#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
ABCF1	23	hgsc.bcm.edu	37	6	30558467	30558467	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:30558467C>T	ENST00000326195.8	+	25	2639	c.2527C>T	c.(2527-2529)Ccc>Tcc	p.P843S	ABCF1_ENST00000376545.3_Missense_Mutation_p.P805S|ABCF1_ENST00000396515.4_Missense_Mutation_p.P236S	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	843					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)	p.P843S(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						GGTCAGCCGGCCCCGAGAGTG	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											118.0	133.0	128.0					6																	30558467		1511	2708	4219	30666446	SO:0001583	missense	23			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2527C>T	6.37:g.30558467C>T	ENSP00000313603:p.Pro843Ser	Somatic		Capture	SOLID	Phase_IV	30666446	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	ENST00000326195.8	37	CCDS34380.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	c	16.58	3.164245	0.57476	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000455943;ENST00000396515	D;D;T	0.90385	-2.51;-2.66;-1.32	5.39	5.39	0.77823	.	0.245105	0.40554	N	0.001079	D	0.86863	0.6035	L	0.44542	1.39	0.38752	D	0.954125	P;P;P	0.47762	0.9;0.759;0.9	B;B;P	0.46452	0.415;0.379;0.517	D	0.88761	0.3257	10	0.59425	D	0.04	-16.0273	16.0942	0.81110	0.0:1.0:0.0:0.0	.	236;805;843	Q5STZ7;Q2L6I2;Q8NE71	.;.;ABCF1_HUMAN	S	843;805;531;236	ENSP00000313603:P843S;ENSP00000365728:P805S;ENSP00000379772:P236S	ENSP00000313603:P843S	P	+	1	0	ABCF1	30666446	0.940000	0.31905	0.980000	0.43619	0.956000	0.61745	2.583000	0.46094	2.548000	0.85928	0.580000	0.79431	CCC		0.567	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3			Missense_Mutation
ACTR8	93973	hgsc.bcm.edu	37	3	53904167	53904167	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:53904167C>G	ENST00000335754.3	-	12	1673	c.1573G>C	c.(1573-1575)Gac>Cac	p.D525H	ACTR8_ENST00000488802.1_5'UTR|ACTR8_ENST00000482349.1_Missense_Mutation_p.D414H|ACTR8_ENST00000231909.7_Missense_Mutation_p.D230H	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	525					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.D525H(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TTGGTGTCGTCAGATGCTGAA	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											163.0	142.0	149.0					3																	53904167		2203	4300	6503	53879207	SO:0001583	missense	93973				CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.1573G>C	3.37:g.53904167C>G	ENSP00000336842:p.Asp525His	Somatic		Capture	SOLID	Phase_IV	53879207	B3KSW7|Q8N566|Q9H663	Missense_Mutation	SNP	ENST00000335754.3	37	CCDS2875.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396441	0.83011	.	.	ENSG00000113812	ENST00000335754;ENST00000482349;ENST00000231909	D;D;D	0.94280	-3.39;-3.39;-3.39	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.96833	0.8966	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.986;0.999	D	0.97268	0.9909	10	0.72032	D	0.01	-12.8458	17.2355	0.86997	0.0:1.0:0.0:0.0	.	525;230	Q9H981;Q9H981-3	ARP8_HUMAN;.	H	525;414;230	ENSP00000336842:D525H;ENSP00000419429:D414H;ENSP00000231909:D230H	ENSP00000231909:D230H	D	-	1	0	ACTR8	53879207	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.464000	0.80887	2.574000	0.86865	0.655000	0.94253	GAC		0.438	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899		Missense_Mutation
ADAMTSL2	9719	hgsc.bcm.edu	37	9	136405833	136405834	+	Frame_Shift_Ins	INS	-	-	T			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:136405833_136405834insT	ENST00000354484.4	+	6	1083_1084	c.526_527insT	c.(526-528)ctgfs	p.L176fs	ADAMTSL2_ENST00000393060.1_Frame_Shift_Ins_p.L176fs|ADAMTSL2_ENST00000393061.3_Frame_Shift_Ins_p.L285fs	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	176					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R177fs*10(1)		kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GCTCACTGACCTGCGAGGGGTT	0.614																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								135395655	SO:0001589	frameshift_variant	9719			AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.527dupT	9.37:g.136405834_136405834dupT	ENSP00000346478:p.Leu176fs	Somatic		Capture	SOLID	Phase_IV	135395654	B1B0D5|O60345	Frame_Shift_Ins	INS	ENST00000354484.4	37	CCDS6976.1	INS	24	Baylor																																																																																				0.614	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694		Frame_Shift_Ins
ADCY7	113	hgsc.bcm.edu	37	16	50341013	50341014	+	In_Frame_Ins	INS	-	-	GTG			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:50341013_50341014insGTG	ENST00000394697.2	+	15	2145_2146	c.1805_1806insGTG	c.(1804-1809)ctgatc>ctGTGgatc	p.602_603LI>LWI	ADCY7_ENST00000537579.1_3'UTR|ADCY7_ENST00000538642.1_In_Frame_Ins_p.602_603LI>LWI|ADCY7_ENST00000254235.3_In_Frame_Ins_p.602_603LI>LWI|ADCY7_ENST00000566433.2_In_Frame_Ins_p.602_603LI>LWI			P51828	ADCY7_HUMAN	adenylate cyclase 7	602					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.L602_I603insW(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		TGCGCCAGCCTGATCTTCGTCT	0.673																																																1	Insertion - In frame(1)	ovary(1)	16																																								48898515	SO:0001652	inframe_insertion	113			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	Exception_encountered	16.37:g.50341013_50341014insGTG	ENSP00000378187:p.Leu602_Ile603insTrp	Somatic		Capture	SOLID	Phase_IV	48898514	A0AVA6	In_Frame_Ins	INS	ENST00000394697.2	37	CCDS10741.1	INS	55	Baylor																																																																																				0.673	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3			In_Frame_Ins
ADH4	127	hgsc.bcm.edu	37	4	100063890	100063890	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr4:100063890C>A	ENST00000265512.7	-	2	134	c.60G>T	c.(58-60)aaG>aaT	p.K20N	ADH4_ENST00000423445.1_Missense_Mutation_p.K39N|ADH4_ENST00000505590.1_Missense_Mutation_p.K39N|RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000508393.1_Missense_Mutation_p.K39N|ADH4_ENST00000504581.1_5'UTR	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	20					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		TGCAAAGGGGCTTGCCTGCTT	0.498																																																0			4											64.0	56.0	58.0					4																	100063890		2203	4300	6503	100282913	SO:0001583	missense	127			M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.60G>T	4.37:g.100063890C>A	ENSP00000265512:p.Lys20Asn	Somatic		Capture	SOLID	Phase_IV	100282913	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	37	CCDS34032.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301712	0.40694	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590;ENST00000512499;ENST00000504125	T;T;T;T;T;T	0.03745	3.82;3.82;3.82;3.82;3.82;3.82	4.0	-0.169	0.13339	GroES-like (1);	0.512384	0.18284	N	0.145933	T	0.12050	0.0293	H	0.94620	3.56	0.45648	D	0.998572	P;P	0.47762	0.9;0.718	P;B	0.50049	0.629;0.343	T	0.02208	-1.1195	10	0.87932	D	0	-1.3201	2.6707	0.05066	0.4148:0.3422:0.1364:0.1066	.	39;20	P08319-2;P08319	.;ADH4_HUMAN	N	39;20;39;39;39;20	ENSP00000424630:K39N;ENSP00000265512:K20N;ENSP00000397939:K39N;ENSP00000425416:K39N;ENSP00000423571:K39N;ENSP00000427525:K20N	ENSP00000265512:K20N	K	-	3	2	ADH4	100282913	0.081000	0.21417	0.318000	0.25279	0.993000	0.82548	-0.754000	0.04787	0.102000	0.17638	0.655000	0.94253	AAG		0.498	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670		Missense_Mutation
AFF2	2334	hgsc.bcm.edu	37	X	148049172	148049172	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chrX:148049172G>T	ENST00000370460.2	+	15	3696	c.3217G>T	c.(3217-3219)Gat>Tat	p.D1073Y	AFF2_ENST00000342251.3_Missense_Mutation_p.D1040Y|AFF2_ENST00000370457.5_Missense_Mutation_p.D1038Y|AFF2_ENST00000286437.5_Missense_Mutation_p.D714Y	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1073					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.D1073Y(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCACAATGCTGATTATTACAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	X											144.0	131.0	136.0					X																	148049172		2203	4300	6503	147856866	SO:0001583	missense	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3217G>T	X.37:g.148049172G>T	ENSP00000359489:p.Asp1073Tyr	Somatic		Capture	SOLID	Phase_IV	147856866	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658168	0.88154	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.89798	0.6819	M	0.85197	2.74	0.80722	D	1	D;D;D;D;D;D	0.89917	0.994;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.995;0.999;0.997;0.999;0.999;1.0	D	0.91106	0.4918	10	0.87932	D	0	.	18.9066	0.92464	0.0:0.0:1.0:0.0	.	714;1038;1038;1034;1063;1073	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	Y	1073;1038;1040;714	ENSP00000359489:D1073Y;ENSP00000359486:D1038Y;ENSP00000345459:D1040Y;ENSP00000286437:D714Y	ENSP00000286437:D714Y	D	+	1	0	AFF2	147856866	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.822000	0.99363	2.412000	0.81896	0.523000	0.50628	GAT		0.338	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		Missense_Mutation
AHNAK2	113146	hgsc.bcm.edu	37	14	105413319	105413320	+	Frame_Shift_Del	DEL	GA	GA	-	rs367598825	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	GA	GA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr14:105413319_105413320delGA	ENST00000333244.5	-	7	8587_8588	c.8468_8469delTC	c.(8467-8469)ttcfs	p.F2823fs	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2823						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.F2823F(1)|p.F2823fs*17(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGACACCCCGAATGACGGCAT	0.599																																																2	Deletion - Frameshift(1)|Substitution - coding silent(1)	upper_aerodigestive_tract(1)|ovary(1)	14																																								104484365	SO:0001589	frameshift_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8468_8469delTC	14.37:g.105413319_105413320delGA	ENSP00000353114:p.Phe2823fs	Somatic		Capture	SOLID	Phase_IV	104484364	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Frame_Shift_Del	DEL	ENST00000333244.5	37	CCDS45177.1	DEL	37	Baylor																																																																																				0.599	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		Frame_Shift_Del
ALOX15B	247	hgsc.bcm.edu	37	17	7942501	7942501	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:7942501A>C	ENST00000380183.4	+	1	167	c.28A>C	c.(28-30)Acc>Ccc	p.T10P	ALOX15B_ENST00000573359.1_Missense_Mutation_p.T10P|ALOX15B_ENST00000572022.1_Missense_Mutation_p.T10P|ALOX15B_ENST00000380173.2_Missense_Mutation_p.T10P	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	10	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)	p.T10A(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CAGGGTGTCCACCGGAGAAGC	0.667																																																1	Substitution - Missense(1)	kidney(1)	17											60.0	63.0	62.0					17																	7942501		2203	4300	6503	7883226	SO:0001583	missense	247			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.28A>C	17.37:g.7942501A>C	ENSP00000369530:p.Thr10Pro	Somatic		Capture	SOLID	Phase_IV	7883226	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	CCDS11128.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336841	0.81801	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.80994	-1.44;-1.44	4.09	4.09	0.47781	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.000000	0.85682	U	0.000000	D	0.90239	0.6948	M	0.88979	2.995	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91769	0.5426	10	0.87932	D	0	-25.0281	12.3363	0.55069	1.0:0.0:0.0:0.0	.	10;10;10;10	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	P	10	ENSP00000369520:T10P;ENSP00000369530:T10P	ENSP00000344337:T10P	T	+	1	0	ALOX15B	7883226	0.999000	0.42202	0.940000	0.37924	0.144000	0.21451	6.840000	0.75369	1.598000	0.50083	0.477000	0.44152	ACC		0.667	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2			Missense_Mutation
ANXA11	311	hgsc.bcm.edu	37	10	81930613	81930613	+	Silent	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:81930613C>A	ENST00000438331.1	-	5	596	c.114G>T	c.(112-114)ggG>ggT	p.G38G	ANXA11_ENST00000422982.3_Silent_p.G38G|ANXA11_ENST00000463657.1_5'Flank|ANXA11_ENST00000537102.1_Silent_p.G5G|ANXA11_ENST00000265447.4_Silent_p.G38G|ANXA11_ENST00000372231.3_Silent_p.G38G|ANXA11_ENST00000535999.1_Silent_p.G38G|ANXA11_ENST00000360615.4_Silent_p.G38G	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	38					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.G38G(1)		endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			CGTTATCCAGCCCGATGGGGG	0.647																																																1	Substitution - coding silent(1)	ovary(1)	10											70.0	62.0	65.0					10																	81930613		2203	4300	6503	81920593	SO:0001819	synonymous_variant	311			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.114G>T	10.37:g.81930613C>A		Somatic		Capture	SOLID	Phase_IV	81920593	B4DVE7	Silent	SNP	ENST00000438331.1	37	CCDS7364.1	SNP	26	Baylor																																																																																				0.647	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869		Silent
AP2A2	161	hgsc.bcm.edu	37	11	993375	993375	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr11:993375G>A	ENST00000448903.2	+	12	1685	c.1544G>A	c.(1543-1545)aGa>aAa	p.R515K	AP2A2_ENST00000332231.5_Missense_Mutation_p.R516K|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	515					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.R516K(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGAGACCCGAGATCCAGGTGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	11											37.0	41.0	40.0					11																	993375		1925	4129	6054	983375	SO:0001583	missense	161			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1544G>A	11.37:g.993375G>A	ENSP00000413234:p.Arg515Lys	Somatic		Capture	SOLID	Phase_IV	983375	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	5.737	0.320433	0.10845	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	T;T	0.26810	1.71;1.71	3.51	3.51	0.40186	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	L	0.46819	1.47	0.80722	D	1	P;B;B	0.42161	0.772;0.302;0.332	P;B;B	0.62382	0.901;0.182;0.277	T	0.09443	-1.0674	10	0.08179	T	0.78	-44.1555	15.903	0.79397	0.0:0.0:1.0:0.0	.	254;516;515	B7Z1Q4;O94973-2;O94973	.;.;AP2A2_HUMAN	K	515;516;516;252;255	ENSP00000413234:R515K;ENSP00000327694:R516K	ENSP00000327694:R516K	R	+	2	0	AP2A2	983375	1.000000	0.71417	0.218000	0.23776	0.076000	0.17211	9.709000	0.98729	1.896000	0.54893	0.462000	0.41574	AGA		0.657	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305		Missense_Mutation
AQP7	364	hgsc.bcm.edu	37	9	33386989	33386989	+	Silent	SNP	C	C	G	rs77244521	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:33386989C>G	ENST00000539936.1	-	4	484	c.246G>C	c.(244-246)gtG>gtC	p.V82V	AQP7_ENST00000541274.1_Intron|AQP7_ENST00000537089.1_Intron|AQP7_ENST00000377425.4_Silent_p.V25V			O14520	AQP7_HUMAN	aquaporin 7	82					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)	p.V82V(1)		NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTGCCACGTGCACTCCCATGG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	9											105.0	102.0	103.0					9																	33386989		2203	4300	6503	33376989	SO:0001819	synonymous_variant	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.246G>C	9.37:g.33386989C>G		Somatic		Capture	SOLID	Phase_IV	33376989	Q08E94|Q5T5L9|Q8NHM3	Silent	SNP	ENST00000539936.1	37		SNP	25	Baylor																																																																																				0.582	AQP7-203	KNOWN	basic	protein_coding	protein_coding		NM_001170		Silent
ARFGAP2	84364	hgsc.bcm.edu	37	11	47197456	47197456	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr11:47197456delG	ENST00000524782.1	-	3	438	c.210delC	c.(208-210)tccfs	p.S70fs	ARFGAP2_ENST00000419701.2_5'UTR|ARFGAP2_ENST00000426335.2_Frame_Shift_Del_p.S70fs|ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000395449.3_5'UTR	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	70	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.N71fs*7(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						AGTTCCAGTTGGAATCCAACT	0.547																																																1	Deletion - Frameshift(1)	ovary(1)	11											128.0	106.0	113.0					11																	47197456		2201	4298	6499	47154032	SO:0001589	frameshift_variant	84364			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.210delC	11.37:g.47197456delG	ENSP00000434442:p.Ser70fs	Somatic		Capture	SOLID	Phase_IV	47154032	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Frame_Shift_Del	DEL	ENST00000524782.1	37	CCDS7926.1	DEL	47	Baylor																																																																																				0.547	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391425.1	NM_032389		Frame_Shift_Del
ARHGEF15	22899	hgsc.bcm.edu	37	17	8219206	8219207	+	In_Frame_Ins	INS	-	-	ATT			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:8219206_8219207insATT	ENST00000361926.3	+	8	1665_1666	c.1555_1556insATT	c.(1555-1557)gag>gATTag	p.519_519E>D*	ARHGEF15_ENST00000421050.1_In_Frame_Ins_p.519_519E>D*|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	519	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E519>D*(1)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GTATCAGGAGGAGACCTACAGC	0.619																																																1	Complex - insertion inframe(1)	ovary(1)	17																																								8159932	SO:0001652	inframe_insertion	22899			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	Exception_encountered	17.37:g.8219206_8219207insATT	ENSP00000355026:p.Glu519delinsAsp*	Somatic		Capture	SOLID	Phase_IV	8159931	A8K6G1|Q8N449|Q9H8B4	In_Frame_Ins	INS	ENST00000361926.3	37	CCDS11139.1	INS	41	Baylor																																																																																				0.619	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728		In_Frame_Ins
ARHGEF18	23370	hgsc.bcm.edu	37	19	7518482	7518482	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:7518482A>T	ENST00000359920.6	+	7	1674	c.1421A>T	c.(1420-1422)gAc>gTc	p.D474V	ARHGEF18_ENST00000319670.9_Missense_Mutation_p.D316V|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.T432S	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	474					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GGGAAGATGGACCTGAAGTCT	0.557																																																0			19											114.0	100.0	104.0					19																	7518482		2203	4300	6503	7424482	SO:0001583	missense	23370			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1421A>T	19.37:g.7518482A>T	ENSP00000352995:p.Asp474Val	Somatic		Capture	SOLID	Phase_IV	7424482	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	27.1	4.802771	0.90623	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.66280	-0.2;-0.2	5.4	5.4	0.78164	Dbl homology (DH) domain (1);	0.097936	0.44688	D	0.000430	T	0.74336	0.3703	L	0.53249	1.67	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.968	T	0.77021	-0.2742	10	0.87932	D	0	-46.8049	13.4425	0.61121	1.0:0.0:0.0:0.0	.	316;474	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	V	316;474	ENSP00000319200:D316V;ENSP00000352995:D474V	ENSP00000319200:D316V	D	+	2	0	ARHGEF18	7424482	1.000000	0.71417	0.983000	0.44433	0.957000	0.61999	9.317000	0.96327	2.074000	0.62210	0.439000	0.28862	GAC		0.557	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318		Missense_Mutation
ASPH	444	hgsc.bcm.edu	37	8	62550514	62550514	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr8:62550514A>G	ENST00000379454.4	-	12	1068	c.881T>C	c.(880-882)aTt>aCt	p.I294T	ASPH_ENST00000445642.3_Missense_Mutation_p.I280T|ASPH_ENST00000356457.5_Missense_Mutation_p.I294T|ASPH_ENST00000517903.1_Missense_Mutation_p.I279T|ASPH_ENST00000518068.1_Missense_Mutation_p.I251T|ASPH_ENST00000517847.2_Missense_Mutation_p.I280T|ASPH_ENST00000541428.1_Missense_Mutation_p.I265T|ASPH_ENST00000522835.1_Missense_Mutation_p.I237T|ASPH_ENST00000523897.1_5'UTR|ASPH_ENST00000522919.1_Missense_Mutation_p.I107T	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	294	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)	p.I294T(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	ACCTTCTACAATTACCTGTGA	0.343																																																1	Substitution - Missense(1)	ovary(1)	8											51.0	50.0	50.0					8																	62550514		2203	4300	6503	62713068	SO:0001583	missense	444			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.881T>C	8.37:g.62550514A>G	ENSP00000368767:p.Ile294Thr	Somatic		Capture	SOLID	Phase_IV	62713068	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	SNP	4	Baylor	.	.	.	.	.	.	.	.	.	.	A	8.531	0.871111	0.17322	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000522919;ENST00000356457;ENST00000519234;ENST00000518068;ENST00000517903;ENST00000445642;ENST00000517847;ENST00000522835	T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	3.82	2.67	0.31697	Aspartyl beta-hydroxylase/Triadin domain (1);	0.635376	0.14174	N	0.336533	T	0.61413	0.2345	L	0.55481	1.735	0.09310	N	1	P;D;D;D;B;P;D;B;D;B	0.67145	0.936;0.994;0.976;0.976;0.187;0.921;0.996;0.017;0.989;0.27	P;D;D;P;B;P;D;B;D;B	0.67725	0.63;0.947;0.95;0.872;0.08;0.497;0.953;0.018;0.953;0.089	T	0.47522	-0.9111	10	0.59425	D	0.04	-4.5662	5.9268	0.19116	0.8827:0.0:0.1173:0.0	.	275;237;279;260;265;275;251;294;280;294	B8Y0L3;B4DIC9;B7ZM95;B7ZM96;F5H667;F8W7A9;Q8TB28;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;.;.;ASPH_HUMAN	T	275;265;294;107;294;308;251;279;280;280;237	ENSP00000437864:I265T;ENSP00000368767:I294T;ENSP00000430516:I107T;ENSP00000348841:I294T;ENSP00000427823:I308T;ENSP00000429286:I251T;ENSP00000430245:I279T;ENSP00000394013:I280T;ENSP00000429954:I280T;ENSP00000429160:I237T	ENSP00000348841:I294T	I	-	2	0	ASPH	62713068	0.345000	0.24835	0.001000	0.08648	0.003000	0.03518	1.682000	0.37628	0.832000	0.34804	-0.256000	0.11100	ATT		0.343	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318		Missense_Mutation
ATP2B2	491	hgsc.bcm.edu	37	3	10401757	10401757	+	Missense_Mutation	SNP	C	C	G	rs554270950		TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:10401757C>G	ENST00000352432.4	-	12	1779	c.1710G>C	c.(1708-1710)gaG>gaC	p.E570D	ATP2B2_ENST00000397077.1_Missense_Mutation_p.E525D|ATP2B2_ENST00000383800.4_Missense_Mutation_p.E525D|ATP2B2_ENST00000360273.2_Missense_Mutation_p.E570D|ATP2B2_ENST00000343816.4_Missense_Mutation_p.E556D			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	570					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.E525D(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GCAGGCCGCACTCCGTCTTGT	0.637																																					Ovarian(125;1619 1709 15675 19819 38835)											1	Substitution - Missense(1)	ovary(1)	3											61.0	54.0	57.0					3																	10401757		2203	4300	6503	10376757	SO:0001583	missense	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1710G>C	3.37:g.10401757C>G	ENSP00000324172:p.Glu570Asp	Somatic		Capture	SOLID	Phase_IV	10376757	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947103	0.73672	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	4.93	1.08	0.20341	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	M	0.79475	2.455	0.80722	D	1	D;D;D	0.76494	0.992;0.999;0.999	D;D;D	0.77004	0.984;0.986;0.989	D	0.85076	0.0943	10	0.87932	D	0	-37.8701	10.1781	0.42950	0.0:0.6059:0.0:0.3941	.	505;537;570	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	D	570;525;525;570;556;505;426;570	ENSP00000324172:E570D;ENSP00000373311:E525D;ENSP00000380267:E525D;ENSP00000353414:E570D;ENSP00000344677:E556D;ENSP00000414854:E426D	ENSP00000342954:E570D	E	-	3	2	ATP2B2	10376757	0.073000	0.21202	0.995000	0.50966	0.995000	0.86356	-0.461000	0.06712	0.496000	0.27904	0.591000	0.81541	GAG		0.637	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683		Missense_Mutation
AVIL	10677	hgsc.bcm.edu	37	12	58201432	58201432	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:58201432G>T	ENST00000257861.3	-	11	1703	c.1273C>A	c.(1273-1275)Ctg>Atg	p.L425M	AVIL_ENST00000550083.1_5'Flank|RNU6-1083P_ENST00000384022.1_RNA|AVIL_ENST00000537081.1_Missense_Mutation_p.L418M|TSFM_ENST00000548851.1_Intron	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	425	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)	p.L425M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TAGAGGACCAGATAACAGTCT	0.507																																																1	Substitution - Missense(1)	ovary(1)	12											116.0	108.0	111.0					12																	58201432		2203	4300	6503	56487699	SO:0001583	missense	10677			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1273C>A	12.37:g.58201432G>T	ENSP00000257861:p.Leu425Met	Somatic		Capture	SOLID	Phase_IV	56487699	B2RAU7|Q2NKM9	Missense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	SNP	33	Baylor	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433558	0.62955	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.71103	-0.54;-0.54	5.07	4.18	0.49190	Gelsolin domain (1);	0.000000	0.64402	D	0.000001	D	0.85881	0.5800	H	0.94771	3.58	0.49299	D	0.999771	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.86358	0.1715	10	0.72032	D	0.01	-8.148	6.6144	0.22769	0.2682:0.0:0.7318:0.0	.	418;425	O75366-2;O75366	.;AVIL_HUMAN	M	418;425	ENSP00000443207:L418M;ENSP00000257861:L425M	ENSP00000257861:L425M	L	-	1	2	AVIL	56487699	1.000000	0.71417	0.997000	0.53966	0.897000	0.52465	2.139000	0.42149	1.360000	0.45960	0.561000	0.74099	CTG		0.507	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576		Missense_Mutation
AXIN2	8313	hgsc.bcm.edu	37	17	63554371	63554371	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:63554371T>G	ENST00000375702.5	-	1	476	c.368A>C	c.(367-369)aAg>aCg	p.K123T	AXIN2_ENST00000307078.5_Missense_Mutation_p.K123T|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	123	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.K123T(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TTTGGTATCCTTCAGGTTCAT	0.478									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																							1	Substitution - Missense(1)	ovary(1)	17											269.0	238.0	248.0					17																	63554371		2203	4300	6503	60984833	SO:0001583	missense	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.368A>C	17.37:g.63554371T>G	ENSP00000364854:p.Lys123Thr	Somatic		Capture	SOLID	Phase_IV	60984833	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.433	1.086142	0.20390	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.21543	2.0;2.0;2.0	4.36	4.36	0.52297	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.113878	0.64402	D	0.000009	T	0.31796	0.0808	L	0.43152	1.355	0.58432	D	0.999991	D;P;D	0.76494	0.999;0.599;0.999	D;P;D	0.74674	0.984;0.475;0.984	T	0.04333	-1.0959	10	0.23302	T	0.38	-26.2133	8.3559	0.32329	0.0:0.0894:0.0:0.9106	.	123;123;123	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	T	123	ENSP00000302625:K123T;ENSP00000441151:K123T;ENSP00000364854:K123T	ENSP00000302625:K123T	K	-	2	0	AXIN2	60984833	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.533000	0.81994	1.602000	0.50124	0.374000	0.22700	AAG		0.478	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655		Missense_Mutation
BLOC1S3	388552	hgsc.bcm.edu	37	19	45683137	45683137	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:45683137delG	ENST00000433642.2	+	2	679	c.583delG	c.(583-585)gagfs	p.E195fs	TRAPPC6A_ENST00000588062.1_5'Flank|TRAPPC6A_ENST00000585934.1_5'Flank|BLOC1S3_ENST00000587722.1_Frame_Shift_Del_p.E195fs|AC005779.2_ENST00000593083.1_Frame_Shift_Del_p.E20fs|TRAPPC6A_ENST00000592647.1_5'Flank|TRAPPC6A_ENST00000006275.4_5'Flank	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3	195					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)		p.E195fs*>8(1)		ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GACCGAGCCTGAGAAAGACCC	0.672									Hermansky-Pudlak syndrome																																							1	Deletion - Frameshift(1)	ovary(1)	19											23.0	24.0	23.0					19																	45683137		1868	3724	5592	50374977	SO:0001589	frameshift_variant	388552	Familial Cancer Database	HPS, HPS1-8	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.583delG	19.37:g.45683137delG	ENSP00000393840:p.Glu195fs	Somatic		Capture	SOLID	Phase_IV	50374977	B2RXB8	Frame_Shift_Del	DEL	ENST00000433642.2	37	CCDS12656.1	DEL	45	Baylor																																																																																				0.672	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457559.1	NM_212550		Frame_Shift_Del
