST00000326004	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2732	0.94019	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HMGB1	29935343	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.585000	0.82584	2.547000	0.85894	0.643000	0.83706	.		0.418	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	Intron	Splice_Site_SNP
GPC5	2262	broad.mit.edu	37	13	92380859	92380859	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr13:92380859A>G	ENST00000377067.3	+	4	1466	c.1094A>G	c.(1093-1095)gAg>gGg	p.E365G	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	365					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.E365G(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CAGAGCAAAGAGAAGCATGGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	13											127.0	132.0	130.0					13																	92380859		2203	4300	6503	91178860	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1094A>G	13.37:g.92380859A>G	ENSP00000366267:p.Glu365Gly	Unknown		x	x	x	91178860	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	16.74	3.207050	0.58343	.	.	ENSG00000179399	ENST00000377067	T	0.47177	0.85	5.88	4.67	0.58626	.	0.506290	0.22119	N	0.064361	T	0.43612	0.1255	L	0.53249	1.67	0.37203	D	0.904452	B	0.18310	0.027	B	0.22152	0.038	T	0.44832	-0.9302	10	0.49607	T	0.09	0.0079	10.2909	0.43594	0.853:0.0:0.0:0.147	.	365	P78333	GPC5_HUMAN	G	365	ENSP00000366267:E365G	ENSP00000366267:E365G	E	+	2	0	GPC5	91178860	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.878000	0.56130	1.014000	0.39417	0.455000	0.32223	GAG		0.398	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466		Missense_Mutation
Unknown	0	broad.mit.edu	37	13	0	0	+	IGR	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr13:0C>T								None (None upstream) : None (None downstream)																							NNNNNNNNNN	0.0																																																0			13																																								113572816	SO:0001628	intergenic_variant	2621																															13.37:g.0C>T		Unknown		x	x	x	113572816		Silent	SNP		37		SNP	30	Broad																																																																																			0	0.000									Silent
MCF2L	23263	broad.mit.edu	37	13	113634001	113634001	+	Intron	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr13:113634001C>G	ENST00000375608.3	+	3	227				MCF2L_ENST00000421756.1_Missense_Mutation_p.S7C|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000442652.2_Intron|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000375601.3_Missense_Mutation_p.S7C			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S7C(1)		kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				AAGGGAGCATCCCGGGGAACC	0.662																																																1	Substitution - Missense(1)	ovary(1)	13											27.0	32.0	30.0					13																	113634001		1568	3579	5147	112682002	SO:0001627	intron_variant	23263			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.170-35076C>G	13.37:g.113634001C>G		Unknown		x	x	x	112682002	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	37		SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	15.44	2.832998	0.50951	.	.	ENSG00000126217	ENST00000421756;ENST00000375601	T;T	0.37584	1.25;1.19	3.38	1.64	0.23874	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31024	-0.9958	6	0.87932	D	0	.	5.2782	0.15661	0.0:0.7336:0.0:0.2664	.	.	.	.	C	7	ENSP00000397285:S7C;ENSP00000364751:S7C	ENSP00000364751:S7C	S	+	2	0	MCF2L	112682002	0.002000	0.14202	0.000000	0.03702	0.242000	0.25591	0.658000	0.24979	0.434000	0.26340	0.478000	0.44815	TCC		0.662	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4			Missense_Mutation
FANCM	57697	broad.mit.edu	37	14	45644576	45644576	+	Silent	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr14:45644576T>C	ENST00000267430.5	+	14	2704	c.2619T>C	c.(2617-2619)ggT>ggC	p.G873G	FANCM_ENST00000542564.2_Silent_p.G847G	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	873					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.G873G(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATAATCACGGTATTATAGATT	0.259								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							1	Substitution - coding silent(1)	ovary(1)	14											40.0	48.0	45.0					14																	45644576		2194	4283	6477	44714326	SO:0001819	synonymous_variant	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2619T>C	14.37:g.45644576T>C		Unknown		x	x	x	44714326	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	CCDS32070.1	SNP	57	Broad																																																																																				0.259	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		Silent
KLHDC2	23588	broad.mit.edu	37	14	50244914	50244914	+	Silent	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr14:50244914G>A	ENST00000298307.5	+	5	1347	c.486G>A	c.(484-486)ggG>ggA	p.G162G	KLHDC2_ENST00000557247.1_Silent_p.G162G|KLHDC2_ENST00000553538.1_3'UTR|KLHDC2_ENST00000554589.1_Silent_p.G162G	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	162						nucleus (GO:0005634)		p.G162G(1)		endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					TTTTTGGAGGGTATGGATATT	0.343																																																1	Substitution - coding silent(1)	ovary(1)	14											129.0	129.0	129.0					14																	50244914		2203	4300	6503	49314664	SO:0001819	synonymous_variant	23588			AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.486G>A	14.37:g.50244914G>A		Unknown		x	x	x	49314664	B3KPF9|Q6IAF0|Q86TY9	Silent	SNP	ENST00000298307.5	37	CCDS9693.1	SNP	44	Broad																																																																																				0.343	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1			Silent
PCNXL4	64430	broad.mit.edu	37	14	60581979	60581979	+	Missense_Mutation	SNP	A	A	G	rs200309248		TCGA-23-1032-01	TCGA-23-1032-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr14:60581979A>G	ENST00000406854.1	+	4	1711	c.1157A>G	c.(1156-1158)aAt>aGt	p.N386S	PCNXL4_ENST00000404681.2_Missense_Mutation_p.N386S|PCNXL4_ENST00000406949.1_Missense_Mutation_p.N152S|PCNXL4_ENST00000317623.4_Missense_Mutation_p.N152S			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	386						integral component of membrane (GO:0016021)		p.N152S(1)									TCTAAAAGCAATTCCCAGGCT	0.348																																																1	Substitution - Missense(1)	ovary(1)	14						A	SER/ASN	8,3640		0,8,1816	143.0	137.0	139.0		455	2.7	0.0	14		139	0,8158		0,0,4079	yes	missense	C14orf135	NM_022495.5	46	0,8,5895	GG,GA,AA		0.0,0.2193,0.0678	benign	152/939	60581979	8,11798	1824	4079	5903	59651732	SO:0001583	missense	64430			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.1157A>G	14.37:g.60581979A>G	ENSP00000384801:p.Asn386Ser	Somatic		x	x	x	59651732	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.478818	0.00165	0.002193	0.0	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681	T;T;T;T	0.20200	2.1;2.09;2.1;2.09	5.51	2.68	0.31781	.	.	.	.	.	T	0.04588	0.0125	N	0.00289	-1.7	0.20403	N	0.99991	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35475	-0.9787	9	0.02654	T	1	.	11.709	0.51614	0.1967:0.0:0.8033:0.0	.	386;152	Q63HM2;B5MC47	CN135_HUMAN;.	S	152;386;152;386	ENSP00000317396:N152S;ENSP00000384801:N386S;ENSP00000385201:N152S;ENSP00000385713:N386S	ENSP00000317396:N152S	N	+	2	0	C14orf135	59651732	0.481000	0.25941	0.003000	0.11579	0.168000	0.22595	1.849000	0.39318	0.368000	0.24481	-0.400000	0.06385	AAT		0.348	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495		Missense_Mutation
BAG5	9529	broad.mit.edu	37	14	104027422	104027422	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr14:104027422A>C	ENST00000445922.2	-	2	326	c.80T>G	c.(79-81)gTt>gGt	p.V27G	APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000556253.2_5'Flank|RP11-73M18.2_ENST00000472726.2_5'Flank|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000337322.4_Missense_Mutation_p.V68G|BAG5_ENST00000299204.4_Missense_Mutation_p.V27G|RP11-894P9.2_ENST00000556332.1_RNA	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	27	BAG 1. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.V27G(1)		endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			GAAGCCGATAACTTGCTGTTC	0.373																																					NSCLC(171;1832 2055 18950 31566 41632)											1	Substitution - Missense(1)	ovary(1)	14											85.0	86.0	86.0					14																	104027422		2203	4300	6503	103097175	SO:0001583	missense	9529			AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.80T>G	14.37:g.104027422A>C	ENSP00000391713:p.Val27Gly	Unknown		x	x	x	103097175	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	37	CCDS9982.1	SNP	2	Broad	.	.	.	.	.	.	.	.	.	.	A	18.80	3.700694	0.68501	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322;ENST00000557666	D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74	5.61	5.61	0.85477	BAG domain (3);	0.000000	0.85682	D	0.000000	D	0.95683	0.8596	M	0.85630	2.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96308	0.9226	10	0.87932	D	0	-25.0726	15.8191	0.78626	1.0:0.0:0.0:0.0	.	27;68	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	G	27;27;68;27	ENSP00000299204:V27G;ENSP00000391713:V27G;ENSP00000338814:V68G;ENSP00000450497:V27G	ENSP00000299204:V27G	V	-	2	0	BAG5	103097175	1.000000	0.71417	0.887000	0.34795	0.788000	0.44548	8.117000	0.89575	2.139000	0.66308	0.533000	0.62120	GTT		0.373	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1			Missense_Mutation
MKRN3	7681	broad.mit.edu	37	15	23811155	23811155	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr15:23811155C>T	ENST00000314520.3	+	1	702	c.226C>T	c.(226-228)Cca>Tca	p.P76S	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Missense_Mutation_p.P76S|MKRN3_ENST00000564592.1_Missense_Mutation_p.P76S	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	76					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P76S(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GAGGCCTGCCCCAGCCTCAGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	15											29.0	31.0	30.0					15																	23811155		2203	4300	6503	21362248	SO:0001583	missense	7681			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.226C>T	15.37:g.23811155C>T	ENSP00000313881:p.Pro76Ser	Somatic		x	x	x	21362248		Missense_Mutation	SNP	ENST00000314520.3	37	CCDS10013.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	c	14.45	2.538627	0.45176	.	.	ENSG00000179455	ENST00000314520	T	0.30714	1.52	3.6	3.6	0.41247	.	0.685661	0.11953	N	0.513536	T	0.16385	0.0394	N	0.14661	0.345	0.09310	N	1	B;B	0.33103	0.397;0.033	B;B	0.24701	0.055;0.007	T	0.06463	-1.0825	10	0.25751	T	0.34	.	11.0336	0.47787	0.0:1.0:0.0:0.0	.	76;76	Q6NSB6;Q13064	.;MKRN3_HUMAN	S	76	ENSP00000313881:P76S	ENSP00000313881:P76S	P	+	1	0	MKRN3	21362248	0.000000	0.05858	0.010000	0.14722	0.036000	0.12997	0.744000	0.26245	2.304000	0.77564	0.467000	0.42956	CCA		0.627	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664		Missense_Mutation
CYP19A1	1588	broad.mit.edu	37	15	51520007	51520007	+	Silent	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr15:51520007G>A	ENST00000396402.1	-	4	573	c.420C>T	c.(418-420)ctC>ctT	p.L140L	RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000557858.1_Silent_p.L140L|CYP19A1_ENST00000396404.4_Silent_p.L140L|CYP19A1_ENST00000559878.1_Silent_p.L140L|CYP19A1_ENST00000260433.2_Silent_p.L140L|CYP19A1_ENST00000405913.3_Silent_p.L140L	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	140					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	TTGTTTTCCAGAGCTCTGGAT	0.388																																					Melanoma(142;1016 1807 39614 48966 51721)											0			15											121.0	109.0	113.0					15																	51520007		2196	4293	6489	49307299	SO:0001819	synonymous_variant	1588			D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.420C>T	15.37:g.51520007G>A		Unknown		x	x	x	49307299	Q16731|Q3B764|Q58FA0|Q8IYJ7	Silent	SNP	ENST00000396402.1	37	CCDS10139.1	SNP	33	Broad																																																																																				0.388	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1			Silent
LMF1	64788	broad.mit.edu	37	16	919942	919942	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr16:919942A>T	ENST00000262301.11	-	9	1375	c.1357T>A	c.(1357-1359)Tgc>Agc	p.C453S	LMF1_ENST00000399843.2_Missense_Mutation_p.C453S|LMF1_ENST00000543238.1_Missense_Mutation_p.C216S|LMF1_ENST00000568268.1_5'Flank|LMF1_ENST00000568897.1_Missense_Mutation_p.C236S	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	453					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				GAGATGAGGCAGGGCCGTCTG	0.667																																																0			16											58.0	72.0	67.0					16																	919942		2159	4240	6399	859943	SO:0001583	missense	64788			AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1357T>A	16.37:g.919942A>T	ENSP00000262301:p.Cys453Ser	Unknown		x	x	x	859943	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	37	CCDS45373.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250491	0.39797	.	.	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000540070;ENST00000545827;ENST00000543238	T;T;T	0.21361	2.01;2.01;2.01	5.16	5.16	0.70880	.	0.093064	0.85682	D	0.000000	T	0.27313	0.0670	M	0.73962	2.25	0.80722	D	1	B	0.32968	0.392	B	0.37989	0.262	T	0.05566	-1.0877	10	0.10377	T	0.69	-15.7247	13.8024	0.63208	1.0:0.0:0.0:0.0	.	453	Q96S06	LMF1_HUMAN	S	453;453;236;207;216	ENSP00000262301:C453S;ENSP00000382737:C453S;ENSP00000437418:C216S	ENSP00000262301:C453S	C	-	1	0	LMF1	859943	1.000000	0.71417	0.924000	0.36721	0.952000	0.60782	7.274000	0.78538	1.948000	0.56530	0.459000	0.35465	TGC		0.667	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773		Missense_Mutation
