#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_classification	i_context	i_dataset	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_type
SLC45A1	50651	broad.mit.edu	37	1	8390598	8390598	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:8390598G>A	ENST00000471889.1	+	5	1430	c.1045G>A	c.(1045-1047)Ggc>Agc	p.G349S	Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000377479.2_Missense_Mutation_p.G383S|SLC45A1_ENST00000481265.1_3'UTR|SLC45A1_ENST00000289877.8_Missense_Mutation_p.G349S			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	349					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)	p.G349S(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCAAGTACGGCAGCTTCAT	0.642																																																1	Substitution - Missense(1)	ovary(1)	1											38.0	38.0	38.0					1																	8390598		2199	4298	6497	8313185	SO:0001583	missense	50651			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1045G>A	1.37:g.8390598G>A	ENSP00000418096:p.Gly349Ser	Unknown		x	x	x	8313185	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	SNP	39	Broad	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764071	0.89932	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.46063	0.99;0.88;0.99	4.66	4.66	0.58398	.	0.049877	0.85682	D	0.000000	T	0.60274	0.2256	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58148	-0.7687	10	0.33141	T	0.24	-38.2574	16.5386	0.84378	0.0:0.0:1.0:0.0	.	349	Q9Y2W3	S45A1_HUMAN	S	349;383;349	ENSP00000418096:G349S;ENSP00000366699:G383S;ENSP00000289877:G349S	ENSP00000289877:G349S	G	+	1	0	SLC45A1	8313185	1.000000	0.71417	0.990000	0.47175	0.777000	0.43975	9.356000	0.97091	2.121000	0.65114	0.561000	0.74099	GGC		0.642	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5			Missense_Mutation
PTCHD2	57540	broad.mit.edu	37	1	11561401	11561401	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:11561401C>T	ENST00000294484.6	+	2	490	c.352C>T	c.(352-354)Cgt>Tgt	p.R118C	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R118C	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	118					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.R335C(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGCCTCACAGCGTTTCGACGC	0.592																																																1	Substitution - Missense(1)	ovary(1)	1											65.0	65.0	65.0					1																	11561401		2104	4217	6321	11483988	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.352C>T	1.37:g.11561401C>T	ENSP00000294484:p.Arg118Cys	Unknown		x	x	x	11483988	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266555	0.80358	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.25912	1.77;1.77	5.8	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.40222	0.1108	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.19712	-1.0297	10	0.87932	D	0	-5.7102	14.7923	0.69851	0.1446:0.8554:0.0:0.0	.	118	Q9P2K9	PTHD2_HUMAN	C	118	ENSP00000294484:R118C;ENSP00000374226:R118C	ENSP00000294484:R118C	R	+	1	0	PTCHD2	11483988	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	4.348000	0.59379	2.735000	0.93741	0.655000	0.94253	CGT		0.592	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561		Missense_Mutation
OSCP1	127700	broad.mit.edu	37	1	36888400	36888400	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:36888400C>T	ENST00000356637.5	-	7	811	c.748G>A	c.(748-750)Gga>Aga	p.G250R	OSCP1_ENST00000315643.9_Missense_Mutation_p.G250R|OSCP1_ENST00000495222.1_5'UTR|OSCP1_ENST00000235532.5_Missense_Mutation_p.G240R|OSCP1_ENST00000433045.2_Missense_Mutation_p.G195R			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	250					transport (GO:0006810)	plasma membrane (GO:0005886)		p.G250R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						ACTCGGTCTCCATAAAGTTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											135.0	124.0	128.0					1																	36888400		2203	4300	6503	36660987	SO:0001583	missense	127700				CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.748G>A	1.37:g.36888400C>T	ENSP00000349052:p.Gly250Arg	Unknown		x	x	x	36660987	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	ENST00000356637.5	37		SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	32	5.162405	0.94727	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045;ENST00000445843;ENST00000315643	T;T;T;T;T	0.36340	1.81;1.84;1.41;1.26;1.81	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.51770	0.1694	M	0.72894	2.215	0.80722	D	1	D;P	0.54964	0.969;0.947	P;B	0.50659	0.647;0.445	T	0.56353	-0.7993	10	0.87932	D	0	.	18.6261	0.91340	0.0:1.0:0.0:0.0	.	240;250	Q8WVF1-3;Q8WVF1	.;OSCP1_HUMAN	R	240;250;195;210;250	ENSP00000235532:G240R;ENSP00000349052:G250R;ENSP00000390820:G195R;ENSP00000396417:G210R;ENSP00000314541:G250R	ENSP00000235532:G240R	G	-	1	0	OSCP1	36660987	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.027000	0.76463	2.657000	0.90304	0.655000	0.94253	GGA		0.383	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000389759.1	NM_145047		Missense_Mutation
FLG	2312	broad.mit.edu	37	1	152278672	152278672	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:152278672C>T	ENST00000368799.1	-	3	8725	c.8690G>A	c.(8689-8691)aGt>aAt	p.S2897N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2897	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S2897N(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCCCTCACTGTCACTGTC	0.567									Ichthyosis																																							1	Substitution - Missense(1)	ovary(1)	1											109.0	175.0	154.0					1																	152278672		2034	4296	6330	150545296	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8690G>A	1.37:g.152278672C>T	ENSP00000357789:p.Ser2897Asn	Unknown		x	x	x	150545296	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509212	0.27036	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.10288	2.89	3.27	3.27	0.37495	.	.	.	.	.	T	0.19406	0.0466	M	0.77820	2.39	0.09310	N	1	D	0.89917	1.0	D	0.72982	0.979	T	0.01819	-1.1267	9	0.72032	D	0.01	.	10.243	0.43324	0.0:1.0:0.0:0.0	.	2897	P20930	FILA_HUMAN	N	2897;159	ENSP00000357789:S2897N	ENSP00000357786:S159N	S	-	2	0	FLG	150545296	0.000000	0.05858	0.004000	0.12327	0.009000	0.06853	-0.208000	0.09371	1.813000	0.52934	0.306000	0.20318	AGT		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		Missense_Mutation
CRTC2	200186	broad.mit.edu	37	1	153921792	153921792	+	Silent	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:153921792T>A	ENST00000368633.1	-	12	1600	c.1473A>T	c.(1471-1473)ccA>ccT	p.P491P	DENND4B_ENST00000361217.4_5'Flank|CRTC2_ENST00000368630.3_Silent_p.P171P	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	491					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.P491P(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GAACCAGACTTGGGGAGCTGT	0.572																																																1	Substitution - coding silent(1)	ovary(1)	1											57.0	60.0	59.0					1																	153921792		2203	4300	6503	152188416	SO:0001819	synonymous_variant	200186			AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1473A>T	1.37:g.153921792T>A		Unknown		x	x	x	152188416	Q6UUV8|Q7Z3X7|Q8N332	Silent	SNP	ENST00000368633.1	37	CCDS30875.1	SNP	63	Broad																																																																																				0.572	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715		Silent