BMPR2	659	hgsc.bcm.edu	37	2	203420662	203420662	+	Silent	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:203420662G>A	ENST00000374580.4	+	12	2813	c.2274G>A	c.(2272-2274)ttG>ttA	p.L758L	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	758					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.L758L(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						CTACTAGTTTGCCTTTGAACA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	2											58.0	61.0	60.0					2																	203420662		2203	4300	6503	203128907	SO:0001819	synonymous_variant	659			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.2274G>A	2.37:g.203420662G>A		Somatic		Capture	SOLID	Phase_IV	203128907	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	ENST00000374580.4	37	CCDS33361.1	SNP	46	Baylor																																																																																				0.443	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204		Silent
BNC1	646	hgsc.bcm.edu	37	15	83932595	83932595	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr15:83932595G>T	ENST00000345382.2	-	4	1493	c.1408C>A	c.(1408-1410)Cca>Aca	p.P470T	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.P463T	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	470					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CCAATGTTTGGGAAGGCTGGT	0.547																																																0			15											86.0	76.0	80.0					15																	83932595		2203	4300	6503	81723599	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1408C>A	15.37:g.83932595G>T	ENSP00000307041:p.Pro470Thr	Somatic		Capture	SOLID	Phase_IV	81723599	Q15840	Missense_Mutation	SNP	ENST00000345382.2	37	CCDS10324.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	0.437	-0.900316	0.02472	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.44083	0.93	5.51	0.923	0.19413	.	0.318283	0.33980	N	0.004370	T	0.31295	0.0792	M	0.65975	2.015	0.09310	N	0.999995	B;B	0.31548	0.328;0.048	B;B	0.27380	0.079;0.006	T	0.16424	-1.0403	10	0.16420	T	0.52	-5.4681	5.5668	0.17175	0.3541:0.1317:0.5141:0.0	.	463;470	F5GY04;Q01954	.;BNC1_HUMAN	T	470;463	ENSP00000307041:P470T	ENSP00000307041:P470T	P	-	1	0	BNC1	81723599	1.000000	0.71417	0.746000	0.31095	0.552000	0.35366	0.809000	0.27168	0.186000	0.20125	0.655000	0.94253	CCA		0.547	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717		Missense_Mutation
BPIFC	254240	hgsc.bcm.edu	37	22	32815387	32815387	+	Missense_Mutation	SNP	G	G	A	rs376981555		TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr22:32815387G>A	ENST00000397452.1	-	13	1332	c.1222C>T	c.(1222-1224)Cgc>Tgc	p.R408C	BPIFC_ENST00000534972.1_Missense_Mutation_p.R132C|BPIFC_ENST00000432451.2_Missense_Mutation_p.R165C|BPIFC_ENST00000300399.3_Missense_Mutation_p.R408C			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	408						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.R408C(1)									AAAGCAAGGCGGAATCTAAAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	22						G	CYS/ARG	0,4406		0,0,2203	101.0	104.0	103.0		1222	4.9	1.0	22		103	1,8599	1.2+/-3.3	0,1,4299	no	missense	BPIFC	NM_174932.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	408/508	32815387	1,13005	2203	4300	6503	31145387	SO:0001583	missense	254240			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.1222C>T	22.37:g.32815387G>A	ENSP00000380594:p.Arg408Cys	Somatic		Capture	SOLID	Phase_IV	31145387	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	SNP	39	Baylor	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822349	0.71028	0.0	1.16E-4	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000534972;ENST00000432451	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	4.87	4.87	0.63330	.	0.571361	0.19698	N	0.108115	T	0.28067	0.0692	M	0.75447	2.3	0.45161	D	0.998174	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.971	T	0.01036	-1.1473	10	0.66056	D	0.02	-6.5261	13.5063	0.61485	0.0:0.0:1.0:0.0	.	165;408	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	C	408;408;132;165	ENSP00000380594:R408C;ENSP00000300399:R408C;ENSP00000439123:R132C;ENSP00000408920:R165C	ENSP00000300399:R408C	R	-	1	0	BPIFC	31145387	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.393000	0.59665	2.238000	0.73509	0.455000	0.32223	CGC		0.383	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932		Missense_Mutation
N4BP2L1	90634	hgsc.bcm.edu	37	13	32972481	32972481	+	IGR	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr13:32972481delG	ENST00000380130.2	-	0	3046				BRCA2_ENST00000380152.3_Frame_Shift_Del_p.L3277fs|BRCA2_ENST00000544455.1_Frame_Shift_Del_p.L3277fs	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1									p.P3278fs*35(1)		large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		TGAGTAGACTGCCTTTACCTC	0.448																																																1	Deletion - Frameshift(1)	ovary(1)	13											181.0	177.0	178.0					13																	32972481		2203	4300	6503	31870481	SO:0001628	intergenic_variant	675			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972481delG		Somatic		Capture	SOLID	Phase_IV	31870481	A4QN21|Q5TBK0	Frame_Shift_Del	DEL	ENST00000380130.2	37	CCDS9345.2	DEL	46	Baylor																																																																																				0.448	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052818		Frame_Shift_Del
FAM69C	125704	hgsc.bcm.edu	37	18	72103737	72103737	+	Stop_Codon_Del	DEL	T	T	-			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr18:72103737delT	ENST00000343998.6	-	0	1267				FAM69C_ENST00000400291.2_Stop_Codon_Del	NM_001044369.2	NP_001037834.2	Q0P6D2	FA69C_HUMAN	family with sequence similarity 69, member C							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.*121fs?(1)		breast(1)|large_intestine(2)|ovary(2)	5						AGAGAGTGGCTACTTCTCTGC	0.542																																																1	Deletion - Frameshift(1)	ovary(1)	18											30.0	34.0	32.0					18																	72103737		1949	4142	6091	70254717	SO:0001567	stop_retained_variant	125704			BC019628	CCDS42445.2	18q22.3	2012-08-03	2009-07-23	2009-07-23	ENSG00000187773	ENSG00000187773			31729	protein-coding gene	gene with protein product		614544	"""chromosome 18 open reading frame 51"""	C18orf51		21334309	Standard	NM_001044369		Approved		uc002llk.3	Q0P6D2	OTTHUMG00000156984	Exception_encountered	18.37:g.72103737delT	Exception_encountered	Somatic		Capture	SOLID	Phase_IV	70254717		Frame_Shift_Del	DEL	ENST00000343998.6	37	CCDS42445.2	DEL	53	Baylor																																																																																				0.542	FAM69C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346971.2	XM_058931		Frame_Shift_Del
C6orf132	647024	hgsc.bcm.edu	37	6	42110164	42110164	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:42110164delC	ENST00000341865.4	-	1	18	c.19delG	c.(19-21)gtgfs	p.V7fs	C6orf132_ENST00000356542.5_Frame_Shift_Del_p.V7fs	NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	7								p.V7fs*55(1)		breast(1)	1						GTGCCCTGCACCGTCTGCTTC	0.647																																																1	Deletion - Frameshift(1)	ovary(1)	6											114.0	126.0	122.0					6																	42110164		692	1591	2283	42218142	SO:0001589	frameshift_variant	647024				CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.19delG	6.37:g.42110164delC	ENSP00000341368:p.Val7fs	Somatic		Capture	SOLID	Phase_IV	42218142	A6NI05	Frame_Shift_Del	DEL	ENST00000341865.4	37	CCDS47428.1	DEL	18	Baylor																																																																																				0.647	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040548.2	NM_001164446		Frame_Shift_Del
STKLD1	169436	hgsc.bcm.edu	37	9	136265611	136265612	+	Frame_Shift_Ins	INS	-	-	C			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:136265611_136265612insC	ENST00000371957.3	+	12	1259_1260	c.1152_1153insC	c.(1153-1155)gtcfs	p.V385fs	C9orf96_ENST00000371955.1_Frame_Shift_Ins_p.V10fs	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		385							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.V429fs*67(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGGTCCTCGATGTCCAGCTGTG	0.678																																																1	Insertion - Frameshift(1)	ovary(1)	9																																								135255433	SO:0001589	frameshift_variant	169436																														Exception_encountered	9.37:g.136265611_136265612insC	ENSP00000361025:p.Val385fs	Somatic		Capture	SOLID	Phase_IV	135255432	Q5T8U8|Q6ZMP6|Q6ZMQ5	Frame_Shift_Ins	INS	ENST00000371957.3	37	CCDS35169.1	INS	51	Baylor																																																																																				0.678	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1			Frame_Shift_Ins
CASP2	835	hgsc.bcm.edu	37	7	142985577	142985577	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:142985577C>T	ENST00000310447.5	+	1	270	c.29C>T	c.(28-30)tCc>tTc	p.S10F	AC073342.12_ENST00000446192.1_RNA|RN7SL535P_ENST00000479087.2_RNA|CASP2_ENST00000392925.2_Missense_Mutation_p.S10F|AC073342.12_ENST00000427392.1_RNA	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	10					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GGGTCTTGGTCCACCTTCCAG	0.677																																																0			7											34.0	39.0	37.0					7																	142985577		2202	4300	6502	142695699	SO:0001583	missense	835			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.29C>T	7.37:g.142985577C>T	ENSP00000312664:p.Ser10Phe	Somatic		Capture	SOLID	Phase_IV	142695699	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	CCDS5879.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121309	0.37436	.	.	ENSG00000106144	ENST00000310447;ENST00000392925	T;T	0.51574	4.49;0.7	4.29	3.4	0.38934	.	1.893230	0.02803	N	0.123411	T	0.37544	0.1007	N	0.19112	0.55	0.09310	N	1	B;B	0.14805	0.011;0.005	B;B	0.09377	0.004;0.002	T	0.24404	-1.0161	10	0.42905	T	0.14	.	9.3755	0.38281	0.2128:0.7872:0.0:0.0	.	10;10	E9PDN0;P42575	.;CASP2_HUMAN	F	10	ENSP00000312664:S10F;ENSP00000376656:S10F	ENSP00000312664:S10F	S	+	2	0	CASP2	142695699	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	1.237000	0.32695	1.024000	0.39682	0.650000	0.86243	TCC		0.677	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		Missense_Mutation
CASP9	842	hgsc.bcm.edu	37	1	15831240	15831240	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:15831240T>G	ENST00000333868.5	-	6	828	c.734A>C	c.(733-735)cAg>cCg	p.Q245P	CASP9_ENST00000375890.4_Missense_Mutation_p.Q162P|CASP9_ENST00000348549.5_Intron|CASP9_ENST00000546424.1_Missense_Mutation_p.Q245P	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	245					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)	p.Q245P(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CCCTGGGAACTGCAGGTGGCT	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	54.0	54.0					1																	15831240		2203	4300	6503	15703827	SO:0001583	missense	842			U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.734A>C	1.37:g.15831240T>G	ENSP00000330237:p.Gln245Pro	Somatic		Capture	SOLID	Phase_IV	15703827	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	ENST00000333868.5	37	CCDS158.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986980	0.74589	.	.	ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000375874;ENST00000375890;ENST00000447522;ENST00000440484	T;T;T;T;T	0.03094	4.12;4.12;4.12;4.12;4.05	5.45	5.45	0.79879	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.106824	0.64402	D	0.000003	T	0.20047	0.0482	M	0.85197	2.74	0.58432	D	0.999991	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.991	T	0.00505	-1.1700	10	0.59425	D	0.04	.	13.4602	0.61223	0.0:0.0:0.0:1.0	.	245;245	P55211;F8VVS7	CASP9_HUMAN;.	P	245;245;89;162;162;215	ENSP00000449584:Q245P;ENSP00000330237:Q245P;ENSP00000365051:Q162P;ENSP00000396540:Q162P;ENSP00000411304:Q215P	ENSP00000330237:Q245P	Q	-	2	0	CASP9	15703827	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.302000	0.65733	2.054000	0.61138	0.533000	0.62120	CAG		0.547	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996		Missense_Mutation
CCDC155	147872	hgsc.bcm.edu	37	19	49897817	49897817	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:49897817C>T	ENST00000447857.3	+	3	333	c.128C>T	c.(127-129)gCt>gTt	p.A43V		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	43						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.A43V(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						ACGTTCGAAGCTTGTGACCCT	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											76.0	79.0	78.0					19																	49897817		2080	4214	6294	54589629	SO:0001583	missense	147872				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.128C>T	19.37:g.49897817C>T	ENSP00000404220:p.Ala43Val	Somatic		Capture	SOLID	Phase_IV	54589629	Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	37	CCDS46140.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502741	0.85176	.	.	ENSG00000161609	ENST00000447857	T	0.63255	-0.03	4.96	4.96	0.65561	EF-hand-like domain (1);	0.141423	0.43579	D	0.000548	T	0.77824	0.4188	M	0.76574	2.34	0.35849	D	0.826601	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	D	0.83499	0.0074	10	0.54805	T	0.06	-19.1132	14.0553	0.64764	0.0:1.0:0.0:0.0	.	43;43;123	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	V	43	ENSP00000404220:A43V	ENSP00000404220:A43V	A	+	2	0	CCDC155	54589629	0.993000	0.37304	0.999000	0.59377	0.897000	0.52465	3.750000	0.55157	2.465000	0.83290	0.462000	0.41574	GCT		0.632	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688		Missense_Mutation
CCDC88A	55704	hgsc.bcm.edu	37	2	55646004	55646004	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:55646004delC	ENST00000436346.1	-	2	953	c.112delG	c.(112-114)gaafs	p.E38fs	CCDC88A_ENST00000336838.6_Frame_Shift_Del_p.E38fs|CCDC88A_ENST00000263630.8_Frame_Shift_Del_p.E38fs|CCDC88A_ENST00000413716.2_Frame_Shift_Del_p.E38fs|CCDC88A_ENST00000471947.1_5'UTR	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	38					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.E38fs*11(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GCCACATATTCATCAAGGTTG	0.458																																																1	Deletion - Frameshift(1)	ovary(1)	2											139.0	128.0	132.0					2																	55646004		2203	4300	6503	55499508	SO:0001589	frameshift_variant	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.112delG	2.37:g.55646004delC	ENSP00000410608:p.Glu38fs	Somatic		Capture	SOLID	Phase_IV	55499508	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Frame_Shift_Del	DEL	ENST00000436346.1	37		DEL	29	Baylor																																																																																				0.458	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571		Frame_Shift_Del
CD97	976	hgsc.bcm.edu	37	19	14517910	14517910	+	Silent	SNP	T	T	C			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:14517910T>C	ENST00000242786.5	+	18	2325	c.2245T>C	c.(2245-2247)Ttg>Ctg	p.L749L	CD97_ENST00000358600.3_Silent_p.L656L|CD97_ENST00000357355.3_Silent_p.L700L|DDX39A_ENST00000592927.1_5'Flank|CTC-548K16.5_ENST00000590626.1_RNA	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	749					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GCTCTTCCTGTTGGGCTGCAC	0.632																																																0			19											135.0	97.0	110.0					19																	14517910		2203	4300	6503	14378910	SO:0001819	synonymous_variant	976				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.2245T>C	19.37:g.14517910T>C		Somatic		Capture	SOLID	Phase_IV	14378910	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Silent	SNP	ENST00000242786.5	37	CCDS32929.1	SNP	60	Baylor																																																																																				0.632	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481		Silent
CETN1	1068	hgsc.bcm.edu	37	18	580475	580475	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr18:580475delC	ENST00000327228.3	+	1	109	c.67delC	c.(67-69)cccfs	p.P23fs		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	23					cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)	p.E24fs*30(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						GGCACCTAAGCCCGAGCTCAC	0.612																																																1	Deletion - Frameshift(1)	ovary(1)	18											42.0	31.0	34.0					18																	580475		2203	4300	6503	570475	SO:0001589	frameshift_variant	1068			U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.67delC	18.37:g.580475delC	ENSP00000319052:p.Pro23fs	Somatic		Capture	SOLID	Phase_IV	570475	B2R536	Frame_Shift_Del	DEL	ENST00000327228.3	37	CCDS11820.1	DEL	26	Baylor																																																																																				0.612	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254314.2	NM_004066		Frame_Shift_Del
CHMP1B	57132	hgsc.bcm.edu	37	18	11851896	11851896	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr18:11851896C>T	ENST00000526991.2	+	1	502	c.386C>T	c.(385-387)aCg>aTg	p.T129M	GNAL_ENST00000535121.1_Intron|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000334049.6_Intron|GNAL_ENST00000269162.5_Intron|RP11-78A19.3_ENST00000586474.1_RNA	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B	129					cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						GACGTCCAGACGCAGCAAATG	0.517																																																0			18											76.0	83.0	81.0					18																	11851896		2105	4237	6342	11841896	SO:0001583	missense	57132			AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.386C>T	18.37:g.11851896C>T	ENSP00000432279:p.Thr129Met	Somatic		Capture	SOLID	Phase_IV	11841896	Q96E89|Q9HD41	Missense_Mutation	SNP	ENST00000526991.2	37	CCDS54180.1	SNP	19	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402624	0.83230	.	.	ENSG00000255112	ENST00000526991	T	0.72282	-0.64	5.59	4.73	0.59995	.	.	.	.	.	D	0.84110	0.5400	M	0.86502	2.82	0.58432	D	0.999999	D	0.71674	0.998	D	0.65140	0.932	D	0.86921	0.2067	9	0.87932	D	0	.	12.7759	0.57448	0.0:0.92:0.0:0.08	.	129	Q7LBR1	CHM1B_HUMAN	M	129	ENSP00000432279:T129M	ENSP00000432279:T129M	T	+	2	0	CHMP1B	11841896	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.750000	0.68712	1.508000	0.48769	0.655000	0.94253	ACG		0.517	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386375.2	NM_020412		Missense_Mutation
CHMP4A	29082	hgsc.bcm.edu	37	14	24680630	24680630	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr14:24680630T>G	ENST00000609024.1	-	3	398	c.350A>C	c.(349-351)tAc>tCc	p.Y117S	CHMP4A_ENST00000542700.2_5'UTR|CHMP4A_ENST00000347519.6_Missense_Mutation_p.Y160S|CHMP4A_ENST00000530996.1_Missense_Mutation_p.Y12S|TM9SF1_ENST00000556387.1_Missense_Mutation_p.Y117S|AL136419.6_ENST00000565988.1_RNA|TM9SF1_ENST00000530611.1_Missense_Mutation_p.Y117S|NEDD8-MDP1_ENST00000604306.1_5'Flank|MDP1_ENST00000532557.1_5'Flank			Q9BY43	CHM4A_HUMAN	charged multivesicular body protein 4A	117	Intramolecular interaction with C- terminus. {ECO:0000250}.				endosomal transport (GO:0016197)|membrane budding (GO:0006900)|membrane organization (GO:0061024)|membrane tubulation (GO:0097320)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)	p.Y160S(1)		NS(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9				GBM - Glioblastoma multiforme(265;0.0181)		CATGTCCTGGTAGGCCTTCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	14											82.0	71.0	74.0					14																	24680630		2203	4300	6503	23750470	SO:0001583	missense	29082			AF212243	CCDS9619.1	14q12	2012-10-04	2011-09-21	2005-04-04	ENSG00000254505	ENSG00000254505		"""Charged multivesicular body proteins"""	20274	protein-coding gene	gene with protein product		610051	"""chromosome 14 open reading frame 123"", ""chromatin modifying protein 4A"""	C14orf123			Standard	NM_014169		Approved	HSPC134, VPS32A		Q9BY43	OTTHUMG00000167036	ENST00000609024.1:c.350A>C	14.37:g.24680630T>G	ENSP00000476412:p.Tyr117Ser	Somatic		Capture	SOLID	Phase_IV	23750470	Q14D22|Q32Q79|Q86SZ8|Q96QJ9|Q9P026	Missense_Mutation	SNP	ENST00000609024.1	37		SNP	57	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211825	0.58452	.	.	ENSG00000100926;ENSG00000254692;ENSG00000254505;ENSG00000254505	ENST00000556387;ENST00000530611;ENST00000347519;ENST00000533011	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	4.59	4.59	0.56863	.	0.161391	0.29493	N	0.011995	T	0.62454	0.2429	L	0.34521	1.04	0.37264	D	0.907109	B;B	0.26041	0.14;0.066	B;B	0.32090	0.14;0.069	T	0.68349	-0.5432	10	0.87932	D	0	-2.9377	11.9493	0.52946	0.0:0.0:0.0:1.0	.	117;160	Q9BY43;Q14D22	CHM4A_HUMAN;.	S	117;117;160;127	ENSP00000451949:Y117S;ENSP00000433967:Y117S;ENSP00000324205:Y160S;ENSP00000432575:Y127S	ENSP00000324205:Y160S	Y	-	2	0	TM9SF1;AL096870.1;RP11-468E2.1	23750470	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.602000	0.67612	1.934000	0.56057	0.459000	0.35465	TAC		0.537	CHMP4A-012	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471846.1	NM_014169		Missense_Mutation
CHRNA2	1135	hgsc.bcm.edu	37	8	27327474	27327475	+	Frame_Shift_Ins	INS	-	-	GGGTGGA			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr8:27327474_27327475insGGGTGGA	ENST00000520933.2	-	2	250_251	c.97_98insTCCACCC	c.(97-99)cctfs	p.-32fs	CHRNA2_ENST00000240132.2_Frame_Shift_Ins_p.-32fs|CHRNA2_ENST00000407991.1_Frame_Shift_Ins_p.-32fs			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)	p.P33fs*29(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	AGCCCTGGGAGGTGGGCGCTTA	0.574																																																1	Insertion - Frameshift(1)	ovary(1)	8																																								27383392	SO:0001589	frameshift_variant	1135			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.97_98insTCCACCC	8.37:g.27327474_27327475insGGGTGGA	ENSP00000429616:p.Pro32fs	Somatic		Capture	SOLID	Phase_IV	27383391	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Frame_Shift_Ins	INS	ENST00000520933.2	37	CCDS6059.1	INS	35	Baylor																																																																																				0.574	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4			Frame_Shift_Ins
CNGB1	1258	hgsc.bcm.edu	37	16	57957184	57957184	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:57957184C>A	ENST00000251102.8	-	18	1696	c.1636G>T	c.(1636-1638)Gac>Tac	p.D546Y	CNGB1_ENST00000564448.1_Missense_Mutation_p.D540Y	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	546					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CACTCAGTGTCCTTCGGGGTG	0.577																																					Colon(156;1293 1853 16336 28962 38659)											0			16											52.0	53.0	53.0					16																	57957184		1887	4111	5998	56514685	SO:0001583	missense	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1636G>T	16.37:g.57957184C>A	ENSP00000251102:p.Asp546Tyr	Somatic		Capture	SOLID	Phase_IV	56514685	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	11.89	1.775090	0.31411	.	.	ENSG00000070729	ENST00000251102	T	0.33438	1.41	4.97	4.03	0.46877	.	0.413848	0.20508	N	0.090949	T	0.15392	0.0371	N	0.08118	0	0.80722	D	1	P	0.50710	0.938	B	0.40534	0.332	T	0.03514	-1.1029	10	0.48119	T	0.1	.	9.3614	0.38197	0.0:0.9034:0.0:0.0966	.	546	Q14028	CNGB1_HUMAN	Y	546	ENSP00000251102:D546Y	ENSP00000251102:D546Y	D	-	1	0	CNGB1	56514685	0.817000	0.29147	0.855000	0.33649	0.291000	0.27294	1.547000	0.36190	1.322000	0.45245	-0.137000	0.14449	GAC		0.577	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297		Missense_Mutation
COASY	80347	hgsc.bcm.edu	37	17	40716173	40716173	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:40716173A>G	ENST00000393818.2	+	2	1351	c.895A>G	c.(895-897)Aac>Gac	p.N299D	COASY_ENST00000420359.1_Missense_Mutation_p.N299D|COASY_ENST00000449624.1_Missense_Mutation_p.N4D|COASY_ENST00000421097.2_Missense_Mutation_p.N299D|COASY_ENST00000590958.1_Missense_Mutation_p.N328D|MLX_ENST00000346833.4_5'Flank|MLX_ENST00000435881.2_5'Flank|RP11-400F19.8_ENST00000585572.1_RNA|MLX_ENST00000246912.4_5'Flank	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	299	Phosphopantetheine adenylyltransferase.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)	p.N299D(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GATGGCCATCAACCGCTTCCG	0.622																																																1	Substitution - Missense(1)	ovary(1)	17											35.0	37.0	36.0					17																	40716173		2203	4300	6503	37969699	SO:0001583	missense	80347			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.895A>G	17.37:g.40716173A>G	ENSP00000377406:p.Asn299Asp	Somatic		Capture	SOLID	Phase_IV	37969699	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	32	5.131680	0.94473	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	T;D;D	0.96716	0.3;-4.1;-4.1	5.23	5.23	0.72850	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.98040	0.9354	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.993	D	0.98771	1.0728	10	0.87932	D	0	-28.222	13.3897	0.60816	1.0:0.0:0.0:0.0	.	328;299	Q13057-2;Q13057	.;COASY_HUMAN	D	328;4;299;299	ENSP00000407740:N4D;ENSP00000413338:N299D;ENSP00000377406:N299D	ENSP00000377406:N299D	N	+	1	0	COASY	37969699	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.118000	0.77137	2.324000	0.78689	0.533000	0.62120	AAC		0.622	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233		Missense_Mutation
COL9A2	1298	hgsc.bcm.edu	37	1	40779891	40779892	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:40779891_40779892insGA	ENST00000372748.3	-	4	330_331	c.234_235insTC	c.(232-237)gggaagfs	p.K79fs		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	79	Triple-helical region 4 (COL4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.K79fs*8(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			ATCCCGGGCTTCCCGTCTGGCC	0.589																																																1	Insertion - Frameshift(1)	ovary(1)	1																																								40552479	SO:0001589	frameshift_variant	1298			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.234_235insTC	1.37:g.40779891_40779892insGA	ENSP00000361834:p.Lys79fs	Somatic		Capture	SOLID	Phase_IV	40552478	B2RMP9	Frame_Shift_Ins	INS	ENST00000372748.3	37	CCDS450.1	INS	62	Baylor																																																																																				0.589	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852		Frame_Shift_Ins
CRLF1	9244	hgsc.bcm.edu	37	19	18707727	18707728	+	Frame_Shift_Del	DEL	CG	CG	-	rs137853145		TCGA-23-1120-01	TCGA-23-1120-10	CG	CG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:18707727_18707728delCG	ENST00000392386.3	-	5	1022_1023	c.829_830delCG	c.(829-831)cgafs	p.R277fs	CRLF1_ENST00000594325.1_5'Flank	NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	277	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.R277fs*52(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						GTCCTCCACTCGGTAGCGGATC	0.668																																																1	Deletion - Frameshift(1)	ovary(1)	19	GRCh37	CM086806	CRLF1	M	rs137853145																																			18568728	SO:0001589	frameshift_variant	9244			AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.829_830delCG	19.37:g.18707727_18707728delCG	ENSP00000376188:p.Arg277fs	Somatic		Capture	SOLID	Phase_IV	18568727	Q9UHH5	Frame_Shift_Del	DEL	ENST00000392386.3	37	CCDS32962.1	DEL	31	Baylor																																																																																				0.668	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1			Frame_Shift_Del
COMP	1311	hgsc.bcm.edu	37	19	18895048	18895048	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:18895048C>G	ENST00000222271.2	-	17	2084	c.2040G>C	c.(2038-2040)aaG>aaC	p.K680N	COMP_ENST00000542601.2_Missense_Mutation_p.K647N|COMP_ENST00000425807.1_Missense_Mutation_p.K627N	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	680	Mediates cell survival and induction of the IAP family of survival proteins.|TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						AACGATAGGACTTCTTGTCCT	0.627																																																0			19											106.0	92.0	97.0					19																	18895048		2203	4300	6503	18756048	SO:0001583	missense	1311			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.2040G>C	19.37:g.18895048C>G	ENSP00000222271:p.Lys680Asn	Somatic		Capture	SOLID	Phase_IV	18756048	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	ENST00000222271.2	37	CCDS12385.1	SNP	20	Baylor	.	.	.	.	.	.	.	.	.	.	C	8.488	0.861383	0.17178	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.95069	-3.6;-3.6;-3.6	4.92	-9.84	0.00479	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.155987	0.42294	U	0.000740	T	0.80042	0.4551	N	0.08118	0	0.09310	N	0.999995	B;B	0.21606	0.014;0.058	B;B	0.26864	0.074;0.074	T	0.66795	-0.5833	10	0.87932	D	0	-5.4137	1.1913	0.01865	0.2203:0.2706:0.1238:0.3853	.	627;680	B4DKJ3;P49747	.;COMP_HUMAN	N	647;680;627;667	ENSP00000439156:K647N;ENSP00000222271:K680N;ENSP00000403792:K627N	ENSP00000222271:K680N	K	-	3	2	COMP	18756048	0.000000	0.05858	0.073000	0.20177	0.302000	0.27658	-4.882000	0.00174	-2.779000	0.00361	-0.535000	0.04281	AAG		0.627	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095		Missense_Mutation