LMF1	64788	broad.mit.edu	37	16	920799	920799	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr16:920799T>A	ENST00000262301.11	-	8	1180	c.1162A>T	c.(1162-1164)Agc>Tgc	p.S388C	LMF1_ENST00000568268.1_5'Flank|LMF1_ENST00000399843.2_Missense_Mutation_p.S388C|LMF1_ENST00000543238.1_Missense_Mutation_p.S151C|LMF1_ENST00000568897.1_Missense_Mutation_p.S171C	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	388					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				TGCCTGGAGCTCAGCAAGTTG	0.642																																																0			16											72.0	87.0	82.0					16																	920799		2172	4258	6430	860800	SO:0001583	missense	64788			AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.1162A>T	16.37:g.920799T>A	ENSP00000262301:p.Ser388Cys	Unknown		x	x	x	860800	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	37	CCDS45373.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228512	0.79576	.	.	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000540070;ENST00000545827;ENST00000543238	T;T;T	0.25749	1.78;1.78;1.78	5.48	5.48	0.80851	.	0.117966	0.85682	D	0.000000	T	0.62889	0.2465	H	0.95437	3.67	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.75213	-0.3397	10	0.87932	D	0	-9.7776	14.3786	0.66897	0.0:0.0:0.0:1.0	.	388	Q96S06	LMF1_HUMAN	C	388;388;171;142;151	ENSP00000262301:S388C;ENSP00000382737:S388C;ENSP00000437418:S151C	ENSP00000262301:S388C	S	-	1	0	LMF1	860800	1.000000	0.71417	0.997000	0.53966	0.446000	0.32137	7.553000	0.82203	2.091000	0.63221	0.459000	0.35465	AGC		0.642	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773		Missense_Mutation
LMF1	64788	broad.mit.edu	37	16	929647	929647	+	Missense_Mutation	SNP	C	C	T	rs531415593		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr16:929647C>T	ENST00000262301.11	-	6	838	c.820G>A	c.(820-822)Gag>Aag	p.E274K	LMF1_ENST00000568268.1_5'UTR|LMF1_ENST00000399843.2_Missense_Mutation_p.E274K|LMF1_ENST00000543238.1_Missense_Mutation_p.E37K|LMF1_ENST00000568897.1_Missense_Mutation_p.E57K	NM_022773.2	NP_073610.2	Q96S06	LMF1_HUMAN	lipase maturation factor 1	274					chylomicron remnant clearance (GO:0034382)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of lipoprotein lipase activity (GO:0051006)|protein glycosylation in Golgi (GO:0033578)|protein maturation (GO:0051604)|protein secretion (GO:0009306)|regulation of cholesterol metabolic process (GO:0090181)|regulation of triglyceride metabolic process (GO:0090207)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.E274K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	18		Hepatocellular(780;0.00308)				ACCAGGAGCTCGATGAAGTGG	0.652													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16864	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	16											62.0	78.0	73.0					16																	929647		2139	4233	6372	869648	SO:0001583	missense	64788			AK022743	CCDS45373.1	16p13.3	2008-02-05	2007-11-29	2007-11-29	ENSG00000103227	ENSG00000103227			14154	protein-coding gene	gene with protein product		611761	"""chromosome 16 open reading frame 26"", ""transmembrane protein 112"""	C16orf26, TMEM112		11157797, 17994020	Standard	NM_022773		Approved	FLJ12681, JFP11, FLJ22302, TMEM112A	uc021tae.1	Q96S06	OTTHUMG00000047848	ENST00000262301.11:c.820G>A	16.37:g.929647C>T	ENSP00000262301:p.Glu274Lys	Unknown		x	x	x	869648	Q68CJ3|Q96FJ4|Q9H6G4|Q9H9K7	Missense_Mutation	SNP	ENST00000262301.11	37	CCDS45373.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368795	0.82463	.	.	ENSG00000103227	ENST00000262301;ENST00000399843;ENST00000540070;ENST00000545827;ENST00000543238	T;T;T	0.31510	1.49;1.49;1.49	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.68522	0.3010	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79818	-0.1643	10	0.87932	D	0	-15.5193	17.3999	0.87456	0.0:1.0:0.0:0.0	.	274	Q96S06	LMF1_HUMAN	K	274;274;57;28;37	ENSP00000262301:E274K;ENSP00000382737:E274K;ENSP00000437418:E37K	ENSP00000262301:E274K	E	-	1	0	LMF1	869648	1.000000	0.71417	0.999000	0.59377	0.416000	0.31233	7.773000	0.85462	2.356000	0.79943	0.555000	0.69702	GAG		0.652	LMF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109071.3	NM_022773		Missense_Mutation
CASKIN1	57524	broad.mit.edu	37	16	2235361	2235361	+	Missense_Mutation	SNP	G	G	A	rs549109076		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr16:2235361G>A	ENST00000343516.6	-	11	1189	c.1097C>T	c.(1096-1098)tCg>tTg	p.S366L	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	366					signal transduction (GO:0007165)	cytoplasm (GO:0005737)		p.S195L(1)|p.S366L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						AGAGGGTCCCGATGAGCTGCT	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17024	0.0		0.0	False		,,,				2504	0.001															2	Substitution - Missense(2)	ovary(2)	16											36.0	40.0	39.0					16																	2235361		1982	4152	6134	2175362	SO:0001583	missense	57524			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1097C>T	16.37:g.2235361G>A	ENSP00000345436:p.Ser366Leu	Unknown		x	x	x	2175362	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	37	CCDS42103.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	1.288	-0.608292	0.03717	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.66995	-0.24	4.64	-0.299	0.12808	Src homology-3 domain (1);	.	.	.	.	T	0.50854	0.1640	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.33137	-0.9880	9	0.25751	T	0.34	0.0799	6.1783	0.20457	0.2746:0.0:0.5875:0.1379	.	366	Q8WXD9	CSKI1_HUMAN	L	366;195	ENSP00000345436:S366L	ENSP00000345436:S366L	S	-	2	0	CASKIN1	2175362	0.002000	0.14202	0.006000	0.13384	0.005000	0.04900	0.408000	0.21065	0.136000	0.18733	-1.224000	0.01588	TCG		0.627	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764		Missense_Mutation
ABCC1	4363	broad.mit.edu	37	16	16208672	16208672	+	Silent	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr16:16208672G>A	ENST00000399410.3	+	23	3304	c.3129G>A	c.(3127-3129)ttG>ttA	p.L1043L	ABCC1_ENST00000399408.2_Silent_p.L1053L|ABCC1_ENST00000346370.5_Silent_p.L987L|ABCC1_ENST00000345148.5_Silent_p.L1043L|ABCC1_ENST00000349029.5_Silent_p.L928L|ABCC1_ENST00000351154.5_Silent_p.L984L	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1043	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.L1043L(1)		breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GGGGGATCTTGGCTTCCCGCT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	16											57.0	59.0	58.0					16																	16208672		2147	4261	6408	16116173	SO:0001819	synonymous_variant	4363			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3129G>A	16.37:g.16208672G>A		Unknown		x	x	x	16116173	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Silent	SNP	ENST00000399410.3	37	CCDS42122.1	SNP	47	Broad																																																																																				0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996		Silent
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	17	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln	Unknown		x	x	x	7518263	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		Missense_Mutation
WDR16	146845	broad.mit.edu	37	17	9536212	9536212	+	Silent	SNP	C	C	T	rs376283850		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:9536212C>T	ENST00000352665.5	+	10	1251	c.1182C>T	c.(1180-1182)aaC>aaT	p.N394N	WDR16_ENST00000396219.3_Silent_p.N326N|WDR16_ENST00000299764.5_Silent_p.N404N	NM_145054.4	NP_659491.4			WD repeat domain 16									p.N394N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CAGCATGGAACGACGGTAAAA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	17						C	,	0,4406		0,0,2203	102.0	86.0	92.0		978,1182	-1.5	0.5	17		92	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	WDR16	NM_001080556.1,NM_145054.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	326/553,394/621	9536212	1,13005	2203	4300	6503	9476937	SO:0001819	synonymous_variant	146845			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1182C>T	17.37:g.9536212C>T		Unknown		x	x	x	9476937		Silent	SNP	ENST00000352665.5	37	CCDS11149.2	SNP	19	Broad																																																																																				0.557	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054		Silent
SHMT1	6470	broad.mit.edu	37	17	18232093	18232093	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1032-01	TCGA-23-1032-10			A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:18232093A>C	ENST00000316694.3	-	12	1557	c.1423T>G	c.(1423-1425)Ttc>Gtc	p.F475V	SHMT1_ENST00000354098.3_Missense_Mutation_p.F436V|RP1-178F10.3_ENST00000577764.1_lincRNA|SHMT1_ENST00000539052.1_Missense_Mutation_p.F337V|SHMT1_ENST00000352886.6_Missense_Mutation_p.F395V	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	475					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.F475V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	GGCAGAGGGAAGAGAGAGGCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	17											24.0	23.0	23.0					17																	18232093		2201	4295	6496	18172818	SO:0001583	missense	6470				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1423T>G	17.37:g.18232093A>C	ENSP00000318868:p.Phe475Val	Somatic		x	x	x	18172818	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	37	CCDS11196.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252492	0.80135	.	.	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	5.48	5.48	0.80851	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79108	0.988;0.984;0.992	T	0.80214	-0.1475	10	0.87932	D	0	-28.2211	15.8563	0.78979	1.0:0.0:0.0:0.0	.	438;436;475	A8MYA6;P34896-2;P34896	.;.;GLYC_HUMAN	V	475;250;395;337;436;438	ENSP00000318868:F475V;ENSP00000345881:F395V;ENSP00000440089:F337V;ENSP00000318805:F436V	ENSP00000318868:F475V	F	-	1	0	SHMT1	18172818	1.000000	0.71417	0.976000	0.42696	0.440000	0.31957	8.949000	0.93012	2.210000	0.71456	0.533000	0.62120	TTC		0.637	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169		Missense_Mutation
GAS2L2	246176	broad.mit.edu	37	17	34077126	34077126	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:34077126C>G	ENST00000254466.6	-	2	624	c.597G>C	c.(595-597)caG>caC	p.Q199H	GAS2L2_ENST00000587565.1_Splice_Site	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	199					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)	p.Q199H(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGTGGCAGGGCTGGCGCCTGG	0.716																																																1	Substitution - Missense(1)	ovary(1)	17											10.0	14.0	13.0					17																	34077126		2138	4203	6341	31101239	SO:0001583	missense	246176			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.597G>C	17.37:g.34077126C>G	ENSP00000254466:p.Gln199His	Unknown		x	x	x	31101239	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	8.050	0.765796	0.15983	.	.	ENSG00000132139	ENST00000254466	T	0.18810	2.19	4.85	2.45	0.29901	Growth-arrest-specific protein 2 domain (1);	0.487586	0.18535	N	0.138377	T	0.12475	0.0303	N	0.22421	0.69	0.23969	N	0.99631	B	0.02656	0.0	B	0.04013	0.001	T	0.16928	-1.0386	10	0.51188	T	0.08	-2.7732	6.2397	0.20783	0.0:0.6091:0.0:0.3909	.	199	Q8NHY3	GA2L2_HUMAN	H	199	ENSP00000254466:Q199H	ENSP00000254466:Q199H	Q	-	3	2	GAS2L2	31101239	0.000000	0.05858	0.778000	0.31720	0.103000	0.19146	-0.029000	0.12329	1.027000	0.39758	0.491000	0.48974	CAG		0.716	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285		Missense_Mutation
KRT31	3881	broad.mit.edu	37	17	39553692	39553692	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:39553692C>G	ENST00000251645.2	-	1	152	c.100G>C	c.(100-102)Gcc>Ccc	p.A34P		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	34	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)	p.A34P(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				ATGTTGCAGGCCCCGGGCAGG	0.637																																																2	Substitution - Missense(2)	ovary(2)	17											44.0	47.0	46.0					17																	39553692		2203	4300	6503	36807218	SO:0001583	missense	3881			X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.100G>C	17.37:g.39553692C>G	ENSP00000251645:p.Ala34Pro	Unknown		x	x	x	36807218	Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	37	CCDS11391.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	c	19.29	3.799077	0.70567	.	.	ENSG00000094796	ENST00000251645	D	0.82167	-1.58	5.78	4.81	0.61882	.	0.000000	0.64402	D	0.000008	D	0.86736	0.6004	L	0.48362	1.52	0.35481	D	0.798143	D	0.60575	0.988	P	0.62649	0.905	D	0.90843	0.4725	10	0.72032	D	0.01	.	13.5502	0.61728	0.1555:0.8445:0.0:0.0	.	34	Q15323	K1H1_HUMAN	P	34	ENSP00000251645:A34P	ENSP00000251645:A34P	A	-	1	0	KRT31	36807218	0.009000	0.17119	1.000000	0.80357	0.939000	0.58152	0.581000	0.23819	1.459000	0.47892	0.650000	0.86243	GCC		0.637	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277		Missense_Mutation
KLHL11	55175	broad.mit.edu	37	17	40010062	40010062	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:40010062C>T	ENST00000319121.3	-	2	2117	c.2057G>A	c.(2056-2058)aGa>aAa	p.R686K	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	686								p.R686K(1)		NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				TTGCATCTGTCTGATGCGGTC	0.507																																																1	Substitution - Missense(1)	ovary(1)	17											203.0	182.0	189.0					17																	40010062		2203	4300	6503	37263588	SO:0001583	missense	55175				CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.2057G>A	17.37:g.40010062C>T	ENSP00000314608:p.Arg686Lys	Unknown		x	x	x	37263588		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081744	0.36758	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.70986	-0.53	5.69	5.69	0.88448	.	0.059606	0.64402	D	0.000002	T	0.60248	0.2254	N	0.19112	0.55	0.42978	D	0.994454	B	0.29378	0.243	B	0.27380	0.079	T	0.57556	-0.7791	10	0.41790	T	0.15	-0.1114	20.1668	0.98153	0.0:1.0:0.0:0.0	.	686	Q9NVR0	KLH11_HUMAN	K	686;549	ENSP00000314608:R686K	ENSP00000314608:R686K	R	-	2	0	KLHL11	37263588	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.179000	0.65043	2.831000	0.97527	0.650000	0.86243	AGA		0.507	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143		Missense_Mutation
TUBG2	27175	broad.mit.edu	37	17	40817779	40817779	+	Silent	SNP	G	G	C	rs141008194		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:40817779G>C	ENST00000251412.7	+	8	976	c.777G>C	c.(775-777)tcG>tcC	p.S259S	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	259					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.S259S(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		TCATCGCCTCGCTCATTCCCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											215.0	176.0	189.0					17																	40817779		2203	4300	6503	38071305	SO:0001819	synonymous_variant	27175			AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.777G>C	17.37:g.40817779G>C		Unknown		x	x	x	38071305	A6NDI4|Q32NB2	Silent	SNP	ENST00000251412.7	37	CCDS32658.1	SNP	38	Broad																																																																																				0.627	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	NM_016437		Silent