SUCO	51430	broad.mit.edu	37	1	172520743	172520743	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:172520743G>A	ENST00000263688.3	+	2	373	c.154G>A	c.(154-156)Gaa>Aaa	p.E52K	SUCO_ENST00000367723.4_Missense_Mutation_p.E247K|SUCO_ENST00000610051.1_Missense_Mutation_p.E52K|SUCO_ENST00000608151.1_Missense_Mutation_p.E248K	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	52					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)		p.E52K(1)									ACTAGAAAATGAAGATGTACA	0.368																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	83.0	84.0					1																	172520743		2203	4300	6503	170787366	SO:0001583	missense	51430			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.154G>A	1.37:g.172520743G>A	ENSP00000263688:p.Glu52Lys	Unknown		x	x	x	170787366	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775901	0.49786	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.69	3.8	0.43715	.	0.173923	0.40554	N	0.001076	T	0.34106	0.0886	L	0.32530	0.975	0.39238	D	0.963805	B;D;P;P	0.53885	0.001;0.963;0.953;0.9	B;P;P;P	0.50825	0.002;0.651;0.551;0.493	T	0.30149	-0.9988	9	0.66056	D	0.02	-7.2602	7.9261	0.29876	0.0859:0.1611:0.753:0.0	.	52;52;248;52	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	K	248;52	.	ENSP00000263688:E52K	E	+	1	0	C1orf9	170787366	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	4.340000	0.59328	0.737000	0.32582	-0.237000	0.12165	GAA		0.368	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227		Missense_Mutation
TNR	7143	broad.mit.edu	37	1	175375513	175375513	+	Missense_Mutation	SNP	G	G	C	rs140600179	byFrequency	TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:175375513G>C	ENST00000367674.2	-	3	1046	c.338C>G	c.(337-339)aCc>aGc	p.T113S	TNR_ENST00000263525.2_Missense_Mutation_p.T113S			Q92752	TENR_HUMAN	tenascin R	113					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.T113S(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GTGTGTAAAGGTGACCTGGCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	1											214.0	176.0	188.0					1																	175375513		2203	4300	6503	173642136	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.338C>G	1.37:g.175375513G>C	ENSP00000356646:p.Thr113Ser	Unknown		x	x	x	173642136	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333290	0.81801	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.30714	1.52;1.52	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	L	0.58101	1.795	0.51482	D	0.999923	D;D	0.76494	0.997;0.999	D;D	0.78314	0.97;0.991	T	0.55341	-0.8156	10	0.66056	D	0.02	.	18.4464	0.90685	0.0:0.0:1.0:0.0	.	113;113	B4DIX8;Q92752	.;TENR_HUMAN	S	113	ENSP00000356646:T113S;ENSP00000263525:T113S	ENSP00000263525:T113S	T	-	2	0	TNR	173642136	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.930000	0.87610	2.445000	0.82738	0.561000	0.74099	ACC		0.587	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		Missense_Mutation
TNR	7143	broad.mit.edu	37	1	175375818	175375818	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:175375818C>A	ENST00000367674.2	-	3	741	c.33G>T	c.(31-33)aaG>aaT	p.K11N	TNR_ENST00000263525.2_Missense_Mutation_p.K11N			Q92752	TENR_HUMAN	tenascin R	11					associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.K11N(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGAGCATGTTCTTCAGAACCA	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											153.0	138.0	143.0					1																	175375818		2203	4300	6503	173642441	SO:0001583	missense	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.33G>T	1.37:g.175375818C>A	ENSP00000356646:p.Lys11Asn	Unknown		x	x	x	173642441	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	SNP	32	Broad	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420397	0.42918	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.27256	1.68;1.68	5.56	4.65	0.58169	.	0.451738	0.24172	N	0.040883	T	0.17916	0.0430	L	0.34521	1.04	0.26972	N	0.965578	P;P	0.47106	0.89;0.651	B;B	0.38378	0.272;0.15	T	0.11743	-1.0575	10	0.62326	D	0.03	.	9.0317	0.36262	0.0:0.7739:0.0:0.2261	.	11;11	B4DIX8;Q92752	.;TENR_HUMAN	N	11	ENSP00000356646:K11N;ENSP00000263525:K11N	ENSP00000263525:K11N	K	-	3	2	TNR	173642441	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	0.371000	0.20450	1.348000	0.45733	-0.258000	0.10820	AAG		0.542	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285		Missense_Mutation
CRB1	23418	broad.mit.edu	37	1	197396584	197396584	+	Splice_Site	SNP	A	A	G	rs145282040		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:197396584A>G	ENST00000367400.3	+	7	2264	c.2129A>G	c.(2128-2130)gAg>gGg	p.E710G	CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000544212.1_Splice_Site_p.E191G|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Splice_Site_p.E598G|CRB1_ENST00000535699.1_Splice_Site_p.E641G|CRB1_ENST00000367397.1_Splice_Site_p.E91G	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	710			E -> Q (in LCA8). {ECO:0000269|PubMed:15024725}.|E -> V (in RP12). {ECO:0000269|PubMed:20591486, ECO:0000269|PubMed:20956273}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E710G(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GACATTGAAGAGTATGTGGCA	0.413																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	55.0	57.0					1																	197396584		2203	4300	6503	195663207	SO:0001630	splice_region_variant	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2129-1A>G	1.37:g.197396584A>G		Unknown		x	x	x	195663207	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	SNP	11	Broad	.	.	.	.	.	.	.	.	.	.	A	14.18	2.459088	0.43634	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32	5.75	3.37	0.38596	Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	D	0.88829	0.6543	M	0.84511	2.7	0.58432	D	0.999999	P;B;D;B	0.89917	0.547;0.285;1.0;0.412	B;B;D;B	0.97110	0.162;0.275;1.0;0.078	D	0.87170	0.2220	8	.	.	.	.	9.1357	0.36872	0.7467:0.1298:0.0:0.1235	.	641;598;359;710	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	G	641;710;598;191;91;359	ENSP00000438786:E641G;ENSP00000356370:E710G;ENSP00000356369:E598G;ENSP00000444556:E191G;ENSP00000356367:E91G	.	E	+	2	0	CRB1	195663207	1.000000	0.71417	0.300000	0.25030	0.033000	0.12548	5.546000	0.67243	0.404000	0.25506	0.528000	0.53228	GAG		0.413	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	Missense_Mutation	Missense_Mutation