CST9	128822	hgsc.bcm.edu	37	20	23584223	23584223	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr20:23584223C>G	ENST00000376971.3	-	2	415	c.404G>C	c.(403-405)aGc>aCc	p.S135T		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	135						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.S135T(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					GCATCCACAGCTGTGGACCTG	0.527																																																1	Substitution - Missense(1)	ovary(1)	20											166.0	133.0	144.0					20																	23584223		2203	4300	6503	23532223	SO:0001583	missense	128822			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.404G>C	20.37:g.23584223C>G	ENSP00000366170:p.Ser135Thr	Somatic		Capture	SOLID	Phase_IV	23532223	B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	CCDS33450.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	4.345	0.063468	0.08388	.	.	ENSG00000173335	ENST00000376971	D	0.93076	-3.16	2.19	-2.0	0.07433	.	0.701100	0.11723	N	0.535658	T	0.80984	0.4729	N	0.08118	0	0.09310	N	1	B	0.22414	0.069	B	0.10450	0.005	T	0.66748	-0.5845	10	0.14656	T	0.56	.	7.6236	0.28200	0.0:0.5363:0.0:0.4637	.	135	Q5W186	CST9_HUMAN	T	135	ENSP00000366170:S135T	ENSP00000366170:S135T	S	-	2	0	CST9	23532223	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.030000	0.12308	-0.957000	0.03627	-1.134000	0.01955	AGC		0.527	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1		Missense_Mutation
CYFIP1	23191	hgsc.bcm.edu	37	15	22993077	22993077	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr15:22993077G>C	ENST00000313077.7	+	26	3089	c.2964G>C	c.(2962-2964)gaG>gaC	p.E988D	CYFIP1_ENST00000435939.2_Missense_Mutation_p.E557D|CYFIP1_ENST00000560848.1_Missense_Mutation_p.E988D	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		AGTACGCAGAGCTGAAGACGG	0.647																																																0			15											125.0	112.0	116.0					15																	22993077		2203	4300	6503	20544518	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2964G>C	15.37:g.22993077G>C	ENSP00000324549:p.Glu988Asp	Somatic		Capture	SOLID	Phase_IV	20544518		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	12.10	1.838013	0.32513	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.22539	1.95;1.95	5.1	-0.846	0.10734	.	0.000000	0.64402	D	0.000001	T	0.17023	0.0409	N	0.10618	0.005	0.58432	D	0.999999	D;B;B	0.63046	0.992;0.001;0.017	D;B;B	0.76071	0.987;0.005;0.059	T	0.09818	-1.0657	10	0.02654	T	1	-30.0545	10.8908	0.46994	0.5173:0.0:0.4827:0.0	.	1016;557;988	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	D	988;1016;557	ENSP00000324549:E988D;ENSP00000405956:E557D	ENSP00000324549:E988D	E	+	3	2	CYFIP1	20544518	1.000000	0.71417	0.965000	0.40720	0.850000	0.48378	1.235000	0.32671	0.008000	0.14787	-0.140000	0.14226	GAG		0.647	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608		Missense_Mutation
DACH1	1602	hgsc.bcm.edu	37	13	72147085	72147085	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr13:72147085C>T	ENST00000359684.2	-	5	1347	c.1348G>A	c.(1348-1350)Gca>Aca	p.A450T	DACH1_ENST00000313174.7_Intron|DACH1_ENST00000305425.4_Missense_Mutation_p.A398T|DACH1_ENST00000354591.4_Intron			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	450					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.A398T(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GTGACAGATGCTGGAGGTAGG	0.478																																																1	Substitution - Missense(1)	ovary(1)	13											98.0	100.0	100.0					13																	72147085		2082	4248	6330	71045086	SO:0001583	missense	1602			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1348G>A	13.37:g.72147085C>T	ENSP00000352712:p.Ala450Thr	Somatic		Capture	SOLID	Phase_IV	71045086	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37		SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	35	5.502694	0.96371	.	.	ENSG00000165659	ENST00000305425;ENST00000359684;ENST00000377826	T;T	0.50813	1.15;0.73	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.62575	0.2439	M	0.74881	2.28	0.80722	D	1	D	0.55605	0.972	P	0.52159	0.691	T	0.62515	-0.6838	10	0.44086	T	0.13	-10.1282	19.5667	0.95397	0.0:1.0:0.0:0.0	.	396	Q9UI36-2	.	T	398;450;450	ENSP00000304994:A398T;ENSP00000352712:A450T	ENSP00000304994:A398T	A	-	1	0	DACH1	71045086	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.346000	0.79347	2.800000	0.96347	0.591000	0.81541	GCA		0.478	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392		Missense_Mutation
DDX21	9188	hgsc.bcm.edu	37	10	70723144	70723144	+	Silent	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:70723144G>A	ENST00000354185.4	+	4	803	c.705G>A	c.(703-705)ggG>ggA	p.G235G	RN7SL373P_ENST00000577512.1_RNA	NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	235	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.G235G(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAGGAACTGGGAAGACATTCT	0.473																																																1	Substitution - coding silent(1)	ovary(1)	10											147.0	127.0	134.0					10																	70723144		2203	4300	6503	70393150	SO:0001819	synonymous_variant	9188			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.705G>A	10.37:g.70723144G>A		Somatic		Capture	SOLID	Phase_IV	70393150	B2RDL0|Q13436|Q5VX41|Q68D35	Silent	SNP	ENST00000354185.4	37	CCDS31211.1	SNP	41	Baylor																																																																																				0.473	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048374.1	NM_004728		Silent
DDX25	29118	hgsc.bcm.edu	37	11	125788554	125788555	+	In_Frame_Ins	INS	-	-	GAT			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr11:125788554_125788555insGAT	ENST00000263576.6	+	10	1225_1226	c.1070_1071insGAT	c.(1069-1074)gagatg>gaGATgatg	p.358_359insM	RP11-680F20.9_ENST00000533033.2_RNA|DDX25_ENST00000525943.1_3'UTR	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	358	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.M244_I245insM(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TTGACCGTGGAGATGATACAGG	0.515																																																1	Insertion - In frame(1)	ovary(1)	11																																								125293765	SO:0001652	inframe_insertion	29118			AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.1074_1076dupGAT	11.37:g.125788558_125788560dupGAT	ENSP00000263576:p.Met358_Met358dup	Somatic		Capture	SOLID	Phase_IV	125293764	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	In_Frame_Ins	INS	ENST00000263576.6	37	CCDS44766.1	INS	11	Baylor																																																																																				0.515	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264		In_Frame_Ins
DDX52	11056	hgsc.bcm.edu	37	17	36002175	36002175	+	Missense_Mutation	SNP	C	C	T	rs563123769|rs373034938	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:36002175C>T	ENST00000349699.2	-	2	293	c.250G>A	c.(250-252)Gag>Aag	p.E84K	RP11-697E22.2_ENST00000586163.1_RNA|DDX52_ENST00000394367.3_5'UTR|RP11-697E22.2_ENST00000586950.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	84						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				TTGCTCTGCTCCCTCTTCCTT	0.373																																																0			17											190.0	189.0	190.0					17																	36002175		2203	4300	6503	33076288	SO:0001583	missense	11056			AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.250G>A	17.37:g.36002175C>T	ENSP00000268854:p.Glu84Lys	Somatic		Capture	SOLID	Phase_IV	33076288	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.879	0.531561	0.13127	.	.	ENSG00000141141	ENST00000349699	T	0.13778	2.56	4.7	-0.884	0.10597	.	2.277430	0.01108	N	0.005514	T	0.07279	0.0184	N	0.14661	0.345	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.23833	-1.0177	10	0.10636	T	0.68	.	3.6961	0.08365	0.0:0.3859:0.1914:0.4227	.	84	Q9Y2R4	DDX52_HUMAN	K	84	ENSP00000268854:E84K	ENSP00000268854:E84K	E	-	1	0	DDX52	33076288	0.003000	0.15002	0.000000	0.03702	0.024000	0.10985	0.229000	0.17833	0.063000	0.16370	0.491000	0.48974	GAG		0.373	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300		Missense_Mutation
DIP2C	22982	hgsc.bcm.edu	37	10	391048	391048	+	Frame_Shift_Del	DEL	C	C	-			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:391048delC	ENST00000280886.6	-	27	3321	c.3234delG	c.(3232-3234)gtgfs	p.V1078fs		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1078						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.S1079fs*6(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CAGAGCGACTCACCTGGCATC	0.577																																																1	Deletion - Frameshift(1)	ovary(1)	10											46.0	38.0	40.0					10																	391048		2203	4300	6503	381048	SO:0001589	frameshift_variant	22982			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3234delG	10.37:g.391048delC	ENSP00000280886:p.Val1078fs	Somatic		Capture	SOLID	Phase_IV	381048	B4DPI5|Q5SS78	Frame_Shift_Del	DEL	ENST00000280886.6	37	CCDS7054.1	DEL	29	Baylor																																																																																				0.577	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974		Frame_Shift_Del
DLG5	9231	hgsc.bcm.edu	37	10	79595594	79595594	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:79595594C>A	ENST00000372391.2	-	8	1529	c.1524G>T	c.(1522-1524)gaG>gaT	p.E508D	DLG5_ENST00000372388.2_Missense_Mutation_p.E508D	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	508					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.E508D(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CTTCCTTCAGCTCCTGGCACA	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											102.0	87.0	92.0					10																	79595594		2203	4300	6503	79265600	SO:0001583	missense	9231			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.1524G>T	10.37:g.79595594C>A	ENSP00000361467:p.Glu508Asp	Somatic		Capture	SOLID	Phase_IV	79265600	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606440	0.66445	.	.	ENSG00000151208	ENST00000372391;ENST00000372388	T;T	0.06371	3.31;3.38	5.8	1.9	0.25705	.	0.000000	0.39544	N	0.001326	T	0.18130	0.0435	M	0.68317	2.08	0.29106	N	0.88118	D;D;D	0.76494	0.989;0.999;0.996	D;D;D	0.77557	0.922;0.99;0.987	T	0.01051	-1.1468	10	0.51188	T	0.08	.	8.823	0.35039	0.0:0.5889:0.0:0.4111	.	398;508;508	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	D	508	ENSP00000361467:E508D;ENSP00000361464:E508D	ENSP00000361464:E508D	E	-	3	2	DLG5	79265600	0.928000	0.31464	1.000000	0.80357	0.999000	0.98932	0.083000	0.14871	0.801000	0.34066	0.655000	0.94253	GAG		0.582	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2			Missense_Mutation
DNAH1	25981	hgsc.bcm.edu	37	3	52404172	52404174	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-23-1120-01	TCGA-23-1120-10	CAA	CAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:52404172_52404174delCAA	ENST00000420323.2	+	39	6446_6448	c.6185_6187delCAA	c.(6184-6189)tcaacc>tcc	p.T2063del		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2063					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T2063delT(1)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTGATCGCCTCAACCAACTGCAA	0.576																																																1	Deletion - In frame(1)	ovary(1)	3																																								52379214	SO:0001651	inframe_deletion	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6185_6187delCAA	3.37:g.52404172_52404174delCAA	ENSP00000401514:p.Thr2063del	Somatic		Capture	SOLID	Phase_IV	52379212	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	In_Frame_Del	DEL	ENST00000420323.2	37	CCDS46842.1	DEL	29	Baylor																																																																																				0.576	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		In_Frame_Del
DNAH10	196385	hgsc.bcm.edu	37	12	124415898	124415898	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:124415898delG	ENST00000409039.3	+	73	12466	c.12441delG	c.(12439-12441)gagfs	p.E4147fs	DNAH10OS_ENST00000514254.2_Intron|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4147					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A2740fs*60(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGCCATCGAGGCCCTCCCGC	0.582																																																1	Deletion - Frameshift(1)	ovary(1)	12											55.0	61.0	59.0					12																	124415898		2104	4218	6322	122981851	SO:0001589	frameshift_variant	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12441delG	12.37:g.124415898delG	ENSP00000386770:p.Glu4147fs	Somatic		Capture	SOLID	Phase_IV	122981851	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Frame_Shift_Del	DEL	ENST00000409039.3	37	CCDS9255.2	DEL	35	Baylor																																																																																				0.582	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			Frame_Shift_Del
DNM1	1759	hgsc.bcm.edu	37	9	131010964	131010964	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:131010964A>G	ENST00000372923.3	+	19	2100	c.2008A>G	c.(2008-2010)Atg>Gtg	p.M670V	DNM1_ENST00000475805.1_Missense_Mutation_p.M670V|DNM1_ENST00000393594.3_Missense_Mutation_p.M670V|DNM1_ENST00000341179.7_Missense_Mutation_p.M670V|DNM1_ENST00000486160.1_Missense_Mutation_p.M670V	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	670	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						GGACTCATACATGGCCATTGT	0.542																																					GBM(113;146 1575 2722 28670 29921)											0			9											207.0	167.0	181.0					9																	131010964		2203	4300	6503	130050785	SO:0001583	missense	1759			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.2008A>G	9.37:g.131010964A>G	ENSP00000362014:p.Met670Val	Somatic		Capture	SOLID	Phase_IV	130050785	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	ENST00000372923.3	37	CCDS6895.1	SNP	8	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.93	2.086600	0.36855	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	4.67	4.67	0.58626	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.048163	0.85682	D	0.000000	T	0.40791	0.1131	L	0.45228	1.405	0.80722	D	1	B;B;B	0.18166	0.026;0.012;0.01	B;B;B	0.20384	0.029;0.017;0.017	T	0.22871	-1.0204	10	0.27082	T	0.32	-11.7046	14.2897	0.66268	1.0:0.0:0.0:0.0	.	670;670;609	Q05193;Q05193-3;B4DHH5	DYN1_HUMAN;.;.	V	670;670;670;670;670;215	ENSP00000419225:M670V;ENSP00000345680:M670V;ENSP00000362014:M670V;ENSP00000377219:M670V;ENSP00000420045:M670V	ENSP00000345680:M670V	M	+	1	0	DNM1	130050785	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	7.232000	0.78116	1.975000	0.57531	0.528000	0.53228	ATG		0.542	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408		Missense_Mutation
DXO	1797	hgsc.bcm.edu	37	6	31937677	31937677	+	Missense_Mutation	SNP	G	G	T	rs192273589		TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:31937677G>T	ENST00000375349.3	-	7	1579	c.1168C>A	c.(1168-1170)Ccc>Acc	p.P390T	DXO_ENST00000478221.1_5'UTR|STK19_ENST00000375333.2_5'Flank|DXO_ENST00000375356.3_Missense_Mutation_p.P390T|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000337523.5_Missense_Mutation_p.P390T			O77932	DXO_HUMAN	decapping exoribonuclease	390					metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										GGAGTCTTGGGGGGTGATGGG	0.507																																																0			6											54.0	57.0	56.0					6																	31937677		2203	4300	6503	32045656	SO:0001583	missense	1797			AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.1168C>A	6.37:g.31937677G>T	ENSP00000364498:p.Pro390Thr	Somatic		Capture	SOLID	Phase_IV	32045656	A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Missense_Mutation	SNP	ENST00000375349.3	37	CCDS4732.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761218	0.31137	.	.	ENSG00000204348	ENST00000337523;ENST00000375349;ENST00000375356	T;T;T	0.16457	2.34;2.34;2.34	5.69	4.81	0.61882	.	0.332809	0.24154	N	0.041056	T	0.04318	0.0119	L	0.44542	1.39	0.28384	N	0.919389	B	0.10296	0.003	B	0.09377	0.004	T	0.38950	-0.9637	10	0.05833	T	0.94	-10.8267	12.7063	0.57061	0.0817:0.0:0.9183:0.0	.	390	O77932	DOM3Z_HUMAN	T	390	ENSP00000337759:P390T;ENSP00000364498:P390T;ENSP00000364505:P390T	ENSP00000337759:P390T	P	-	1	0	DOM3Z	32045656	0.926000	0.31397	0.913000	0.36048	0.672000	0.39443	0.508000	0.22692	1.372000	0.46190	0.655000	0.94253	CCC		0.507	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076592.3			Missense_Mutation
DXO	1797	hgsc.bcm.edu	37	6	31939279	31939279	+	Silent	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:31939279G>T	ENST00000375349.3	-	2	585	c.174C>A	c.(172-174)cgC>cgA	p.R58R	DXO_ENST00000478221.1_Intron|STK19_ENST00000375333.2_5'Flank|DXO_ENST00000375356.3_Silent_p.R58R|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000337523.5_Silent_p.R58R			O77932	DXO_HUMAN	decapping exoribonuclease	58					metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										CATGGTACTGGCGTTGAGCAT	0.612																																																0			6											77.0	80.0	79.0					6																	31939279		2203	4300	6503	32047258	SO:0001819	synonymous_variant	1797			AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.174C>A	6.37:g.31939279G>T		Somatic		Capture	SOLID	Phase_IV	32047258	A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Silent	SNP	ENST00000375349.3	37	CCDS4732.1	SNP	42	Baylor																																																																																				0.612	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076592.3			Silent
DPEP3	64180	hgsc.bcm.edu	37	16	68009858	68009859	+	Frame_Shift_Ins	INS	-	-	A			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:68009858_68009859insA	ENST00000268793.4	-	10	1724_1725	c.1351_1352insT	c.(1351-1353)ccafs	p.P451fs	DPEP3_ENST00000574342.1_5'Flank	NM_001129758.1|NM_022357.3	NP_001123230.1|NP_071752.3	Q9H4B8	DPEP3_HUMAN	dipeptidase 3	426					male meiosis (GO:0007140)	anchored component of membrane (GO:0031225)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)	p.P451fs*>64(1)		breast(4)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		TTGCCCATATGGAAACTCAGCC	0.609																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								66567360	SO:0001589	frameshift_variant	64180			AJ291679	CCDS10856.1	16q22.1	2011-07-22			ENSG00000141096	ENSG00000141096	3.4.13.19		23029	protein-coding gene	gene with protein product		609926					Standard	NM_022357		Approved		uc002evc.4	Q9H4B8	OTTHUMG00000137544	ENST00000268793.4:c.1351_1352insT	16.37:g.68009858_68009859insA	ENSP00000268793:p.Pro451fs	Somatic		Capture	SOLID	Phase_IV	66567359	B3KQ48|Q6PEZ5|Q6UXE4	Frame_Shift_Ins	INS	ENST00000268793.4	37	CCDS10856.1	INS	47	Baylor																																																																																				0.609	DPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268875.3	NM_022357		Frame_Shift_Ins
DRG2	1819	hgsc.bcm.edu	37	17	18003917	18003920	+	Frame_Shift_Del	DEL	CAGT	CAGT	-	rs143296623	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	CAGT	CAGT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:18003917_18003920delCAGT	ENST00000225729.3	+	7	713_716	c.575_578delCAGT	c.(574-579)acagtcfs	p.TV192fs	DRG2_ENST00000395726.4_Frame_Shift_Del_p.TV192fs|DRG2_ENST00000583355.1_Intron	NM_001388.4	NP_001379.1	P55039	DRG2_HUMAN	developmentally regulated GTP binding protein 2	192	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.V193fs*2(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	14	all_neural(463;0.228)					TTTAACTCGACAGTCACGCTGACC	0.559																																																1	Deletion - Frameshift(1)	ovary(1)	17																																								17944645	SO:0001589	frameshift_variant	1819			X80754	CCDS11191.1	17p13-p12	2008-07-18	2001-11-28		ENSG00000108591	ENSG00000108591			3030	protein-coding gene	gene with protein product		602986	"""developmentally regulated GTP-binding protein 2"""			9605870, 7929244	Standard	NM_001388		Approved		uc002gsh.2	P55039	OTTHUMG00000059399	ENST00000225729.3:c.575_578delCAGT	17.37:g.18003917_18003920delCAGT	ENSP00000225729:p.Thr192fs	Somatic		Capture	SOLID	Phase_IV	17944642	B2R8G5|Q53Y50|Q9BWB2	Frame_Shift_Del	DEL	ENST00000225729.3	37	CCDS11191.1	DEL	17	Baylor																																																																																				0.559	DRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132075.3	NM_001388		Frame_Shift_Del
DYSF	8291	hgsc.bcm.edu	37	2	71795346	71795346	+	Silent	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:71795346A>C	ENST00000258104.3	+	26	2965	c.2688A>C	c.(2686-2688)acA>acC	p.T896T	DYSF_ENST00000410020.3_Silent_p.T914T|DYSF_ENST00000409582.3_Silent_p.T913T|DYSF_ENST00000413539.2_Silent_p.T927T|DYSF_ENST00000429174.2_Silent_p.T896T|DYSF_ENST00000409762.1_Silent_p.T913T|DYSF_ENST00000409744.1_Silent_p.T883T|DYSF_ENST00000410041.1_Silent_p.T914T|DYSF_ENST00000394120.2_Silent_p.T897T|DYSF_ENST00000409366.1_Silent_p.T897T|DYSF_ENST00000409651.1_Silent_p.T928T	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	896					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						ACTGGGGCACAACGGGCCTCA	0.602																																																0			2											150.0	152.0	152.0					2																	71795346		2203	4300	6503	71648854	SO:0001819	synonymous_variant	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2688A>C	2.37:g.71795346A>C		Somatic		Capture	SOLID	Phase_IV	71648854	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1	SNP	5	Baylor																																																																																				0.602	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494		Silent
ECEL1	9427	hgsc.bcm.edu	37	2	233347595	233347596	+	Frame_Shift_Del	DEL	CT	CT	-	rs202046121		TCGA-23-1120-01	TCGA-23-1120-10	CT	CT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:233347595_233347596delCT	ENST00000304546.1	-	10	1860_1861	c.1650_1651delAG	c.(1648-1653)tcagttfs	p.V551fs	ECEL1_ENST00000409941.1_Frame_Shift_Del_p.V551fs	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	551					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)	p.V551fs*1(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ATCTTCTTAACTGAGAGCTGGA	0.584																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								233055840	SO:0001589	frameshift_variant	9427			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1650_1651delAG	2.37:g.233347595_233347596delCT	ENSP00000302051:p.Val551fs	Somatic		Capture	SOLID	Phase_IV	233055839	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Frame_Shift_Del	DEL	ENST00000304546.1	37	CCDS2493.1	DEL	20	Baylor																																																																																				0.584	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826		Frame_Shift_Del
ESPL1	9700	hgsc.bcm.edu	37	12	53663734	53663734	+	Silent	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:53663734G>A	ENST00000257934.4	+	3	1099	c.1008G>A	c.(1006-1008)ttG>ttA	p.L336L	ESPL1_ENST00000552462.1_Silent_p.L336L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	336					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TTCGGGCATTGTATGAGAGCT	0.542																																					Colon(53;1069 1201 2587 5382)											0			12											75.0	79.0	78.0					12																	53663734		2203	4300	6503	51950001	SO:0001819	synonymous_variant	9700			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1008G>A	12.37:g.53663734G>A		Somatic		Capture	SOLID	Phase_IV	51950001		Silent	SNP	ENST00000257934.4	37	CCDS8852.1	SNP	48	Baylor																																																																																				0.542	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291		Silent
EXOSC10	5394	hgsc.bcm.edu	37	1	11141255	11141255	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:11141255T>G	ENST00000376936.4	-	11	1370	c.1321A>C	c.(1321-1323)Acc>Ccc	p.T441P	EXOSC10_ENST00000485606.1_5'UTR|EXOSC10_ENST00000304457.7_Missense_Mutation_p.T441P|EXOSC10_ENST00000544779.1_Missense_Mutation_p.T441P	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	441					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		AGGTAATGGGTGTCATCCCGG	0.552																																					Colon(179;105 1987 14326 27364 29542)											0			1											85.0	84.0	84.0					1																	11141255		2203	4300	6503	11063842	SO:0001583	missense	5394			BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1321A>C	1.37:g.11141255T>G	ENSP00000366135:p.Thr441Pro	Somatic		Capture	SOLID	Phase_IV	11063842	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	37	CCDS30584.1	SNP	59	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.85	3.903252	0.72754	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	T;T;T	0.68181	-0.31;-0.31;-0.31	5.77	5.77	0.91146	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.88317	0.6404	H	0.97516	4.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92253	0.5810	10	0.87932	D	0	-23.8875	15.5753	0.76373	0.0:0.0:0.0:1.0	.	441;441	Q01780-2;Q01780	.;EXOSX_HUMAN	P	441	ENSP00000366135:T441P;ENSP00000307307:T441P;ENSP00000439473:T441P	ENSP00000307307:T441P	T	-	1	0	EXOSC10	11063842	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	7.997000	0.88414	2.326000	0.78906	0.533000	0.62120	ACC		0.552	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998		Missense_Mutation
FAM193B	54540	hgsc.bcm.edu	37	5	176963526	176963526	+	Silent	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:176963526A>C	ENST00000514747.1	-	4	957	c.909T>G	c.(907-909)acT>acG	p.T303T	FAM193B_ENST00000329540.5_5'UTR|FAM193B_ENST00000443375.2_Silent_p.T190T|FAM193B_ENST00000508298.1_Intron	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	303	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						ATGGCCCTGGAGTGTGGGGGG	0.677																																																0			5											13.0	16.0	15.0					5																	176963526		2049	4189	6238	176896132	SO:0001819	synonymous_variant	54540				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.909T>G	5.37:g.176963526A>C		Somatic		Capture	SOLID	Phase_IV	176896132	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	37	CCDS54954.1	SNP	11	Baylor																																																																																				0.677	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057		Silent
FOSB	2354	hgsc.bcm.edu	37	19	45976079	45976079	+	Silent	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:45976079C>T	ENST00000353609.3	+	4	1418	c.826C>T	c.(826-828)Ctg>Ttg	p.L276L	FOSB_ENST00000592811.1_Intron|FOSB_ENST00000417353.2_Silent_p.L240L|FOSB_ENST00000586615.1_Silent_p.L227L|FOSB_ENST00000443841.2_Silent_p.L133L|FOSB_ENST00000585836.1_Silent_p.L201L|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000592436.1_Intron|FOSB_ENST00000591858.1_Silent_p.L237L	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	276					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		ACCCCCCAACCTGACGGCTTC	0.617																																																0			19											62.0	58.0	60.0					19																	45976079		2203	4300	6503	50667919	SO:0001819	synonymous_variant	2354				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.826C>T	19.37:g.45976079C>T		Somatic		Capture	SOLID	Phase_IV	50667919	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Silent	SNP	ENST00000353609.3	37	CCDS12664.1	SNP	24	Baylor																																																																																				0.617	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459561.1	NM_006732		Silent