MPP3	4356	broad.mit.edu	37	17	41909254	41909254	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:41909254G>C	ENST00000398389.4	-	3	186	c.21C>G	c.(19-21)gaC>gaG	p.D7E	MPP3_ENST00000398393.1_Missense_Mutation_p.D32E	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	7	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)	p.D7E(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		ACTTACCAGAGTCCTCCGATA	0.617																																																1	Substitution - Missense(1)	ovary(1)	17											31.0	36.0	35.0					17																	41909254		1951	4138	6089	39264780	SO:0001583	missense	4356				CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.21C>G	17.37:g.41909254G>C	ENSP00000381425:p.Asp7Glu	Unknown		x	x	x	39264780	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	37	CCDS42344.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671141	0.47781	.	.	ENSG00000161647	ENST00000398393;ENST00000398389;ENST00000356492	T;T	0.15487	2.42;2.45	5.53	2.33	0.28932	L27 (1);	.	.	.	.	T	0.09379	0.0231	N	0.19112	0.55	0.38886	D	0.957008	P;B;B	0.35328	0.495;0.227;0.227	B;B;B	0.30716	0.119;0.108;0.108	T	0.27938	-1.0059	9	0.32370	T	0.25	.	9.0026	0.36092	0.2585:0.0:0.7415:0.0	.	32;7;32	B4DS20;Q13368;D3DX46	.;MPP3_HUMAN;.	E	32;7;32	ENSP00000381430:D32E;ENSP00000381425:D7E	ENSP00000348885:D32E	D	-	3	2	MPP3	39264780	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	1.235000	0.32671	0.903000	0.36546	0.655000	0.94253	GAC		0.617	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932		Missense_Mutation
NGFR	4804	broad.mit.edu	37	17	47590150	47590150	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1032-01	TCGA-23-1032-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:47590150G>T	ENST00000172229.3	+	6	1188	c.1063G>T	c.(1063-1065)Gcg>Tcg	p.A355S	NGFR_ENST00000504201.1_Missense_Mutation_p.A261S|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	355	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.A355S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CAACGGCTCTGCGGGGGACAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	17											52.0	59.0	57.0					17																	47590150		2203	4299	6502	44945149	SO:0001583	missense	4804			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.1063G>T	17.37:g.47590150G>T	ENSP00000172229:p.Ala355Ser	Somatic		x	x	x	44945149	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	2.389	-0.340277	0.05243	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.84873	-1.91;-1.91	4.37	3.28	0.37604	Death (3);DEATH-like (2);	1.060590	0.07213	N	0.859623	T	0.66287	0.2774	N	0.05441	-0.05	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.59069	-0.7523	10	0.07644	T	0.81	-23.947	3.7729	0.08649	0.1027:0.1488:0.5754:0.1731	.	355	P08138	TNR16_HUMAN	S	355;261	ENSP00000172229:A355S;ENSP00000421731:A261S	ENSP00000172229:A355S	A	+	1	0	NGFR	44945149	0.001000	0.12720	0.702000	0.30337	0.184000	0.23303	0.748000	0.26305	1.958000	0.56883	0.561000	0.74099	GCG		0.667	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1			Missense_Mutation
CLTC	1213	broad.mit.edu	37	17	57760368	57760368	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:57760368A>G	ENST00000269122.3	+	24	4140	c.3866A>G	c.(3865-3867)tAc>tGc	p.Y1289C	CLTC_ENST00000579456.1_Missense_Mutation_p.Y226C|CLTC_ENST00000393043.1_Missense_Mutation_p.Y1289C	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1289	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)	p.Y1289C(1)	CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CTTATCAACTACTATCAGGTA	0.373			T	"""ALK, TFE3"""	"""ALCL, renal """																																		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	1	Substitution - Missense(1)	ovary(1)	17											127.0	120.0	122.0					17																	57760368		2203	4300	6503	55115150	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.3866A>G	17.37:g.57760368A>G	ENSP00000269122:p.Tyr1289Cys	Somatic		x	x	x	55115150	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	SNP	14	Broad	.	.	.	.	.	.	.	.	.	.	A	17.64	3.439811	0.63067	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.20069	2.1;2.1	5.59	5.59	0.84812	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;0.975	D;P	0.91635	0.999;0.854	T	0.61267	-0.7097	10	0.52906	T	0.07	-20.0608	15.7603	0.78073	1.0:0.0:0.0:0.0	.	1289;1289	Q00610;Q00610-2	CLH1_HUMAN;.	C	1289	ENSP00000269122:Y1289C;ENSP00000376763:Y1289C	ENSP00000269122:Y1289C	Y	+	2	0	CLTC	55115150	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.339000	0.96797	2.132000	0.65825	0.379000	0.24179	TAC		0.373	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859		Missense_Mutation
CEP131	22994	broad.mit.edu	37	17	79164787	79164787	+	Missense_Mutation	SNP	G	G	C	rs375749739		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr17:79164787G>C	ENST00000269392.4	-	23	3119	c.2872C>G	c.(2872-2874)Ctt>Gtt	p.L958V	AZI1_ENST00000575907.1_Missense_Mutation_p.L922V|AZI1_ENST00000450824.2_Missense_Mutation_p.L955V|AZI1_ENST00000374782.3_Missense_Mutation_p.L919V	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		958					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)	p.L919V(1)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GCCTCCCCAAGCTGGCCCTTC	0.672																																																1	Substitution - Missense(1)	ovary(1)	17											34.0	41.0	39.0					17																	79164787		2202	4300	6502	76779382	SO:0001583	missense	22994																														ENST00000269392.4:c.2872C>G	17.37:g.79164787G>C	ENSP00000269392:p.Leu958Val	Unknown		x	x	x	76779382	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37		SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186977	0.38609	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.15834	2.39;2.44;2.4	4.08	3.07	0.35406	.	0.179966	0.37809	N	0.001931	T	0.14830	0.0358	L	0.41710	1.295	0.09310	N	0.999999	P;P;P;P	0.49559	0.775;0.476;0.782;0.925	B;B;B;P	0.44561	0.204;0.108;0.187;0.453	T	0.09357	-1.0678	10	0.51188	T	0.08	-13.0044	8.0286	0.30451	0.0886:0.1585:0.7529:0.0	.	955;958;919;955	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	V	955;919;958	ENSP00000393583:L955V;ENSP00000363914:L919V;ENSP00000269392:L958V	ENSP00000269392:L958V	L	-	1	0	AZI1	76779382	1.000000	0.71417	0.202000	0.23494	0.894000	0.52154	4.471000	0.60182	2.101000	0.63845	0.585000	0.79938	CTT		0.672	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1			Missense_Mutation
LAMA3	3909	broad.mit.edu	37	18	21329425	21329425	+	Missense_Mutation	SNP	G	G	A	rs78284895	byFrequency	TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr18:21329425G>A	ENST00000313654.9	+	4	840	c.599G>A	c.(598-600)cGg>cAg	p.R200Q	LAMA3_ENST00000399516.3_Missense_Mutation_p.R200Q	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	200	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)	p.R200Q(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GAATTTGGGCGGGAGGCAAAT	0.328													G|||	6	0.00119808	0.0038	0.0	5008	,	,		15812	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	18						G	GLN/ARG,GLN/ARG	12,3602		0,12,1795	62.0	64.0	63.0		599,599	-3.5	1.0	18	dbSNP_131	63	1,8147		0,1,4073	yes	missense,missense	LAMA3	NM_001127717.1,NM_198129.1	43,43	0,13,5868	AA,AG,GG		0.0123,0.332,0.1105	benign,benign	200/3278,200/3334	21329425	13,11749	1807	4074	5881	19583423	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.599G>A	18.37:g.21329425G>A	ENSP00000324532:p.Arg200Gln	Unknown		x	x	x	19583423	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	SNP	39	Broad	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	G	5.933	0.356147	0.11239	0.00332	1.23E-4	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669;ENST00000538801	T;T	0.75050	-0.9;-0.9	5.72	-3.49	0.04724	Laminin, N-terminal (3);	.	.	.	.	T	0.45296	0.1335	L	0.28014	0.82	0.80722	D	1	B;B;B	0.20261	0.043;0.009;0.007	B;B;B	0.08055	0.003;0.002;0.001	T	0.21415	-1.0246	9	0.16896	T	0.51	.	9.0176	0.36179	0.6509:0.0993:0.2498:0.0	.	200;200;200	F5H8G3;Q6VU67;Q16787	.;.;LAMA3_HUMAN	Q	200	ENSP00000324532:R200Q;ENSP00000382432:R200Q	ENSP00000324532:R200Q	R	+	2	0	LAMA3	19583423	0.930000	0.31532	0.963000	0.40424	0.004000	0.04260	1.110000	0.31147	-0.367000	0.08052	-1.642000	0.00770	CGG		0.328	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129		Missense_Mutation
ILF3	3609	broad.mit.edu	37	19	10792757	10792757	+	Silent	SNP	G	G	A	rs35968299		TCGA-23-1032-01	TCGA-23-1032-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr19:10792757G>A	ENST00000590261.1	+	11	1269	c.1269G>A	c.(1267-1269)caG>caA	p.Q423Q	ILF3_ENST00000250241.8_Silent_p.Q423Q|ILF3_ENST00000407004.3_Silent_p.Q423Q|ILF3_ENST00000318511.3_Silent_p.Q423Q|ILF3_ENST00000449870.1_Silent_p.Q423Q|ILF3_ENST00000588657.1_Silent_p.Q423Q|ILF3_ENST00000420083.1_Silent_p.Q423Q|ILF3_ENST00000589998.1_Silent_p.Q423Q|ILF3_ENST00000592763.1_Silent_p.Q423Q			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	423	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Q423Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TGGTGTCCCAGACTGGGCCCG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	19											67.0	64.0	65.0					19																	10792757		2203	4300	6503	10653757	SO:0001819	synonymous_variant	3609			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.1269G>A	19.37:g.10792757G>A		Somatic		x	x	x	10653757	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	ENST00000590261.1	37	CCDS12246.1	SNP	33	Broad																																																																																				0.582	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452074.1			Silent
IFNL2	282616	broad.mit.edu	37	19	39759799	39759799	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr19:39759799C>G	ENST00000331982.5	+	3	255	c.200C>G	c.(199-201)tCg>tGg	p.S67W		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	67					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)		p.S67W(1)									TAGGAAGAGTCGCTTCTGCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	35.0	35.0					19																	39759799		2202	4299	6501	44451639	SO:0001583	missense	282616			AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.200C>G	19.37:g.39759799C>G	ENSP00000333639:p.Ser67Trp	Unknown		x	x	x	44451639	Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	ENST00000331982.5	37	CCDS42567.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	c	10.75	1.439561	0.25900	.	.	ENSG00000183709	ENST00000331982	T	0.34859	1.34	3.13	-2.37	0.06643	.	1.660860	0.03362	N	0.197765	T	0.55768	0.1941	M	0.81341	2.54	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48779	-0.9005	10	0.72032	D	0.01	2.0703	0.7117	0.00925	0.181:0.3804:0.1924:0.2461	.	67	Q8IZJ0	IL28A_HUMAN	W	67	ENSP00000333639:S67W	ENSP00000333639:S67W	S	+	2	0	IL28A	44451639	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.088000	0.11198	-0.437000	0.07243	-1.906000	0.00525	TCG		0.622	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463833.1	NM_172138		Missense_Mutation
GRWD1	83743	broad.mit.edu	37	19	48956277	48956277	+	Missense_Mutation	SNP	G	G	A	rs371830640		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr19:48956277G>A	ENST00000253237.5	+	7	1569	c.1336G>A	c.(1336-1338)Gtc>Atc	p.V446I	KCNJ14_ENST00000342291.2_5'Flank	NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	446						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.V446I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		CACCATCAGCGTCTGAGGCGT	0.607																																																1	Substitution - Missense(1)	ovary(1)	19						G	ILE/VAL	1,4405		0,1,2202	32.0	35.0	34.0		1336	4.9	1.0	19		34	0,8576		0,0,4288	no	missense	GRWD1	NM_031485.3	29	0,1,6490	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	446/447	48956277	1,12981	2203	4288	6491	53648089	SO:0001583	missense	83743			AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.1336G>A	19.37:g.48956277G>A	ENSP00000253237:p.Val446Ile	Unknown		x	x	x	53648089	Q8TF59	Missense_Mutation	SNP	ENST00000253237.5	37	CCDS12720.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	19.42	3.823963	0.71143	2.27E-4	0.0	ENSG00000105447	ENST00000253237	T	0.71698	-0.59	4.93	4.93	0.64822	.	0.070670	0.56097	D	0.000036	T	0.71005	0.3289	L	0.52011	1.625	0.80722	D	1	P	0.51351	0.944	P	0.47744	0.556	T	0.69269	-0.5189	10	0.28530	T	0.3	.	17.3051	0.87192	0.0:0.0:1.0:0.0	.	446	Q9BQ67	GRWD1_HUMAN	I	446	ENSP00000253237:V446I	ENSP00000253237:V446I	V	+	1	0	GRWD1	53648089	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	6.445000	0.73456	2.449000	0.82847	0.561000	0.74099	GTC		0.607	GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466122.1	NM_031485		Missense_Mutation
RPS9	6203	broad.mit.edu	37	19	54711372	54711372	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr19:54711372C>A	ENST00000302907.4	+	5	686	c.514C>A	c.(514-516)Cgc>Agc	p.R172S	RPS9_ENST00000391753.2_Missense_Mutation_p.R172S|RPS9_ENST00000402367.1_3'UTR|RPS9_ENST00000391752.1_Missense_Mutation_p.R172S|RPS9_ENST00000391751.3_3'UTR|RPS9_ENST00000441429.1_3'UTR	NM_001013.3	NP_001004.2	P46781	RS9_HUMAN	ribosomal protein S9	172	S4 RNA-binding. {ECO:0000255|PROSITE- ProRule:PRU00182}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)	p.R172S(1)		NS(1)|breast(1)|kidney(11)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	20	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.18)		CCGCCCGGGCCGCGTGAAGAG	0.627																																																1	Substitution - Missense(1)	ovary(1)	19											31.0	31.0	31.0					19																	54711372		2203	4300	6503	59403184	SO:0001583	missense	6203			U14971	CCDS12884.1	19q13.4	2011-04-05			ENSG00000170889	ENSG00000170889		"""S ribosomal proteins"""	10442	protein-coding gene	gene with protein product	"""40S ribosomal protein S9"""	603631				7772601, 9582194	Standard	XM_005259135		Approved	S9	uc002qdx.3	P46781	OTTHUMG00000066618	ENST00000302907.4:c.514C>A	19.37:g.54711372C>A	ENSP00000302896:p.Arg172Ser	Unknown		x	x	x	59403184	A9C4C1|Q4QRK7|Q9BVZ0	Missense_Mutation	SNP	ENST00000302907.4	37	CCDS12884.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339077	0.81911	.	.	ENSG00000170889	ENST00000302907;ENST00000391752;ENST00000391753	T;T;T	0.57595	0.39;0.39;0.39	4.64	2.48	0.30137	RNA-binding S4 (2);	0.050065	0.85682	D	0.000000	T	0.71533	0.3351	M	0.92555	3.32	0.80722	D	1	D	0.67145	0.996	P	0.61477	0.889	T	0.75065	-0.3449	10	0.72032	D	0.01	-9.4523	7.5368	0.27714	0.1682:0.7395:0.0:0.0923	.	172	P46781	RS9_HUMAN	S	172	ENSP00000302896:R172S;ENSP00000375632:R172S;ENSP00000375633:R172S	ENSP00000302896:R172S	R	+	1	0	RPS9	59403184	1.000000	0.71417	0.998000	0.56505	0.901000	0.52897	3.199000	0.51043	1.287000	0.44583	0.655000	0.94253	CGC		0.627	RPS9-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142834.3	NM_001013		Missense_Mutation