CACNA1S	779	broad.mit.edu	37	1	201061172	201061172	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:201061172C>T	ENST00000362061.3	-	4	695	c.469G>A	c.(469-471)Gcc>Acc	p.A157T	CACNA1S_ENST00000367338.3_Missense_Mutation_p.A157T	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	157					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A157T(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCAAGCCGGCTCCTTTGCTG	0.602																																																1	Substitution - Missense(1)	ovary(1)	1											95.0	91.0	92.0					1																	201061172		2203	4300	6503	199327795	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.469G>A	1.37:g.201061172C>T	ENSP00000355192:p.Ala157Thr	Unknown		x	x	x	199327795	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518782	0.85495	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97455	-4.39;-4.39	4.48	4.48	0.54585	Ion transport (1);	0.237466	0.41500	D	0.000869	D	0.94311	0.8172	L	0.39692	1.235	0.39254	D	0.964081	B	0.27997	0.197	B	0.27262	0.078	D	0.93586	0.6917	10	0.37606	T	0.19	.	14.9994	0.71459	0.0:1.0:0.0:0.0	.	157	Q13698	CAC1S_HUMAN	T	157	ENSP00000355192:A157T;ENSP00000356307:A157T	ENSP00000355192:A157T	A	-	1	0	CACNA1S	199327795	0.999000	0.42202	0.939000	0.37840	0.989000	0.77384	5.889000	0.69766	2.198000	0.70561	0.655000	0.94253	GCC		0.602	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069		Missense_Mutation
KISS1	3814	broad.mit.edu	37	1	204161957	204161957	+	Silent	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:204161957G>T	ENST00000367194.4	-	2	196	c.48C>A	c.(46-48)acC>acA	p.T16T		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	16					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.T16T(1)		large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CCCCAAAGTGGGTGGCACAGA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	1											32.0	32.0	32.0					1																	204161957		1867	4109	5976	202428580	SO:0001819	synonymous_variant	3814			U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.48C>A	1.37:g.204161957G>T		Unknown		x	x	x	202428580	A8K6N0|Q9HBP1	Silent	SNP	ENST00000367194.4	37	CCDS41454.1	SNP	43	Broad																																																																																				0.532	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087892.1	NM_002256		Silent
SYT14	255928	broad.mit.edu	37	1	210194567	210194567	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:210194567A>T	ENST00000472886.1	+	4	424	c.410A>T	c.(409-411)gAt>gTt	p.D137V	SYT14_ENST00000367015.1_Missense_Mutation_p.D99V|SYT14_ENST00000422431.1_Missense_Mutation_p.D182V|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.D99V|SYT14_ENST00000399639.2_Missense_Mutation_p.D137V|SYT14_ENST00000367019.1_Missense_Mutation_p.D137V|SYT14_ENST00000534859.1_Missense_Mutation_p.D137V			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	137					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)	p.D137V(1)		endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GCAGAGTATGATGGATACAGT	0.388																																																1	Substitution - Missense(1)	ovary(1)	1											117.0	106.0	110.0					1																	210194567		2203	4300	6503	208261190	SO:0001583	missense	255928			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.410A>T	1.37:g.210194567A>T	ENSP00000418901:p.Asp137Val	Unknown		x	x	x	208261190	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	SNP	12	Broad	.	.	.	.	.	.	.	.	.	.	A	23.0	4.368445	0.82463	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.19938	3.22;3.09;2.11;3.36;3.09;3.35;3.36	5.15	5.15	0.70609	.	0.051803	0.64402	D	0.000001	T	0.35480	0.0933	L	0.54323	1.7	0.80722	D	1	D;P;D;P	0.61080	0.974;0.627;0.989;0.914	P;B;P;P	0.55391	0.497;0.139;0.775;0.475	T	0.08146	-1.0736	10	0.56958	D	0.05	-14.1983	15.2559	0.73585	1.0:0.0:0.0:0.0	.	165;137;137;182	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	V	182;137;137;99;137;137;99	ENSP00000389039:D182V;ENSP00000442891:D137V;ENSP00000445837:D137V;ENSP00000437423:D99V;ENSP00000355986:D137V;ENSP00000418901:D137V;ENSP00000355982:D99V	ENSP00000355982:D99V	D	+	2	0	SYT14	208261190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.626000	0.83164	2.078000	0.62432	0.528000	0.53228	GAT		0.388	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262		Missense_Mutation
CNIH4	29097	broad.mit.edu	37	1	224559009	224559009	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:224559009C>A	ENST00000465271.1	+	4	351	c.276C>A	c.(274-276)aaC>aaA	p.N92K	CNIH4_ENST00000468318.1_3'UTR|CNIH4_ENST00000366858.3_Intron|CNIH4_ENST00000366857.5_Intron|CNIH4_ENST00000366856.3_Missense_Mutation_p.N92K	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4	92					intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.N92K(1)		kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		CGAGTGGTAACATGGGAGTGT	0.383																																																1	Substitution - Missense(1)	ovary(1)	1											189.0	171.0	177.0					1																	224559009		2203	4300	6503	222625632	SO:0001583	missense	29097				CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.276C>A	1.37:g.224559009C>A	ENSP00000420443:p.Asn92Lys	Unknown		x	x	x	222625632	A8K1Q8|B2R553|Q9H0X8	Missense_Mutation	SNP	ENST00000465271.1	37	CCDS1543.1	SNP	17	Broad	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226837	0.79576	.	.	ENSG00000143771	ENST00000465271;ENST00000366856	T;T	0.41400	1.04;1.0	5.43	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.59865	0.2225	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.54543	-0.8278	10	0.30854	T	0.27	-0.2236	15.098	0.72250	0.0:0.9281:0.0:0.0719	.	92	Q9P003	CNIH4_HUMAN	K	92	ENSP00000420443:N92K;ENSP00000355821:N92K	ENSP00000355821:N92K	N	+	3	2	CNIH4	222625632	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.555000	0.45854	2.692000	0.91855	0.655000	0.94253	AAC		0.383	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091754.1	NM_014184		Missense_Mutation
LBR	3930	broad.mit.edu	37	1	225609864	225609864	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr1:225609864G>C	ENST00000338179.2	-	3	406	c.281C>G	c.(280-282)gCc>gGc	p.A94G	LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.A94G	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	94					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)	p.A94G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AGATCGGCGGGCACTTTTAGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	1											79.0	76.0	77.0					1																	225609864		2203	4300	6503	223676487	SO:0001583	missense	3930			L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.281C>G	1.37:g.225609864G>C	ENSP00000339883:p.Ala94Gly	Unknown		x	x	x	223676487	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489442	0.44249	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.97016	-4.21;-4.21;0.5	5.5	5.5	0.81552	.	0.704331	0.13954	N	0.351285	D	0.91264	0.7246	N	0.14661	0.345	0.23889	N	0.996553	B;B	0.14012	0.009;0.003	B;B	0.14023	0.01;0.0	T	0.77416	-0.2596	10	0.14656	T	0.56	-19.9604	15.2746	0.73732	0.0:0.0:1.0:0.0	.	94;94	C9JXK0;Q14739	.;LBR_HUMAN	G	94	ENSP00000272163:A94G;ENSP00000339883:A94G;ENSP00000388059:A94G	ENSP00000272163:A94G	A	-	2	0	LBR	223676487	0.914000	0.31030	0.811000	0.32455	0.261000	0.26267	1.265000	0.33027	2.756000	0.94617	0.655000	0.94253	GCC		0.542	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296		Missense_Mutation