FRMPD1	22844	hgsc.bcm.edu	37	9	37745493	37745494	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-23-1120-01	TCGA-23-1120-10	GT	GT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:37745493_37745494delGT	ENST00000539465.1	+	16	4057_4058	c.3464_3465delGT	c.(3463-3465)ggtfs	p.G1155fs	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Frame_Shift_Del_p.G1155fs			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1155						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.G1155fs*24(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TCTCCAGCTGGTAAAATAGTAA	0.49																																																1	Deletion - Frameshift(1)	ovary(1)	9																																								37735494	SO:0001589	frameshift_variant	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3464_3465delGT	9.37:g.37745493_37745494delGT	ENSP00000444411:p.Gly1155fs	Somatic		Capture	SOLID	Phase_IV	37735493	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Frame_Shift_Del	DEL	ENST00000539465.1	37	CCDS6612.1	DEL	44	Baylor																																																																																				0.490	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		Frame_Shift_Del
FYB	2533	hgsc.bcm.edu	37	5	39202368	39202368	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:39202368C>G	ENST00000351578.6	-	2	885	c.695G>C	c.(694-696)aGg>aCg	p.R232T	FYB_ENST00000515010.1_Missense_Mutation_p.R232T|FYB_ENST00000505428.1_Missense_Mutation_p.R232T|FYB_ENST00000540520.1_Missense_Mutation_p.R242T|FYB_ENST00000512982.1_Missense_Mutation_p.R232T	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	232					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)	p.R232T(1)		endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GCTTTTGGACCTGACTCCCAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	5											78.0	78.0	78.0					5																	39202368		1837	4081	5918	39238125	SO:0001583	missense	2533			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.695G>C	5.37:g.39202368C>G	ENSP00000316460:p.Arg232Thr	Somatic		Capture	SOLID	Phase_IV	39238125	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	37	CCDS47200.1	SNP	24	Baylor	.	.	.	.	.	.	.	.	.	.	C	6.971	0.549092	0.13312	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8	6.07	2.36	0.29203	.	0.863259	0.10719	N	0.642006	T	0.14743	0.0356	N	0.14661	0.345	0.09310	N	1	B;B	0.28128	0.201;0.201	B;B	0.27608	0.037;0.081	T	0.32561	-0.9902	10	0.25751	T	0.34	-2.9495	8.9822	0.35972	0.0:0.3638:0.0:0.6362	.	242;232	B4DLN2;O15117	.;FYB_HUMAN	T	232;232;232;232;242;232	ENSP00000316460:R232T;ENSP00000426346:R232T;ENSP00000425845:R232T;ENSP00000427114:R232T;ENSP00000442840:R242T	ENSP00000316460:R232T	R	-	2	0	FYB	39238125	0.819000	0.29175	0.018000	0.16275	0.201000	0.24016	0.986000	0.29590	0.175000	0.19841	0.655000	0.94253	AGG		0.507	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465		Missense_Mutation
GADD45B	4616	hgsc.bcm.edu	37	19	2477147	2477148	+	Frame_Shift_Ins	INS	-	-	G			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:2477147_2477148insG	ENST00000215631.4	+	3	499_500	c.267_268insG	c.(268-270)gtgfs	p.V90fs	GADD45B_ENST00000587345.1_Frame_Shift_Ins_p.V90fs	NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	90					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V90fs*>72(1)		cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACATCAACATCGTGCGGGTGTC	0.624											OREG0025141	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Insertion - Frameshift(1)	ovary(1)	19																																								2428148	SO:0001589	frameshift_variant	4616			AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.268dupG	19.37:g.2477148_2477148dupG	ENSP00000215631:p.Val90fs	Somatic	603	Capture	SOLID	Phase_IV	2428147	A8KAM2|O75960|Q17R46	Frame_Shift_Ins	INS	ENST00000215631.4	37	CCDS32868.1	INS	31	Baylor																																																																																				0.624	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451337.1	NM_015675		Frame_Shift_Ins
GLG1	2734	hgsc.bcm.edu	37	16	74499603	74499603	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:74499603G>A	ENST00000422840.2	-	19	2637	c.2638C>T	c.(2638-2640)Ctc>Ttc	p.L880F	GLG1_ENST00000447066.2_Missense_Mutation_p.L869F|GLG1_ENST00000205061.5_Missense_Mutation_p.L880F|Y_RNA_ENST00000384794.1_RNA	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	880					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.L880F(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						ACCCTCATGAGGGTGTAGTCT	0.478																																																1	Substitution - Missense(1)	ovary(1)	16											212.0	204.0	207.0					16																	74499603		2198	4300	6498	73057104	SO:0001583	missense	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2638C>T	16.37:g.74499603G>A	ENSP00000405984:p.Leu880Phe	Somatic		Capture	SOLID	Phase_IV	73057104	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	SNP	35	Baylor	.	.	.	.	.	.	.	.	.	.	G	33	5.200250	0.94997	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.75737	0.3890	M	0.71581	2.175	0.80722	D	1	B;P;P;D	0.54207	0.235;0.91;0.811;0.965	B;P;P;P	0.55345	0.285;0.737;0.618;0.774	T	0.75510	-0.3292	9	0.54805	T	0.06	-18.2125	20.3789	0.98926	0.0:0.0:1.0:0.0	.	10;880;880;869	Q6ZMF1;Q92896;Q92896-2;B7Z8Y4	.;GSLG1_HUMAN;.;.	F	880;869;880	.	ENSP00000205061:L880F	L	-	1	0	GLG1	73057104	1.000000	0.71417	0.986000	0.45419	0.971000	0.66376	9.505000	0.97989	2.826000	0.97356	0.563000	0.77884	CTC		0.478	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201		Missense_Mutation
GLI1	2735	hgsc.bcm.edu	37	12	57865802	57865802	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:57865802A>T	ENST00000228682.2	+	12	3370	c.3279A>T	c.(3277-3279)agA>agT	p.R1093S	GLI1_ENST00000546141.1_Missense_Mutation_p.R1052S|GLI1_ENST00000543426.1_Missense_Mutation_p.R965S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	1093					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.R1093S(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			TCTTACTGAGATCCCTACCTG	0.532																																					Pancreas(157;841 1936 10503 41495 50368)											1	Substitution - Missense(1)	ovary(1)	12											68.0	69.0	69.0					12																	57865802		2203	4300	6503	56152069	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.3279A>T	12.37:g.57865802A>T	ENSP00000228682:p.Arg1093Ser	Somatic		Capture	SOLID	Phase_IV	56152069	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	10.42	1.344005	0.24339	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.11063	2.92;2.81;2.88;2.88	5.22	-2.5	0.06384	.	0.151192	0.31082	N	0.008282	T	0.02418	0.0074	N	0.01874	-0.695	0.23162	N	0.99819	B	0.02656	0.0	B	0.04013	0.001	T	0.37549	-0.9701	10	0.20046	T	0.44	.	2.1559	0.03811	0.2367:0.1259:0.3927:0.2447	.	1093	P08151	GLI1_HUMAN	S	965;1093;1052;1052;561	ENSP00000437607:R965S;ENSP00000228682:R1093S;ENSP00000441006:R1052S;ENSP00000434408:R1052S	ENSP00000228682:R1093S	R	+	3	2	GLI1	56152069	0.975000	0.34042	0.982000	0.44146	0.677000	0.39632	0.130000	0.15850	-0.279000	0.09167	-0.250000	0.11733	AGA		0.532	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		Missense_Mutation
GRIN3A	116443	hgsc.bcm.edu	37	9	104375703	104375703	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:104375703C>A	ENST00000361820.3	-	6	3321	c.2721G>T	c.(2719-2721)tgG>tgT	p.W907C	GRIN3A_ENST00000479772.1_5'UTR	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	907					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.W907C(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CCACCCTGTACCACTTGTCAT	0.478																																																1	Substitution - Missense(1)	ovary(1)	9											180.0	140.0	153.0					9																	104375703		2203	4300	6503	103415524	SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2721G>T	9.37:g.104375703C>A	ENSP00000355155:p.Trp907Cys	Somatic		Capture	SOLID	Phase_IV	103415524	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	SNP	18	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362936	0.82353	.	.	ENSG00000198785	ENST00000361820	T	0.42131	0.98	5.2	5.2	0.72013	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80067	-0.1537	10	0.87932	D	0	.	19.0971	0.93257	0.0:1.0:0.0:0.0	.	907	Q8TCU5	NMD3A_HUMAN	C	907	ENSP00000355155:W907C	ENSP00000355155:W907C	W	-	3	0	GRIN3A	103415524	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.445000	0.80570	2.586000	0.87340	0.655000	0.94253	TGG		0.478	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1			Missense_Mutation
GSG2	83903	hgsc.bcm.edu	37	17	3628811	3628811	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:3628811A>T	ENST00000325418.4	+	1	1601	c.1582A>T	c.(1582-1584)Acc>Tcc	p.T528S	ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	528	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										CCATCAGAAAACCTTTGAGGA	0.448																																																0			17											74.0	70.0	71.0					17																	3628811		2203	4300	6503	3575560	SO:0001583	missense	83903			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1582A>T	17.37:g.3628811A>T	ENSP00000325290:p.Thr528Ser	Somatic		Capture	SOLID	Phase_IV	3575560	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542387	0.45280	.	.	ENSG00000177602	ENST00000325418	T	0.63913	-0.07	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45361	D	0.000367	T	0.47210	0.1433	N	0.12831	0.26	0.48762	D	0.999706	B	0.20887	0.049	B	0.29440	0.102	T	0.50608	-0.8808	10	0.87932	D	0	-16.2578	12.8971	0.58106	1.0:0.0:0.0:0.0	.	528	Q8TF76	HASP_HUMAN	S	528	ENSP00000325290:T528S	ENSP00000325290:T528S	T	+	1	0	GSG2	3575560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.977000	0.63792	2.139000	0.66308	0.533000	0.62120	ACC		0.448	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965		Missense_Mutation
GSDMB	55876	hgsc.bcm.edu	37	17	38063235	38063235	+	Intron	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:38063235C>A	ENST00000394179.1	-	7	843				GSDMB_ENST00000360317.3_Missense_Mutation_p.D236Y|GSDMB_ENST00000394175.2_Intron|GSDMB_ENST00000309481.7_Missense_Mutation_p.D223Y|GSDMB_ENST00000418519.1_Missense_Mutation_p.D236Y|GSDMB_ENST00000520542.1_Intron			Q8TAX9	GSDMB_HUMAN	gasdermin B							cytoplasm (GO:0005737)				breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						GAAGCACCATCCTTCTCTGCA	0.498																																																0			17											108.0	105.0	106.0					17																	38063235		1991	4160	6151	35316761	SO:0001627	intron_variant	55876			AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.713-711G>T	17.37:g.38063235C>A		Somatic		Capture	SOLID	Phase_IV	35316761	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Missense_Mutation	SNP	ENST00000394179.1	37		SNP	30	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.35|10.35	1.324803|1.324803	0.24080|0.24080	.|.	.|.	ENSG00000073605|ENSG00000073605	ENST00000309481;ENST00000418519|ENST00000420491	T;T|.	0.21191|.	3.09;2.02|.	3.54|3.54	3.54|3.54	0.40534|0.40534	.|.	.|.	.|.	.|.	.|.	T|T	0.51856|0.51856	0.1699|0.1699	L|L	0.44542|0.44542	1.39|1.39	0.34599|0.34599	D|D	0.716311|0.716311	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.67382|.	0.917;0.951|.	T|T	0.60296|0.60296	-0.7291|-0.7291	9|5	0.66056|.	D|.	0.02|.	.|.	10.9149|10.9149	0.47131|0.47131	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	236;223|.	Q8TAX9-4;Q8TAX9-3|.	.;.|.	Y|S	223;236|167	ENSP00000312584:D223Y;ENSP00000415049:D236Y|.	ENSP00000312584:D223Y|.	D|R	-|-	1|3	0|2	GSDMB|GSDMB	35316761|35316761	0.000000|0.000000	0.05858|0.05858	0.004000|0.004000	0.12327|0.12327	0.399000|0.399000	0.30720|0.30720	0.564000|0.564000	0.23563|0.23563	2.278000|2.278000	0.76064|0.76064	0.609000|0.609000	0.83330|0.83330	GAT|AGG		0.498	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530		Missense_Mutation
IQSEC2	23096	hgsc.bcm.edu	37	X	53279530	53279530	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chrX:53279530T>G	ENST00000375368.5	-	4	2398	c.2198A>C	c.(2197-2199)gAc>gCc	p.D733A	IQSEC2_ENST00000396435.3_Missense_Mutation_p.D743A|IQSEC2_ENST00000375365.2_Missense_Mutation_p.D538A			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	733					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						AGCTGGCGAGTCCCAGCTATG	0.592																																																0			X											77.0	58.0	64.0					X																	53279530		2203	4300	6503	53296255	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2198A>C	X.37:g.53279530T>G	ENSP00000364517:p.Asp733Ala	Somatic		Capture	SOLID	Phase_IV	53296255	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		SNP	58	Baylor	.	.	.	.	.	.	.	.	.	.	t	19.54	3.846637	0.71603	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.14516	2.5;2.5;2.58	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	L	0.52905	1.665	0.58432	D	0.999999	B;D	0.89917	0.257;1.0	B;D	0.85130	0.204;0.997	T	0.02533	-1.1145	10	0.66056	D	0.02	.	12.4858	0.55872	0.0:0.0:0.0:1.0	.	743;538	Q5JU85-2;Q5JU85-3	.;.	A	743;733;538	ENSP00000379712:D743A;ENSP00000364517:D733A;ENSP00000364514:D538A	ENSP00000364514:D538A	D	-	2	0	IQSEC2	53296255	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.946000	0.87746	1.583000	0.49898	0.483000	0.47432	GAC		0.592	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		Missense_Mutation
IRF6	3664	hgsc.bcm.edu	37	1	209964112	209964112	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:209964112T>A	ENST00000367021.3	-	7	960	c.788A>T	c.(787-789)gAg>gTg	p.E263V	IRF6_ENST00000542854.1_Missense_Mutation_p.E168V	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	263					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		AAAGAGCTCCTCCTGGTCAGG	0.567										HNSCC(57;0.16)																																						0			1											71.0	69.0	70.0					1																	209964112		2203	4300	6503	208030735	SO:0001583	missense	3664			AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.788A>T	1.37:g.209964112T>A	ENSP00000355988:p.Glu263Val	Somatic		Capture	SOLID	Phase_IV	208030735	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	CCDS1492.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.56	3.157051	0.57259	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.94184	-3.33;-3.33;-3.37	6.17	6.17	0.99709	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.186793	0.32593	U	0.005886	D	0.89206	0.6649	N	0.25060	0.705	0.80722	D	1	B	0.22146	0.065	B	0.31101	0.124	D	0.85057	0.0932	9	.	.	.	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	263	O14896	IRF6_HUMAN	V	263;168;263	ENSP00000355988:E263V;ENSP00000440532:E168V;ENSP00000403855:E263V	.	E	-	2	0	IRF6	208030735	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	5.681000	0.68175	2.371000	0.80710	0.533000	0.62120	GAG		0.567	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147		Missense_Mutation
KAT2A	2648	hgsc.bcm.edu	37	17	40272303	40272303	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:40272303G>C	ENST00000225916.5	-	3	602	c.549C>G	c.(547-549)ttC>ttG	p.F183L	CTD-2132N18.3_ENST00000592574.1_Missense_Mutation_p.F217L|HSPB9_ENST00000355067.3_5'Flank	NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	183					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GAACAGACATGAAGAGATTCT	0.502																																																0			17											157.0	145.0	149.0					17																	40272303		2203	4300	6503	37525829	SO:0001583	missense	2648			AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.549C>G	17.37:g.40272303G>C	ENSP00000225916:p.Phe183Leu	Somatic		Capture	SOLID	Phase_IV	37525829	Q8N1A2|Q9UCW1	Missense_Mutation	SNP	ENST00000225916.5	37	CCDS11417.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983101	0.53827	.	.	ENSG00000108773	ENST00000225916	T	0.04809	3.55	5.92	3.94	0.45596	PCAF, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.06962	0.0177	L	0.53249	1.67	0.58432	D	0.999999	B	0.17038	0.02	B	0.20384	0.029	T	0.13980	-1.0489	10	0.45353	T	0.12	-22.2127	12.3014	0.54876	0.1362:0.0:0.8638:0.0	.	183	Q92830	KAT2A_HUMAN	L	183	ENSP00000225916:F183L	ENSP00000225916:F183L	F	-	3	2	KAT2A	37525829	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.870000	0.39529	1.518000	0.48934	-0.291000	0.09656	TTC		0.502	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078		Missense_Mutation
KAZALD1	81621	hgsc.bcm.edu	37	10	102824042	102824042	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:102824042A>G	ENST00000370200.5	+	3	862	c.536A>G	c.(535-537)tAt>tGt	p.Y179C		NM_030929.4	NP_112191.2	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	179	Ig-like C2-type.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|regulation of cell growth (GO:0001558)	interstitial matrix (GO:0005614)				endometrium(1)|ovary(1)|prostate(2)	4				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		TCACATCCATATGACACTTGG	0.542																																																0			10											76.0	66.0	70.0					10																	102824042		2203	4300	6503	102814032	SO:0001583	missense	81621			AF333487	CCDS7509.1	10q24.32	2013-01-11	2005-08-17		ENSG00000107821	ENSG00000107821		"""Immunoglobulin superfamily / I-set domain containing"""	25460	protein-coding gene	gene with protein product		609208	"""Kazal-type serine protease inhibitor domain 1"""			12975309	Standard	NM_030929		Approved	FKSG40, FKSG28	uc001ksr.3	Q96I82	OTTHUMG00000018918	ENST00000370200.5:c.536A>G	10.37:g.102824042A>G	ENSP00000359219:p.Tyr179Cys	Somatic		Capture	SOLID	Phase_IV	102814032	D3DR74|Q6ZMB1|Q9BQ73	Missense_Mutation	SNP	ENST00000370200.5	37	CCDS7509.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115708	0.37339	.	.	ENSG00000107821	ENST00000313664;ENST00000370200	T	0.66995	-0.24	5.85	0.231	0.15377	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.808751	0.11874	N	0.521180	T	0.61515	0.2353	L	0.27053	0.805	0.09310	N	1	D	0.61697	0.99	P	0.56788	0.806	T	0.51576	-0.8688	10	0.56958	D	0.05	.	5.6242	0.17473	0.644:0.0:0.1367:0.2194	.	179	Q96I82	KAZD1_HUMAN	C	179	ENSP00000359219:Y179C	ENSP00000313288:Y179C	Y	+	2	0	KAZALD1	102814032	0.005000	0.15991	0.002000	0.10522	0.369000	0.29798	1.983000	0.40648	0.096000	0.17463	0.459000	0.35465	TAT		0.542	KAZALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049891.2	NM_030929		Missense_Mutation
KCNA6	3742	hgsc.bcm.edu	37	12	4919495	4919496	+	Frame_Shift_Ins	INS	-	-	A	rs570806842|rs533147484		TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:4919495_4919496insA	ENST00000280684.3	+	1	1154_1155	c.288_289insA	c.(289-291)ctcfs	p.L97fs	KCNA6_ENST00000433855.1_Frame_Shift_Ins_p.L97fs|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	97					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.L97fs*69(1)		NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	TCGACGCCATCCTCTACTACTA	0.653										HNSCC(72;0.22)																																						1	Insertion - Frameshift(1)	ovary(1)	12																																								4789757	SO:0001589	frameshift_variant	3742			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		Exception_encountered	12.37:g.4919495_4919496insA	ENSP00000280684:p.Leu97fs	Somatic		Capture	SOLID	Phase_IV	4789756		Frame_Shift_Ins	INS	ENST00000280684.3	37	CCDS8534.1	INS	30	Baylor																																																																																				0.653	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		Frame_Shift_Ins
KCNA6	3742	hgsc.bcm.edu	37	12	4919678	4919679	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-23-1120-01	TCGA-23-1120-10	GC	GC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:4919678_4919679delGC	ENST00000280684.3	+	1	1337_1338	c.471_472delGC	c.(469-474)cagcgcfs	p.R158fs	KCNA6_ENST00000433855.1_Frame_Shift_Del_p.R158fs|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	158					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.R158fs*7(1)		NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	AGCCCTTCCAGCGCCAGGTGTG	0.658										HNSCC(72;0.22)																																						1	Deletion - Frameshift(1)	ovary(1)	12																																								4789940	SO:0001589	frameshift_variant	3742			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.471_472delGC	12.37:g.4919680_4919681delGC	ENSP00000280684:p.Arg158fs	Somatic		Capture	SOLID	Phase_IV	4789939		Frame_Shift_Del	DEL	ENST00000280684.3	37	CCDS8534.1	DEL	34	Baylor																																																																																				0.658	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		Frame_Shift_Del
KCNJ12	3768	hgsc.bcm.edu	37	17	21318948	21318948	+	Silent	SNP	C	C	T	rs112314728		TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:21318948C>T	ENST00000583088.1	+	3	1189	c.294C>T	c.(292-294)ttC>ttT	p.F98F	KCNJ12_ENST00000331718.5_Silent_p.F98F	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	98					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.F98F(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GGCTGCTGTTCGGCATCATCT	0.632										Prostate(3;0.18)																																						1	Substitution - coding silent(1)	large_intestine(1)	17											126.0	81.0	96.0					17																	21318948		2203	4300	6503	21259541	SO:0001819	synonymous_variant	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.294C>T	17.37:g.21318948C>T		Somatic		Capture	SOLID	Phase_IV	21259541	O43401|Q15756|Q8NG63	Silent	SNP	ENST00000583088.1	37	CCDS11219.1	SNP	31	Baylor																																																																																				0.632	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012		Silent
KIAA1109	84162	hgsc.bcm.edu	37	4	123117898	123117898	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr4:123117898G>A	ENST00000264501.4	+	12	1534	c.1161G>A	c.(1159-1161)atG>atA	p.M387I	KIAA1109_ENST00000455637.1_Missense_Mutation_p.M387I|KIAA1109_ENST00000388738.3_Missense_Mutation_p.M387I			Q2LD37	K1109_HUMAN	KIAA1109	387					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.M387I(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AATTACGAATGAATATTATTG	0.303																																																1	Substitution - Missense(1)	ovary(1)	4											114.0	107.0	109.0					4																	123117898		1803	4066	5869	123337348	SO:0001583	missense	84162			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1161G>A	4.37:g.123117898G>A	ENSP00000264501:p.Met387Ile	Somatic		Capture	SOLID	Phase_IV	123337348	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	SNP	45	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.94|19.94	3.919611|3.919611	0.73098|0.73098	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000424425|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.19669	.|2.72;2.72;2.13	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|3.263340	.|0.01230	.|N	.|0.008336	T|T	0.36580|0.36580	0.0972|0.0972	N|N	0.20530|0.20530	0.585|0.585	0.80722|0.80722	D|D	1|1	.|P	.|0.50528	.|0.936	.|P	.|0.61201	.|0.885	T|T	0.47433|0.47433	-0.9118|-0.9118	5|10	.|0.11794	.|T	.|0.64	.|.	19.7617|19.7617	0.96321|0.96321	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|387	.|Q2LD37	.|K1109_HUMAN	K|I	220|387	.|ENSP00000264501:M387I;ENSP00000373390:M387I;ENSP00000389925:M387I	.|ENSP00000264501:M387I	E|M	+|+	1|3	0|0	KIAA1109|KIAA1109	123337348|123337348	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.753000|9.753000	0.98904|0.98904	2.671000|2.671000	0.90904|0.90904	0.655000|0.655000	0.94253|0.94253	GAA|ATG		0.303	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797		Missense_Mutation
EPG5	57724	hgsc.bcm.edu	37	18	43496072	43496072	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr18:43496072C>G	ENST00000282041.5	-	19	3518	c.3484G>C	c.(3484-3486)Gaa>Caa	p.E1162Q	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1162					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.E1162Q(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ATAGGTTGTTCTCGGTACCAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	18											71.0	69.0	70.0					18																	43496072		1940	4139	6079	41750070	SO:0001583	missense	57724			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3484G>C	18.37:g.43496072C>G	ENSP00000282041:p.Glu1162Gln	Somatic		Capture	SOLID	Phase_IV	41750070	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	SNP	32	Baylor	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829795	0.91036	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.10192	2.9	5.92	5.92	0.95590	.	0.370981	0.30428	N	0.009644	T	0.25158	0.0611	L	0.43152	1.355	0.58432	D	0.999998	D;D	0.61080	0.989;0.976	P;P	0.58266	0.836;0.743	T	0.00045	-1.2215	10	0.72032	D	0.01	-17.6143	20.3214	0.98679	0.0:1.0:0.0:0.0	.	1162;1162	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	Q	1162;37	ENSP00000282041:E1162Q	ENSP00000282041:E1162Q	E	-	1	0	EPG5	41750070	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	7.599000	0.82757	2.804000	0.96469	0.655000	0.94253	GAA		0.483	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964		Missense_Mutation
CFAP74	85452	hgsc.bcm.edu	37	1	1920336	1920337	+	In_Frame_Ins	INS	-	-	CCC			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:1920336_1920337insCCC	ENST00000434971.2	-	3	175_176	c.143_144insGGG	c.(142-144)gga>ggGGGa	p.48_48G>GG				Q69YW0	CA222_HUMAN		274								p.G48_H49insG(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)	11	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACCTGCTGTGTCCCGGGTCCAC	0.584																																																1	Insertion - In frame(1)	ovary(1)	1																																								1910197	SO:0001652	inframe_insertion	85452																														ENST00000434971.2:c.141_143dupGGG	1.37:g.1920337_1920339dupCCC	ENSP00000408078:p.Gly48dup	Somatic		Capture	SOLID	Phase_IV	1910196		In_Frame_Ins	INS	ENST00000434971.2	37		INS	58	Baylor																																																																																				0.584	C1orf222-201	KNOWN	basic	protein_coding	protein_coding				In_Frame_Ins
SRRM4	84530	hgsc.bcm.edu	37	12	119583488	119583489	+	Frame_Shift_Ins	INS	-	-	C			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:119583488_119583489insC	ENST00000267260.4	+	9	1462_1463	c.1074_1075insC	c.(1075-1077)aggfs	p.R359fs		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	359	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.R359fs*67(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GCAGAGAGTCAAGGTCAGTGCA	0.594																																																1	Insertion - Frameshift(1)	ovary(1)	12																																								118067872	SO:0001589	frameshift_variant	84530			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	Exception_encountered	12.37:g.119583488_119583489insC	ENSP00000267260:p.Arg359fs	Somatic		Capture	SOLID	Phase_IV	118067871	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Frame_Shift_Ins	INS	ENST00000267260.4	37	CCDS44994.1	INS	5	Baylor																																																																																				0.594	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286		Frame_Shift_Ins
KIT	3815	hgsc.bcm.edu	37	4	55524245	55524245	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr4:55524245A>G	ENST00000288135.5	+	1	161	c.64A>G	c.(64-66)Aca>Gca	p.T22A		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	22					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T22A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCGCGTCCAGACAGGTGGGAC	0.667		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																													yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - Missense(1)	ovary(1)	4											45.0	46.0	45.0					4																	55524245		2203	4300	6503	55219002	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.64A>G	4.37:g.55524245A>G	ENSP00000288135:p.Thr22Ala	Somatic		Capture	SOLID	Phase_IV	55219002	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	4.599	0.111251	0.08831	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.76316	-1.01;-1.01	3.46	2.2	0.27929	Immunoglobulin-like fold (1);	0.245550	0.28343	N	0.015700	T	0.57562	0.2062	N	0.19112	0.55	0.47341	D	0.999396	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.38908	-0.9639	10	0.19590	T	0.45	.	6.6161	0.22778	0.7542:0.2458:0.0:0.0	.	22;22	P10721-2;P10721	.;KIT_HUMAN	A	22	ENSP00000288135:T22A;ENSP00000390987:T22A	ENSP00000288135:T22A	T	+	1	0	KIT	55219002	1.000000	0.71417	0.998000	0.56505	0.106000	0.19336	1.802000	0.38853	0.468000	0.27243	0.260000	0.18958	ACA		0.667	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1			Missense_Mutation