DTNB	1838	broad.mit.edu	37	2	25678274	25678274	+	Splice_Site	SNP	C	C	T	rs200296831		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:25678274C>T	ENST00000406818.3	-	11	1418	c.1169G>A	c.(1168-1170)cGt>cAt	p.R390H	DTNB_ENST00000407186.1_Intron|DTNB_ENST00000407038.3_Intron|DTNB_ENST00000545439.1_Splice_Site_p.R186H|DTNB_ENST00000407661.3_Splice_Site_p.R390H|DTNB_ENST00000288642.8_Splice_Site_p.R390H|DTNB_ENST00000496972.2_Splice_Site_p.R333H|DTNB_ENST00000405222.1_Intron|DTNB_ENST00000404103.3_Splice_Site_p.R390H	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	390						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R390H(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCACTGACCGTGCACAGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											32.0	33.0	33.0					2																	25678274		2057	4210	6267	25531778	SO:0001630	splice_region_variant	1838			AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1169+1G>A	2.37:g.25678274C>T		Unknown		x	x	x	25531778	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165981	0.57476	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000288642;ENST00000545439;ENST00000535791	T;T;T;T;T;T	0.48522	2.15;2.14;2.14;2.15;2.14;0.81	5.11	5.11	0.69529	.	0.336663	0.33792	N	0.004546	T	0.44726	0.1307	L	0.58810	1.83	0.49130	D	0.999751	P;P;B;B;B;B;B;B	0.35493	0.505;0.505;0.003;0.001;0.002;0.0;0.003;0.004	B;B;B;B;B;B;B;B	0.32465	0.081;0.146;0.003;0.005;0.002;0.001;0.003;0.002	T	0.39761	-0.9598	9	.	.	.	-15.487	16.3891	0.83525	0.0:1.0:0.0:0.0	.	390;186;333;390;390;390;390;390	E7EVB6;B7Z202;F5GZG4;O60941-3;B7Z6A9;O60941-4;G5E9F6;O60941	.;.;.;.;.;.;.;DTNB_HUMAN	H	333;390;390;390;390;186;243	ENSP00000444463:R333H;ENSP00000384084:R390H;ENSP00000385482:R390H;ENSP00000385193:R390H;ENSP00000288642:R390H;ENSP00000444961:R186H	.	R	-	2	0	DTNB	25531778	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.439000	0.66556	2.530000	0.85305	0.655000	0.94253	CGT		0.547	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	Missense_Mutation	Missense_Mutation
ANKRD36	375248	broad.mit.edu	37	2	97779626	97779627	+	Nonsense_Mutation	DNP	CC	CC	GT			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:97779626_97779627CC>GT	ENST00000461153.2	+	1	394_395	c.150_151CC>GT	c.(148-153)taCCtt>taGTtt	p.50_51YL>*F	ANKRD36_ENST00000420699.2_Nonsense_Mutation_p.50_51YL>*F			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	50								p.Y50*(2)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						AACTGAAGTACCTTCTGCTCAC	0.52																																																2	Substitution - Nonsense(2)	ovary(2)	2																																								97143354	SO:0001587	stop_gained	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	Exception_encountered	2.37:g.97779626_97779627delinsGT	ENSP00000419530:p.Y50_L51delins*F	Unknown		x	x	x	97143353	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Nonsense_Mutation	DNP	ENST00000461153.2	37	CCDS54379.1	DNP	18	Broad																																																																																				0.520	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			Nonsense_Mutation
ZEB2	9839	broad.mit.edu	37	2	145187410	145187410	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10			T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:145187410T>C	ENST00000558170.2	-	3	1441	c.257A>G	c.(256-258)gAt>gGt	p.D86G	ZEB2_ENST00000303660.4_Missense_Mutation_p.D86G|ZEB2_ENST00000539609.3_Missense_Mutation_p.D86G|ZEB2_ENST00000409487.3_Missense_Mutation_p.D86G	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	86					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.D86G(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCTTATTTCATCTTCCTCTTC	0.537																																					Melanoma(33;1235 1264 5755 16332)											1	Substitution - Missense(1)	ovary(1)	2											147.0	132.0	137.0					2																	145187410		2203	4300	6503	144903880	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.257A>G	2.37:g.145187410T>C	ENSP00000454157:p.Asp86Gly	Somatic		x	x	x	144903880	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	SNP	50	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.47|15.47	2.842981|2.842981	0.51057|0.51057	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861;ENST00000409211;ENST00000435831|ENST00000419938;ENST00000431672;ENST00000440875	D;D;D;D;D;D;D|.	0.82984|.	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.159347|.	0.56097|.	D|.	0.000040|.	T|T	0.51534|0.51534	0.1680|0.1680	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	P;B;P;B;B|.	0.45348|.	0.708;0.189;0.856;0.247;0.247|.	B;B;P;B;B|.	0.46419|.	0.338;0.112;0.516;0.086;0.086|.	T|T	0.48747|0.48747	-0.9008|-0.9008	10|5	0.19590|.	T|.	0.45|.	-2.7614|-2.7614	15.9677|15.9677	0.79987|0.79987	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	86;86;86;86;86|.	F5H814;B7Z2P2;E7ESP8;A0JP08;O60315|.	.;.;.;.;ZEB2_HUMAN|.	G|V	81;86;86;86;86;86;86;86|62;76;73	ENSP00000443792:D86G;ENSP00000302501:D86G;ENSP00000386854:D86G;ENSP00000395496:D86G;ENSP00000376601:D86G;ENSP00000387256:D86G;ENSP00000400993:D86G|.	ENSP00000302501:D86G|.	D|M	-|-	2|1	0|0	ZEB2|ZEB2	144903880|144903880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.353000|7.353000	0.79414|0.79414	2.174000|2.174000	0.68829|0.68829	0.528000|0.528000	0.53228|0.53228	GAT|ATG		0.537	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		Missense_Mutation
FMNL2	114793	broad.mit.edu	37	2	153476069	153476069	+	Silent	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:153476069C>A	ENST00000288670.9	+	15	2041	c.1674C>A	c.(1672-1674)ccC>ccA	p.P558P	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	558	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)		p.P558P(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCCGCCGccccctcctccac	0.592																																																1	Substitution - coding silent(1)	ovary(1)	2											4.0	4.0	4.0					2																	153476069		1457	3387	4844	153184315	SO:0001819	synonymous_variant	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1674C>A	2.37:g.153476069C>A		Unknown		x	x	x	153184315	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1	SNP	22	Broad																																																																																				0.592	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905		Silent
FMNL2	114793	broad.mit.edu	37	2	153476072	153476072	+	Silent	SNP	T	T	C	rs372085475		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:153476072T>C	ENST00000288670.9	+	15	2044	c.1677T>C	c.(1675-1677)ccT>ccC	p.P559P	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	559	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)		p.P559P(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCCGccccctcctccacctc	0.592																																																1	Substitution - coding silent(1)	ovary(1)	2											4.0	4.0	4.0					2																	153476072		1467	3451	4918	153184318	SO:0001819	synonymous_variant	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1677T>C	2.37:g.153476072T>C		Unknown		x	x	x	153184318	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1	SNP	54	Broad																																																																																				0.592	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905		Silent
XIRP2	129446	broad.mit.edu	37	2	168114746	168114746	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:168114746C>A	ENST00000409728.1	+	11	1878	c.1789C>A	c.(1789-1791)Cca>Aca	p.P597T	XIRP2_ENST00000409043.1_Missense_Mutation_p.P564T|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409756.2_Missense_Mutation_p.P564T|XIRP2_ENST00000409605.1_Missense_Mutation_p.P342T|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000420519.1_Missense_Mutation_p.P597T	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.P597T(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ACCTAAGTGGCCACCTGAAAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											80.0	79.0	79.0					2																	168114746		1874	4110	5984	167822992	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.1789C>A	2.37:g.168114746C>A	ENSP00000386619:p.Pro597Thr	Unknown		x	x	x	167822992	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	37	CCDS56143.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419700	0.83559	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409756;ENST00000420519;ENST00000409605	D;D;D;D;D	0.96685	-3.77;-3.72;-3.77;-3.72;-4.09	6.06	6.06	0.98353	.	.	.	.	.	D	0.98337	0.9448	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98574	1.0647	8	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	564;597	A4UGR9-4;A4UGR9-6	.;.	T	564;597;564;597;342	ENSP00000386454:P564T;ENSP00000386619:P597T;ENSP00000386724:P564T;ENSP00000415541:P597T;ENSP00000386981:P342T	ENSP00000386454:P564T	P	+	1	0	XIRP2	167822992	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.311000	0.78958	2.882000	0.98803	0.655000	0.94253	CCA		0.403	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179585662	179585662	+	Missense_Mutation	SNP	G	G	A	rs201003628		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:179585662G>A	ENST00000591111.1	-	77	22357	c.22133C>T	c.(22132-22134)gCg>gTg	p.A7378V	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A6451V|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A7695V			Q8WZ42	TITIN_HUMAN	titin	12938	Ig-like 55.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A6451V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGTCAACGCTGTGCTGCA	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											59.0	59.0	59.0					2																	179585662		2020	4200	6220	179293907	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22133C>T	2.37:g.179585662G>A	ENSP00000465570:p.Ala7378Val	Unknown		x	x	x	179293907	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942707	0.34283	.	.	ENSG00000155657	ENST00000342992	T	0.67345	-0.26	6.02	6.02	0.97574	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51941	0.1704	N	0.12502	0.225	0.80722	D	1	P	0.42248	0.774	B	0.35655	0.207	T	0.60762	-0.7199	9	0.87932	D	0	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	7378	Q8WZ42	TITIN_HUMAN	V	6451	ENSP00000343764:A6451V	ENSP00000343764:A6451V	A	-	2	0	TTN	179293907	0.014000	0.17966	0.947000	0.38551	0.945000	0.59286	1.872000	0.39549	2.857000	0.98124	0.650000	0.86243	GCG		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179611871	179611872	+	Intron	DNP	TG	TG	CT			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:179611871_179611872TG>CT	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.T5086A|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.T5086A(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTGGGGGTGTGGAATATCTCT	0.545																																																1	Substitution - Missense(1)	ovary(1)	2																																								179320117	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361_10361delinsCT	2.37:g.179611871_179611872delinsCT		Unknown		x	x	x	179320116	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	DNP	ENST00000591111.1	37		DNP	59	Broad																																																																																				0.545	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		Missense_Mutation
RAPH1	65059	broad.mit.edu	37	2	204306134	204306134	+	Silent	SNP	G	G	T			TCGA-23-1032-01	TCGA-23-1032-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:204306134G>T	ENST00000319170.5	-	14	2078	c.1779C>A	c.(1777-1779)gcC>gcA	p.A593A	RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000374493.3_Silent_p.A645A	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	593					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.A593A(1)		breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACTCCATTCTGGCCTAAAAGG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	2											23.0	27.0	26.0					2																	204306134		1775	3412	5187	204014379	SO:0001819	synonymous_variant	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.1779C>A	2.37:g.204306134G>T		Somatic		x	x	x	204014379	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1	SNP	47	Broad																																																																																				0.448	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252		Silent
ABCA12	26154	broad.mit.edu	37	2	215845230	215845230	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:215845230G>A	ENST00000272895.7	-	31	4936	c.4717C>T	c.(4717-4719)Cac>Tac	p.H1573Y	ABCA12_ENST00000389661.4_Missense_Mutation_p.H1255Y	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1573	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.H1573Y(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCGTGAGGTGATACCCATCG	0.478																																					Ovarian(66;664 1488 5121 34295)											1	Substitution - Missense(1)	ovary(1)	2											87.0	84.0	85.0					2																	215845230		2203	4300	6503	215553475	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4717C>T	2.37:g.215845230G>A	ENSP00000272895:p.His1573Tyr	Somatic		x	x	x	215553475	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	9.709	1.156518	0.21454	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.59906	0.23;0.23	5.56	5.56	0.83823	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	N	0.17723	0.515	0.80722	D	1	D;D	0.69078	0.997;0.997	P;D	0.64042	0.854;0.921	T	0.48758	-0.9007	10	0.05833	T	0.94	.	19.8856	0.96911	0.0:0.0:1.0:0.0	.	1573;1255	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	Y	1573;1255	ENSP00000272895:H1573Y;ENSP00000374312:H1255Y	ENSP00000272895:H1573Y	H	-	1	0	ABCA12	215553475	1.000000	0.71417	0.989000	0.46669	0.954000	0.61252	5.841000	0.69409	2.771000	0.95319	0.650000	0.86243	CAC		0.478	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076		Missense_Mutation