HERC4	26091	broad.mit.edu	37	10	69692499	69692499	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr10:69692499T>C	ENST00000395198.3	-	24	2964	c.2717A>G	c.(2716-2718)aAt>aGt	p.N906S	HERC4_ENST00000412272.2_Missense_Mutation_p.N828S|HERC4_ENST00000373700.4_Missense_Mutation_p.N898S|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000277817.6_Missense_Mutation_p.N796S	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	906	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.N906S(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						CACTGATTTATTGAATATGTA	0.363																																																1	Substitution - Missense(1)	ovary(1)	10											85.0	86.0	86.0					10																	69692499		2203	4300	6503	69362505	SO:0001583	missense	26091			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2717A>G	10.37:g.69692499T>C	ENSP00000378624:p.Asn906Ser	Unknown		x	x	x	69362505	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	SNP	52	Broad	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949254	0.73787	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.15	4.01	0.46588	HECT (4);	0.042277	0.85682	N	0.000000	T	0.55955	0.1953	L	0.42529	1.33	0.80722	D	1	B;P;P;P;P	0.51537	0.154;0.851;0.946;0.933;0.927	B;P;P;P;P	0.54706	0.085;0.493;0.732;0.612;0.759	T	0.55244	-0.8171	10	0.51188	T	0.08	.	10.9443	0.47292	0.0:0.0745:0.0:0.9255	.	828;796;756;898;906	Q5GLZ8-3;Q5GLZ8-6;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	S	796;828;906;898	ENSP00000277817:N796S;ENSP00000416504:N828S;ENSP00000378624:N906S;ENSP00000362804:N898S	ENSP00000277817:N796S	N	-	2	0	HERC4	69362505	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.830000	0.48136	0.900000	0.36469	0.455000	0.32223	AAT		0.363	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601		Missense_Mutation
FAM45A	404636	broad.mit.edu	37	10	120883076	120883076	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr10:120883076G>A	ENST00000361432.2	+	6	715	c.689G>A	c.(688-690)tGc>tAc	p.C230Y	FAM45A_ENST00000535029.1_Missense_Mutation_p.A193T|FAM45A_ENST00000544016.1_Missense_Mutation_p.C79Y|FAM45A_ENST00000489988.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	230								p.C230Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		CTGCAGATGTGCACAGGTAGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	10											68.0	57.0	61.0					10																	120883076		2203	4300	6503	120873066	SO:0001583	missense	404636			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.689G>A	10.37:g.120883076G>A	ENSP00000354688:p.Cys230Tyr	Unknown		x	x	x	120873066	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	SNP	46	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.76|12.76	2.034768|2.034768	0.35893|0.35893	.|.	.|.	ENSG00000119979|ENSG00000119979	ENST00000535029|ENST00000361432;ENST00000544016	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65688|0.65688	0.2715|0.2715	L|L	0.46741|0.46741	1.465|1.465	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.71674	.|0.997;0.998;0.996;0.998	.|D;D;D;D	.|0.71184	.|0.961;0.961;0.935;0.972	T|T	0.59268|0.59268	-0.7486|-0.7486	6|9	0.87932|0.02654	D|T	0|1	.|.	17.3699|17.3699	0.87373|0.87373	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|157;79;222;230	.|B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.|.;.;.;FA45A_HUMAN	T|Y	193|230;79	.|.	ENSP00000444309:A193T|ENSP00000354688:C230Y	A|C	+|+	1|2	0|0	FAM45A|FAM45A	120873066|120873066	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.962000|0.962000	0.63368|0.63368	8.323000|8.323000	0.90002|0.90002	2.547000|2.547000	0.85894|0.85894	0.543000|0.543000	0.68304|0.68304	GCA|TGC		0.527	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009		Missense_Mutation
TUBGCP2	10844	broad.mit.edu	37	10	135095827	135095827	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr10:135095827T>C	ENST00000252936.3	-	15	2348	c.2309A>G	c.(2308-2310)aAa>aGa	p.K770R	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.K798R|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.K640R|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.K770R|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.K363R			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	770					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)		p.K770R(1)		breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCCATCTAATTTCATGCTCTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											20.0	24.0	23.0					10																	135095827		2199	4299	6498	134945817	SO:0001583	missense	10844			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2309A>G	10.37:g.135095827T>C	ENSP00000252936:p.Lys770Arg	Unknown		x	x	x	134945817	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	ENST00000252936.3	37	CCDS7676.1	SNP	64	Broad	.	.	.	.	.	.	.	.	.	.	T	3.330	-0.136880	0.06711	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.33216	2.41;2.15;2.41;1.42;2.42	4.71	4.71	0.59529	.	0.053639	0.64402	D	0.000001	T	0.17959	0.0431	N	0.13043	0.29	0.35300	D	0.782978	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.005;0.002;0.002	T	0.16897	-1.0387	10	0.14252	T	0.57	-27.4373	13.4763	0.61310	0.0:0.0:0.0:1.0	.	798;798;770	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	R	770;640;770;363;798	ENSP00000252936:K770R;ENSP00000395666:K640R;ENSP00000357551:K770R;ENSP00000357550:K363R;ENSP00000446093:K798R	ENSP00000252936:K770R	K	-	2	0	TUBGCP2	134945817	0.967000	0.33354	0.915000	0.36163	0.150000	0.21749	1.788000	0.38714	2.118000	0.64928	0.459000	0.35465	AAA		0.582	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1			Missense_Mutation