KRT77	374454	hgsc.bcm.edu	37	12	53096815	53096815	+	Missense_Mutation	SNP	C	C	G	rs377708946		TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:53096815C>G	ENST00000341809.3	-	1	432	c.404G>C	c.(403-405)gGc>gCc	p.G135A	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	135	Head.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.G135A(1)		NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTCTTGGATGCCCCCAGGAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											137.0	123.0	128.0					12																	53096815		2203	4300	6503	51383082	SO:0001583	missense	374454			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.404G>C	12.37:g.53096815C>G	ENSP00000342710:p.Gly135Ala	Somatic		Capture	SOLID	Phase_IV	51383082	Q7RTS8	Missense_Mutation	SNP	ENST00000341809.3	37	CCDS8837.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781795	0.49891	.	.	ENSG00000189182	ENST00000341809	D	0.98060	-4.69	4.4	4.4	0.53042	.	.	.	.	.	D	0.99042	0.9672	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99316	1.0905	9	0.87932	D	0	.	17.6072	0.88041	0.0:1.0:0.0:0.0	.	135	Q7Z794	K2C1B_HUMAN	A	135	ENSP00000342710:G135A	ENSP00000342710:G135A	G	-	2	0	KRT77	51383082	0.923000	0.31300	0.951000	0.38953	0.056000	0.15407	3.146000	0.50631	2.483000	0.83821	0.585000	0.79938	GGC		0.562	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078		Missense_Mutation
LIMCH1	22998	hgsc.bcm.edu	37	4	41686515	41686515	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr4:41686515C>G	ENST00000313860.7	+	22	2849	c.2795C>G	c.(2794-2796)aCa>aGa	p.T932R	LIMCH1_ENST00000511496.1_Missense_Mutation_p.T772R|LIMCH1_ENST00000513024.1_Missense_Mutation_p.T785R|LIMCH1_ENST00000512946.1_Missense_Mutation_p.T932R|LIMCH1_ENST00000381753.4_Missense_Mutation_p.T765R|LIMCH1_ENST00000396595.3_Missense_Mutation_p.T777R|LIMCH1_ENST00000512632.1_Missense_Mutation_p.T855R|LIMCH1_ENST00000503057.1_Missense_Mutation_p.T1316R|LIMCH1_ENST00000512820.1_Missense_Mutation_p.T944R|LIMCH1_ENST00000509277.1_Missense_Mutation_p.T765R|LIMCH1_ENST00000514096.1_Missense_Mutation_p.T772R|LIMCH1_ENST00000508501.1_Missense_Mutation_p.T931R	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	932					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.T932R(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						CACTGTGGAACAAACCCACAG	0.483																																																1	Substitution - Missense(1)	ovary(1)	4											49.0	46.0	47.0					4																	41686515		2203	4300	6503	41381272	SO:0001583	missense	22998			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.2795C>G	4.37:g.41686515C>G	ENSP00000316891:p.Thr932Arg	Somatic		Capture	SOLID	Phase_IV	41381272	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	SNP	17	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.921|6.921	0.539573|0.539573	0.13250|0.13250	.|.	.|.	ENSG00000064042|ENSG00000064042	ENST00000508466|ENST00000513024;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000503057;ENST00000511496;ENST00000313875;ENST00000514096;ENST00000509277;ENST00000396595;ENST00000381753;ENST00000537405	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.45276	.|0.9;1.5;1.5;1.51;0.91;1.47;0.9;0.92;0.91;0.91;0.91;0.91	5.37|5.37	0.45|0.45	0.16624|0.16624	.|.	.|1.596950	.|0.02786	.|N	.|0.121516	T|T	0.43897|0.43897	0.1268|0.1268	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;P;B;B;B;B;B	.|0.52170	.|0.201;0.047;0.134;0.006;0.21;0.127;0.951;0.127;0.404;0.134;0.21;0.351	.|B;B;B;B;B;B;P;B;B;B;B;B	.|0.53809	.|0.04;0.078;0.115;0.012;0.165;0.081;0.735;0.162;0.249;0.126;0.249;0.265	T|T	0.33752|0.33752	-0.9856|-0.9856	5|10	.|0.21540	.|T	.|0.41	0.0123|0.0123	7.4946|7.4946	0.27481|0.27481	0.0:0.3077:0.0:0.6923|0.0:0.3077:0.0:0.6923	.|.	.|772;682;765;855;765;777;1316;785;944;931;932;932	.|E7EPK0;B7Z3G0;E9PDJ9;D6RD46;Q9UPQ0-9;Q9UPQ0-6;G5EA03;Q9UPQ0-5;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.|.;.;.;.;.;.;.;.;.;.;.;LIMC1_HUMAN	E|R	766|785;931;932;932;855;944;1316;772;1315;772;765;777;765;284	.|ENSP00000425222:T785R;ENSP00000424825:T931R;ENSP00000424645:T932R;ENSP00000316891:T932R;ENSP00000427045:T855R;ENSP00000424437:T944R;ENSP00000425631:T1316R;ENSP00000421242:T772R;ENSP00000426334:T772R;ENSP00000422864:T765R;ENSP00000379840:T777R;ENSP00000371172:T765R	.|ENSP00000316891:T932R	Q|T	+|+	1|2	0|0	LIMCH1|LIMCH1	41381272|41381272	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.079000|-0.079000	0.11357|0.11357	-0.048000|-0.048000	0.13401|0.13401	-0.251000|-0.251000	0.11542|0.11542	CAA|ACA		0.483	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988		Missense_Mutation
LIX1L	128077	hgsc.bcm.edu	37	1	145492369	145492369	+	Silent	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:145492369T>A	ENST00000369308.3	+	3	665	c.591T>A	c.(589-591)tcT>tcA	p.S197S	RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000366105.2_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000437207.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	197								p.S197S(1)		large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCTGGCATCTTTTAATGTAA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	1											98.0	101.0	100.0					1																	145492369		2203	4300	6503	144203726	SO:0001819	synonymous_variant	128077			AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.591T>A	1.37:g.145492369T>A		Somatic		Capture	SOLID	Phase_IV	144203726	Q6AI36	Silent	SNP	ENST00000369308.3	37	CCDS915.1	SNP	56	Baylor																																																																																				0.443	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038513.1	NM_153713		Silent
LOXL3	84695	hgsc.bcm.edu	37	2	74762854	74762854	+	Missense_Mutation	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:74762854T>G	ENST00000264094.3	-	8	1348	c.1277A>C	c.(1276-1278)cAt>cCt	p.H426P	LOXL3_ENST00000409986.1_Missense_Mutation_p.H281P|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Intron|LOXL3_ENST00000393937.2_Missense_Mutation_p.H281P	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	426	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TCGCCCCTCATGTTGGCTGCG	0.612																																																0			2											39.0	46.0	43.0					2																	74762854		2203	4300	6503	74616362	SO:0001583	missense	84695			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1277A>C	2.37:g.74762854T>G	ENSP00000264094:p.His426Pro	Somatic		Capture	SOLID	Phase_IV	74616362	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	ENST00000264094.3	37	CCDS1953.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.279	1.047558	0.19827	.	.	ENSG00000115318	ENST00000264094;ENST00000393937;ENST00000409986	T;T;T	0.28069	1.63;1.63;1.63	5.11	5.11	0.69529	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.401702	0.28527	N	0.015029	T	0.28034	0.0691	L	0.46157	1.445	0.09310	N	1	P;B;B	0.40360	0.714;0.224;0.076	B;B;B	0.41374	0.355;0.106;0.062	T	0.18272	-1.0342	10	0.34782	T	0.22	.	9.2879	0.37769	0.0:0.0:0.1814:0.8186	.	281;281;426	B9A025;Q6IPL7;P58215	.;.;LOXL3_HUMAN	P	426;281;281	ENSP00000264094:H426P;ENSP00000377512:H281P;ENSP00000386545:H281P	ENSP00000264094:H426P	H	-	2	0	LOXL3	74616362	0.003000	0.15002	0.114000	0.21550	0.983000	0.72400	1.102000	0.31050	2.272000	0.75746	0.460000	0.39030	CAT		0.612	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603		Missense_Mutation
LSS	4047	hgsc.bcm.edu	37	21	47642638	47642638	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr21:47642638A>T	ENST00000397728.3	-	4	412	c.334T>A	c.(334-336)Tgc>Agc	p.C112S	LSS_ENST00000522411.1_Missense_Mutation_p.C112S|LSS_ENST00000457828.2_Missense_Mutation_p.C32S|AP001469.5_ENST00000418029.1_RNA|LSS_ENST00000464357.1_5'UTR|LSS_ENST00000356396.4_Missense_Mutation_p.C112S	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	112					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GCCACGTGGCAAGTGATCAGG	0.607																																					Pancreas(114;955 2313 34923 50507)											0			21											100.0	81.0	87.0					21																	47642638		2203	4300	6503	46467066	SO:0001583	missense	4047			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.334T>A	21.37:g.47642638A>T	ENSP00000380837:p.Cys112Ser	Somatic		Capture	SOLID	Phase_IV	46467066	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	37	CCDS13733.1	SNP	5	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453131	0.43531	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411;ENST00000450351	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	5.17	3.99	0.46301	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.050281	0.85682	N	0.000000	T	0.28001	0.0690	L	0.42581	1.335	0.58432	D	0.999998	D;D	0.59357	0.985;0.975	P;B	0.49477	0.612;0.408	T	0.01393	-1.1366	10	0.32370	T	0.25	.	11.1115	0.48235	0.8612:0.0:0.0:0.1388	.	112;112	E9PEI9;P48449	.;ERG7_HUMAN	S	112;32;112;112;113	ENSP00000348762:C112S;ENSP00000409191:C32S;ENSP00000380837:C112S;ENSP00000429133:C112S;ENSP00000391368:C113S	ENSP00000348762:C112S	C	-	1	0	LSS	46467066	1.000000	0.71417	0.060000	0.19600	0.813000	0.45954	7.043000	0.76572	0.872000	0.35775	0.496000	0.49642	TGC		0.607	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2			Missense_Mutation
MAST3	23031	hgsc.bcm.edu	37	19	18232499	18232500	+	Frame_Shift_Ins	INS	-	-	G			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:18232499_18232500insG	ENST00000262811.6	+	3	76_77	c.76_77insG	c.(76-78)cgcfs	p.R26fs	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	26							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.S49fs*35(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CCACAGCTGCCGCAGCGGGAAC	0.673																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								18093500	SO:0001589	frameshift_variant	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.77dupG	19.37:g.18232500_18232500dupG	ENSP00000262811:p.Arg26fs	Somatic		Capture	SOLID	Phase_IV	18093499	Q7LDZ8|Q9UPI0	Frame_Shift_Ins	INS	ENST00000262811.6	37	CCDS46014.1	INS	23	Baylor																																																																																				0.673	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150		Frame_Shift_Ins
MARK4	57787	hgsc.bcm.edu	37	19	45783675	45783675	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:45783675G>T	ENST00000262891.4	+	11	1381	c.1050G>T	c.(1048-1050)gaG>gaT	p.E350D	MARK4_ENST00000300843.4_Missense_Mutation_p.E350D	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	350	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.E350D(1)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AAATCAAAGAGTCCTTGACCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	19											137.0	132.0	134.0					19																	45783675		2203	4300	6503	50475515	SO:0001583	missense	57787			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1050G>T	19.37:g.45783675G>T	ENSP00000262891:p.Glu350Asp	Somatic		Capture	SOLID	Phase_IV	50475515	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	SNP	36	Baylor	.	.	.	.	.	.	.	.	.	.	G	3.135	-0.177575	0.06380	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.23552	1.9;1.9	5.16	4.12	0.48240	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);	0.063428	0.64402	D	0.000010	T	0.07908	0.0198	N	0.02973	-0.45	0.36626	D	0.876031	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.22556	-1.0213	10	0.02654	T	1	.	6.3205	0.21215	0.0919:0.0:0.7258:0.1823	.	216;350;350	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	D	380;350;350	ENSP00000262891:E350D;ENSP00000300843:E350D	ENSP00000262891:E350D	E	+	3	2	MARK4	50475515	0.878000	0.30173	1.000000	0.80357	0.996000	0.88848	0.017000	0.13399	1.406000	0.46857	0.561000	0.74099	GAG		0.577	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417		Missense_Mutation
ME1	4199	hgsc.bcm.edu	37	6	84140610	84140610	+	Missense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:84140610G>T	ENST00000369705.3	-	1	180	c.64C>A	c.(64-66)Cct>Act	p.P22T	ME1_ENST00000543031.1_5'UTR|ME1_ENST00000541327.1_5'UTR	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	22					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)	p.P22T(1)		NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TTGAGGTGAGGGTTCCGTGTC	0.716																																																1	Substitution - Missense(1)	ovary(1)	6											48.0	41.0	43.0					6																	84140610		2202	4299	6501	84197329	SO:0001583	missense	4199			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.64C>A	6.37:g.84140610G>T	ENSP00000358719:p.Pro22Thr	Somatic		Capture	SOLID	Phase_IV	84197329	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	CCDS34492.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.13	2.144966	0.37825	.	.	ENSG00000065833	ENST00000369705	T	0.29142	1.58	2.54	2.54	0.30619	.	0.394081	0.24793	N	0.035548	T	0.33147	0.0853	M	0.92367	3.3	0.80722	D	1	P	0.43633	0.813	B	0.44224	0.444	T	0.43766	-0.9371	10	0.87932	D	0	-6.5626	8.5929	0.33699	0.0:0.0:1.0:0.0	.	22	P48163	MAOX_HUMAN	T	22	ENSP00000358719:P22T	ENSP00000358719:P22T	P	-	1	0	ME1	84197329	0.991000	0.36638	0.966000	0.40874	0.644000	0.38419	1.672000	0.37523	1.422000	0.47177	0.313000	0.20887	CCT		0.716	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1			Missense_Mutation
METTL17	64745	hgsc.bcm.edu	37	14	21458722	21458722	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr14:21458722C>A	ENST00000339374.6	+	3	562	c.329C>A	c.(328-330)gCt>gAt	p.A110D	METTL17_ENST00000382985.4_Missense_Mutation_p.A110D|METTL17_ENST00000556670.2_Missense_Mutation_p.A110D|METTL17_ENST00000555177.1_3'UTR	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	110					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)	p.A110D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						CAAAGACGGGCTAGGCATCTT	0.453											OREG0022561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	14											55.0	61.0	59.0					14																	21458722		2203	4300	6503	20528562	SO:0001583	missense	64745			AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.329C>A	14.37:g.21458722C>A	ENSP00000343041:p.Ala110Asp	Somatic	748	Capture	SOLID	Phase_IV	20528562	Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	ENST00000339374.6	37	CCDS9562.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970383	0.74246	.	.	ENSG00000165792	ENST00000339374;ENST00000382985;ENST00000536700;ENST00000553564;ENST00000554751;ENST00000554283;ENST00000555670	T;T;T	0.34859	1.37;1.34;1.93	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	M	0.65498	2.005	0.53688	D	0.999973	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.44590	-0.9318	10	0.12766	T	0.61	.	16.1513	0.81624	0.0:1.0:0.0:0.0	.	110;110;110;110	B4E298;Q9H7H0-3;Q9H7H0;Q9H7H0-2	.;.;MET17_HUMAN;.	D	110;110;148;28;28;148;28	ENSP00000343041:A110D;ENSP00000372445:A110D;ENSP00000451478:A28D	ENSP00000343041:A110D	A	+	2	0	METTL17	20528562	0.965000	0.33210	0.966000	0.40874	0.324000	0.28378	2.303000	0.43646	2.882000	0.98803	0.655000	0.94253	GCT		0.453	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734		Missense_Mutation
MGRN1	23295	hgsc.bcm.edu	37	16	4700453	4700454	+	Frame_Shift_Ins	INS	-	-	GCCG			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:4700453_4700454insGCCG	ENST00000399577.5	+	2	269_270	c.176_177insGCCG	c.(175-180)gatctgfs	p.DL59fs	MGRN1_ENST00000415496.1_Frame_Shift_Ins_p.DL59fs|MGRN1_ENST00000588994.1_Frame_Shift_Ins_p.DL59fs|MGRN1_ENST00000262370.7_Frame_Shift_Ins_p.DL59fs|MGRN1_ENST00000586183.1_Frame_Shift_Ins_p.DL59fs	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	59					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D59fs*122(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						GAGAACATGGATCTGAACTTCC	0.569																																																1	Insertion - Frameshift(1)	ovary(1)	16																																								4640455	SO:0001589	frameshift_variant	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		Exception_encountered	16.37:g.4700453_4700454insGCCG	ENSP00000382487:p.Asp59fs	Somatic		Capture	SOLID	Phase_IV	4640454	A4URL3|A4URL4|Q86W76	Frame_Shift_Ins	INS	ENST00000399577.5	37	CCDS45402.1	INS	12	Baylor																																																																																				0.569	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			Frame_Shift_Ins
MGRN1	23295	hgsc.bcm.edu	37	16	4700456	4700456	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr16:4700456T>A	ENST00000399577.5	+	2	272	c.179T>A	c.(178-180)cTg>cAg	p.L60Q	MGRN1_ENST00000415496.1_Missense_Mutation_p.L60Q|MGRN1_ENST00000588994.1_Missense_Mutation_p.L60Q|MGRN1_ENST00000262370.7_Missense_Mutation_p.L60Q|MGRN1_ENST00000586183.1_Missense_Mutation_p.L60Q	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	60					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L60R(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						AACATGGATCTGAACTTCCTG	0.572																																																1	Substitution - Missense(1)	ovary(1)	16											86.0	91.0	89.0					16																	4700456		1893	4130	6023	4640457	SO:0001583	missense	23295			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.179T>A	16.37:g.4700456T>A	ENSP00000382487:p.Leu60Gln	Somatic		Capture	SOLID	Phase_IV	4640457	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	24.5	4.535542	0.85812	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.39	5.39	0.77823	.	0.063724	0.64402	D	0.000005	T	0.60405	0.2266	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.992;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.994;0.998;0.954;0.996;0.997;0.987	T	0.67891	-0.5553	10	0.87932	D	0	-17.6236	13.3663	0.60687	0.0:0.0:0.0:1.0	.	60;60;60;60;60;60	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	Q	60	ENSP00000262370:L60Q;ENSP00000382487:L60Q;ENSP00000393311:L60Q;ENSP00000443810:L60Q	ENSP00000262370:L60Q	L	+	2	0	MGRN1	4640457	1.000000	0.71417	0.997000	0.53966	0.758000	0.43043	7.974000	0.88039	2.048000	0.60808	0.454000	0.30748	CTG		0.572	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2			Missense_Mutation
MIA3	375056	hgsc.bcm.edu	37	1	222803382	222803382	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:222803382G>C	ENST00000344922.5	+	4	2845	c.2820G>C	c.(2818-2820)caG>caC	p.Q940H	MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344441.6_Missense_Mutation_p.Q940H|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	940					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.Q940H(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		AGCGGTTCCAGAAGTACTTTA	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											82.0	76.0	78.0					1																	222803382		1930	4163	6093	220870005	SO:0001583	missense	375056				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2820G>C	1.37:g.222803382G>C	ENSP00000340900:p.Gln940His	Somatic		Capture	SOLID	Phase_IV	220870005	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	SNP	33	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.130|6.130	0.392161|0.392161	0.11581|0.11581	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000354906|ENST00000344922;ENST00000344441;ENST00000320831	.|T;T	.|0.05258	.|3.47;3.47	5.25|5.25	1.76|1.76	0.24704|0.24704	.|.	.|.	.|.	.|.	.|.	T|T	0.11024|0.11024	0.0269|0.0269	L|L	0.50333|0.50333	1.59|1.59	0.25916|0.25916	N|N	0.983173|0.983173	.|P;P	.|0.52842	.|0.956;0.612	.|P;B	.|0.52267	.|0.694;0.219	T|T	0.14282|0.14282	-1.0478|-1.0478	5|9	.|0.62326	.|D	.|0.03	.|.	7.032|7.032	0.24972|0.24972	0.2384:0.1363:0.6253:0.0|0.2384:0.1363:0.6253:0.0	.|.	.|940;940	.|Q5JRA6-2;Q5JRA6	.|.;MIA3_HUMAN	Q|H	523|940	.|ENSP00000340900:Q940H;ENSP00000340587:Q940H	.|ENSP00000325973:Q940H	E|Q	+|+	1|3	0|2	MIA3|MIA3	220870005|220870005	0.162000|0.162000	0.22906|0.22906	0.974000|0.974000	0.42286|0.42286	0.005000|0.005000	0.04900|0.04900	-0.027000|-0.027000	0.12371|0.12371	0.690000|0.690000	0.31570|0.31570	-0.448000|-0.448000	0.05591|0.05591	GAA|CAG		0.443	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551		Missense_Mutation
DPM1	8813	hgsc.bcm.edu	37	20	49575905	49575905	+	5'Flank	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr20:49575905G>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371583.5_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.V176L|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371582.4_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)	p.V176L(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						ATATGATGTGGTGGCTGACTG	0.637																																																1	Substitution - Missense(1)	ovary(1)	20											75.0	70.0	71.0					20																	49575905		2203	4300	6503	49009312	SO:0001631	upstream_gene_variant	27304			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575905G>T	Exception_encountered	Somatic		Capture	SOLID	Phase_IV	49009312	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	SNP	44	Baylor	.	.	.	.	.	.	.	.	.	.	G	31	5.076460	0.94000	.	.	ENSG00000124217	ENST00000244051	T	0.54479	0.57	5.6	5.6	0.85130	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.063541	0.64402	D	0.000006	T	0.77831	0.4189	M	0.89968	3.075	0.80722	D	1	D	0.71674	0.998	D	0.66084	0.941	T	0.81597	-0.0860	9	.	.	.	-18.8689	19.1951	0.93684	0.0:0.0:1.0:0.0	.	176	O95396	MOCS3_HUMAN	L	176	ENSP00000244051:V176L	.	V	+	1	0	MOCS3	49009312	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	5.098000	0.64548	2.640000	0.89533	0.561000	0.74099	GTG		0.637	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859		Missense_Mutation
MUC17	140453	hgsc.bcm.edu	37	7	100696301	100696301	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:100696301G>T	ENST00000306151.4	+	10	13202	c.13138G>T	c.(13138-13140)Gag>Tag	p.E4380*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4380					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.E4380*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTACAGTGGGGAGACCTGTAA	0.602																																																1	Substitution - Nonsense(1)	ovary(1)	7											88.0	79.0	82.0					7																	100696301		2203	4300	6503	100483021	SO:0001587	stop_gained	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13138G>T	7.37:g.100696301G>T	ENSP00000302716:p.Glu4380*	Somatic		Capture	SOLID	Phase_IV	100483021	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	SNP	41	Baylor	.	.	.	.	.	.	.	.	.	.	G	54	22.421701	0.99948	.	.	ENSG00000169876	ENST00000306151	.	.	.	5.52	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	10.7946	0.46453	0.0:0.0:0.8111:0.1889	.	.	.	.	X	4380	.	ENSP00000302716:E4380X	E	+	1	0	MUC17	100483021	0.159000	0.22864	0.310000	0.25168	0.038000	0.13279	1.695000	0.37763	2.595000	0.87683	0.650000	0.86243	GAG		0.602	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		Nonsense_Mutation
MUSK	4593	hgsc.bcm.edu	37	9	113459743	113459743	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:113459743G>C	ENST00000374448.4	+	5	759	c.625G>C	c.(625-627)Gag>Cag	p.E209Q	MUSK_ENST00000416899.2_Missense_Mutation_p.E209Q|MUSK_ENST00000374439.1_Missense_Mutation_p.E91Q|MUSK_ENST00000374440.3_Missense_Mutation_p.E91Q|MUSK_ENST00000189978.5_Missense_Mutation_p.E209Q	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	209					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E209Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GCTGGAAGTTGAGGGTAAGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	9											85.0	87.0	86.0					9																	113459743		1958	4147	6105	112499564	SO:0001583	missense	4593			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.625G>C	9.37:g.113459743G>C	ENSP00000363571:p.Glu209Gln	Somatic		Capture	SOLID	Phase_IV	112499564	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	ENST00000374448.4	37	CCDS48005.1	SNP	45	Baylor	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138047	0.37728	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000374440;ENST00000416899;ENST00000374439	T;T;T	0.27256	1.68;1.68;1.68	5.82	5.82	0.92795	Immunoglobulin-like fold (1);	0.053263	0.85682	D	0.000000	T	0.15349	0.0370	N	0.04994	-0.135	0.50313	D	0.999864	B;B	0.24533	0.105;0.053	B;B	0.24974	0.011;0.057	T	0.15492	-1.0435	10	0.17832	T	0.49	.	18.6627	0.91477	0.0:0.0:1.0:0.0	.	209;209	O15146;F5H6T2	MUSK_HUMAN;.	Q	209;209;209;209;209;91;209;91	ENSP00000363571:E209Q;ENSP00000363563:E91Q;ENSP00000363562:E91Q	ENSP00000189978:E209Q	E	+	1	0	MUSK	112499564	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.373000	0.66162	2.740000	0.93945	0.655000	0.94253	GAG		0.512	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				Missense_Mutation
MYH15	22989	hgsc.bcm.edu	37	3	108124275	108124275	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:108124275T>A	ENST00000273353.3	-	34	4762	c.4706A>T	c.(4705-4707)aAg>aTg	p.K1569M		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1569						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.K1569M(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ATGAAGAATCTTGCTTTCATT	0.318																																																1	Substitution - Missense(1)	ovary(1)	3											62.0	59.0	60.0					3																	108124275		1813	4069	5882	109606965	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4706A>T	3.37:g.108124275T>A	ENSP00000273353:p.Lys1569Met	Somatic		Capture	SOLID	Phase_IV	109606965		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	SNP	56	Baylor	.	.	.	.	.	.	.	.	.	.	T	16.71	3.199582	0.58126	.	.	ENSG00000144821	ENST00000273353	D	0.82526	-1.62	5.13	5.13	0.70059	Myosin tail (1);	.	.	.	.	D	0.92678	0.7673	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94266	0.7506	9	0.87932	D	0	.	15.1071	0.72329	0.0:0.0:0.0:1.0	.	1569	Q9Y2K3	MYH15_HUMAN	M	1569	ENSP00000273353:K1569M	ENSP00000273353:K1569M	K	-	2	0	MYH15	109606965	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	4.058000	0.57463	2.150000	0.67090	0.533000	0.62120	AAG		0.318	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		Missense_Mutation
NARF	26502	hgsc.bcm.edu	37	17	80445993	80445994	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:80445993_80445994insGA	ENST00000309794.11	+	11	1529_1530	c.1331_1332insGA	c.(1330-1335)agccagfs	p.SQ444fs	NARF_ENST00000390006.4_Frame_Shift_Ins_p.SQ385fs|NARF_ENST00000457415.3_Frame_Shift_Ins_p.SQ490fs|NARF_ENST00000345415.7_Frame_Shift_Ins_p.SQ396fs	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	444						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)	p.S490fs*>14(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			ACGTACCAGAGCCAGGAGCGTG	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								78039283	SO:0001589	frameshift_variant	26502			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		Exception_encountered	17.37:g.80445993_80445994insGA	ENSP00000309899:p.Ser444fs	Somatic		Capture	SOLID	Phase_IV	78039282	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Frame_Shift_Ins	INS	ENST00000309794.11	37	CCDS32777.1	INS	34	Baylor																																																																																				0.629	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968		Frame_Shift_Ins
NBPF3	84224	hgsc.bcm.edu	37	1	21808256	21808256	+	Missense_Mutation	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:21808256G>A	ENST00000318249.5	+	13	1950	c.1600G>A	c.(1600-1602)Gtg>Atg	p.V534M	NBPF3_ENST00000454000.2_Missense_Mutation_p.V464M|NBPF3_ENST00000342104.5_Missense_Mutation_p.V522M|NBPF3_ENST00000318220.6_Missense_Mutation_p.V478M	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	534	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)		p.V534M(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTCTCTTGACGTGGATGGTGA	0.463																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	1											41.0	26.0	31.0					1																	21808256		2162	4260	6422	21680843	SO:0001583	missense	84224			BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1600G>A	1.37:g.21808256G>A	ENSP00000316782:p.Val534Met	Somatic		Capture	SOLID	Phase_IV	21680843	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	SNP	40	Baylor	.	.	.	.	.	.	.	.	.	.	.	0.342	-0.949941	0.02285	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	0.583	-1.17	0.09648	DUF1220 (2);	.	.	.	.	T	0.18676	0.0448	L	0.35644	1.08	0.09310	N	1	P;D;P	0.69078	0.914;0.997;0.622	B;D;B	0.65773	0.328;0.938;0.092	T	0.14587	-1.0467	8	0.52906	T	0.07	.	.	.	.	.	464;522;534	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	M	464;478;534;522;478	ENSP00000415711:V464M;ENSP00000316739:V478M;ENSP00000316782:V534M;ENSP00000340336:V522M;ENSP00000391865:V478M	ENSP00000316739:V478M	V	+	1	0	NBPF3	21680843	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.194000	0.17135	-1.238000	0.02535	-1.595000	0.00837	GTG		0.463	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264		Missense_Mutation