SLC16A14	151473	broad.mit.edu	37	2	230910735	230910735	+	Silent	SNP	G	G	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:230910735G>T	ENST00000295190.4	-	4	1565	c.1107C>A	c.(1105-1107)atC>atA	p.I369I		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	369						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.I369I(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TGACGCCCAGGATCACTTTTC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											98.0	87.0	91.0					2																	230910735		2203	4300	6503	230618979	SO:0001819	synonymous_variant	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.1107C>A	2.37:g.230910735G>T		Unknown		x	x	x	230618979	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1	SNP	41	Broad																																																																																				0.433	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527		Silent
UGT1A7	54577	broad.mit.edu	37	2	234591343	234591343	+	Nonsense_Mutation	SNP	C	C	T	rs201879946	byFrequency	TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr2:234591343C>T	ENST00000373426.3	+	1	760	c.760C>T	c.(760-762)Cga>Tga	p.R254*	UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	254					cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)	p.R254*(1)		NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	TTGGTTGTTGCGAACTGACTT	0.428													C|||	5	0.000998403	0.0	0.0	5008	,	,		19131	0.005		0.0	False		,,,				2504	0.0															1	Substitution - Nonsense(1)	ovary(1)	2											190.0	192.0	191.0					2																	234591343		2203	4300	6503	234256082	SO:0001587	stop_gained	54577			U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	ENST00000373426.3:c.760C>T	2.37:g.234591343C>T	ENSP00000362525:p.Arg254*	Somatic		x	x	x	234256082	B8K293|O00473	Nonsense_Mutation	SNP	ENST00000373426.3	37	CCDS2506.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141175	0.56936	.	.	ENSG00000244122	ENST00000373426	.	.	.	3.58	-5.14	0.02875	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9279	0.47201	0.7579:0.1508:0.0912:0.0	.	.	.	.	X	254	.	ENSP00000362525:R254X	R	+	1	2	UGT1A7	234256082	0.057000	0.20700	0.216000	0.23742	0.294000	0.27393	0.610000	0.24253	-1.024000	0.03338	0.479000	0.44913	CGA		0.428	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130614.1	NM_019077		Nonsense_Mutation
ATRN	8455	broad.mit.edu	37	20	3578566	3578566	+	Silent	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr20:3578566T>A	ENST00000262919.5	+	22	3551	c.3483T>A	c.(3481-3483)atT>atA	p.I1161I	ATRN_ENST00000446916.2_Silent_p.I1161I	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1161					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.I1161I(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						CTCTTCTTATTGACTATCAGT	0.333																																																1	Substitution - coding silent(1)	ovary(1)	20											157.0	150.0	152.0					20																	3578566		2203	4300	6503	3526566	SO:0001819	synonymous_variant	8455			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3483T>A	20.37:g.3578566T>A		Unknown		x	x	x	3526566	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Silent	SNP	ENST00000262919.5	37	CCDS13053.1	SNP	63	Broad																																																																																				0.333	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321		Silent
TTLL9	164395	broad.mit.edu	37	20	30530752	30530752	+	Silent	SNP	C	C	T	rs376499277		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr20:30530752C>T	ENST00000375938.4	+	15	1501	c.1248C>T	c.(1246-1248)tgC>tgT	p.C416C	TTLL9_ENST00000375922.4_Missense_Mutation_p.R317C|TTLL9_ENST00000375934.4_3'UTR|TTLL9_ENST00000375921.2_3'UTR|TTLL9_ENST00000535842.1_Silent_p.C416C			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	416					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.C416C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTCCAGGCTGCGTCAACGATC	0.577																																																1	Substitution - coding silent(1)	ovary(1)	20						T		0,3956		0,0,1978	182.0	186.0	185.0		1248	-7.3	0.0	20		185	1,8305		0,1,4152	no	coding-synonymous	TTLL9	NM_001008409.2		0,1,6130	TT,TC,CC		0.012,0.0,0.0082		416/440	30530752	1,12261	1978	4153	6131	29994413	SO:0001819	synonymous_variant	164395			AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.1248C>T	20.37:g.30530752C>T		Unknown		x	x	x	29994413	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Silent	SNP	ENST00000375938.4	37	CCDS42863.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	c	13.36	2.214692	0.39102	0.0	1.2E-4	ENSG00000131044	ENST00000375922	T	0.03982	3.74	5.91	-7.28	0.01456	.	.	.	.	.	T	0.11239	0.0274	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.08743	-1.0707	6	0.51188	T	0.08	.	16.112	0.81271	0.0:0.3094:0.0:0.6906	.	.	.	.	C	317	ENSP00000365088:R317C	ENSP00000365088:R317C	R	+	1	0	TTLL9	29994413	0.074000	0.21230	0.001000	0.08648	0.391000	0.30476	-0.498000	0.06420	-1.961000	0.01016	-1.082000	0.02213	CGT		0.577	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409		Silent
PTGIS	5740	broad.mit.edu	37	20	48129799	48129799	+	Splice_Site	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr20:48129799C>T	ENST00000244043.4	-	8	1054		c.e8-1		PTGIS_ENST00000478971.1_Splice_Site	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase						apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	AGCACGCTATCTGCATGGGGC	0.572																																																1	Unknown(1)	ovary(1)	20											56.0	40.0	45.0					20																	48129799		2203	4300	6503	47563206	SO:0001630	splice_region_variant	5740				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1025-1G>A	20.37:g.48129799C>T		Unknown		x	x	x	47563206	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Splice_Site_SNP	SNP	ENST00000244043.4	37	CCDS13419.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057030	0.55325	.	.	ENSG00000124212	ENST00000244043	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5218	0.84319	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTGIS	47563206	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	7.305000	0.78891	2.202000	0.70862	0.561000	0.74099	.		0.572	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2		Intron	Splice_Site_SNP
CDH4	1002	broad.mit.edu	37	20	60419727	60419727	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10			C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr20:60419727C>T	ENST00000360469.5	+	5	668	c.580C>T	c.(580-582)Cgg>Tgg	p.R194W	CDH4_ENST00000543233.1_Missense_Mutation_p.R120W	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	194	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R194W(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CTTTCAGATCCGGTCCGACAA	0.587																																																1	Substitution - Missense(1)	ovary(1)	20											87.0	78.0	81.0					20																	60419727		2203	4300	6503	59853122	SO:0001583	missense	1002			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.580C>T	20.37:g.60419727C>T	ENSP00000353656:p.Arg194Trp	Somatic		x	x	x	59853122	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	SNP	23	Broad	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263355	0.59431	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.70164	-0.46;-0.46	3.68	2.67	0.31697	Cadherin (4);Cadherin-like (1);	0.061344	0.64402	D	0.000003	T	0.82070	0.4957	M	0.87971	2.92	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.83301	-0.0028	9	.	.	.	.	12.1497	0.54044	0.173:0.827:0.0:0.0	.	194	P55283	CADH4_HUMAN	W	194;102;120	ENSP00000353656:R194W;ENSP00000443301:R120W	.	R	+	1	2	CDH4	59853122	1.000000	0.71417	0.998000	0.56505	0.596000	0.36781	2.832000	0.48152	0.585000	0.29608	0.313000	0.20887	CGG		0.587	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794		Missense_Mutation
CLDN17	26285	broad.mit.edu	37	21	31538436	31538436	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr21:31538436A>C	ENST00000286808.3	-	1	535	c.500T>G	c.(499-501)cTt>cGt	p.L167R		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	167					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.L167R(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						TGCCCAGCCAAGGAAAAGTGC	0.507																																																1	Substitution - Missense(1)	ovary(1)	21											76.0	73.0	74.0					21																	31538436		2203	4300	6503	30460307	SO:0001583	missense	26285			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.500T>G	21.37:g.31538436A>C	ENSP00000286808:p.Leu167Arg	Unknown		x	x	x	30460307	Q3MJB5|Q6UY37	Missense_Mutation	SNP	ENST00000286808.3	37	CCDS13586.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551528	0.65311	.	.	ENSG00000156282	ENST00000286808	D	0.92199	-2.99	4.63	4.63	0.57726	.	0.134719	0.49305	D	0.000143	D	0.96156	0.8747	M	0.87971	2.92	0.42438	D	0.992701	D	0.54397	0.966	D	0.68483	0.958	D	0.96986	0.9718	10	0.87932	D	0	.	14.7649	0.69632	1.0:0.0:0.0:0.0	.	167	P56750	CLD17_HUMAN	R	167	ENSP00000286808:L167R	ENSP00000286808:L167R	L	-	2	0	CLDN17	30460307	0.964000	0.33143	0.329000	0.25429	0.702000	0.40608	8.986000	0.93492	2.311000	0.77944	0.533000	0.62120	CTT		0.507	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182261.1	NM_012131		Missense_Mutation
MN1	4330	broad.mit.edu	37	22	28193244	28193244	+	Silent	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr22:28193244C>T	ENST00000302326.4	-	1	4242	c.3288G>A	c.(3286-3288)ccG>ccA	p.P1096P		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1096					intramembranous ossification (GO:0001957)			p.P1096P(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GGGGCGCCTTCGGTCCGTGTT	0.701			T	ETV6	"""AML, meningioma"""																																		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	1	Substitution - coding silent(1)	ovary(1)	22											9.0	11.0	10.0					22																	28193244		1876	4074	5950	26523244	SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3288G>A	22.37:g.28193244C>T		Unknown		x	x	x	26523244	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1	SNP	31	Broad																																																																																				0.701	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430		Silent
DEPDC5	9681	broad.mit.edu	37	22	32162610	32162610	+	Nonsense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr22:32162610C>T	ENST00000382112.3	+	5	389	c.319C>T	c.(319-321)Cag>Tag	p.Q107*	DEPDC5_ENST00000400246.1_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000400248.2_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000266091.3_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000400242.3_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000382111.2_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000400249.2_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000536766.1_Intron|DEPDC5_ENST00000382105.2_Nonsense_Mutation_p.Q107*|DEPDC5_ENST00000535622.1_Nonsense_Mutation_p.Q107*	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	107					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.Q107*(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTTTAAGGATCAGTATATTGG	0.353																																																1	Substitution - Nonsense(1)	ovary(1)	22											196.0	205.0	202.0					22																	32162610		2155	4273	6428	30492610	SO:0001587	stop_gained	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.319C>T	22.37:g.32162610C>T	ENSP00000371546:p.Gln107*	Unknown		x	x	x	30492610	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Nonsense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	36	5.633922	0.96682	.	.	ENSG00000100150	ENST00000535622;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.	.	.	5.42	4.39	0.52855	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.9192	0.63921	0.0:0.8466:0.1534:0.0	.	.	.	.	X	107	.	ENSP00000266091:Q107X	Q	+	1	0	DEPDC5	30492610	1.000000	0.71417	0.997000	0.53966	0.890000	0.51754	7.058000	0.76676	1.266000	0.44231	0.655000	0.94253	CAG		0.353	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662		Nonsense_Mutation
EFCAB6	64800	broad.mit.edu	37	22	44011710	44011710	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr22:44011710G>C	ENST00000262726.7	-	21	2811	c.2558C>G	c.(2557-2559)tCt>tGt	p.S853C	EFCAB6_ENST00000396231.2_Missense_Mutation_p.S701C	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	853	EF-hand 9. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S853C(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TCTTACCTTAGACAAGTCTGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	22											89.0	82.0	85.0					22																	44011710		2203	4300	6503	42343043	SO:0001583	missense	64800			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2558C>G	22.37:g.44011710G>C	ENSP00000262726:p.Ser853Cys	Unknown		x	x	x	42343043	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049482	0.55218	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.08008	3.14;3.14	4.87	3.85	0.44370	EF-hand-like domain (1);	0.083632	0.48767	D	0.000161	T	0.13798	0.0334	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.04635	-1.0937	10	0.56958	D	0.05	-19.5382	10.0154	0.42011	0.1619:0.0:0.8381:0.0	.	853	Q5THR3	EFCB6_HUMAN	C	701;853	ENSP00000379533:S701C;ENSP00000262726:S853C	ENSP00000262726:S853C	S	-	2	0	EFCAB6	42343043	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	4.385000	0.59613	1.414000	0.47017	0.655000	0.94253	TCT		0.373	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		Missense_Mutation