DKK3	27122	broad.mit.edu	37	11	11986154	11986154	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr11:11986154C>G	ENST00000396505.2	-	8	1148	c.910G>C	c.(910-912)Gtc>Ctc	p.V304L	DKK3_ENST00000527132.1_Intron|DKK3_ENST00000326932.4_Missense_Mutation_p.V304L|DKK3_ENST00000450094.2_Missense_Mutation_p.V276L|DKK3_ENST00000525493.1_Missense_Mutation_p.V318L	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	304					adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.V304L(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		TCATCGGGGACCTCTCTGGGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											65.0	68.0	67.0					11																	11986154		2201	4294	6495	11942730	SO:0001583	missense	27122			AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.910G>C	11.37:g.11986154C>G	ENSP00000379762:p.Val304Leu	Unknown		x	x	x	11942730	A8K1I2|D3DQW1|Q9ULB7	Missense_Mutation	SNP	ENST00000396505.2	37	CCDS7808.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	10.12	1.263633	0.23136	.	.	ENSG00000050165	ENST00000396505;ENST00000326932;ENST00000366345;ENST00000525493;ENST00000450094;ENST00000326914	T;T;T;T	0.30714	2.24;2.24;2.22;1.52	5.53	3.34	0.38264	.	0.584033	0.17463	N	0.173365	T	0.12433	0.0302	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.14012	0.004;0.009;0.001	B;B;B	0.11329	0.005;0.006;0.001	T	0.22347	-1.0219	10	0.22706	T	0.39	-5.6445	7.7434	0.28853	0.0:0.747:0.0:0.253	.	318;276;304	F6SYF8;E7EUD0;Q9UBP4	.;.;DKK3_HUMAN	L	304;304;247;318;276;148	ENSP00000379762:V304L;ENSP00000314910:V304L;ENSP00000433112:V318L;ENSP00000398365:V276L	ENSP00000314730:V148L	V	-	1	0	DKK3	11942730	0.001000	0.12720	0.003000	0.11579	0.006000	0.05464	0.660000	0.25009	1.350000	0.45770	-0.136000	0.14681	GTC		0.612	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385863.1	NM_013253		Missense_Mutation
SLC43A3	29015	broad.mit.edu	37	11	57177423	57177423	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr11:57177423G>C	ENST00000395123.2	-	12	1536	c.1232C>G	c.(1231-1233)gCc>gGc	p.A411G	SLC43A3_ENST00000352187.1_Missense_Mutation_p.A411G|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.A55G|SLC43A3_ENST00000529554.1_Missense_Mutation_p.A411G|SLC43A3_ENST00000533524.1_Missense_Mutation_p.A424G|SLC43A3_ENST00000395124.1_Missense_Mutation_p.A411G	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	411					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.A411G(1)		central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GGTGAGGAAGGCCGCGTTGCT	0.602																																																1	Substitution - Missense(1)	ovary(1)	11											62.0	53.0	56.0					11																	57177423		2201	4296	6497	56933999	SO:0001583	missense	29015			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1232C>G	11.37:g.57177423G>C	ENSP00000378555:p.Ala411Gly	Unknown		x	x	x	56933999	B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	ENST00000395123.2	37	CCDS7956.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611012	0.66558	.	.	ENSG00000254979;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802	ENST00000529411;ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524	D;T;T;T;T;T	0.83755	-1.76;0.16;0.16;0.16;0.16;0.16	5.84	5.84	0.93424	Major facilitator superfamily domain, general substrate transporter (1);	0.050439	0.85682	D	0.000000	D	0.86871	0.6037	L	0.48642	1.525	0.52099	D	0.999945	P;D	0.56746	0.94;0.977	P;D	0.65323	0.897;0.934	T	0.82454	-0.0449	10	0.17832	T	0.49	-24.9875	17.0623	0.86550	0.0:0.0:1.0:0.0	.	424;411	E7EQD2;Q8NBI5	.;S43A3_HUMAN	G	55;411;411;411;411;424	ENSP00000431536:A55G;ENSP00000378555:A411G;ENSP00000378556:A411G;ENSP00000337561:A411G;ENSP00000436254:A411G;ENSP00000434515:A424G	ENSP00000431536:A55G	A	-	2	0	RP11-872D17.8;SLC43A3	56933999	1.000000	0.71417	0.994000	0.49952	0.106000	0.19336	8.380000	0.90149	2.758000	0.94735	0.655000	0.94253	GCC		0.602	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611		Missense_Mutation
PDE2A	5138	broad.mit.edu	37	11	72296638	72296638	+	Splice_Site	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr11:72296638C>A	ENST00000334456.5	-	15	1428		c.e15-1		PDE2A_ENST00000444035.2_Splice_Site|PDE2A_ENST00000376450.3_Splice_Site|RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000540345.1_Splice_Site|PDE2A_ENST00000544570.1_Splice_Site|PDE2A_ENST00000418754.2_Splice_Site	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated						blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)	p.?(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GGAGAAGAGCCTGGAATGAAG	0.582											OREG0021196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Unknown(1)	ovary(1)	11											55.0	52.0	53.0					11																	72296638		2200	4293	6493	71974286	SO:0001630	splice_region_variant	5138			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.1183-1G>T	11.37:g.72296638C>A		Unknown	1136	x	x	x	71974286	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Splice_Site_SNP	SNP	ENST00000334456.5	37	CCDS8216.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414763	0.83449	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000475807;ENST00000538299	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2915	0.82755	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE2A	71974286	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	3.569000	0.53827	2.632000	0.89209	0.478000	0.44815	.		0.582	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219839.2	NM_002599	Intron	Splice_Site_SNP
STYK1	55359	broad.mit.edu	37	12	10780256	10780256	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr12:10780256T>A	ENST00000075503.3	-	7	1221	c.701A>T	c.(700-702)cAg>cTg	p.Q234L		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						CAAAAGGACCTGCTTTCCGAT	0.383										HNSCC(73;0.22)																																						0			12											235.0	158.0	184.0					12																	10780256		2203	4300	6503	10671523	SO:0001583	missense	55359			AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.701A>T	12.37:g.10780256T>A	ENSP00000075503:p.Gln234Leu	Unknown		x	x	x	10671523	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	37	CCDS8629.1	SNP	55	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.6|20.6	4.017272|4.017272	0.75161|0.75161	.|.	.|.	ENSG00000060140|ENSG00000060140	ENST00000075503|ENST00000542924	T|.	0.73681|.	-0.77|.	5.11|5.11	5.11|5.11	0.69529|0.69529	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.64402|.	D|.	0.000002|.	D|D	0.87517|0.87517	0.6197|0.6197	H|H	0.97587|0.97587	4.035|4.035	0.58432|0.58432	D|D	0.99999|0.99999	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	D|D	0.91305|0.91305	0.5070|0.5070	10|5	0.87932|.	D|.	0|.	-15.3792|-15.3792	12.9024|12.9024	0.58133|0.58133	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	234|.	Q6J9G0|.	STYK1_HUMAN|.	L|W	234|78	ENSP00000075503:Q234L|.	ENSP00000075503:Q234L|.	Q|R	-|-	2|1	0|2	STYK1|STYK1	10671523|10671523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	5.080000|5.080000	0.64437|0.64437	2.154000|2.154000	0.67381|0.67381	0.533000|0.533000	0.62120|0.62120	CAG|AGG		0.383	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423		Missense_Mutation