NEFH	4744	hgsc.bcm.edu	37	22	29884873	29884873	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr22:29884873T>A	ENST00000310624.6	+	4	1277	c.1244T>A	c.(1243-1245)tTt>tAt	p.F415Y		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	415	Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CGGATTGGCTTTGGCCCAATT	0.463																																																0			22											82.0	84.0	83.0					22																	29884873		2203	4300	6503	28214873	SO:0001583	missense	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1244T>A	22.37:g.29884873T>A	ENSP00000311997:p.Phe415Tyr	Somatic		Capture	SOLID	Phase_IV	28214873	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	SNP	64	Baylor	.	.	.	.	.	.	.	.	.	.	T	18.16	3.562347	0.65538	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.82803	-1.65	6.17	6.17	0.99709	.	0.000000	0.53938	D	0.000058	D	0.82600	0.5072	L	0.54323	1.7	0.35748	D	0.819197	D	0.54601	0.967	P	0.49799	0.622	D	0.87353	0.2339	10	0.66056	D	0.02	.	8.6602	0.34088	0.0:0.1433:0.0:0.8567	.	415	P12036	NFH_HUMAN	Y	415	ENSP00000311997:F415Y	ENSP00000311997:F415Y	F	+	2	0	NEFH	28214873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.749000	0.55150	2.371000	0.80710	0.533000	0.62120	TTT		0.463	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076		Missense_Mutation
NEUROD1	4760	hgsc.bcm.edu	37	2	182542923	182542924	+	Frame_Shift_Ins	INS	-	-	G	rs201829057		TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:182542923_182542924insG	ENST00000295108.3	-	2	1121_1122	c.664_665insC	c.(664-666)cagfs	p.Q222fs	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	222					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.Q222fs*22(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CCCAGGCGACTGGTAGGAGTAG	0.639																																																1	Insertion - Frameshift(1)	ovary(1)	2																																								182251169	SO:0001589	frameshift_variant	4760			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.665dupC	2.37:g.182542925_182542925dupG	ENSP00000295108:p.Gln222fs	Somatic		Capture	SOLID	Phase_IV	182251168	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Frame_Shift_Ins	INS	ENST00000295108.3	37	CCDS2283.1	INS	55	Baylor																																																																																				0.639	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500		Frame_Shift_Ins
NOL9	79707	hgsc.bcm.edu	37	1	6593492	6593492	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:6593492A>T	ENST00000377705.5	-	7	1117	c.1085T>A	c.(1084-1086)tTc>tAc	p.F362Y		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	362					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGTGAGTGAAAGGTGGTCC	0.378																																																0			1											76.0	79.0	78.0					1																	6593492		2203	4300	6503	6516079	SO:0001583	missense	79707			AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1085T>A	1.37:g.6593492A>T	ENSP00000366934:p.Phe362Tyr	Somatic		Capture	SOLID	Phase_IV	6516079	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	SNP	9	Baylor	.	.	.	.	.	.	.	.	.	.	A	12.03	1.816350	0.32145	.	.	ENSG00000162408	ENST00000377705	T	0.25749	1.78	5.95	2.1	0.27182	.	0.156481	0.42053	N	0.000774	T	0.21186	0.0510	L	0.49455	1.56	0.39086	D	0.960993	B	0.20550	0.046	B	0.26094	0.066	T	0.09596	-1.0667	10	0.14252	T	0.57	-22.2608	9.6501	0.39892	0.5942:0.0:0.0:0.4058	.	362	Q5SY16	NOL9_HUMAN	Y	362	ENSP00000366934:F362Y	ENSP00000366934:F362Y	F	-	2	0	NOL9	6516079	1.000000	0.71417	0.398000	0.26321	0.487000	0.33371	3.447000	0.52936	0.081000	0.16988	0.460000	0.39030	TTC		0.378	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654		Missense_Mutation
NOTCH2	4853	hgsc.bcm.edu	37	1	120468421	120468421	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:120468421C>A	ENST00000256646.2	-	25	4237	c.4018G>T	c.(4018-4020)Gca>Tca	p.A1340S	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1340	EGF-like 34. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.A1340S(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGCACCTTGCCCCGGAAAAT	0.517			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	1	Substitution - Missense(1)	ovary(1)	1											26.0	24.0	25.0					1																	120468421		2202	4296	6498	120269944	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4018G>T	1.37:g.120468421C>A	ENSP00000256646:p.Ala1340Ser	Somatic		Capture	SOLID	Phase_IV	120269944	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	SNP	26	Baylor	.	.	.	.	.	.	.	.	.	.	C	3.658	-0.070143	0.07228	.	.	ENSG00000134250	ENST00000256646	D	0.92149	-2.98	5.84	3.93	0.45458	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.37577	U	0.002033	T	0.62048	0.2396	N	0.04994	-0.135	0.20975	N	0.999812	B	0.14012	0.009	B	0.15052	0.012	T	0.54603	-0.8269	10	0.08599	T	0.76	.	7.6421	0.28300	0.2946:0.6306:0.0:0.0748	.	1340	Q04721	NOTC2_HUMAN	S	1340	ENSP00000256646:A1340S	ENSP00000256646:A1340S	A	-	1	0	NOTCH2	120269944	0.016000	0.18221	0.917000	0.36280	0.527000	0.34593	0.873000	0.28052	1.427000	0.47276	0.561000	0.74099	GCA		0.517	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		Missense_Mutation
NSMCE2	286053	hgsc.bcm.edu	37	8	126369996	126369996	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr8:126369996A>T	ENST00000287437.3	+	7	778	c.562A>T	c.(562-564)Acc>Tcc	p.T188S	NSMCE2_ENST00000517315.1_Missense_Mutation_p.T128S|NSMCE2_ENST00000522563.1_Missense_Mutation_p.T188S	NM_173685.2	NP_775956.1	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog (S. cerevisiae)	188					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|protein sumoylation (GO:0016925)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)	p.T188S(1)		breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GTGTGGCCACACCTATGAAGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	8											115.0	97.0	103.0					8																	126369996		2203	4300	6503	126439178	SO:0001583	missense	286053			AK057002	CCDS6356.1	8q24.13	2013-01-28	2006-12-21	2006-07-05	ENSG00000156831	ENSG00000156831		"""Zinc fingers, MIZ-type"""	26513	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 7"""		"""chromosome 8 open reading frame 36"", ""non-SMC element 2 homolog (MMS21, S. cerevisiae)"""	C8orf36		12477932	Standard	NM_173685		Approved	FLJ32440, MMS21, NSE2, ZMIZ7	uc003yrw.2	Q96MF7	OTTHUMG00000164993	ENST00000287437.3:c.562A>T	8.37:g.126369996A>T	ENSP00000287437:p.Thr188Ser	Somatic		Capture	SOLID	Phase_IV	126439178	Q8N549	Missense_Mutation	SNP	ENST00000287437.3	37	CCDS6356.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.684	1.150059	0.21371	.	.	ENSG00000156831	ENST00000517532;ENST00000287437;ENST00000522563;ENST00000517315	T;T;T;T	0.48201	0.82;0.86;0.86;0.85	5.43	4.19	0.49359	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, MIZ-type (1);	0.267790	0.37809	N	0.001936	T	0.33381	0.0861	L	0.33668	1.02	0.27827	N	0.941572	P	0.34934	0.476	B	0.34873	0.191	T	0.15925	-1.0420	10	0.21540	T	0.41	.	9.8299	0.40934	0.7494:0.0:0.0:0.2506	.	188	Q96MF7	NSE2_HUMAN	S	188;188;188;128	ENSP00000429612:T188S;ENSP00000287437:T188S;ENSP00000430668:T188S;ENSP00000428846:T128S	ENSP00000287437:T188S	T	+	1	0	NSMCE2	126439178	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	1.108000	0.31123	2.190000	0.69967	0.397000	0.26171	ACC		0.473	NSMCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381378.1	NM_173685		Missense_Mutation
OTOF	9381	hgsc.bcm.edu	37	2	26696340	26696341	+	In_Frame_Ins	INS	-	-	TCA			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:26696340_26696341insTCA	ENST00000272371.2	-	28	3629_3630	c.3503_3504insTGA	c.(3502-3504)cag>caTGAg	p.1168_1168Q>HE	OTOF_ENST00000403946.3_In_Frame_Ins_p.1168_1168Q>HE|OTOF_ENST00000338581.6_In_Frame_Ins_p.421_421Q>HE|OTOF_ENST00000339598.3_In_Frame_Ins_p.421_421Q>HE|OTOF_ENST00000402415.3_In_Frame_Ins_p.478_478Q>HE	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1168					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.Q421>HE(1)|p.Q1168>HE(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGGGACGACTGCACCCCCTT	0.599																																					GBM(102;732 1451 20652 24062 31372)											2	Complex - insertion inframe(2)	ovary(2)	2																																								26549845	SO:0001652	inframe_insertion	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3503_3504insTGA	2.37:g.26696340_26696341insTCA	ENSP00000272371:p.Gln1168delinsHisGlu	Somatic		Capture	SOLID	Phase_IV	26549844	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	In_Frame_Ins	INS	ENST00000272371.2	37	CCDS1725.1	INS	20	Baylor																																																																																				0.599	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			In_Frame_Ins
OTOF	9381	hgsc.bcm.edu	37	2	26739340	26739340	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:26739340A>C	ENST00000272371.2	-	5	581	c.455T>G	c.(454-456)cTg>cGg	p.L152R	OTOF_ENST00000403946.3_Missense_Mutation_p.L152R	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	152					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.L152R(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCTGGGAGCAGTCCATCCGT	0.642																																					GBM(102;732 1451 20652 24062 31372)											1	Substitution - Missense(1)	ovary(1)	2											78.0	84.0	82.0					2																	26739340		2203	4300	6503	26592844	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.455T>G	2.37:g.26739340A>C	ENSP00000272371:p.Leu152Arg	Somatic		Capture	SOLID	Phase_IV	26592844	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324142	0.41197	.	.	ENSG00000115155	ENST00000272371;ENST00000403946;ENST00000380499	T;T	0.81247	-1.47;-1.47	5.46	5.46	0.80206	.	0.646085	0.15103	N	0.280439	T	0.76863	0.4047	M	0.62723	1.935	0.51233	D	0.999916	B	0.12013	0.005	B	0.09377	0.004	T	0.69917	-0.5015	10	0.14252	T	0.57	-16.6119	13.5006	0.61452	1.0:0.0:0.0:0.0	.	152	Q9HC10	OTOF_HUMAN	R	152;152;21	ENSP00000272371:L152R;ENSP00000385255:L152R	ENSP00000272371:L152R	L	-	2	0	OTOF	26592844	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	5.395000	0.66291	2.081000	0.62600	0.533000	0.62120	CTG		0.642	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			Missense_Mutation
PCDHGB4	8641	hgsc.bcm.edu	37	5	140768013	140768013	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:140768013delG	ENST00000519479.1	+	1	562	c.562delG	c.(562-564)ggcfs	p.G188fs	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	188	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G188C(1)		endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAATCAGATGGCAGTAAATA	0.438																																																1	Substitution - Missense(1)	lung(1)	5											65.0	66.0	65.0					5																	140768013		1915	4125	6040	140748197	SO:0001589	frameshift_variant	8641			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.562delG	5.37:g.140768013delG	ENSP00000428288:p.Gly188fs	Somatic		Capture	SOLID	Phase_IV	140748197	O15099|Q2M267|Q9UN64	Frame_Shift_Del	DEL	ENST00000519479.1	37	CCDS54928.1	DEL	47	Baylor																																																																																				0.438	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736		Frame_Shift_Del
PCDH12	51294	hgsc.bcm.edu	37	5	141337140	141337140	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:141337140C>G	ENST00000231484.3	-	1	1487	c.277G>C	c.(277-279)Gat>Cat	p.D93H	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	93	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D93H(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCTCGATCCAGCCGCCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											52.0	55.0	54.0					5																	141337140		2203	4300	6503	141317324	SO:0001583	missense	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.277G>C	5.37:g.141337140C>G	ENSP00000231484:p.Asp93His	Somatic		Capture	SOLID	Phase_IV	141317324	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	SNP	30	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668742	0.88348	.	.	ENSG00000113555	ENST00000231484	T	0.53640	0.61	4.81	4.81	0.61882	Cadherin, N-terminal (1);Cadherin (4);	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	H	0.94620	3.56	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.83896	0.0287	10	0.87932	D	0	.	15.4202	0.75006	0.0:1.0:0.0:0.0	.	93	Q9NPG4	PCD12_HUMAN	H	93	ENSP00000231484:D93H	ENSP00000231484:D93H	D	-	1	0	PCDH12	141317324	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.905000	0.69893	2.504000	0.84457	0.563000	0.77884	GAT		0.602	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580		Missense_Mutation
PDCD2L	84306	hgsc.bcm.edu	37	19	34900109	34900109	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:34900109C>A	ENST00000246535.3	+	4	427	c.380C>A	c.(379-381)gCt>gAt	p.A127D	PDCD2L_ENST00000587065.2_Intron|RP11-618P17.4_ENST00000606020.1_Missense_Mutation_p.A122D	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	127					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TGTGAAGGTGCTGATGACTGG	0.493																																																0			19											142.0	131.0	134.0					19																	34900109		2203	4300	6503	39591949	SO:0001583	missense	84306			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.380C>A	19.37:g.34900109C>A	ENSP00000246535:p.Ala127Asp	Somatic		Capture	SOLID	Phase_IV	39591949		Missense_Mutation	SNP	ENST00000246535.3	37	CCDS12438.1	SNP	28	Baylor	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420700	0.83559	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.81	5.81	0.92471	.	0.097832	0.64402	D	0.000001	T	0.63593	0.2524	L	0.45470	1.425	0.58432	D	0.999992	D	0.57257	0.979	P	0.55923	0.787	T	0.55231	-0.8173	9	0.16420	T	0.52	-7.6223	17.0001	0.86378	0.0:1.0:0.0:0.0	.	127	Q9BRP1	PDD2L_HUMAN	D	127	.	ENSP00000246535:A127D	A	+	2	0	PDCD2L	39591949	0.999000	0.42202	0.993000	0.49108	0.746000	0.42486	5.047000	0.64232	2.756000	0.94617	0.655000	0.94253	GCT		0.493	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346		Missense_Mutation
PDE12	201626	hgsc.bcm.edu	37	3	57542507	57542507	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:57542507A>T	ENST00000311180.8	+	1	504	c.401A>T	c.(400-402)gAg>gTg	p.E134V	PDE12_ENST00000487257.1_Missense_Mutation_p.E134V	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	134					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)	p.E134V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		GCAGTGGCTGAGGACGTGCTC	0.647																																					Colon(125;308 1634 19198 50622 50717)											1	Substitution - Missense(1)	ovary(1)	3											39.0	40.0	40.0					3																	57542507		2203	4300	6503	57517547	SO:0001583	missense	201626			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.401A>T	3.37:g.57542507A>T	ENSP00000309142:p.Glu134Val	Somatic		Capture	SOLID	Phase_IV	57517547	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Missense_Mutation	SNP	ENST00000311180.8	37	CCDS33772.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943972	0.53079	.	.	ENSG00000174840	ENST00000487257;ENST00000311180	T;T	0.25912	1.77;1.81	5.61	4.45	0.53987	.	0.316938	0.37577	N	0.002028	T	0.20577	0.0495	L	0.41824	1.3	0.54753	D	0.999985	B;B	0.31209	0.172;0.313	B;B	0.26202	0.03;0.067	T	0.02781	-1.1111	10	0.49607	T	0.09	-16.2501	11.1325	0.48356	0.927:0.0:0.073:0.0	.	134;134	Q6L8Q7;F6T1Q0	PDE12_HUMAN;.	V	134	ENSP00000420626:E134V;ENSP00000309142:E134V	ENSP00000309142:E134V	E	+	2	0	PDE12	57517547	1.000000	0.71417	0.577000	0.28562	0.989000	0.77384	8.056000	0.89455	0.964000	0.38108	0.374000	0.22700	GAG		0.647	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		Missense_Mutation
PDE12	201626	hgsc.bcm.edu	37	3	57542510	57542510	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:57542510A>T	ENST00000311180.8	+	1	507	c.404A>T	c.(403-405)gAc>gTc	p.D135V	PDE12_ENST00000487257.1_Missense_Mutation_p.D135V	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	135					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		GTGGCTGAGGACGTGCTCAAC	0.657																																					Colon(125;308 1634 19198 50622 50717)											0			3											40.0	41.0	40.0					3																	57542510		2203	4300	6503	57517550	SO:0001583	missense	201626			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.404A>T	3.37:g.57542510A>T	ENSP00000309142:p.Asp135Val	Somatic		Capture	SOLID	Phase_IV	57517550	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Missense_Mutation	SNP	ENST00000311180.8	37	CCDS33772.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.19	2.461120	0.43736	.	.	ENSG00000174840	ENST00000487257;ENST00000311180	T;T	0.24350	1.86;1.88	5.61	4.43	0.53597	.	0.200171	0.52532	D	0.000075	T	0.25044	0.0608	L	0.50333	1.59	0.58432	D	0.999999	P;P	0.45902	0.868;0.865	B;B	0.43623	0.115;0.425	T	0.02632	-1.1131	10	0.72032	D	0.01	-27.571	7.116	0.25416	0.7764:0.1493:0.0743:0.0	.	135;135	Q6L8Q7;F6T1Q0	PDE12_HUMAN;.	V	135	ENSP00000420626:D135V;ENSP00000309142:D135V	ENSP00000309142:D135V	D	+	2	0	PDE12	57517550	1.000000	0.71417	0.735000	0.30896	0.991000	0.79684	4.901000	0.63259	0.932000	0.37266	0.374000	0.22700	GAC		0.657	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		Missense_Mutation
PDE12	201626	hgsc.bcm.edu	37	3	57542916	57542916	+	Silent	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:57542916A>C	ENST00000311180.8	+	1	913	c.810A>C	c.(808-810)gtA>gtC	p.V270V	PDE12_ENST00000487257.1_Silent_p.V270V	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	270					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)	p.V270V(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TGTGTGTGGTAGAGGCTGGGC	0.587																																					Colon(125;308 1634 19198 50622 50717)											1	Substitution - coding silent(1)	ovary(1)	3											96.0	94.0	95.0					3																	57542916		2203	4300	6503	57517956	SO:0001819	synonymous_variant	201626			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.810A>C	3.37:g.57542916A>C		Somatic		Capture	SOLID	Phase_IV	57517956	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Silent	SNP	ENST00000311180.8	37	CCDS33772.1	SNP	15	Baylor																																																																																				0.587	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		Silent
PDE12	201626	hgsc.bcm.edu	37	3	57542918	57542918	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:57542918A>T	ENST00000311180.8	+	1	915	c.812A>T	c.(811-813)gAg>gTg	p.E271V	PDE12_ENST00000487257.1_Missense_Mutation_p.E271V	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	271					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TGTGTGGTAGAGGCTGGGCCT	0.582																																					Colon(125;308 1634 19198 50622 50717)											0			3											95.0	93.0	94.0					3																	57542918		2203	4300	6503	57517958	SO:0001583	missense	201626			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.812A>T	3.37:g.57542918A>T	ENSP00000309142:p.Glu271Val	Somatic		Capture	SOLID	Phase_IV	57517958	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Missense_Mutation	SNP	ENST00000311180.8	37	CCDS33772.1	SNP	11	Baylor	.	.	.	.	.	.	.	.	.	.	A	17.26	3.345224	0.61073	.	.	ENSG00000174840	ENST00000487257;ENST00000311180	T;T	0.25749	1.78;1.79	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	L	0.57536	1.79	0.80722	D	1	P;D	0.58268	0.804;0.982	P;P	0.62014	0.696;0.897	T	0.40059	-0.9583	10	0.59425	D	0.04	-25.2629	15.0193	0.71617	1.0:0.0:0.0:0.0	.	271;271	Q6L8Q7;F6T1Q0	PDE12_HUMAN;.	V	271	ENSP00000420626:E271V;ENSP00000309142:E271V	ENSP00000309142:E271V	E	+	2	0	PDE12	57517958	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	8.750000	0.91623	1.957000	0.56846	0.459000	0.35465	GAG		0.582	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351440.2	NM_177966		Missense_Mutation
PGBD2	267002	hgsc.bcm.edu	37	1	249211778	249211778	+	Missense_Mutation	SNP	T	T	C			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:249211778T>C	ENST00000329291.5	+	3	1142	c.995T>C	c.(994-996)aTa>aCa	p.I332T	PGBD2_ENST00000355360.4_Missense_Mutation_p.I81T|PGBD2_ENST00000539153.1_Missense_Mutation_p.I329T	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	332										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGTATGGTAATAAAATTTGTG	0.453																																																0			1											125.0	129.0	128.0					1																	249211778		2203	4300	6503	247178401	SO:0001583	missense	267002			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.995T>C	1.37:g.249211778T>C	ENSP00000331643:p.Ile332Thr	Somatic		Capture	SOLID	Phase_IV	247178401	B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	37	CCDS31128.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	8.385	0.838391	0.16891	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.17370	2.28;2.28;2.28	3.91	3.91	0.45181	.	0.191064	0.28736	N	0.014306	T	0.07818	0.0196	N	0.11927	0.2	0.21604	N	0.999621	B;B	0.31459	0.082;0.324	B;B	0.28385	0.049;0.089	T	0.32640	-0.9899	10	0.10902	T	0.67	-29.7892	9.3396	0.38071	0.0:0.0:0.0:1.0	.	329;332	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	T	81;332;329	ENSP00000355424:I81T;ENSP00000331643:I332T;ENSP00000439950:I329T	ENSP00000331643:I332T	I	+	2	0	PGBD2	247178401	0.986000	0.35501	0.059000	0.19551	0.665000	0.39181	1.896000	0.39789	1.765000	0.52091	0.460000	0.39030	ATA		0.453	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1			Missense_Mutation
PIK3R2	5296	hgsc.bcm.edu	37	19	18272834	18272835	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-23-1120-01	TCGA-23-1120-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:18272834_18272835delTT	ENST00000593731.1	+	7	1434_1435	c.874_875delTT	c.(874-876)ttgfs	p.L292fs	PIK3R2_ENST00000222254.8_Frame_Shift_Del_p.L292fs			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	292	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)	p.L292fs*13(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TCAGGAACACTTGGAAGAGCAG	0.614																																																1	Deletion - Frameshift(1)	ovary(1)	19																																								18133835	SO:0001589	frameshift_variant	5296				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.874_875delTT	19.37:g.18272834_18272835delTT	ENSP00000471914:p.Leu292fs	Somatic		Capture	SOLID	Phase_IV	18133834	Q5EAT5|Q9UPH9	Frame_Shift_Del	DEL	ENST00000593731.1	37	CCDS12371.1	DEL	56	Baylor																																																																																				0.614	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027		Frame_Shift_Del
PKD1L1	168507	hgsc.bcm.edu	37	7	47904851	47904851	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:47904851A>G	ENST00000289672.2	-	26	4162	c.4112T>C	c.(4111-4113)gTt>gCt	p.V1371A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1371	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.V1371A(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CAACATAAGAACAGAACCAAT	0.348																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	51.0	52.0					7																	47904851		2203	4300	6503	47871376	SO:0001583	missense	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4112T>C	7.37:g.47904851A>G	ENSP00000289672:p.Val1371Ala	Somatic		Capture	SOLID	Phase_IV	47871376	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596189	0.46318	.	.	ENSG00000158683	ENST00000289672	T	0.31769	1.48	5.21	5.21	0.72293	Egg jelly receptor, REJ-like (1);	0.182824	0.34700	N	0.003759	T	0.43567	0.1253	L	0.56769	1.78	0.09310	N	1	D	0.67145	0.996	P	0.60541	0.876	T	0.35076	-0.9803	10	0.11485	T	0.65	-18.2141	13.0122	0.58737	1.0:0.0:0.0:0.0	.	1371	Q8TDX9	PK1L1_HUMAN	A	1371	ENSP00000289672:V1371A	ENSP00000289672:V1371A	V	-	2	0	PKD1L1	47871376	0.009000	0.17119	0.025000	0.17156	0.362000	0.29581	2.584000	0.46102	1.946000	0.56461	0.528000	0.53228	GTT		0.348	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		Missense_Mutation
PLCB3	5331	hgsc.bcm.edu	37	11	64033809	64033809	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr11:64033809A>T	ENST00000540288.1	+	28	3392	c.3289A>T	c.(3289-3291)Atc>Ttc	p.I1097F	PLCB3_ENST00000325234.5_Missense_Mutation_p.I1030F|PLCB3_ENST00000279230.6_Missense_Mutation_p.I1097F	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1097				REKKELQKILDRKRHNSISEAKMRDKHKKEA -> SWPSWP RSVRSSGRGSPRRSAGACWARCRRG (in Ref. 2; CAA85776). {ECO:0000305}.	inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						GCTGCAGAAGATCCTGGACAG	0.592																																																0			11											67.0	72.0	70.0					11																	64033809		2201	4297	6498	63790385	SO:0001583	missense	5331			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3289A>T	11.37:g.64033809A>T	ENSP00000443631:p.Ile1097Phe	Somatic		Capture	SOLID	Phase_IV	63790385	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614331	0.87359	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.46063	0.88;0.88;0.88	5.17	5.17	0.71159	PLC-beta, C-terminal (1);	0.635049	0.16112	N	0.229053	T	0.55449	0.1921	L	0.47716	1.5	0.52501	D	0.999954	D;D	0.64830	0.994;0.966	P;P	0.62184	0.899;0.842	T	0.56577	-0.7956	10	0.72032	D	0.01	.	13.9879	0.64348	1.0:0.0:0.0:0.0	.	1030;1097	G5E960;Q01970	.;PLCB3_HUMAN	F	1097;1097;1030	ENSP00000279230:I1097F;ENSP00000443631:I1097F;ENSP00000324660:I1030F	ENSP00000279230:I1097F	I	+	1	0	PLCB3	63790385	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.499000	0.60380	1.959000	0.56917	0.454000	0.30748	ATC		0.592	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1			Missense_Mutation
PRSS16	10279	hgsc.bcm.edu	37	6	27223065	27223079	+	In_Frame_Del	DEL	AAGGAGAGCCAGATT	AAGGAGAGCCAGATT	-	rs199705677|rs201493618|rs144604424|rs140280737|rs371606222|rs147170589|rs143492910|rs200987021|rs141138864|rs142712601	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	AAGGAGAGCCAGATT	AAGGAGAGCCAGATT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:27223065_27223079delAAGGAGAGCCAGATT	ENST00000230582.3	+	12	1531_1545	c.1516_1530delAAGGAGAGCCAGATT	c.(1516-1530)aaggagagccagattdel	p.KESQI506del	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_In_Frame_Del_p.KESQI249del	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	506					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.K506_I510delKESQI(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CAAGCTGGCAAAGGAGAGCCAGATTAAGGGTGAAG	0.479														511	0.102037	0.1135	0.1124	5008	,	,		20927	0.0139		0.174	False		,,,				2504	0.0961				NSCLC(178;1118 2105 17078 23587 44429)											1	Deletion - In frame(1)	ovary(1)	6								514,3748		27,460,1644						-5.7	0.0		dbSNP_113	73	1519,6735		166,1187,2774	no	coding	PRSS16	NM_005865.3		193,1647,4418	A1A1,A1R,RR		18.4032,12.0601,16.2432				2033,10483				27331058	SO:0001651	inframe_deletion	10279			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1516_1530delAAGGAGAGCCAGATT	6.37:g.27223065_27223079delAAGGAGAGCCAGATT	ENSP00000230582:p.Lys506_Ile510del	Somatic		Capture	SOLID	Phase_IV	27331044	O75416	In_Frame_Del	DEL	ENST00000230582.3	37	CCDS4623.1	DEL	1	Baylor																																																																																				0.479	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2			In_Frame_Del
PSMB6	5694	hgsc.bcm.edu	37	17	4701625	4701625	+	Silent	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:4701625C>T	ENST00000270586.3	+	6	679	c.628C>T	c.(628-630)Ctg>Ttg	p.L210L	RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001270481.1|NM_002798.2	NP_001257410.1|NP_002789.1	P28072	PSB6_HUMAN	proteasome (prosome, macropain) subunit, beta type, 6	210					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	endopeptidase activity (GO:0004175)|threonine-type endopeptidase activity (GO:0004298)	p.L210L(1)		endometrium(3)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11						AGTGATCCGCCTGGCAGCCAT	0.557																																																1	Substitution - coding silent(1)	ovary(1)	17											130.0	127.0	128.0					17																	4701625		2203	4300	6503	4648583	SO:0001819	synonymous_variant	5694			BC000835	CCDS11056.1, CCDS73944.1	17p13	2004-02-18			ENSG00000142507	ENSG00000142507		"""Proteasome (prosome, macropain) subunits"""	9543	protein-coding gene	gene with protein product		600307				8066462, 1888762	Standard	NM_002798		Approved	Y, DELTA	uc002fzb.4	P28072	OTTHUMG00000090777	ENST00000270586.3:c.628C>T	17.37:g.4701625C>T		Somatic		Capture	SOLID	Phase_IV	4648583	Q96J55	Silent	SNP	ENST00000270586.3	37	CCDS11056.1	SNP	24	Baylor																																																																																				0.557	PSMB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207559.2	NM_002798		Silent