ROBO2	6092	broad.mit.edu	37	3	77651424	77651424	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr3:77651424T>A	ENST00000461745.1	+	20	3818	c.2918T>A	c.(2917-2919)aTt>aAt	p.I973N	ROBO2_ENST00000332191.8_Missense_Mutation_p.I973N|ROBO2_ENST00000487694.3_Missense_Mutation_p.I989N	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	973					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.I973N(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATGGAGCCATTTATAGTAGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	3											115.0	110.0	112.0					3																	77651424		2004	4192	6196	77734114	SO:0001583	missense	6092			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2918T>A	3.37:g.77651424T>A	ENSP00000417164:p.Ile973Asn	Somatic		x	x	x	77734114	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	SNP	52	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	23.4|23.4|23.4	4.406638|4.406638|4.406638	0.83230|0.83230|0.83230	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000471893|ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	.|.|T;T;T	.|.|0.68331	.|.|-0.32;-0.28;-0.22	5.69|5.69|5.69	5.69|5.69|5.69	0.88448|0.88448|0.88448	.|.|.	.|.|0.000000	.|.|0.46442	.|.|D	.|.|0.000283	T|T|T	0.80243|0.80243|0.80243	0.4587|0.4587|0.4587	M|M|M	0.68593|0.68593|0.68593	2.085|2.085|2.085	.|.|0.34337	.|.|D	.|.|0.688379	.|.|D;D;D	.|.|0.89917	.|.|0.998;1.0;1.0	.|.|P;D;D	.|.|0.91635	.|.|0.896;0.999;0.987	T|T|T	0.80701|0.80701|0.80701	-0.1265|-0.1265|-0.1265	4|4|9	.|.|0.42905	.|.|T	.|.|0.14	.|.|.	15.9361|15.9361|15.9361	0.79707|0.79707|0.79707	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|.|989;973;973	.|.|Q19AB5;F8W703;Q9HCK4	.|.|.;.;ROBO2_HUMAN	I|Q|N	130|47|989;989;993;973;973	.|.|ENSP00000417335:I989N;ENSP00000417164:I973N;ENSP00000327536:I973N	.|.|ENSP00000327536:I973N	F|H|I	+|+|+	1|3|2	0|2|0	ROBO2|ROBO2|ROBO2	77734114|77734114|77734114	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.971000|0.971000|0.971000	0.66376|0.66376|0.66376	7.698000|7.698000|7.698000	0.84413|0.84413|0.84413	2.168000|2.168000|2.168000	0.68352|0.68352|0.68352	0.454000|0.454000|0.454000	0.30748|0.30748|0.30748	TTT|CAT|ATT		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246		Missense_Mutation
GPR156	165829	broad.mit.edu	37	3	119892318	119892318	+	Splice_Site	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr3:119892318C>T	ENST00000464295.1	-	9	1379		c.e9-1		GPR156_ENST00000461057.1_Splice_Site|GPR156_ENST00000315843.3_Splice_Site			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.?(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		ATTGCTTCAGCTGTTAGATAA	0.378																																																1	Unknown(1)	ovary(1)	3											170.0	154.0	160.0					3																	119892318		2203	4300	6503	121375008	SO:0001630	splice_region_variant	165829			AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.934-1G>A	3.37:g.119892318C>T		Unknown		x	x	x	121375008	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Splice_Site_SNP	SNP	ENST00000464295.1	37	CCDS2997.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243844	0.79912	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7505	0.88432	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPR156	121375008	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.640000	0.74319	2.427000	0.82271	0.462000	0.41574	.		0.378	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	Intron	Splice_Site_SNP
IGSF10	285313	broad.mit.edu	37	3	151163627	151163627	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr3:151163627G>A	ENST00000282466.3	-	4	4141	c.4142C>T	c.(4141-4143)aCa>aTa	p.T1381I		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1381					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.T1381I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTTTCGGCTGTGGTTAGAAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											178.0	172.0	174.0					3																	151163627		2203	4300	6503	152646317	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4142C>T	3.37:g.151163627G>A	ENSP00000282466:p.Thr1381Ile	Unknown		x	x	x	152646317	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	10.31	1.313609	0.23908	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.70164	-0.46	4.8	1.35	0.21983	.	0.729003	0.11873	N	0.521276	T	0.47525	0.1450	N	0.19112	0.55	0.09310	N	0.999999	B	0.17465	0.022	B	0.10450	0.005	T	0.40384	-0.9566	10	0.59425	D	0.04	.	5.9327	0.19148	0.2256:0.1547:0.6197:0.0	.	1381	Q6WRI0	IGS10_HUMAN	I	1381;8	ENSP00000282466:T1381I	ENSP00000282466:T1381I	T	-	2	0	IGSF10	152646317	0.005000	0.15991	0.002000	0.10522	0.022000	0.10575	0.944000	0.29043	0.531000	0.28639	0.591000	0.81541	ACA		0.473	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822		Missense_Mutation
SMC4	10051	broad.mit.edu	37	3	160120593	160120593	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr3:160120593G>A	ENST00000357388.3	+	4	899	c.448G>A	c.(448-450)Gat>Aat	p.D150N	SMC4_ENST00000462787.1_Missense_Mutation_p.D150N|MIR16-2_ENST00000362117.1_RNA|SMC4_ENST00000360111.2_Missense_Mutation_p.D150N|SMC4_ENST00000469762.1_Missense_Mutation_p.D125N|MIR15B_ENST00000385045.1_RNA|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000344722.5_Missense_Mutation_p.D150N	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	150					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.D150N(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACATAATTCTGATGAACACAA	0.313																																																1	Substitution - Missense(1)	ovary(1)	3											84.0	89.0	87.0					3																	160120593		2203	4299	6502	161603287	SO:0001583	missense	10051			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.448G>A	3.37:g.160120593G>A	ENSP00000349961:p.Asp150Asn	Unknown		x	x	x	161603287	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	34	5.343661	0.95783	.	.	ENSG00000113810	ENST00000497311;ENST00000357388;ENST00000465903;ENST00000485645;ENST00000360111;ENST00000392788;ENST00000472991;ENST00000467468;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000490207;ENST00000485867;ENST00000344722	T;T;T;T;T;T;T;T;T;T;T;T;T	0.67171	3.24;-0.25;3.24;3.24;-0.25;3.24;3.24;-0.25;3.24;-0.25;3.24;3.24;-0.25	5.38	5.38	0.77491	RecF/RecN/SMC (1);	0.048124	0.85682	D	0.000000	T	0.77765	0.4179	L	0.53729	1.69	0.80722	D	1	D;D;P	0.63880	0.974;0.993;0.918	P;D;P	0.63113	0.842;0.911;0.762	T	0.76796	-0.2827	10	0.44086	T	0.13	-26.4066	19.1303	0.93402	0.0:0.0:1.0:0.0	.	150;125;150	Q9NTJ3-2;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	N	150;150;150;150;150;150;25;25;125;150;150;150;78;150	ENSP00000418820:D150N;ENSP00000349961:D150N;ENSP00000419247:D150N;ENSP00000420644:D150N;ENSP00000353225:D150N;ENSP00000417999:D25N;ENSP00000419360:D25N;ENSP00000417964:D125N;ENSP00000420121:D150N;ENSP00000420734:D150N;ENSP00000420817:D150N;ENSP00000417612:D78N;ENSP00000341382:D150N	ENSP00000341382:D150N	D	+	1	0	SMC4	161603287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.514000	0.84764	0.491000	0.48974	GAT		0.313	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1			Missense_Mutation
AFM	173	broad.mit.edu	37	4	74351669	74351669	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr4:74351669A>G	ENST00000226355.3	+	4	454	c.361A>G	c.(361-363)Aga>Gga	p.R121G		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	121	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)	p.R121G(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGATGCTCAAAGAAGACTCTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	4											99.0	101.0	100.0					4																	74351669		2203	4300	6503	74570533	SO:0001583	missense	173			L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.361A>G	4.37:g.74351669A>G	ENSP00000226355:p.Arg121Gly	Unknown		x	x	x	74570533	A8K3E1|Q32MR3|Q4W5C5	Missense_Mutation	SNP	ENST00000226355.3	37	CCDS3557.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199262	0.38806	.	.	ENSG00000079557	ENST00000226355	T	0.80994	-1.44	4.86	4.86	0.63082	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.054242	0.64402	D	0.000001	D	0.88771	0.6527	M	0.83774	2.66	0.32759	N	0.505351	D	0.76494	0.999	D	0.68943	0.961	D	0.91878	0.5513	10	0.87932	D	0	.	11.1378	0.48386	1.0:0.0:0.0:0.0	.	121	P43652	AFAM_HUMAN	G	121	ENSP00000226355:R121G	ENSP00000226355:R121G	R	+	1	2	AFM	74570533	0.473000	0.25878	0.592000	0.28758	0.104000	0.19210	1.882000	0.39648	1.953000	0.56701	0.482000	0.46254	AGA		0.403	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252275.2			Missense_Mutation
WDR17	116966	broad.mit.edu	37	4	177046420	177046420	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr4:177046420T>C	ENST00000280190.4	+	6	932	c.776T>C	c.(775-777)aTa>aCa	p.I259T	WDR17_ENST00000393643.2_Missense_Mutation_p.I235T|WDR17_ENST00000508596.1_Missense_Mutation_p.I235T|WDR17_ENST00000507824.2_Missense_Mutation_p.I242T			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	259								p.I259T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTTTCTTGCATAACAACATTT	0.443																																																1	Substitution - Missense(1)	ovary(1)	4											189.0	192.0	191.0					4																	177046420		2203	4300	6503	177283414	SO:0001583	missense	116966			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.776T>C	4.37:g.177046420T>C	ENSP00000280190:p.Ile259Thr	Unknown		x	x	x	177283414	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701736	0.68501	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.67171	-0.25;-0.25;-0.25	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71195	0.3311	M	0.75447	2.3	0.80722	D	1	P;P	0.45348	0.856;0.856	B;B	0.43809	0.432;0.432	T	0.76353	-0.2990	10	0.72032	D	0.01	-18.5221	16.0847	0.81038	0.0:0.0:0.0:1.0	.	235;259	E7EQX0;Q8IZU2	.;WDR17_HUMAN	T	235;235;259;242	ENSP00000422763:I235T;ENSP00000377258:I235T;ENSP00000280190:I259T	ENSP00000280190:I259T	I	+	2	0	WDR17	177283414	1.000000	0.71417	0.996000	0.52242	0.471000	0.32888	7.361000	0.79497	2.199000	0.70637	0.528000	0.53228	ATA		0.443	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2			Missense_Mutation
TUBB7P	56604	broad.mit.edu	37	4	190903891	190903892	+	IGR	DNP	TG	TG	AA			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr4:190903891_190903892TG>AA								FRG1 (19532 upstream) : RNA5SP174 (32400 downstream)																							TGAAGGTGACTGACATTTTTAG	0.51																																																0			4																																								191140886	SO:0001628	intergenic_variant	56604																															4.37:g.190903891_190903892delinsAA		Unknown		x	x	x	191140885		Missense_Mutation	DNP		37		DNP	55	Broad																																																																																			0	0.510									Missense_Mutation
ZNF608	57507	broad.mit.edu	37	5	123984641	123984641	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr5:123984641C>T	ENST00000306315.5	-	4	1871	c.1436G>A	c.(1435-1437)cGa>cAa	p.R479Q	ZNF608_ENST00000504926.1_Missense_Mutation_p.R52Q	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	479							metal ion binding (GO:0046872)	p.R479Q(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GGGTGTCCTTCGTCCGCTGGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	5											90.0	90.0	90.0					5																	123984641		2203	4300	6503	124012540	SO:0001583	missense	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.1436G>A	5.37:g.123984641C>T	ENSP00000307746:p.Arg479Gln	Unknown		x	x	x	124012540	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579106	0.86645	.	.	ENSG00000168916	ENST00000504926;ENST00000306315;ENST00000509799;ENST00000513986	T;T	0.47528	0.84;0.85	5.26	5.26	0.73747	.	0.224141	0.38217	N	0.001776	T	0.39809	0.1092	L	0.46157	1.445	0.45205	D	0.998213	P	0.42649	0.786	B	0.33690	0.168	T	0.28106	-1.0054	10	0.21540	T	0.41	-9.0567	18.87	0.92309	0.0:1.0:0.0:0.0	.	479	Q9ULD9	ZN608_HUMAN	Q	52;479;479;479	ENSP00000427657:R52Q;ENSP00000307746:R479Q	ENSP00000307746:R479Q	R	-	2	0	ZNF608	124012540	0.990000	0.36364	0.329000	0.25429	0.979000	0.70002	3.831000	0.55776	2.456000	0.83038	0.544000	0.68410	CGA		0.577	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432		Missense_Mutation
PCDHA2	56146	broad.mit.edu	37	5	140175046	140175046	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr5:140175046C>A	ENST00000526136.1	+	1	497	c.497C>A	c.(496-498)gCt>gAt	p.A166D	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A166D|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A166D|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGTAAATGCTCTTCTCTCC	0.443																																																0			5											86.0	90.0	88.0					5																	140175046		2203	4300	6503	140155230	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.497C>A	5.37:g.140175046C>A	ENSP00000431748:p.Ala166Asp	Unknown		x	x	x	140155230	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	c	16.54	3.151550	0.57151	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.21031	2.03;2.03;2.03	3.68	2.79	0.32731	Cadherin (4);Cadherin-like (1);	0.235814	0.20709	U	0.087123	T	0.43722	0.1260	M	0.87682	2.9	0.09310	N	1	P;P;P	0.48407	0.68;0.91;0.68	P;P;P	0.54431	0.548;0.752;0.548	T	0.41698	-0.9494	10	0.87932	D	0	.	13.363	0.60667	0.0:0.8402:0.1598:0.0	.	166;166;166	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	D	166	ENSP00000430584:A166D;ENSP00000367372:A166D;ENSP00000431748:A166D	ENSP00000367372:A166D	A	+	2	0	PCDHA2	140155230	0.082000	0.21442	0.003000	0.11579	0.972000	0.66771	3.713000	0.54882	0.871000	0.35750	0.552000	0.68991	GCT		0.443	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		Missense_Mutation
HSPA1L	3305	broad.mit.edu	37	6	31778436	31778436	+	Silent	SNP	G	G	T	rs199726010		TCGA-23-1032-01	TCGA-23-1032-10			G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr6:31778436G>T	ENST00000375654.4	-	2	1503	c.1314C>A	c.(1312-1314)ccC>ccA	p.P438P	HSPA1L_ENST00000417199.3_Silent_p.P438P	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	438					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.P438P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCAGCACCCCGGGTTGGTTGT	0.587																																																1	Substitution - coding silent(1)	ovary(1)	6											126.0	126.0	126.0					6																	31778436		2203	4300	6503	31886415	SO:0001819	synonymous_variant	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1314C>A	6.37:g.31778436G>T		Somatic		x	x	x	31886415	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	CCDS34413.1	SNP	39	Broad																																																																																				0.587	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			Silent