ASIC1	41	broad.mit.edu	37	12	50471824	50471824	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr12:50471824A>T	ENST00000447966.2	+	5	980	c.751A>T	c.(751-753)Agt>Tgt	p.S251C	ASIC1_ENST00000228468.4_Missense_Mutation_p.S251C|ASIC1_ENST00000552438.1_Missense_Mutation_p.S285C	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1	251					associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)	p.S251C(1)								Amiloride(DB00594)|Diclofenac(DB00586)	GCAGATCCATAGTCAGGATGA	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											191.0	156.0	168.0					12																	50471824		2203	4300	6503	48758091	SO:0001583	missense	41			U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.751A>T	12.37:g.50471824A>T	ENSP00000400228:p.Ser251Cys	Unknown		x	x	x	48758091	A3KN86|E5KBL7|P78349|Q96CV2	Missense_Mutation	SNP	ENST00000447966.2	37	CCDS44876.1	SNP	15	Broad	.	.	.	.	.	.	.	.	.	.	A	26.3	4.725119	0.89298	.	.	ENSG00000110881	ENST00000228468;ENST00000447966;ENST00000552438	T;T;T	0.67345	-0.26;-0.26;-0.26	4.09	4.09	0.47781	.	0.247618	0.38837	N	0.001552	D	0.82939	0.5146	M	0.93808	3.46	0.58432	D	0.999997	P;D	0.58620	0.922;0.983	P;P	0.58013	0.701;0.831	D	0.87891	0.2684	10	0.87932	D	0	-8.5795	13.5416	0.61676	1.0:0.0:0.0:0.0	.	251;251	P78348;P78348-1	ACCN2_HUMAN;.	C	251;251;285	ENSP00000228468:S251C;ENSP00000400228:S251C;ENSP00000450247:S285C	ENSP00000228468:S251C	S	+	1	0	ACCN2	48758091	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.086000	0.94088	1.844000	0.53588	0.460000	0.39030	AGT		0.592	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039		Missense_Mutation
GRIP1	23426	broad.mit.edu	37	12	66849241	66849241	+	Silent	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr12:66849241T>A	ENST00000398016.3	-	10	1214	c.1146A>T	c.(1144-1146)ccA>ccT	p.P382P	GRIP1_ENST00000286445.7_Silent_p.P434P|GRIP1_ENST00000359742.4_Silent_p.P434P	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.P382P(1)		NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGGTTCCACGTGGGCTGGTGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	12											159.0	156.0	157.0					12																	66849241		1949	4155	6104	65135508	SO:0001819	synonymous_variant	23426			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1146A>T	12.37:g.66849241T>A		Unknown		x	x	x	65135508	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000398016.3	37	CCDS41807.1	SNP	59	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.39|10.39	1.337338|1.337338	0.24253|0.24253	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000538164|ENST00000543172	.|.	.|.	.|.	5.51|5.51	-1.91|-1.91	0.07641|0.07641	.|.	.|.	.|.	.|.	.|.	T|T	0.43277|0.43277	0.1240|0.1240	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.31752|0.31752	-0.9932|-0.9932	4|4	.|.	.|.	.|.	-11.5531|-11.5531	4.2799|4.2799	0.10827|0.10827	0.3275:0.1886:0.0:0.4839|0.3275:0.1886:0.0:0.4839	.|.	.|.	.|.	.|.	L|S	249|202	.|.	.|.	H|T	-|-	2|1	0|0	GRIP1|GRIP1	65135508|65135508	0.010000|0.010000	0.17322|0.17322	0.997000|0.997000	0.53966|0.53966	0.980000|0.980000	0.70556|0.70556	-1.237000|-1.237000	0.02922|0.02922	-0.137000|-0.137000	0.11455|0.11455	-0.441000|-0.441000	0.05720|0.05720	CAC|ACG		0.488	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2			Silent
E2F7	144455	broad.mit.edu	37	12	77423719	77423719	+	Silent	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr12:77423719A>T	ENST00000322886.7	-	10	2011	c.1776T>A	c.(1774-1776)gcT>gcA	p.A592A	E2F7_ENST00000416496.2_Silent_p.A592A	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	592					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A592A(1)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GGCGCTTCTGAGCTGAGGGTG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	12											97.0	88.0	91.0					12																	77423719		2203	4300	6503	75947850	SO:0001819	synonymous_variant	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1776T>A	12.37:g.77423719A>T		Unknown		x	x	x	75947850	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	37	CCDS9016.1	SNP	11	Broad																																																																																				0.572	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		Silent
MGAT4C	25834	broad.mit.edu	37	12	86374195	86374195	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr12:86374195A>C	ENST00000604798.1	-	8	1513	c.309T>G	c.(307-309)atT>atG	p.I103M	MGAT4C_ENST00000332156.1_Missense_Mutation_p.I103M|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000552808.2_Missense_Mutation_p.I103M|MGAT4C_ENST00000549405.2_Missense_Mutation_p.I103M|MGAT4C_ENST00000548651.1_Missense_Mutation_p.I103M|MGAT4C_ENST00000393205.2_Missense_Mutation_p.I132M			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	103					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.I103M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AAGAAAGTCCAATTGTAAGAT	0.313																																																1	Substitution - Missense(1)	ovary(1)	12											39.0	43.0	42.0					12																	86374195		2202	4299	6501	84898326	SO:0001583	missense	25834				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.309T>G	12.37:g.86374195A>C	ENSP00000474896:p.Ile103Met	Unknown		x	x	x	84898326	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	CCDS9030.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	14.70	2.612615	0.46631	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	5.04	3.87	0.44632	.	0.244160	0.39407	N	0.001375	T	0.52533	0.1740	L	0.43152	1.355	0.48236	D	0.99961	D;P	0.56746	0.977;0.921	P;P	0.57846	0.828;0.828	T	0.45396	-0.9264	10	0.34782	T	0.22	-6.467	11.334	0.49492	0.8637:0.0:0.0:0.1363	.	132;103	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	M	103;132;103;103;103;103;103	ENSP00000331664:I103M;ENSP00000376900:I132M;ENSP00000449022:I103M;ENSP00000446647:I103M;ENSP00000447253:I103M;ENSP00000449172:I103M	ENSP00000331664:I103M	I	-	3	3	MGAT4C	84898326	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.380000	0.44327	0.834000	0.34852	0.482000	0.46254	ATT		0.313	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244		Missense_Mutation
PARP4	143	broad.mit.edu	37	13	25060373	25060373	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr13:25060373T>C	ENST00000381989.3	-	11	1390	c.1285A>G	c.(1285-1287)Aaa>Gaa	p.K429E		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	429	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.K429E(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTACCAAGTTTGCTCAAAAAC	0.388																																																1	Substitution - Missense(1)	ovary(1)	13											108.0	97.0	101.0					13																	25060373		2203	4300	6503	23958373	SO:0001583	missense	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.1285A>G	13.37:g.25060373T>C	ENSP00000371419:p.Lys429Glu	Unknown		x	x	x	23958373	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	SNP	63	Broad	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.685779	0.00738	.	.	ENSG00000102699	ENST00000381989	T	0.14391	2.51	4.56	0.758	0.18432	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.714516	0.13212	U	0.405108	T	0.09730	0.0239	L	0.31294	0.92	0.09310	N	1	B	0.23650	0.089	B	0.25614	0.062	T	0.40136	-0.9579	10	0.14656	T	0.56	-0.042	11.2239	0.48871	0.0:0.0:0.5254:0.4746	.	429	Q9UKK3	PARP4_HUMAN	E	429	ENSP00000371419:K429E	ENSP00000371419:K429E	K	-	1	0	PARP4	23958373	0.867000	0.29959	0.056000	0.19401	0.058000	0.15608	1.772000	0.38552	-0.010000	0.14271	-0.472000	0.04984	AAA		0.388	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437		Missense_Mutation