PSME1	5720	hgsc.bcm.edu	37	14	24606394	24606394	+	Frame_Shift_Del	DEL	G	G	-			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr14:24606394delG	ENST00000206451.6	+	3	220	c.115delG	c.(115-117)gagfs	p.E39fs	PSME1_ENST00000561435.1_Frame_Shift_Del_p.E39fs|PSME1_ENST00000382708.3_Frame_Shift_Del_p.E39fs|RP11-468E2.5_ENST00000558478.1_lincRNA|PSME1_ENST00000470718.1_3'UTR|EMC9_ENST00000558200.1_5'Flank|PSME1_ENST00000559123.1_5'UTR	NM_001281528.1|NM_006263.2	NP_001268457.1|NP_006254.1	Q06323	PSME1_HUMAN	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	39					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)	p.E39fs*6(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(265;0.00831)		GAAGATTTCTGAGCTGGATGC	0.547																																																1	Deletion - Frameshift(1)	ovary(1)	14											120.0	130.0	127.0					14																	24606394		2203	4300	6503	23676234	SO:0001589	frameshift_variant	5720				CCDS9612.1, CCDS41930.1, CCDS61415.1	14q11.2	2008-08-29			ENSG00000092010	ENSG00000092010		"""Proteasome (prosome, macropain) subunits"""	9568	protein-coding gene	gene with protein product		600654				8269930	Standard	NM_006263		Approved	IFI5111, PA28alpha	uc001wmh.3	Q06323	OTTHUMG00000028795	ENST00000206451.6:c.115delG	14.37:g.24606394delG	ENSP00000206451:p.Glu39fs	Somatic		Capture	SOLID	Phase_IV	23676234	A6NJG9|H0YNE3|Q6IBM2|Q9UEF4	Frame_Shift_Del	DEL	ENST00000206451.6	37	CCDS9612.1	DEL	45	Baylor																																																																																				0.547	PSME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071910.2	NM_006263		Frame_Shift_Del
PTPN12	5782	hgsc.bcm.edu	37	7	77268030	77268030	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:77268030A>G	ENST00000248594.6	+	17	2535	c.2263A>G	c.(2263-2265)Aca>Gca	p.T755A	PTPN12_ENST00000435495.2_Missense_Mutation_p.T625A|PTPN12_ENST00000415482.2_Missense_Mutation_p.T636A	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	755					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)	p.T755A(1)		breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						AGAAAATCCAACAGAAGCCAC	0.353																																																1	Substitution - Missense(1)	ovary(1)	7											83.0	87.0	85.0					7																	77268030		2203	4300	6503	77105966	SO:0001583	missense	5782				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.2263A>G	7.37:g.77268030A>G	ENSP00000248594:p.Thr755Ala	Somatic		Capture	SOLID	Phase_IV	77105966	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	SNP	2	Baylor	.	.	.	.	.	.	.	.	.	.	A	2.484	-0.319021	0.05386	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000435495	T;T;T	0.06068	3.93;3.35;3.35	5.46	-6.97	0.01616	.	0.822405	0.10716	N	0.642304	T	0.02848	0.0085	N	0.15975	0.35	0.19945	N	0.999947	B	0.02656	0.0	B	0.01281	0.0	T	0.42327	-0.9458	10	0.38643	T	0.18	.	5.9629	0.19308	0.2943:0.0:0.371:0.3347	.	755	Q05209	PTN12_HUMAN	A	755;636;625	ENSP00000248594:T755A;ENSP00000392429:T636A;ENSP00000397991:T625A	ENSP00000248594:T755A	T	+	1	0	PTPN12	77105966	0.013000	0.17824	0.868000	0.34077	0.132000	0.20833	-0.119000	0.10676	-0.768000	0.04626	-1.303000	0.01326	ACA		0.353	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3			Missense_Mutation
RASA3	22821	hgsc.bcm.edu	37	13	114765132	114765133	+	In_Frame_Ins	INS	-	-	CTC			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr13:114765132_114765133insCTC	ENST00000334062.7	-	20	1981_1982	c.1860_1861insGAG	c.(1858-1863)cctctc>cctGAGctc	p.620_621PL>PEL	RASA3_ENST00000389544.4_In_Frame_Ins_p.588_589PL>PEL	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	620	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.P620_L621insE(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ATGCTGTAGAGAGGCTGGTCCC	0.624																																																1	Insertion - In frame(1)	ovary(1)	13																																								113783235	SO:0001652	inframe_insertion	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1860_1861insGAG	13.37:g.114765132_114765133insCTC	ENSP00000335029:p.Pro620_Leu621insGlu	Somatic		Capture	SOLID	Phase_IV	113783234	A6NL15|F8W6X8|Q8IUY2	In_Frame_Ins	INS	ENST00000334062.7	37	CCDS32016.1	INS	33	Baylor																																																																																				0.624	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368		In_Frame_Ins
RPS6KA2	6196	hgsc.bcm.edu	37	6	166827304	166827304	+	Missense_Mutation	SNP	C	C	A			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:166827304C>A	ENST00000265678.4	-	20	2277	c.2054G>T	c.(2053-2055)cGa>cTa	p.R685L	RPS6KA2_ENST00000481261.2_Missense_Mutation_p.R596L|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.R710L|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.R693L|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.R596L|RPS6KA2_ENST00000509742.1_5'UTR	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	685					axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.R685L(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CACGTCCTGTCGGCTGAGCTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											106.0	83.0	91.0					6																	166827304		2203	4300	6503	166747294	SO:0001583	missense	6196			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.2054G>T	6.37:g.166827304C>A	ENSP00000265678:p.Arg685Leu	Somatic		Capture	SOLID	Phase_IV	166747294	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	SNP	31	Baylor	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796437	0.70567	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	3.99	3.99	0.46301	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.14657	0.0354	M	0.68317	2.08	0.80722	D	1	B;B;P	0.48694	0.007;0.012;0.914	B;B;B	0.27076	0.007;0.015;0.076	T	0.14035	-1.0487	10	0.10377	T	0.69	.	15.671	0.77274	0.0:1.0:0.0:0.0	.	710;693;685	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	L	685;710;693;596;596	ENSP00000265678:R685L;ENSP00000422435:R710L;ENSP00000427015:R693L;ENSP00000422484:R596L;ENSP00000386050:R596L	ENSP00000265678:R685L	R	-	2	0	RPS6KA2	166747294	1.000000	0.71417	0.991000	0.47740	0.926000	0.56050	4.132000	0.57977	2.245000	0.73994	0.478000	0.44815	CGA		0.582	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135		Missense_Mutation
SCN11A	11280	hgsc.bcm.edu	37	3	38889039	38889039	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:38889039T>A	ENST00000302328.3	-	26	4720	c.4522A>T	c.(4522-4524)Atg>Ttg	p.M1508L	SCN11A_ENST00000450244.1_Missense_Mutation_p.M1508L|SCN11A_ENST00000456224.3_Missense_Mutation_p.M1470L	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1508					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.M1508L(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TAGATAAACATAATCAGAAAG	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											80.0	80.0	80.0					3																	38889039		2203	4300	6503	38864043	SO:0001583	missense	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4522A>T	3.37:g.38889039T>A	ENSP00000307599:p.Met1508Leu	Somatic		Capture	SOLID	Phase_IV	38864043	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	SNP	49	Baylor	.	.	.	.	.	.	.	.	.	.	T	29.2	4.982917	0.93044	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.97941	-4.62;-4.62;-4.62	5.81	5.81	0.92471	Ion transport (1);	0.120921	0.85682	D	0.000000	D	0.98337	0.9448	M	0.73598	2.24	0.53005	D	0.999966	D	0.60160	0.987	P	0.61592	0.891	D	0.99349	1.0914	10	0.87932	D	0	.	16.1668	0.81768	0.0:0.0:0.0:1.0	.	1508	Q9UI33	SCNBA_HUMAN	L	1508;1508;1470	ENSP00000307599:M1508L;ENSP00000400945:M1508L;ENSP00000416757:M1470L	ENSP00000307599:M1508L	M	-	1	0	SCN11A	38864043	1.000000	0.71417	0.980000	0.43619	0.924000	0.55760	8.032000	0.88838	2.220000	0.72140	0.519000	0.50382	ATG		0.443	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139		Missense_Mutation
SCRN1	9805	hgsc.bcm.edu	37	7	29983757	29983757	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:29983757A>G	ENST00000426154.1	-	4	556	c.380T>C	c.(379-381)tTa>tCa	p.L127S	SCRN1_ENST00000434476.2_Missense_Mutation_p.L147S|SCRN1_ENST00000416113.2_Missense_Mutation_p.L18S|SCRN1_ENST00000242059.5_Missense_Mutation_p.L127S|SCRN1_ENST00000425819.2_Missense_Mutation_p.L59S|SCRN1_ENST00000494620.1_5'UTR|SCRN1_ENST00000409497.1_Missense_Mutation_p.L127S	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	127					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)	p.L127S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						AATGACATCTAAGGCTTCTTT	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											119.0	106.0	110.0					7																	29983757		2203	4300	6503	29950282	SO:0001583	missense	9805			D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.380T>C	7.37:g.29983757A>G	ENSP00000409068:p.Leu127Ser	Somatic		Capture	SOLID	Phase_IV	29950282	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	ENST00000426154.1	37	CCDS5422.1	SNP	13	Baylor	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681491	0.88542	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000425819;ENST00000409497;ENST00000416113;ENST00000434476;ENST00000421434;ENST00000438497	T;T;T;T;T;T;T;T	0.37411	1.9;1.9;1.9;1.9;2.46;1.9;1.9;1.2	5.93	5.93	0.95920	.	0.107748	0.40469	N	0.001086	T	0.68238	0.2979	M	0.92169	3.28	0.40575	D	0.981334	D;D;D	0.59767	0.978;0.971;0.986	D;P;D	0.69142	0.962;0.857;0.962	T	0.77435	-0.2589	9	.	.	.	-9.5276	15.2069	0.73186	1.0:0.0:0.0:0.0	.	147;59;127	C9JPG0;B4DIP5;Q12765	.;.;SCRN1_HUMAN	S	127;127;59;127;18;147;127;127	ENSP00000242059:L127S;ENSP00000409068:L127S;ENSP00000414245:L59S;ENSP00000386872:L127S;ENSP00000407460:L18S;ENSP00000388942:L147S;ENSP00000413184:L127S;ENSP00000406289:L127S	.	L	-	2	0	SCRN1	29950282	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.339000	0.96797	2.271000	0.75665	0.459000	0.35465	TTA		0.428	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766		Missense_Mutation
SCYL1	57410	hgsc.bcm.edu	37	11	65305475	65305475	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr11:65305475A>G	ENST00000270176.5	+	16	2146	c.2069A>G	c.(2068-2070)gAg>gGg	p.E690G	SCYL1_ENST00000533862.1_Splice_Site_p.S678G|SCYL1_ENST00000524944.1_Missense_Mutation_p.E690G|SCYL1_ENST00000527009.1_Missense_Mutation_p.E547G|SCYL1_ENST00000279270.6_Missense_Mutation_p.E690G|SCYL1_ENST00000525364.1_Missense_Mutation_p.E689G|SCYL1_ENST00000534462.1_3'UTR|SCYL1_ENST00000420247.2_Missense_Mutation_p.E673G	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	690					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)	p.E690G(1)		ovary(1)|skin(1)	2						AAATCCCCAGAGTCCGACTGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											50.0	51.0	51.0					11																	65305475		1901	4125	6026	65062051	SO:0001583	missense	57410			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.2069A>G	11.37:g.65305475A>G	ENSP00000270176:p.Glu690Gly	Somatic		Capture	SOLID	Phase_IV	65062051	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	CCDS41672.1	SNP	11	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.48|11.48	1.651560|1.651560	0.29336|0.29336	.|.	.|.	ENSG00000142186|ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000279270;ENST00000524944;ENST00000527009;ENST00000528545|ENST00000533862	T;T;T;T;T;T;T|T	0.36520|0.08720	2.3;2.22;2.28;2.3;2.3;2.3;1.25|3.06	4.16|4.16	2.98|2.98	0.34508|0.34508	.|.	0.314247|.	0.21700|.	U|.	0.070431|.	T|T	0.08403|0.08403	0.0209|0.0209	L|L	0.53249|0.53249	1.67|1.67	0.43133|0.43133	D|D	0.994872|0.994872	B;P;B;B|B	0.35575|0.02656	0.191;0.51;0.29;0.191|0.0	B;B;B;B|B	0.32864|0.06405	0.073;0.154;0.098;0.073|0.002	T|T	0.15752|0.15752	-1.0426|-1.0426	10|8	0.45353|.	T|.	0.12|.	.|.	7.7708|7.7708	0.29008|0.29008	0.7869:0.213:0.0:0.0|0.7869:0.213:0.0:0.0	.|.	690;690;673;690|678	E9PS17;Q96KG9-4;Q96KG9-2;Q96KG9|Q96KG9-6	.;.;.;NTKL_HUMAN|.	G|G	690;689;673;690;690;547;162|678	ENSP00000270176:E690G;ENSP00000431635:E689G;ENSP00000408192:E673G;ENSP00000279270:E690G;ENSP00000432175:E690G;ENSP00000436993:E547G;ENSP00000433604:E162G|ENSP00000437254:S678G	ENSP00000270176:E690G|.	E|S	+|+	2|1	0|0	SCYL1|SCYL1	65062051|65062051	0.998000|0.998000	0.40836|0.40836	0.110000|0.110000	0.21437|0.21437	0.110000|0.110000	0.19582|0.19582	3.175000|3.175000	0.50855|0.50855	0.561000|0.561000	0.29186|0.29186	0.459000|0.459000	0.35465|0.35465	GAG|AGT		0.627	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680		Missense_Mutation
SEC23IP	11196	hgsc.bcm.edu	37	10	121658154	121658154	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr10:121658154C>G	ENST00000369075.3	+	2	451	c.379C>G	c.(379-381)Caa>Gaa	p.Q127E	SEC23IP_ENST00000543134.1_Intron	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	127	Interaction with SEC23A.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.Q127E(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		AACTGGATCCCAAGATGTCTC	0.478																																																1	Substitution - Missense(1)	ovary(1)	10											165.0	140.0	148.0					10																	121658154		2203	4300	6503	121648144	SO:0001583	missense	11196			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.379C>G	10.37:g.121658154C>G	ENSP00000358071:p.Gln127Glu	Somatic		Capture	SOLID	Phase_IV	121648144	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	37	CCDS7618.1	SNP	21	Baylor	.	.	.	.	.	.	.	.	.	.	C	13.02	2.110997	0.37242	.	.	ENSG00000107651	ENST00000369075	D	0.97352	-4.35	5.44	5.44	0.79542	.	0.670897	0.16279	N	0.221442	D	0.94968	0.8372	L	0.51422	1.61	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	D	0.92006	0.5614	10	0.07813	T	0.8	-11.319	19.2574	0.93951	0.0:1.0:0.0:0.0	.	127	Q9Y6Y8	S23IP_HUMAN	E	127	ENSP00000358071:Q127E	ENSP00000358071:Q127E	Q	+	1	0	SEC23IP	121648144	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	2.310000	0.43708	2.546000	0.85860	0.655000	0.94253	CAA		0.478	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1			Missense_Mutation
SH3TC2	79628	hgsc.bcm.edu	37	5	148384447	148384447	+	Missense_Mutation	SNP	C	C	T			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:148384447C>T	ENST00000515425.1	-	17	3795	c.3694G>A	c.(3694-3696)Gag>Aag	p.E1232K	SH3TC2_ENST00000538184.1_3'UTR|SH3TC2_ENST00000512049.1_Missense_Mutation_p.E1225K|SH3TC2_ENST00000502274.1_Missense_Mutation_p.E94K	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1232					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)		p.E1232K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAAGTACTCAGTGGCATCA	0.582																																																1	Substitution - Missense(1)	ovary(1)	5											66.0	65.0	65.0					5																	148384447		2203	4300	6503	148364640	SO:0001583	missense	79628			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3694G>A	5.37:g.148384447C>T	ENSP00000423660:p.Glu1232Lys	Somatic		Capture	SOLID	Phase_IV	148364640	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	SNP	29	Baylor	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293143	0.60086	.	.	ENSG00000169247	ENST00000502274;ENST00000515425;ENST00000512049	T;T;T	0.75704	0.13;-0.92;-0.96	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.280362	0.37623	N	0.002010	T	0.57519	0.2059	N	0.22421	0.69	0.80722	D	1	B;B	0.20887	0.049;0.049	B;B	0.18561	0.022;0.022	T	0.53514	-0.8428	10	0.29301	T	0.29	-11.2722	7.3563	0.26721	0.1421:0.7233:0.0:0.1346	.	1225;1232	Q14CC0;Q8TF17	.;S3TC2_HUMAN	K	94;1232;1225	ENSP00000421092:E94K;ENSP00000423660:E1232K;ENSP00000421860:E1225K	ENSP00000421092:E94K	E	-	1	0	SH3TC2	148364640	0.995000	0.38212	0.971000	0.41717	0.983000	0.72400	3.705000	0.54823	2.873000	0.98535	0.561000	0.74099	GAG		0.582	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		Missense_Mutation
SKIV2L	6499	hgsc.bcm.edu	37	6	31930761	31930761	+	Splice_Site	SNP	G	G	A			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:31930761G>A	ENST00000375394.2	+	13	1409		c.e13-1		SKIV2L_ENST00000544581.1_Splice_Site	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)						ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.?(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						TCTGTGCCCAGCGTGGGGTCG	0.567																																																1	Unknown(1)	ovary(1)	6											72.0	62.0	65.0					6																	31930761		1510	2709	4219	32038740	SO:0001630	splice_region_variant	6499				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1297-1G>A	6.37:g.31930761G>A		Somatic		Capture	SOLID	Phase_IV	32038740	O15005|Q12902|Q15476|Q5ST66	Splice_Site_SNP	SNP	ENST00000375394.2	37	CCDS4731.1	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349209	0.82132	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2295	0.86981	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SKIV2L	32038740	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.646000	0.67916	2.612000	0.88384	0.655000	0.94253	.		0.567	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		Intron	Splice_Site_SNP
SLC4A1	6521	hgsc.bcm.edu	37	17	42330613	42330613	+	Silent	SNP	G	G	A	rs150858709		TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:42330613G>A	ENST00000262418.6	-	17	2339	c.2184C>T	c.(2182-2184)acC>acT	p.T728T		NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	728	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.T728T(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CGGAACGCACGGTGGTGGCAC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12368	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	17						G		1,4405	2.1+/-5.4	0,1,2202	76.0	66.0	69.0		2184	-9.2	0.1	17	dbSNP_134	69	0,8600		0,0,4300	no	coding-synonymous	SLC4A1	NM_000342.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		728/912	42330613	1,13005	2203	4300	6503	39686139	SO:0001819	synonymous_variant	6521				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2184C>T	17.37:g.42330613G>A		Somatic		Capture	SOLID	Phase_IV	39686139	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	ENST00000262418.6	37	CCDS11481.1	SNP	39	Baylor																																																																																				0.642	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346194.1	NM_000342		Silent
SLCO4A1	28231	hgsc.bcm.edu	37	20	61299403	61299403	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr20:61299403T>A	ENST00000370507.1	+	8	1774	c.1678T>A	c.(1678-1680)Tct>Act	p.S560T	SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000451648.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.S560T|RP11-93B14.5_ENST00000433126.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	560					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.S560T(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GAATCTTTCCTCTGGTTTTGG	0.498											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(168;741 2006 10379 40139 45334)											1	Substitution - Missense(1)	ovary(1)	20											180.0	174.0	176.0					20																	61299403		2203	4300	6503	60769848	SO:0001583	missense	28231			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1678T>A	20.37:g.61299403T>A	ENSP00000359538:p.Ser560Thr	Somatic	1052	Capture	SOLID	Phase_IV	60769848	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	CCDS13501.1	SNP	54	Baylor	.	.	.	.	.	.	.	.	.	.	T	9.585	1.124542	0.20959	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.39787	1.06;1.06	4.22	4.22	0.49857	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.915506	0.08762	U	0.897602	T	0.32882	0.0844	L	0.46670	1.46	0.32232	N	0.573803	B	0.10296	0.003	B	0.14023	0.01	T	0.38950	-0.9637	10	0.15952	T	0.53	.	4.866	0.13609	0.0:0.1746:0.0:0.8254	.	560	Q96BD0	SO4A1_HUMAN	T	560;560;560;412	ENSP00000217159:S560T;ENSP00000359538:S560T	ENSP00000217159:S560T	S	+	1	0	SLCO4A1	60769848	0.167000	0.22975	0.999000	0.59377	0.879000	0.50718	-0.225000	0.09151	1.759000	0.51996	0.482000	0.46254	TCT		0.498	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354		Missense_Mutation
SMYD4	114826	hgsc.bcm.edu	37	17	1684605	1684605	+	Missense_Mutation	SNP	G	G	T	rs58337165	byFrequency	TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:1684605G>T	ENST00000305513.7	-	11	2557	c.2390C>A	c.(2389-2391)cCc>cAc	p.P797H		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	797							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.P797H(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TACAGGGGTGGGTGGTAAGTC	0.507													G|||	684	0.136581	0.2632	0.1369	5008	,	,		18163	0.128		0.0368	False		,,,				2504	0.0767															1	Substitution - Missense(1)	ovary(1)	17						G	HIS/PRO	998,3408	373.7+/-320.9	114,770,1319	99.0	92.0	94.0		2390	3.3	0.0	17	dbSNP_129	94	415,8185	128.5+/-186.7	10,395,3895	yes	missense	SMYD4	NM_052928.2	77	124,1165,5214	TT,TG,GG		4.8256,22.6509,10.8642	possibly-damaging	797/805	1684605	1413,11593	2203	4300	6503	1631355	SO:0001583	missense	114826			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.2390C>A	17.37:g.1684605G>T	ENSP00000304360:p.Pro797His	Somatic		Capture	SOLID	Phase_IV	1631355	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	ENST00000305513.7	37	CCDS11013.1	SNP	43	Baylor	318	0.14560439560439561	155	0.3150406504065041	43	0.11878453038674033	96	0.16783216783216784	24	0.0316622691292876	G	14.46	2.541339	0.45280	0.226509	0.048256	ENSG00000186532	ENST00000305513	T	0.09723	2.95	5.41	3.28	0.37604	.	0.827129	0.11012	N	0.609411	T	0.00012	0.0000	M	0.70595	2.14	0.80722	P	0.0	D	0.69078	0.997	P	0.55667	0.781	T	0.42882	-0.9425	9	0.35671	T	0.21	-3.4871	4.658	0.12628	0.0875:0.2249:0.5517:0.1359	rs58337165;rs61753097	797	Q8IYR2	SMYD4_HUMAN	H	797	ENSP00000304360:P797H	ENSP00000304360:P797H	P	-	2	0	SMYD4	1631355	0.001000	0.12720	0.003000	0.11579	0.061000	0.15899	0.860000	0.27871	1.383000	0.46405	0.561000	0.74099	CCC		0.507	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082		Missense_Mutation
SNED1	25992	hgsc.bcm.edu	37	2	242004803	242004806	+	Frame_Shift_Del	DEL	CAGG	CAGG	-			TCGA-23-1120-01	TCGA-23-1120-10	CAGG	CAGG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:242004803_242004806delCAGG	ENST00000310397.8	+	21	2802_2805	c.2802_2805delCAGG	c.(2800-2805)gccaggfs	p.AR934fs	SNED1_ENST00000405547.3_Frame_Shift_Del_p.AR934fs|AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000401884.1_Frame_Shift_Del_p.AR934fs|SNED1_ENST00000342631.6_Frame_Shift_Del_p.AR934fs	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	934	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Q936fs*47(1)		NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GTCCAGCCGCCAGGCAGATGCTTG	0.627																																																1	Deletion - Frameshift(1)	ovary(1)	2																																								241653479	SO:0001589	frameshift_variant	25992			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.2802_2805delCAGG	2.37:g.242004803_242004806delCAGG	ENSP00000308893:p.Ala934fs	Somatic		Capture	SOLID	Phase_IV	241653476	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Frame_Shift_Del	DEL	ENST00000310397.8	37	CCDS46562.1	DEL	21	Baylor																																																																																				0.627	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482		Frame_Shift_Del
SOX13	9580	hgsc.bcm.edu	37	1	204093883	204093883	+	Missense_Mutation	SNP	C	C	G			TCGA-23-1120-01	TCGA-23-1120-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:204093883C>G	ENST00000367204.1	+	13	1599	c.1490C>G	c.(1489-1491)cCc>cGc	p.P497R		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	497					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P497R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			AAGCCGCGGCCCAAGCGCACC	0.627																																																1	Substitution - Missense(1)	ovary(1)	1											20.0	24.0	22.0					1																	204093883		2199	4297	6496	202360506	SO:0001583	missense	9580				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1490C>G	1.37:g.204093883C>G	ENSP00000356172:p.Pro497Arg	Somatic		Capture	SOLID	Phase_IV	202360506	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	SNP	22	Baylor	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672969	0.88445	.	.	ENSG00000143842	ENST00000367204	T	0.61158	0.13	5.53	5.53	0.82687	High mobility group, HMG1/HMG2 (1);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.82047	-0.0651	10	0.87932	D	0	.	19.0635	0.93101	0.0:1.0:0.0:0.0	.	364;364;497	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	R	497	ENSP00000356172:P497R	ENSP00000356172:P497R	P	+	2	0	SOX13	202360506	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.779000	0.85648	2.596000	0.87737	0.491000	0.48974	CCC		0.627	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686		Missense_Mutation
STXBP5L	9515	hgsc.bcm.edu	37	3	120628437	120628437	+	Silent	SNP	T	T	C			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:120628437T>C	ENST00000273666.6	+	2	283	c.12T>C	c.(10-12)ttT>ttC	p.F4F	STXBP5L_ENST00000492541.1_Silent_p.F4F|STXBP5L_ENST00000471454.1_Silent_p.F4F|STXBP5L_ENST00000472879.1_Silent_p.F4F|STXBP5L_ENST00000497029.1_Silent_p.F4F	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	4					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F4F(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TGAAGAAGTTTAATTTCCGAA	0.438																																																1	Substitution - coding silent(1)	ovary(1)	3											46.0	48.0	47.0					3																	120628437		1872	4106	5978	122111127	SO:0001819	synonymous_variant	9515			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.12T>C	3.37:g.120628437T>C		Somatic		Capture	SOLID	Phase_IV	122111127	Q4G1B4|Q6PIC3	Silent	SNP	ENST00000273666.6	37	CCDS43137.1	SNP	61	Baylor																																																																																				0.438	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3			Silent
SVEP1	79987	hgsc.bcm.edu	37	9	113212416	113212416	+	Missense_Mutation	SNP	A	A	C			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:113212416A>C	ENST00000401783.2	-	24	4362	c.4026T>G	c.(4024-4026)tgT>tgG	p.C1342W	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Missense_Mutation_p.C1342W|SVEP1_ENST00000374469.1_Missense_Mutation_p.C1319W	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1342	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.C1342W(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CGTTCTTTCCACATCGGGTAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											247.0	231.0	236.0					9																	113212416		1893	4113	6006	112252237	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.4026T>G	9.37:g.113212416A>C	ENSP00000384917:p.Cys1342Trp	Somatic		Capture	SOLID	Phase_IV	112252237	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	SNP	6	Baylor	.	.	.	.	.	.	.	.	.	.	A	14.38	2.519637	0.44866	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	D;D;D	0.82433	-1.61;-1.61;-1.61	5.44	4.3	0.51218	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.94823	0.8328	H	0.99811	4.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.93986	0.7262	10	0.87932	D	0	.	8.6577	0.34073	0.8525:0.0:0.1475:0.0	.	1342;1342	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	W	1342;1319;1342	ENSP00000384917:C1342W;ENSP00000363593:C1319W;ENSP00000304118:C1342W	ENSP00000304118:C1342W	C	-	3	2	SVEP1	112252237	1.000000	0.71417	0.999000	0.59377	0.477000	0.33069	2.754000	0.47532	1.007000	0.39238	-0.334000	0.08254	TGT		0.458	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				Missense_Mutation
SYNE1	23345	hgsc.bcm.edu	37	6	152469323	152469324	+	Frame_Shift_Ins	INS	-	-	T	rs200663180		TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:152469323_152469324insT	ENST00000367255.5	-	137	25433_25434	c.24832_24833insA	c.(24832-24834)gtgfs	p.V8278fs	SYNE1_ENST00000423061.1_Frame_Shift_Ins_p.V8207fs|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000265368.4_Frame_Shift_Ins_p.V8278fs|SYNE1_ENST00000354674.4_Frame_Shift_Ins_p.V433fs|SYNE1_ENST00000341594.5_Frame_Shift_Ins_p.V7890fs|SYNE1_ENST00000448038.1_Frame_Shift_Ins_p.V8207fs|SYNE1_ENST00000539504.1_Frame_Shift_Ins_p.V433fs|SYNE1_ENST00000356820.4_Frame_Shift_Ins_p.V2802fs	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8278					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V8278fs*13(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGGAGTCCACACTAGCCGGG	0.609										HNSCC(10;0.0054)																																						2	Insertion - Frameshift(2)	ovary(2)	6																																								152511017	SO:0001589	frameshift_variant	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24832_24833insA	6.37:g.152469323_152469324insT	ENSP00000356224:p.Val8278fs	Somatic		Capture	SOLID	Phase_IV	152511016	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Frame_Shift_Ins	INS	ENST00000367255.5	37	CCDS5236.2	INS	6	Baylor																																																																																				0.609	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		Frame_Shift_Ins