GPRC6A	222545	broad.mit.edu	37	6	117130679	117130679	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr6:117130679A>T	ENST00000310357.3	-	2	317	c.296T>A	c.(295-297)aTc>aAc	p.I99N	GPRC6A_ENST00000530250.1_Missense_Mutation_p.I99N|GPRC6A_ENST00000368549.3_Missense_Mutation_p.I99N	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	99					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.I99N(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGTGTCATAGATTTCATACCC	0.398																																																1	Substitution - Missense(1)	ovary(1)	6											112.0	103.0	106.0					6																	117130679		2203	4300	6503	117237372	SO:0001583	missense	222545			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.296T>A	6.37:g.117130679A>T	ENSP00000309493:p.Ile99Asn	Unknown		x	x	x	117237372	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157615	0.78114	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.84873	-1.91;-1.91;-1.91	4.81	4.81	0.61882	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.91399	0.7286	M	0.88906	2.99	0.33103	D	0.539495	D;D;D	0.71674	0.998;0.997;0.998	P;P;D	0.68353	0.894;0.858;0.957	D	0.92549	0.6048	10	0.87932	D	0	.	14.5343	0.67950	1.0:0.0:0.0:0.0	.	99;99;99	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	N	99	ENSP00000309493:I99N;ENSP00000357537:I99N;ENSP00000433465:I99N	ENSP00000309493:I99N	I	-	2	0	GPRC6A	117237372	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.198000	0.89729	2.015000	0.59207	0.528000	0.53228	ATC		0.398	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			Missense_Mutation
NMBR	4829	broad.mit.edu	37	6	142409491	142409491	+	Missense_Mutation	SNP	G	G	A	rs556376921		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr6:142409491G>A	ENST00000258042.1	-	1	445	c.305C>T	c.(304-306)tCg>tTg	p.S102L	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	102					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)	p.S102W(1)|p.S102L(1)		breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GAAGTAGCGCGAGGCGTCCAC	0.592													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17629	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(2)	ovary(1)|lung(1)	6											74.0	63.0	67.0					6																	142409491		2203	4300	6503	142451184	SO:0001583	missense	4829				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.305C>T	6.37:g.142409491G>A	ENSP00000258042:p.Ser102Leu	Unknown		x	x	x	142451184	E9KL38|Q5VUK8	Missense_Mutation	SNP	ENST00000258042.1	37	CCDS5196.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739517	0.89573	.	.	ENSG00000135577	ENST00000258042	T	0.70986	-0.53	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.051799	0.85682	D	0.000000	T	0.38134	0.1029	L	0.28608	0.87	0.40440	D	0.980035	B	0.32829	0.386	B	0.28784	0.094	T	0.35176	-0.9799	10	0.09084	T	0.74	-14.389	13.2433	0.60010	0.0728:0.0:0.9272:0.0	.	102	P28336	NMBR_HUMAN	L	102	ENSP00000258042:S102L	ENSP00000258042:S102L	S	-	2	0	NMBR	142451184	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.552000	0.53705	2.813000	0.96785	0.655000	0.94253	TCG		0.592	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1			Missense_Mutation
THBS2	7058	broad.mit.edu	37	6	169648825	169648825	+	Missense_Mutation	SNP	G	G	A	rs369355659		TCGA-23-1032-01	TCGA-23-1032-10			G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr6:169648825G>A	ENST00000366787.3	-	4	545	c.296C>T	c.(295-297)aCg>aTg	p.T99M		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	99	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T99M(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		AGCCAACAGCGTGCCCCTGGA	0.622																																					Esophageal Squamous(91;219 1934 18562 44706)											1	Substitution - Missense(1)	ovary(1)	6						G	MET/THR	0,4406		0,0,2203	113.0	101.0	105.0		296	4.6	1.0	6		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	THBS2	NM_003247.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	99/1173	169648825	1,13005	2203	4300	6503	169390750	SO:0001583	missense	7058				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.296C>T	6.37:g.169648825G>A	ENSP00000355751:p.Thr99Met	Somatic		x	x	x	169390750	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426381	0.62733	0.0	1.16E-4	ENSG00000186340	ENST00000366787	T	0.02552	4.25	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.42172	U	0.000746	T	0.10809	0.0264	M	0.77820	2.39	0.52501	D	0.999954	D	0.89917	1.0	D	0.91635	0.999	T	0.02358	-1.1171	10	0.87932	D	0	-23.6862	17.7033	0.88301	0.0:0.0:1.0:0.0	.	99	P35442	TSP2_HUMAN	M	99	ENSP00000355751:T99M	ENSP00000355751:T99M	T	-	2	0	THBS2	169390750	1.000000	0.71417	0.964000	0.40570	0.066000	0.16364	9.187000	0.94912	2.250000	0.74265	0.563000	0.77884	ACG		0.622	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247		Missense_Mutation
HOXA11	3207	broad.mit.edu	37	7	27224343	27224343	+	Missense_Mutation	SNP	C	C	G	rs200850004		TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr7:27224343C>G	ENST00000006015.3	-	1	492	c.421G>C	c.(421-423)Gac>Cac	p.D141H	HOXA11-AS_ENST00000522674.1_RNA|RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000520360.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	141					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)	p.D141H(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						AAAAACTGGTCGAAAGCCTGT	0.662			T	NUP98	CML																																		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	1	Substitution - Missense(1)	ovary(1)	7											33.0	38.0	36.0					7																	27224343		2202	4299	6501	27190868	SO:0001583	missense	3207				CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.421G>C	7.37:g.27224343C>G	ENSP00000006015:p.Asp141His	Unknown		x	x	x	27190868	A4D190	Missense_Mutation	SNP	ENST00000006015.3	37	CCDS5411.1	SNP	31	Broad	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973634	0.53720	.	.	ENSG00000005073	ENST00000006015	T	0.65549	-0.16	5.35	5.35	0.76521	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	M	0.91872	3.25	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	D	0.87111	0.2185	10	0.87932	D	0	.	19.0802	0.93178	0.0:1.0:0.0:0.0	.	141	P31270	HXA11_HUMAN	H	141	ENSP00000006015:D141H	ENSP00000006015:D141H	D	-	1	0	HOXA11	27190868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.339000	0.79282	2.493000	0.84123	0.655000	0.94253	GAC		0.662	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1			Missense_Mutation
GRM3	2913	broad.mit.edu	37	7	86469005	86469005	+	Silent	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10			A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr7:86469005A>G	ENST00000361669.2	+	4	3274	c.2175A>G	c.(2173-2175)acA>acG	p.T725T	GRM3_ENST00000439827.1_Intron|GRM3_ENST00000536043.1_Silent_p.T597T|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000546348.1_Silent_p.T317T	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	725					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.T725T(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AGCGGGAAACAGTCATCCTAA	0.502																																					GBM(52;969 1098 3139 52280)											1	Substitution - coding silent(1)	ovary(1)	7											110.0	97.0	101.0					7																	86469005		2203	4300	6503	86306941	SO:0001819	synonymous_variant	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2175A>G	7.37:g.86469005A>G		Somatic		x	x	x	86306941	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	ENST00000361669.2	37	CCDS5600.1	SNP	7	Broad																																																																																				0.502	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2			Silent
LRRN3	54674	broad.mit.edu	37	7	110763551	110763551	+	Silent	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr7:110763551C>T	ENST00000422987.3	+	2	1554	c.723C>T	c.(721-723)atC>atT	p.I241I	IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|LRRN3_ENST00000308478.5_Silent_p.I241I|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Silent_p.I241I|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	241					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I241I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		TAGAAAGCATCTCTTTTTACG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	7											60.0	63.0	62.0					7																	110763551		2202	4299	6501	110550787	SO:0001819	synonymous_variant	54674			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.723C>T	7.37:g.110763551C>T		Unknown		x	x	x	110550787	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1	SNP	32	Broad																																																																																				0.343	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334		Silent
PPP1R3A	5506	broad.mit.edu	37	7	113519408	113519408	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10			T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr7:113519408T>A	ENST00000284601.3	-	4	1807	c.1739A>T	c.(1738-1740)gAt>gTt	p.D580V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	580					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.D580V(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATGAGACACATCTGCTGTGAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	7											116.0	111.0	113.0					7																	113519408		2203	4300	6503	113306644	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1739A>T	7.37:g.113519408T>A	ENSP00000284601:p.Asp580Val	Somatic		x	x	x	113306644	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	15.97	2.989730	0.54041	.	.	ENSG00000154415	ENST00000284601	T	0.20463	2.07	5.89	2.34	0.29019	.	0.367658	0.26407	N	0.024551	T	0.26011	0.0634	M	0.69823	2.125	0.20489	N	0.999894	D	0.60575	0.988	P	0.46479	0.518	T	0.14090	-1.0485	10	0.87932	D	0	-0.3165	7.6128	0.28139	0.0:0.2351:0.0:0.7649	.	580	Q16821	PPR3A_HUMAN	V	580	ENSP00000284601:D580V	ENSP00000284601:D580V	D	-	2	0	PPP1R3A	113306644	0.000000	0.05858	0.004000	0.12327	0.062000	0.15995	0.087000	0.14958	0.505000	0.28104	0.460000	0.39030	GAT		0.483	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		Missense_Mutation
TMEM176B	28959	broad.mit.edu	37	7	150493653	150493653	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr7:150493653G>A	ENST00000447204.2	-	2	377	c.5C>T	c.(4-6)aCg>aTg	p.T2M	TMEM176B_ENST00000326442.5_Missense_Mutation_p.T2M|TMEM176B_ENST00000492607.1_Missense_Mutation_p.T2M|TMEM176B_ENST00000450753.2_Missense_Mutation_p.T2M|TMEM176B_ENST00000429904.2_Missense_Mutation_p.T2M|TMEM176B_ENST00000434545.1_Missense_Mutation_p.T2M	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	2					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.T2M(1)		cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGTGTTTTGCGTCATCCTGCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	7											66.0	60.0	62.0					7																	150493653		2203	4300	6503	150124586	SO:0001583	missense	28959			AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.5C>T	7.37:g.150493653G>A	ENSP00000410269:p.Thr2Met	Unknown		x	x	x	150124586	B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Missense_Mutation	SNP	ENST00000447204.2	37	CCDS5908.1	SNP	40	Broad	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342108	0.24339	.	.	ENSG00000106565	ENST00000492607;ENST00000326442;ENST00000447204;ENST00000434545;ENST00000429904;ENST00000450753;ENST00000528038	T;T;T;T;T;T	0.09723	3.1;3.1;3.1;3.1;3.1;2.95	4.92	2.68	0.31781	.	1.351640	0.05234	N	0.510941	T	0.17152	0.0412	L	0.44542	1.39	0.09310	N	1	D;D	0.60160	0.987;0.987	P;P	0.50754	0.649;0.649	T	0.22626	-1.0211	10	0.54805	T	0.06	-1.4617	8.1318	0.31031	0.2229:0.0:0.7771:0.0	.	2;2	E9PAV4;Q3YBM2	.;T176B_HUMAN	M	2	ENSP00000419258:T2M;ENSP00000318409:T2M;ENSP00000410269:T2M;ENSP00000413531:T2M;ENSP00000397810:T2M;ENSP00000404831:T2M	ENSP00000318409:T2M	T	-	2	0	TMEM176B	150124586	0.001000	0.12720	0.032000	0.17829	0.085000	0.17905	0.475000	0.22164	1.033000	0.39918	0.467000	0.42956	ACG		0.512	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349204.1	NM_014020		Missense_Mutation
TEX15	56154	broad.mit.edu	37	8	30706056	30706056	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr8:30706056A>G	ENST00000256246.2	-	1	552	c.478T>C	c.(478-480)Tct>Cct	p.S160P	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	160					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.S160P(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTTGACACAGAAATTGGGAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	8											74.0	73.0	73.0					8																	30706056		2203	4300	6503	30825598	SO:0001583	missense	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.478T>C	8.37:g.30706056A>G	ENSP00000256246:p.Ser160Pro	Unknown		x	x	x	30825598		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	SNP	9	Broad	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551425	0.27739	.	.	ENSG00000133863	ENST00000256246	T	0.10860	2.83	5.66	3.13	0.36017	.	0.452720	0.20979	N	0.082256	T	0.06917	0.0176	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.26326	-1.0106	10	0.87932	D	0	.	4.8167	0.13371	0.6286:0.0:0.3714:0.0	.	160	Q9BXT5	TEX15_HUMAN	P	160	ENSP00000256246:S160P	ENSP00000256246:S160P	S	-	1	0	TEX15	30825598	0.000000	0.05858	0.001000	0.08648	0.931000	0.56810	0.742000	0.26216	1.092000	0.41356	0.533000	0.62120	TCT		0.453	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1			Missense_Mutation
IDO2	169355	broad.mit.edu	37	8	39840218	39840218	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10			C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom_PCR_WGA			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr8:39840218C>A	ENST00000389060.4	+	4	363	c.363C>A	c.(361-363)aaC>aaA	p.N121K	IDO2_ENST00000502986.2_Missense_Mutation_p.N134K|RP11-44K6.3_ENST00000517623.1_RNA|IDO2_ENST00000343295.4_3'UTR			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	121					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)	p.N121K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						TCTCCAGGAACTTGGGGCTCC	0.463																																																1	Substitution - Missense(1)	ovary(1)	8											74.0	74.0	74.0					8																	39840218		1887	4105	5992	39959375	SO:0001583	missense	169355			AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.363C>A	8.37:g.39840218C>A	ENSP00000426447:p.Asn121Lys	Somatic		x	x	x	39959375	A4UD41	Missense_Mutation	SNP	ENST00000389060.4	37		SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.532	-0.857355	0.02630	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	T;T	0.39229	1.09;1.09	5.57	2.76	0.32466	.	0.894012	0.10063	N	0.720654	T	0.21427	0.0516	N	0.11023	0.085	0.09310	N	1	B	0.16396	0.017	B	0.15484	0.013	T	0.28776	-1.0033	9	.	.	.	.	5.6595	0.17660	0.0:0.6629:0.1619:0.1752	.	134	F5H5G0	.	K	134;121	ENSP00000443432:N134K;ENSP00000426447:N121K	.	N	+	3	2	IDO2	39959375	0.000000	0.05858	0.113000	0.21522	0.971000	0.66376	-0.187000	0.09656	0.296000	0.22592	0.467000	0.42956	AAC		0.463	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294		Missense_Mutation