TRPC4	7223	broad.mit.edu	37	13	38211452	38211452	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr13:38211452T>G	ENST00000379705.3	-	11	3379	c.2522A>C	c.(2521-2523)gAt>gCt	p.D841A	TRPC4_ENST00000379679.1_Missense_Mutation_p.D668A|TRPC4_ENST00000447043.1_Intron|TRPC4_ENST00000379681.3_Missense_Mutation_p.D846A|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000355779.2_Intron|TRPC4_ENST00000358477.2_Intron|TRPC4_ENST00000338947.5_Missense_Mutation_p.D668A			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	841	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.D841A(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GTTTTTGATATCGGTCACAAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	13											76.0	78.0	77.0					13																	38211452		2203	4300	6503	37109452	SO:0001583	missense	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2522A>C	13.37:g.38211452T>G	ENSP00000369027:p.Asp841Ala	Unknown		x	x	x	37109452	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	SNP	50	Broad	.	.	.	.	.	.	.	.	.	.	T	20.1	3.935321	0.73442	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679	T;T;T;T	0.68025	-0.29;-0.3;-0.14;-0.14	5.9	5.9	0.94986	.	2.549700	0.01231	N	0.008354	T	0.76328	0.3972	N	0.19112	0.55	0.80722	D	1	D;P;P	0.76494	0.999;0.902;0.842	D;P;B	0.80764	0.994;0.57;0.366	T	0.59526	-0.7438	10	0.30854	T	0.27	-36.5795	16.3318	0.83023	0.0:0.0:0.0:1.0	.	846;668;841	Q9UBN4-5;Q9UBN4-6;Q9UBN4	.;.;TRPC4_HUMAN	A	841;846;668;668	ENSP00000369027:D841A;ENSP00000369003:D846A;ENSP00000342580:D668A;ENSP00000369001:D668A	ENSP00000342580:D668A	D	-	2	0	TRPC4	37109452	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	6.474000	0.73578	2.248000	0.74166	0.460000	0.39030	GAT		0.428	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306		Missense_Mutation
OXGR1	27199	broad.mit.edu	37	13	97639260	97639260	+	Missense_Mutation	SNP	C	C	T	rs144457939		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr13:97639260C>T	ENST00000298440.1	-	4	997	c.754G>A	c.(754-756)Gta>Ata	p.V252I	OXGR1_ENST00000543457.1_Missense_Mutation_p.V252I	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	252					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V252L(2)|p.V252I(1)		NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			AAAAAACATACGTAAAATGCA	0.438																																																3	Substitution - Missense(3)	lung(2)|ovary(1)	13						C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	122.0	119.0	120.0		754	-1.5	0.3	13	dbSNP_134	120	0,8600		0,0,4300	no	missense	OXGR1	NM_080818.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	252/338	97639260	1,13005	2203	4300	6503	96437261	SO:0001583	missense	27199			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.754G>A	13.37:g.97639260C>T	ENSP00000298440:p.Val252Ile	Unknown		x	x	x	96437261	Q5T5A7|Q86TL1	Missense_Mutation	SNP	ENST00000298440.1	37	CCDS9482.1	SNP	19	Broad	.	.	.	.	.	.	.	.	.	.	C	2.661	-0.279643	0.05642	2.27E-4	0.0	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.36699	1.24;1.24	5.83	-1.51	0.08664	GPCR, rhodopsin-like superfamily (1);	0.562270	0.18992	N	0.125569	T	0.17238	0.0414	N	0.11756	0.17	0.09310	N	0.999998	B	0.19817	0.039	B	0.19391	0.025	T	0.28964	-1.0027	10	0.08837	T	0.75	.	13.4167	0.60972	0.0:0.6035:0.0:0.3965	.	252	Q96P68	OXGR1_HUMAN	I	252	ENSP00000298440:V252I;ENSP00000438800:V252I	ENSP00000298440:V252I	V	-	1	0	OXGR1	96437261	0.000000	0.05858	0.275000	0.24674	0.538000	0.34931	-0.242000	0.08928	-0.354000	0.08212	-0.355000	0.07637	GTA		0.438	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045521.3	NM_080818		Missense_Mutation
ADCY4	196883	broad.mit.edu	37	14	24791318	24791318	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr14:24791318G>A	ENST00000310677.4	-	21	2653	c.2540C>T	c.(2539-2541)cCt>cTt	p.P847L	ADCY4_ENST00000554068.2_Missense_Mutation_p.P847L|ADCY4_ENST00000418030.2_Missense_Mutation_p.P847L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	847					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.P847L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CACGTGTGCAGGGAGCACGTT	0.602																																																1	Substitution - Missense(1)	ovary(1)	14											136.0	118.0	124.0					14																	24791318		2203	4300	6503	23861158	SO:0001583	missense	196883			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2540C>T	14.37:g.24791318G>A	ENSP00000312126:p.Pro847Leu	Unknown		x	x	x	23861158	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	CCDS9627.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	33	5.224627	0.95173	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	D;D;D	0.89343	-2.5;-2.5;-2.5	5.31	5.31	0.75309	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.49305	D	0.000141	D	0.95915	0.8670	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96603	0.9446	10	0.87932	D	0	.	16.5178	0.84305	0.0:0.0:1.0:0.0	.	847	Q8NFM4	ADCY4_HUMAN	L	847	ENSP00000312126:P847L;ENSP00000452250:P847L;ENSP00000393177:P847L	ENSP00000312126:P847L	P	-	2	0	ADCY4	23861158	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	9.601000	0.98297	2.765000	0.95021	0.655000	0.94253	CCT		0.602	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4			Missense_Mutation
SPTBN5	51332	broad.mit.edu	37	15	42173364	42173364	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr15:42173364G>A	ENST00000320955.6	-	13	2753	c.2526C>T	c.(2524-2526)tgC>tgT	p.C842C		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	842					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)	p.C842C(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GGCCAGGGTGGCAGGAAGCCT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	15											53.0	58.0	57.0					15																	42173364		2016	4165	6181	39960656	SO:0001819	synonymous_variant	51332			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2526C>T	15.37:g.42173364G>A		Unknown		x	x	x	39960656		Silent	SNP	ENST00000320955.6	37		SNP	42	Broad																																																																																				0.612	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642		Silent