SYTL3	94120	hgsc.bcm.edu	37	6	159084315	159084315	+	Missense_Mutation	SNP	A	A	G	rs144534535		TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr6:159084315A>G	ENST00000297239.9	+	3	209	c.15A>G	c.(13-15)atA>atG	p.I5M	SYTL3_ENST00000367081.3_5'UTR|SYTL3_ENST00000360448.3_Missense_Mutation_p.I5M			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	5	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CCCAAGAAATAGATCTGAGTG	0.562													A|||	1	0.000199681	0.0	0.0	5008	,	,		18557	0.0		0.001	False		,,,				2504	0.0															0			6											78.0	68.0	71.0					6																	159084315		2203	4300	6503	159004303	SO:0001583	missense	94120			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.15A>G	6.37:g.159084315A>G	ENSP00000297239:p.Ile5Met	Somatic		Capture	SOLID	Phase_IV	159004303	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	ENST00000297239.9	37	CCDS56458.1	SNP	15	Baylor	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	7.896	0.733457	0.15574	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239	T;T	0.19938	2.11;2.16	5.44	-3.18	0.05186	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);	0.314646	0.34959	N	0.003555	T	0.04998	0.0134	L	0.56199	1.76	0.23396	N	0.997766	B;B	0.09022	0.001;0.002	B;B	0.12837	0.002;0.008	T	0.27839	-1.0062	10	0.66056	D	0.02	.	1.1208	0.01724	0.3896:0.2624:0.1954:0.1527	.	5;5	Q4VX76;Q4VX76-2	SYTL3_HUMAN;.	M	5	ENSP00000353631:I5M;ENSP00000297239:I5M	ENSP00000297239:I5M	I	+	3	3	SYTL3	159004303	0.001000	0.12720	0.000000	0.03702	0.018000	0.09664	-0.130000	0.10498	-0.651000	0.05415	-0.256000	0.11100	ATA		0.562	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1			Missense_Mutation
TANC1	85461	hgsc.bcm.edu	37	2	160086620	160086620	+	Silent	SNP	T	T	G			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:160086620T>G	ENST00000263635.6	+	27	4920	c.4683T>G	c.(4681-4683)ccT>ccG	p.P1561P	TANC1_ENST00000454300.1_Silent_p.P1455P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1561					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTCAGAACCCTCCTCCAAGTC	0.547																																																0			2											51.0	56.0	54.0					2																	160086620		1934	4144	6078	159794866	SO:0001819	synonymous_variant	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4683T>G	2.37:g.160086620T>G		Somatic		Capture	SOLID	Phase_IV	159794866	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1	SNP	54	Baylor																																																																																				0.547	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1			Silent
TBC1D21	161514	hgsc.bcm.edu	37	15	74177227	74177227	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr15:74177227A>T	ENST00000300504.2	+	5	556	c.473A>T	c.(472-474)cAg>cTg	p.Q158L	TBC1D21_ENST00000535547.2_Missense_Mutation_p.Q122L|TBC1D21_ENST00000562056.1_Intron	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	158	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.Q158L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						TGCAACACGCAGGCAGGTGAG	0.577																																																1	Substitution - Missense(1)	ovary(1)	15											83.0	73.0	76.0					15																	74177227		2198	4297	6495	71964280	SO:0001583	missense	161514			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.473A>T	15.37:g.74177227A>T	ENSP00000300504:p.Gln158Leu	Somatic		Capture	SOLID	Phase_IV	71964280	B9A6M2	Missense_Mutation	SNP	ENST00000300504.2	37	CCDS10252.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.27	3.076745	0.55753	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.04360	3.64;3.64	5.29	5.29	0.74685	Rab-GAP/TBC domain (4);	0.253309	0.27500	N	0.019083	T	0.03434	0.0099	N	0.08118	0	0.80722	D	1	B;B	0.23185	0.081;0.024	B;B	0.24269	0.052;0.052	T	0.48843	-0.8999	10	0.87932	D	0	.	11.6003	0.50999	1.0:0.0:0.0:0.0	.	122;158	B9A6M2;Q8IYX1	.;TBC21_HUMAN	L	158;122	ENSP00000300504:Q158L;ENSP00000439325:Q122L	ENSP00000300504:Q158L	Q	+	2	0	TBC1D21	71964280	0.999000	0.42202	0.991000	0.47740	0.985000	0.73830	4.753000	0.62183	1.999000	0.58509	0.459000	0.35465	CAG		0.577	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1	NM_153356		Missense_Mutation
TBX20	57057	hgsc.bcm.edu	37	7	35242182	35242182	+	Missense_Mutation	SNP	T	T	C	rs368803336		TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:35242182T>C	ENST00000408931.3	-	8	1730	c.1204A>G	c.(1204-1206)Att>Gtt	p.I402V		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	402					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I402V(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						GAGCTGGCAATGGCCGATGGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	7						T	VAL/ILE	1,3993		0,1,1996	76.0	75.0	75.0		1204	5.7	1.0	7		75	0,8364		0,0,4182	no	missense	TBX20	NM_001077653.2	29	0,1,6178	CC,CT,TT		0.0,0.025,0.0081	benign	402/448	35242182	1,12357	1997	4182	6179	35208707	SO:0001583	missense	57057			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.1204A>G	7.37:g.35242182T>C	ENSP00000386170:p.Ile402Val	Somatic		Capture	SOLID	Phase_IV	35208707	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	CCDS43568.1	SNP	51	Baylor	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086745	0.36855	2.5E-4	0.0	ENSG00000164532	ENST00000408931	D	0.87334	-2.24	5.66	5.66	0.87406	.	.	.	.	.	T	0.73273	0.3566	N	0.08118	0	0.37795	D	0.927494	B	0.10296	0.003	B	0.14023	0.01	T	0.69975	-0.4999	9	0.15499	T	0.54	.	11.8301	0.52290	0.0:0.0:0.1462:0.8538	.	402	Q9UMR3	TBX20_HUMAN	V	402	ENSP00000386170:I402V	ENSP00000386170:I402V	I	-	1	0	TBX20	35208707	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	5.127000	0.64727	2.144000	0.66660	0.496000	0.49642	ATT		0.562	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417		Missense_Mutation
C7orf72	100130988	hgsc.bcm.edu	37	7	50180906	50180906	+	Missense_Mutation	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:50180906A>G	ENST00000297001.6	+	7	1057	c.1007A>G	c.(1006-1008)gAt>gGt	p.D336G	AC020743.2_ENST00000454877.1_RNA	NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	336								p.D336G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						AATGCTGATGATGTTGACAAC	0.403																																																1	Substitution - Missense(1)	ovary(1)	7											182.0	151.0	160.0					7																	50180906		692	1591	2283	50151452	SO:0001583	missense	100130988				CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.1007A>G	7.37:g.50180906A>G	ENSP00000297001:p.Asp336Gly	Somatic		Capture	SOLID	Phase_IV	50151452	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	37	CCDS47585.1	SNP	12	Baylor	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085054	0.55861	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.78	4.6	0.57074	.	.	.	.	.	T	0.32823	0.0842	L	0.34521	1.04	0.23361	N	0.997831	P	0.45957	0.869	P	0.45276	0.475	T	0.11842	-1.0571	8	0.72032	D	0.01	.	9.8233	0.40896	0.8272:0.1728:0.0:0.0	.	336	A4D263	CG072_HUMAN	G	336	.	ENSP00000297001:D336G	D	+	2	0	C7orf72	50151452	0.947000	0.32204	0.583000	0.28640	0.572000	0.35998	2.079000	0.41577	0.970000	0.38263	0.528000	0.53228	GAT		0.403	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834		Missense_Mutation
THADA	63892	hgsc.bcm.edu	37	2	43514123	43514123	+	Silent	SNP	T	T	C			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr2:43514123T>C	ENST00000405006.4	-	35	5439	c.5088A>G	c.(5086-5088)acA>acG	p.T1696T	THADA_ENST00000415080.2_Silent_p.T1377T|THADA_ENST00000405975.2_Silent_p.T1696T|THADA_ENST00000330266.7_Intron	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1696								p.T1696T(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GCCTAGACTCTGTAGGAAGAT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	2											90.0	90.0	90.0					2																	43514123		2000	4181	6181	43367627	SO:0001819	synonymous_variant	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.5088A>G	2.37:g.43514123T>C		Somatic		Capture	SOLID	Phase_IV	43367627	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Silent	SNP	ENST00000405006.4	37	CCDS46268.1	SNP	55	Baylor	.	.	.	.	.	.	.	.	.	.	T	6.230	0.410535	0.11812	.	.	ENSG00000115970	ENST00000407351	.	.	.	5.78	-1.72	0.08107	.	.	.	.	.	T	0.38904	0.1058	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32877	-0.9890	4	.	.	.	.	0.8662	0.01204	0.2323:0.3398:0.1538:0.2741	.	.	.	.	R	936	.	.	Q	-	2	0	THADA	43367627	0.048000	0.20356	0.997000	0.53966	0.415000	0.31203	-1.641000	0.02007	0.042000	0.15717	0.533000	0.62120	CAG		0.488	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065		Silent
TNPO2	30000	hgsc.bcm.edu	37	19	12825707	12825708	+	Frame_Shift_Ins	INS	-	-	CGTTG			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:12825707_12825708insCGTTG	ENST00000592287.1	-	9	925_926	c.817_818insCAACG	c.(817-819)gagfs	p.E273fs	TNPO2_ENST00000588216.1_Frame_Shift_Ins_p.E273fs|TNPO2_ENST00000589956.1_Intron|TNPO2_ENST00000441499.1_Frame_Shift_Ins_p.E273fs|TNPO2_ENST00000356861.5_Frame_Shift_Ins_p.E273fs|TNPO2_ENST00000425528.1_Frame_Shift_Ins_p.E273fs|TNPO2_ENST00000450764.2_Frame_Shift_Ins_p.E273fs	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	273					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.E273fs*9(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTCACAGGCCTCAAGGGCAACG	0.629																																																1	Insertion - Frameshift(1)	ovary(1)	19																																								12686708	SO:0001589	frameshift_variant	30000			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.817_818insCAACG	19.37:g.12825707_12825708insCGTTG	ENSP00000468434:p.Glu273fs	Somatic		Capture	SOLID	Phase_IV	12686707	O14655|Q6IN77	Frame_Shift_Ins	INS	ENST00000592287.1	37	CCDS45991.1	INS	54	Baylor																																																																																				0.629	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433		Frame_Shift_Ins
TNS4	84951	hgsc.bcm.edu	37	17	38638615	38638616	+	Frame_Shift_Ins	INS	-	-	T			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:38638615_38638616insT	ENST00000254051.6	-	7	1712_1713	c.1554_1555insA	c.(1552-1557)aaaggafs	p.G519fs		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	519	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)		p.G519fs*9(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGATGCACTCCTTTGGCAGACG	0.564																																																1	Insertion - Frameshift(1)	ovary(1)	17																																								35892142	SO:0001589	frameshift_variant	84951			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1555dupA	17.37:g.38638618_38638618dupT	ENSP00000254051:p.Gly519fs	Somatic		Capture	SOLID	Phase_IV	35892141	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Frame_Shift_Ins	INS	ENST00000254051.6	37	CCDS11368.1	INS	24	Baylor																																																																																				0.564	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865		Frame_Shift_Ins
TRIP10	9322	hgsc.bcm.edu	37	19	6750598	6750598	+	Silent	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:6750598A>G	ENST00000313244.9	+	14	1646	c.1611A>G	c.(1609-1611)gaA>gaG	p.E537E	CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000596758.1_Silent_p.E481E|TRIP10_ENST00000313285.8_Silent_p.E481E|TRIP10_ENST00000600428.1_Silent_p.E373E			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	537	Interaction with CDC42.|Interaction with DNM1 and WASL.|Interaction with DNM2 and WASL. {ECO:0000250}.|Interaction with PDE6G. {ECO:0000250}.|Required for interaction with FASLG and localization to lysosomes.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						TCGAGGAGGAACCCACATCCC	0.547																																																0			19											103.0	86.0	92.0					19																	6750598		2203	4300	6503	6701598	SO:0001819	synonymous_variant	9322			AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1611A>G	19.37:g.6750598A>G		Somatic		Capture	SOLID	Phase_IV	6701598	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Silent	SNP	ENST00000313244.9	37		SNP	2	Baylor																																																																																				0.547	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2			Silent
TRPV2	51393	hgsc.bcm.edu	37	17	16330175	16330175	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr17:16330175A>T	ENST00000338560.7	+	7	1634	c.1235A>T	c.(1234-1236)cAg>cTg	p.Q412L	AC093484.4_ENST00000441875.1_RNA|TRPV2_ENST00000577397.1_Splice_Site	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	412					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GCCTACCATCAGCCTACCCTG	0.532																																																0			17											96.0	76.0	82.0					17																	16330175		2203	4300	6503	16270900	SO:0001583	missense	51393			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1235A>T	17.37:g.16330175A>T	ENSP00000342222:p.Gln412Leu	Somatic		Capture	SOLID	Phase_IV	16270900	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	SNP	7	Baylor	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551603	0.65311	.	.	ENSG00000187688	ENST00000338560	D	0.88818	-2.43	5.78	5.78	0.91487	.	0.404574	0.30584	N	0.009316	D	0.87136	0.6102	L	0.54323	1.7	0.80722	D	1	P	0.41420	0.749	B	0.43225	0.412	D	0.87451	0.2401	10	0.62326	D	0.03	-28.0105	9.7279	0.40344	0.9233:0.0:0.0767:0.0	.	412	Q9Y5S1	TRPV2_HUMAN	L	412	ENSP00000342222:Q412L	ENSP00000342222:Q412L	Q	+	2	0	TRPV2	16270900	0.844000	0.29557	1.000000	0.80357	0.853000	0.48598	2.997000	0.49457	2.208000	0.71279	0.455000	0.32223	CAG		0.532	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113		Missense_Mutation
TXNDC15	79770	hgsc.bcm.edu	37	5	134210206	134210206	+	Frame_Shift_Del	DEL	T	T	-			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr5:134210206delT	ENST00000358387.4	+	1	714	c.89delT	c.(88-90)gtcfs	p.V30fs	TXNDC15_ENST00000546290.1_5'Flank	NM_024715.3	NP_078991.3	Q96J42	TXD15_HUMAN	thioredoxin domain containing 15	30					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)		p.V30fs*63(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGACTTCCCGTCCGCGGCGTG	0.716																																																1	Deletion - Frameshift(1)	ovary(1)	5											54.0	60.0	58.0					5																	134210206		2202	4298	6500	134238105	SO:0001589	frameshift_variant	79770			AK026278	CCDS4180.1	5q31.1	2008-02-05	2007-08-16	2007-08-16	ENSG00000113621	ENSG00000113621			20652	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 14"""	C5orf14			Standard	NM_024715		Approved	2310047H23Rik, FLJ22625	uc003lac.1	Q96J42	OTTHUMG00000129115	ENST00000358387.4:c.89delT	5.37:g.134210206delT	ENSP00000351157:p.Val30fs	Somatic		Capture	SOLID	Phase_IV	134238105	D3DQA9|Q96MT2|Q9H639	Frame_Shift_Del	DEL	ENST00000358387.4	37	CCDS4180.1	DEL	58	Baylor																																																																																				0.716	TXNDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251160.1	NM_024715		Frame_Shift_Del
SUN1	23353	hgsc.bcm.edu	37	7	894583	894583	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr7:894583A>T	ENST00000405266.1	+	12	1425	c.1401A>T	c.(1399-1401)gaA>gaT	p.E467D	SUN1_ENST00000425407.2_Missense_Mutation_p.E347D|SUN1_ENST00000456758.2_Missense_Mutation_p.E619D|SUN1_ENST00000413514.2_Missense_Mutation_p.E228D|SUN1_ENST00000452783.2_Missense_Mutation_p.E327D|SUN1_ENST00000401592.1_Missense_Mutation_p.E430D|SUN1_ENST00000389574.3_Missense_Mutation_p.E347D			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	457					cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCACCAAGAACATGAAGTGC	0.373																																																0			7											115.0	103.0	107.0					7																	894583		1863	4105	5968	861109	SO:0001583	missense	23353			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.1401A>T	7.37:g.894583A>T	ENSP00000384116:p.Glu467Asp	Somatic		Capture	SOLID	Phase_IV	861109	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	37		SNP	2	Baylor	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.420|7.420	0.636580|0.636580	0.14386|0.14386	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514|ENST00000433212	T;T;T;T;T;T;T;T|.	0.25414|.	2.12;2.16;2.16;2.15;2.16;2.16;1.81;1.8|.	4.77|4.77	-4.38|-4.38	0.03622|0.03622	.|.	0.457002|.	0.26136|.	N|.	0.026124|.	T|T	0.19087|0.19087	0.0458|0.0458	N|N	0.16656|0.16656	0.425|0.425	0.30967|0.30967	N|N	0.722943|0.722943	B;B;B;B;B;B|.	0.15719|.	0.002;0.001;0.014;0.006;0.008;0.014|.	B;B;B;B;B;B|.	0.19946|.	0.006;0.008;0.015;0.006;0.015;0.027|.	T|T	0.29941|0.29941	-0.9995|-0.9995	10|5	0.20046|.	T|.	0.44|.	-13.2385|-13.2385	1.6791|1.6791	0.02828|0.02828	0.3311:0.2537:0.2977:0.1175|0.3311:0.2537:0.2977:0.1175	.|.	228;327;430;619;457;347|.	E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5|.	.;.;.;.;SUN1_HUMAN;.|.	D|S	619;347;327;467;430;457;347;355;228|279	ENSP00000388743:E619D;ENSP00000374225:E347D;ENSP00000413439:E327D;ENSP00000384116:E467D;ENSP00000384015:E430D;ENSP00000392309:E347D;ENSP00000409909:E355D;ENSP00000389313:E228D|.	ENSP00000297445:E457D|.	E|T	+|+	3|1	2|0	SUN1|SUN1	861109|861109	0.162000|0.162000	0.22906|0.22906	0.098000|0.098000	0.21074|0.21074	0.122000|0.122000	0.20287|0.20287	-0.782000|-0.782000	0.04643|0.04643	-0.985000|-0.985000	0.03503|0.03503	-0.256000|-0.256000	0.11100|0.11100	GAA|ACA		0.373	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154		Missense_Mutation
USP24	23358	hgsc.bcm.edu	37	1	55600023	55600023	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:55600023G>C	ENST00000294383.6	-	29	3264	c.3265C>G	c.(3265-3267)Ctc>Gtc	p.L1089V	USP24_ENST00000407756.1_Missense_Mutation_p.L929V	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1089					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.L1006V(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AGATTGGCGAGCTGATAAAGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	1											35.0	34.0	34.0					1																	55600023		1832	4087	5919	55372611	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3265C>G	1.37:g.55600023G>C	ENSP00000294383:p.Leu1089Val	Somatic		Capture	SOLID	Phase_IV	55372611	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	SNP	34	Baylor	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193058	0.58017	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.04234	3.71;3.67	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.11922	0.0290	L	0.44542	1.39	0.80722	D	1	D	0.61080	0.989	P	0.52957	0.714	T	0.02173	-1.1201	10	0.33141	T	0.24	.	20.5752	0.99366	0.0:0.0:1.0:0.0	.	929	B7WPF4	.	V	1089;929	ENSP00000294383:L1089V;ENSP00000385700:L929V	ENSP00000294383:L1089V	L	-	1	0	USP24	55372611	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.476000	0.97823	2.868000	0.98415	0.557000	0.71058	CTC		0.378	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2			Missense_Mutation
VAV3	10451	hgsc.bcm.edu	37	1	108298100	108298100	+	Silent	SNP	A	A	G			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr1:108298100A>G	ENST00000370056.4	-	12	1396	c.1122T>C	c.(1120-1122)gaT>gaC	p.D374D	VAV3_ENST00000371846.4_Silent_p.D309D|VAV3_ENST00000527011.1_Silent_p.D374D|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	374					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.D374D(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GGGTCTCATTATCTCTTTTCA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	1											84.0	81.0	82.0					1																	108298100		2203	4300	6503	108099623	SO:0001819	synonymous_variant	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1122T>C	1.37:g.108298100A>G		Somatic		Capture	SOLID	Phase_IV	108099623	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	CCDS785.1	SNP	16	Baylor	.	.	.	.	.	.	.	.	.	.	A	9.113	1.007034	0.19199	.	.	ENSG00000134215	ENST00000490388	.	.	.	5.61	3.31	0.37934	.	.	.	.	.	T	0.43456	0.1248	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33777	-0.9855	4	.	.	.	.	8.0842	0.30762	0.7055:0.0:0.2945:0.0	.	.	.	.	T	369	.	.	I	-	2	0	VAV3	108099623	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.916000	0.28651	0.424000	0.26061	0.533000	0.62120	ATA		0.378	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113		Silent
VWF	7450	hgsc.bcm.edu	37	12	6103046	6103047	+	Frame_Shift_Ins	INS	-	-	C			TCGA-23-1120-01	TCGA-23-1120-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr12:6103046_6103047insC	ENST00000261405.5	-	37	6833_6834	c.6579_6580insG	c.(6577-6582)tggaggfs	p.R2194fs		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2194					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.R2194fs*4(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TCAGGTGTCCTCCAGTCAACGC	0.545																																																1	Insertion - Frameshift(1)	ovary(1)	12																																								5973308	SO:0001589	frameshift_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6580dupG	12.37:g.6103048_6103048dupC	ENSP00000261405:p.Arg2194fs	Somatic		Capture	SOLID	Phase_IV	5973307	Q8TCE8|Q99806	Frame_Shift_Ins	INS	ENST00000261405.5	37	CCDS8539.1	INS	54	Baylor																																																																																				0.545	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		Frame_Shift_Ins
ZDHHC12	84885	hgsc.bcm.edu	37	9	131483625	131483626	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-23-1120-01	TCGA-23-1120-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr9:131483625_131483626delTT	ENST00000372663.4	-	5	650_651	c.638_639delAA	c.(637-639)gaafs	p.E213fs	ZDHHC12_ENST00000467312.1_5'UTR|ZDHHC12_ENST00000372672.2_Intron|ZDHHC12_ENST00000372667.5_Frame_Shift_Del_p.E227fs	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	213					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.E213fs*44(1)		central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						AGGAGATGAATTCCCAGGTGGT	0.634																																																1	Deletion - Frameshift(1)	ovary(1)	9																																								130523447	SO:0001589	frameshift_variant	84885			AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.638_639delAA	9.37:g.131483625_131483626delTT	ENSP00000361748:p.Glu213fs	Somatic		Capture	SOLID	Phase_IV	130523446	A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Frame_Shift_Del	DEL	ENST00000372663.4	37	CCDS6909.1	DEL	52	Baylor																																																																																				0.634	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054484.1	NM_032799		Frame_Shift_Del
ZNF197	10168	hgsc.bcm.edu	37	3	44672579	44672579	+	Missense_Mutation	SNP	A	A	T			TCGA-23-1120-01	TCGA-23-1120-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:44672579A>T	ENST00000396058.1	+	2	583	c.416A>T	c.(415-417)gAc>gTc	p.D139V	RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Missense_Mutation_p.D139V|ZNF197_ENST00000383744.4_Missense_Mutation_p.D139V|ZNF197_ENST00000344387.4_Missense_Mutation_p.D139V			O14709	ZN197_HUMAN	zinc finger protein 197	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AAGGATCAGGACACTCTCCAG	0.483																																																0			3											105.0	92.0	97.0					3																	44672579		2203	4300	6503	44647583	SO:0001583	missense	10168			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.416A>T	3.37:g.44672579A>T	ENSP00000379370:p.Asp139Val	Somatic		Capture	SOLID	Phase_IV	44647583	B2RAH8|Q86VG0	Missense_Mutation	SNP	ENST00000396058.1	37	CCDS2717.1	SNP	10	Baylor	.	.	.	.	.	.	.	.	.	.	A	0.644	-0.812256	0.02798	.	.	ENSG00000186448	ENST00000383744;ENST00000536299;ENST00000344387;ENST00000383745;ENST00000396058	T;T;T;T	0.06687	5.57;3.27;5.57;3.27	4.53	3.37	0.38596	Transcription regulator SCAN (1);	0.000000	0.40385	N	0.001103	T	0.12860	0.0312	L	0.29908	0.895	0.09310	N	0.999999	B;D	0.76494	0.002;0.999	B;D	0.80764	0.002;0.994	T	0.15780	-1.0425	10	0.16420	T	0.52	.	7.0438	0.25035	0.8957:0.0:0.1043:0.0	.	139;139	Q86VG0;O14709	.;ZN197_HUMAN	V	139	ENSP00000373250:D139V;ENSP00000345809:D139V;ENSP00000373251:D139V;ENSP00000379370:D139V	ENSP00000345809:D139V	D	+	2	0	ZNF197	44647583	0.284000	0.24287	0.027000	0.17364	0.079000	0.17450	1.033000	0.30191	0.852000	0.35287	-0.274000	0.10170	GAC		0.483	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991		Missense_Mutation
ZNF148	7707	hgsc.bcm.edu	37	3	124952176	124952176	+	Missense_Mutation	SNP	T	T	A			TCGA-23-1120-01	TCGA-23-1120-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr3:124952176T>A	ENST00000360647.4	-	9	1879	c.1394A>T	c.(1393-1395)gAt>gTt	p.D465V	ZNF148_ENST00000484491.1_Missense_Mutation_p.D465V|ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000485866.1_Missense_Mutation_p.D465V|SLC12A8_ENST00000423114.2_Intron|ZNF148_ENST00000492394.1_Missense_Mutation_p.D465V|ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000468369.1_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	465					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.D465V(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						CATGGCATCATCATAATTAGT	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											112.0	113.0	113.0					3																	124952176		2203	4300	6503	126434866	SO:0001583	missense	7707			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.1394A>T	3.37:g.124952176T>A	ENSP00000353863:p.Asp465Val	Somatic		Capture	SOLID	Phase_IV	126434866	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	37	CCDS3031.1	SNP	50	Baylor	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910349	0.72983	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.49	5.49	0.81192	.	0.043864	0.85682	D	0.000000	T	0.71484	0.3345	M	0.65975	2.015	0.80722	D	1	D	0.54601	0.967	P	0.52909	0.713	T	0.75744	-0.3210	10	0.87932	D	0	-16.2112	15.7623	0.78096	0.0:0.0:0.0:1.0	.	465	Q9UQR1	ZN148_HUMAN	V	465	ENSP00000353863:D465V;ENSP00000420335:D465V;ENSP00000419322:D465V;ENSP00000420448:D465V	ENSP00000353863:D465V	D	-	2	0	ZNF148	126434866	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	6.127000	0.71642	2.311000	0.77944	0.533000	0.62120	GAT		0.443	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964		Missense_Mutation
ZNF395	55893	hgsc.bcm.edu	37	8	28206644	28206644	+	Silent	SNP	G	G	T			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr8:28206644G>T	ENST00000344423.5	-	9	1559	c.1428C>A	c.(1426-1428)gcC>gcA	p.A476A	ZNF395_ENST00000523202.1_Silent_p.A476A|ZNF395_ENST00000523095.1_Silent_p.A476A	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CATCTCACCTGGCACCACTCT	0.617																																																0			8											112.0	117.0	115.0					8																	28206644		2203	4300	6503	28262563	SO:0001819	synonymous_variant	55893			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1428C>A	8.37:g.28206644G>T		Somatic		Capture	SOLID	Phase_IV	28262563	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Silent	SNP	ENST00000344423.5	37	CCDS6067.1	SNP	47	Baylor																																																																																				0.617	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1			Silent
ZNF536	9745	hgsc.bcm.edu	37	19	31039137	31039137	+	Missense_Mutation	SNP	G	G	C			TCGA-23-1120-01	TCGA-23-1120-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	WXS	Unknown	.	.	Illumina GAIIx	TCGA-23-1120-01	TCGA-23-1120-10	g.chr19:31039137G>C	ENST00000355537.3	+	4	2758	c.2611G>C	c.(2611-2613)Ggg>Cgg	p.G871R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	871					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G871R(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGATCACTCGGGGCAGGCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	74.0	72.0					19																	31039137		2203	4300	6503	35730977	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2611G>C	19.37:g.31039137G>C	ENSP00000347730:p.Gly871Arg	Somatic		Capture	SOLID	Phase_IV	35730977	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	SNP	43	Baylor	.	.	.	.	.	.	.	.	.	.	G	1.482	-0.556844	0.03967	.	.	ENSG00000198597	ENST00000355537	T	0.07567	3.18	5.71	5.71	0.89125	.	0.276358	0.41823	N	0.000805	T	0.15003	0.0362	N	0.14661	0.345	0.53005	D	0.999966	D;D	0.71674	0.998;0.998	P;P	0.62649	0.905;0.905	T	0.16305	-1.0407	10	0.36615	T	0.2	-28.5431	19.8413	0.96690	0.0:0.0:1.0:0.0	.	871;871	A7E228;O15090	.;ZN536_HUMAN	R	871	ENSP00000347730:G871R	ENSP00000347730:G871R	G	+	1	0	ZNF536	35730977	1.000000	0.71417	0.270000	0.24601	0.033000	0.12548	4.345000	0.59360	2.705000	0.92388	0.579000	0.79373	GGG		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		Missense_Mutation