SPAG1	6674	broad.mit.edu	37	8	101253167	101253167	+	Silent	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr8:101253167C>T	ENST00000388798.2	+	19	2889	c.2698C>T	c.(2698-2700)Ctg>Ttg	p.L900L	SPAG1_ENST00000251809.3_Silent_p.L900L	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	900					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.L900L(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AATTGAACAGCTGTTTGAGGA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	8											82.0	82.0	82.0					8																	101253167		2203	4300	6503	101322343	SO:0001819	synonymous_variant	6674			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.2698C>T	8.37:g.101253167C>T		Unknown		x	x	x	101322343	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Silent	SNP	ENST00000388798.2	37	CCDS34930.1	SNP	28	Broad																																																																																				0.338	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218		Silent
FOCAD	54914	broad.mit.edu	37	9	20874701	20874701	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr9:20874701C>G	ENST00000380249.1	+	21	2576	c.2212C>G	c.(2212-2214)Cct>Gct	p.P738A	FOCAD_ENST00000605086.1_Missense_Mutation_p.P174A|FOCAD_ENST00000338382.6_Missense_Mutation_p.P738A|FOCAD_ENST00000604828.1_3'UTR	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	738						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.P738A(1)									AATTCCCATTCCTGAAGAGTT	0.368																																																1	Substitution - Missense(1)	ovary(1)	9											177.0	162.0	167.0					9																	20874701		2203	4300	6503	20864701	SO:0001583	missense	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2212C>G	9.37:g.20874701C>G	ENSP00000369599:p.Pro738Ala	Unknown		x	x	x	20864701	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	3.643	-0.073102	0.07228	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.66280	-0.2;-0.2	5.21	2.02	0.26589	Armadillo-type fold (1);	0.434923	0.26525	N	0.023893	T	0.42832	0.1220	L	0.43152	1.355	0.09310	N	1	B	0.17038	0.02	B	0.15870	0.014	T	0.10917	-1.0609	10	0.13108	T	0.6	-18.8689	2.0074	0.03480	0.1345:0.488:0.1314:0.2461	.	738	Q5VW36	K1797_HUMAN	A	738	ENSP00000369599:P738A;ENSP00000344307:P738A	ENSP00000344307:P738A	P	+	1	0	KIAA1797	20864701	0.004000	0.15560	0.255000	0.24374	0.103000	0.19146	0.164000	0.16542	0.618000	0.30179	-0.157000	0.13467	CCT		0.368	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794		Missense_Mutation
CDKL5	6792	broad.mit.edu	37	X	18668702	18668702	+	Silent	SNP	C	C	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:18668702C>A	ENST00000379989.3	+	21	3255	c.2970C>A	c.(2968-2970)acC>acA	p.T990T	CDKL5_ENST00000379996.3_Silent_p.T990T|RS1_ENST00000476595.1_5'Flank|RS1_ENST00000379984.3_Intron	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	990					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)	p.T990T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GCTGCCCAACCCAGCAATCCG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	X											89.0	73.0	79.0					X																	18668702		2203	4300	6503	18578623	SO:0001819	synonymous_variant	6792			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2970C>A	X.37:g.18668702C>A		Unknown		x	x	x	18578623	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	ENST00000379989.3	37	CCDS14186.1	SNP	22	Broad																																																																																				0.587	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159		Silent
BMP15	9210	broad.mit.edu	37	X	50659057	50659057	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:50659057A>T	ENST00000252677.3	+	2	629	c.629A>T	c.(628-630)cAg>cTg	p.Q210L		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	210					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.Q210L(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TTTATGTGTCAGCAGCAAAAA	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											146.0	116.0	126.0					X																	50659057		2203	4299	6502	50675797	SO:0001583	missense	9210			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.629A>T	X.37:g.50659057A>T	ENSP00000252677:p.Gln210Leu	Unknown		x	x	x	50675797	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	a	6.659	0.490064	0.12702	.	.	ENSG00000130385	ENST00000252677	T	0.78595	-1.19	5.52	4.37	0.52481	.	0.658526	0.16461	N	0.213438	T	0.70474	0.3228	M	0.69823	2.125	0.22996	N	0.998456	P	0.35383	0.498	B	0.30401	0.115	T	0.61088	-0.7133	10	0.27082	T	0.32	.	6.4618	0.21960	0.8927:0.0:0.1073:0.0	.	210	O95972	BMP15_HUMAN	L	210	ENSP00000252677:Q210L	ENSP00000252677:Q210L	Q	+	2	0	BMP15	50675797	0.030000	0.19436	0.812000	0.32479	0.010000	0.07245	0.714000	0.25808	1.854000	0.53819	0.451000	0.29950	CAG		0.418	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448		Missense_Mutation
MTMR8	55613	broad.mit.edu	37	X	63574698	63574698	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:63574698T>A	ENST00000374852.3	-	4	494	c.427A>T	c.(427-429)Aac>Tac	p.N143Y	MTMR8_ENST00000453546.1_Missense_Mutation_p.N143Y	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	143	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.N143Y(1)|p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						CAGTTTCTGTTGGGTATTCCC	0.378																																																2	Substitution - Missense(1)|Whole gene deletion(1)	ovary(2)	X											155.0	124.0	134.0					X																	63574698		2203	4300	6503	63491423	SO:0001583	missense	55613			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.427A>T	X.37:g.63574698T>A	ENSP00000363985:p.Asn143Tyr	Unknown		x	x	x	63491423	Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	CCDS14379.1	SNP	63	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.350|7.350	0.622724|0.622724	0.14193|0.14193	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000453546;ENST00000374852;ENST00000247400|ENST00000442913	D;D|.	0.93366|.	-3.21;-3.21|.	2.67|2.67	2.67|2.67	0.31697|0.31697	Myotubularin phosphatase domain (1);|.	0.000000|.	0.52532|.	U|.	0.000071|.	T|T	0.73644|0.73644	0.3613|0.3613	H|H	0.94183|0.94183	3.505|3.505	0.09310|0.09310	N|N	0.999997|0.999997	D;D|.	0.89917|.	0.988;1.0|.	P;D|.	0.69307|.	0.484;0.963|.	T|T	0.64879|0.64879	-0.6303|-0.6303	10|5	0.28530|.	T|.	0.3|.	.|.	9.6324|9.6324	0.39787|0.39787	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	143;143|.	B4DQL0;Q96EF0|.	.;MTMR8_HUMAN|.	Y|L	143;143;142|59	ENSP00000394003:N143Y;ENSP00000363985:N143Y|.	ENSP00000247400:N142Y|.	N|Q	-|-	1|2	0|0	MTMR8|MTMR8	63491423|63491423	0.994000|0.994000	0.37717|0.37717	0.276000|0.276000	0.24689|0.24689	0.792000|0.792000	0.44763|0.44763	3.641000|3.641000	0.54360|0.54360	1.309000|1.309000	0.44985|0.44985	0.412000|0.412000	0.27726|0.27726	AAC|CAA		0.378	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677		Missense_Mutation
DACH2	117154	broad.mit.edu	37	X	86069730	86069730	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:86069730A>T	ENST00000373125.4	+	10	1577	c.1577A>T	c.(1576-1578)aAg>aTg	p.K526M	DACH2_ENST00000510272.1_Missense_Mutation_p.K307M|DACH2_ENST00000508860.1_Missense_Mutation_p.K359M|DACH2_ENST00000373131.1_Missense_Mutation_p.K513M	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	526	DACHbox-C.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K526M(1)|p.K513M(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						AAAAAAACCAAGAGAAAATTG	0.448																																																2	Substitution - Missense(2)	ovary(2)	X											60.0	57.0	58.0					X																	86069730		2203	4300	6503	85956386	SO:0001583	missense	117154			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1577A>T	X.37:g.86069730A>T	ENSP00000362217:p.Lys526Met	Unknown		x	x	x	85956386	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	17.50	3.404069	0.62288	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.86956	-2.15;-2.19	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000002	D	0.92136	0.7507	M	0.69358	2.11	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.998	D	0.92864	0.6308	10	0.87932	D	0	.	13.4743	0.61299	1.0:0.0:0.0:0.0	.	392;526;513;526	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	M	526;513;526;359;307;359;191	ENSP00000362223:K513M;ENSP00000362217:K526M	ENSP00000345134:K526M	K	+	2	0	DACH2	85956386	1.000000	0.71417	1.000000	0.80357	0.472000	0.32918	8.793000	0.91862	1.553000	0.49476	0.339000	0.21740	AAG		0.448	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281		Missense_Mutation
DIAPH2	1730	broad.mit.edu	37	X	96502831	96502831	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:96502831A>T	ENST00000324765.8	+	23	3184	c.2837A>T	c.(2836-2838)aAg>aTg	p.K946M	DIAPH2_ENST00000373054.4_Missense_Mutation_p.K942M|DIAPH2_ENST00000355827.4_Missense_Mutation_p.K946M|DIAPH2_ENST00000373049.4_Missense_Mutation_p.K946M|DIAPH2_ENST00000373061.3_Missense_Mutation_p.K946M			O60879	DIAP2_HUMAN	diaphanous-related formin 2	946	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.K946M(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						TTTGTGGAAAAGATGACCATA	0.348																																																1	Substitution - Missense(1)	ovary(1)	X											135.0	114.0	121.0					X																	96502831		2203	4300	6503	96389487	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2837A>T	X.37:g.96502831A>T	ENSP00000321348:p.Lys946Met	Unknown		x	x	x	96389487	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	SNP	3	Broad	.	.	.	.	.	.	.	.	.	.	A	18.96	3.734556	0.69189	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09	5.66	5.66	0.87406	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.183014	0.32802	U	0.005633	T	0.54127	0.1839	M	0.90252	3.1	0.53688	D	0.999971	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.997	T	0.62105	-0.6924	10	0.48119	T	0.1	.	15.0903	0.72188	1.0:0.0:0.0:0.0	.	946;946	O60879;O60879-2	DIAP2_HUMAN;.	M	946;942;946;946;946;953	ENSP00000362152:K946M;ENSP00000362145:K942M;ENSP00000348082:K946M;ENSP00000362140:K946M;ENSP00000321348:K946M	ENSP00000321348:K946M	K	+	2	0	DIAPH2	96389487	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.560000	0.90712	2.014000	0.59158	0.481000	0.45027	AAG		0.348	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309		Missense_Mutation
SLC25A14	9016	broad.mit.edu	37	X	129474302	129474302	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chrX:129474302C>T	ENST00000218197.5	+	1	277	c.50C>T	c.(49-51)gCa>gTa	p.A17V	SLC25A14_ENST00000545805.1_Missense_Mutation_p.A17V|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000361980.5_Missense_Mutation_p.A17V|SLC25A14_ENST00000339231.3_Missense_Mutation_p.A17V|SLC25A14_ENST00000543953.1_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	17					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						GTGAAGTTTGCAACGGCGGCC	0.488																																																0			X											84.0	88.0	87.0					X																	129474302		2203	4300	6503	129301983	SO:0001583	missense	9016			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.50C>T	X.37:g.129474302C>T	ENSP00000218197:p.Ala17Val	Unknown		x	x	x	129301983	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	CCDS14623.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829787	0.71258	.	.	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000218197;ENST00000361980;ENST00000339231	T;T;T;D;T	0.81996	-1.18;-1.45;-1.43;-1.56;-1.34	4.31	4.31	0.51392	.	1.580150	0.02976	N	0.145063	D	0.83529	0.5274	N	0.08118	0	0.80722	D	1	P;P;P	0.52577	0.954;0.877;0.805	D;D;P	0.66351	0.943;0.916;0.827	T	0.74907	-0.3504	10	0.52906	T	0.07	-5.0878	11.0968	0.48150	0.0:1.0:0.0:0.0	.	17;17;17	O95258-3;O95258-2;O95258	.;.;UCP5_HUMAN	V	17	ENSP00000402578:A17V;ENSP00000444642:A17V;ENSP00000218197:A17V;ENSP00000354455:A17V;ENSP00000342797:A17V	ENSP00000218197:A17V	A	+	2	0	SLC25A14	129301983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.014000	0.49590	2.387000	0.81309	0.594000	0.82650	GCA		0.488	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951		Missense_Mutation
RANBP1	5902	broad.mit.edu	37	22	20109874	20109899	+	Frame_Shift_Del	DEL	CAAGGAGAAAGGGGCCATCCGCCTCC	CAAGGAGAAAGGGGCCATCCGCCTCC	-	rs375393752|rs138745087	byFrequency	TCGA-23-1032-01	TCGA-23-1032-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-1032-01	TCGA-23-1032-10	g.chr22:20109874_20109899delCAAGGAGAAAGGGGCCATCCGCCTCC	ENST00000331821.3	+	3	342_367	c.240_265delCAAGGAGAAAGGGGCCATCCGCCTCC	c.(238-267)cacaaggagaaaggggccatccgcctcctcfs	p.KEKGAIRLL81fs	RANBP1_ENST00000402752.1_Frame_Shift_Del_p.KEKGAIRLL81fs|RANBP1_ENST00000430524.1_5'UTR	NM_002882.2	NP_002873.1	P43487	RANG_HUMAN	RAN binding protein 1	81	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|positive regulation of mitotic centrosome separation (GO:0046604)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|spindle organization (GO:0007051)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Ran GTPase binding (GO:0008536)	p.K81fs*27(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)	4	Colorectal(54;0.0993)					TCCTGAAGCACAAGGAGAAAGGGGCCATCCGCCTCCTCATGCGGAG	0.571																																																1	Deletion - Frameshift(1)	ovary(1)	22																																								18489899	SO:0001589	frameshift_variant	5902			D38076	CCDS13775.1, CCDS63408.1, CCDS74823.1	22q11.21	2008-06-16			ENSG00000099901	ENSG00000099901			9847	protein-coding gene	gene with protein product		601180				7616957, 10330396	Standard	NM_001278639		Approved	HTF9A	uc002zro.1	P43487	OTTHUMG00000150490	ENST00000331821.3:c.240_265delCAAGGAGAAAGGGGCCATCCGCCTCC	22.37:g.20109874_20109899delCAAGGAGAAAGGGGCCATCCGCCTCC	ENSP00000327583:p.Lys81fs	Unknown		Capture	Illumina GAIIx	Phase_I	18489874	Q53EY3	Frame_Shift_Del	DEL	ENST00000331821.3	37	CCDS13775.1	DEL	17	Broad																																																																																				0.571	RANBP1-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343733.1	NM_002882		Frame_Shift_Del