MYO5A	4644	broad.mit.edu	37	15	52689476	52689476	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr15:52689476C>G	ENST00000399231.3	-	10	1484	c.1241G>C	c.(1240-1242)tGg>tCg	p.W414S	MYO5A_ENST00000399233.2_Missense_Mutation_p.W414S|MYO5A_ENST00000553916.1_Missense_Mutation_p.W414S|MYO5A_ENST00000358212.6_Missense_Mutation_p.W414S|MYO5A_ENST00000356338.6_Missense_Mutation_p.W414S	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	414	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)	p.W414S(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ATCTACAATCCAGTTAAAGAG	0.463																																																1	Substitution - Missense(1)	ovary(1)	15											98.0	91.0	93.0					15																	52689476		1963	4152	6115	50476768	SO:0001583	missense	4644				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1241G>C	15.37:g.52689476C>G	ENSP00000382177:p.Trp414Ser	Unknown		x	x	x	50476768	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	SNP	21	Broad	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656209	0.88056	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85	5.84	5.84	0.93424	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97126	0.9061	H	0.96576	3.845	0.80722	D	1	D;D	0.71674	0.96;0.998	P;D	0.66497	0.852;0.944	D	0.97842	1.0269	10	0.87932	D	0	.	20.1392	0.98050	0.0:1.0:0.0:0.0	.	414;414	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	S	414;414;414;414;44;414	ENSP00000382177:W414S;ENSP00000382179:W414S;ENSP00000348693:W414S;ENSP00000350945:W414S;ENSP00000451109:W414S	ENSP00000348693:W414S	W	-	2	0	MYO5A	50476768	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.066000	0.71185	2.751000	0.94390	0.591000	0.81541	TGG		0.463	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259		Missense_Mutation
HERC1	8925	broad.mit.edu	37	15	63958318	63958318	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr15:63958318G>A	ENST00000443617.2	-	42	8442	c.8355C>T	c.(8353-8355)atC>atT	p.I2785I		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2785					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I2785I(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CAAGGACAGTGATATTCTGGG	0.517																																																1	Substitution - coding silent(1)	ovary(1)	15											37.0	37.0	37.0					15																	63958318		2007	4177	6184	61745371	SO:0001819	synonymous_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8355C>T	15.37:g.63958318G>A		Unknown		x	x	x	61745371	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1	SNP	45	Broad																																																																																				0.517	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		Silent
SLC2A4	6517	broad.mit.edu	37	17	7189873	7189873	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:7189873G>A	ENST00000317370.8	+	11	1723	c.1455G>A	c.(1453-1455)cgG>cgA	p.R485R	RP1-4G17.2_ENST00000576271.1_RNA	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	485					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						CCTTCCACCGGACACCCTCTC	0.547																																																0			17											234.0	242.0	240.0					17																	7189873		2203	4300	6503	7130597	SO:0001819	synonymous_variant	6517			M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.1455G>A	17.37:g.7189873G>A		Unknown		x	x	x	7130597	Q05BQ3|Q14CX2	Silent	SNP	ENST00000317370.8	37	CCDS11097.1	SNP	41	Broad																																																																																				0.547	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220031.3			Silent
MYH13	8735	broad.mit.edu	37	17	10263337	10263337	+	Nonsense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:10263337A>T	ENST00000418404.3	-	6	748	c.585T>A	c.(583-585)taT>taA	p.Y195*	MYH13_ENST00000252172.4_Nonsense_Mutation_p.Y195*			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	195	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.Y195*(1)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTGTTGCAAAATACTGGATGA	0.517																																																1	Substitution - Nonsense(1)	ovary(1)	17											103.0	104.0	104.0					17																	10263337		2203	4300	6503	10204062	SO:0001587	stop_gained	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.585T>A	17.37:g.10263337A>T	ENSP00000404570:p.Tyr195*	Unknown		x	x	x	10204062	O95252|Q9P0U8	Nonsense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	38	6.699846	0.97772	.	.	ENSG00000006788	ENST00000252172	.	.	.	3.94	2.96	0.34315	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.654	0.34051	0.2606:0.0:0.7394:0.0	.	.	.	.	X	195	.	ENSP00000252172:Y195X	Y	-	3	2	MYH13	10204062	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.144000	0.50616	0.973000	0.38340	-0.242000	0.12053	TAT		0.517	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		Nonsense_Mutation
NF1	4763	broad.mit.edu	37	17	29509525	29509525	+	Splice_Site	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:29509525G>T	ENST00000358273.4	+	8	1113		c.e8-1		NF1_ENST00000356175.3_Splice_Site|NF1_ENST00000431387.4_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTTCATGCAGAATGTGCAGA	0.358			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|ovary(1)	17	GRCh37	CS086352|CS086353	NF1	S							71.0	62.0	65.0					17																	29509525		2203	4300	6503	26533651	SO:0001630	splice_region_variant	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.731-1G>T	17.37:g.29509525G>T		Unknown		x	x	x	26533651	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site_SNP	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788502	0.90367	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175	.	.	.	5.37	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8846	0.41253	0.0723:0.0:0.788:0.1398	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26533651	1.000000	0.71417	0.806000	0.32338	0.928000	0.56348	8.798000	0.91888	0.607000	0.29982	0.561000	0.74099	.		0.358	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Intron	Splice_Site_SNP
NF1	4763	broad.mit.edu	37	17	29654820	29654820	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:29654820G>A	ENST00000358273.4	+	38	5955	c.5572G>A	c.(5572-5574)Gca>Aca	p.A1858T	NF1_ENST00000356175.3_Missense_Mutation_p.A1837T|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1858					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.A1858T(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCTCAATATCGCATTACTTAA	0.443			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|ovary(1)|central_nervous_system(1)	17											92.0	92.0	92.0					17																	29654820		2203	4300	6503	26678946	SO:0001583	missense	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5572G>A	17.37:g.29654820G>A	ENSP00000351015:p.Ala1858Thr	Unknown		x	x	x	26678946	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	G	32	5.180447	0.94846	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.65364	1.48;-0.15;1.48	5.8	5.8	0.92144	Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.79470	0.4451	M	0.71920	2.185	0.80722	D	1	D;D;P	0.76494	0.998;0.999;0.824	P;D;B	0.76575	0.638;0.988;0.18	T	0.79850	-0.1629	10	0.62326	D	0.03	.	19.049	0.93034	0.0:0.0:1.0:0.0	.	887;1837;1858	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	T	1858;1837;1503	ENSP00000351015:A1858T;ENSP00000348498:A1837T;ENSP00000389907:A1503T	ENSP00000348498:A1837T	A	+	1	0	NF1	26678946	1.000000	0.71417	0.952000	0.39060	0.949000	0.60115	9.434000	0.97515	2.733000	0.93635	0.650000	0.86243	GCA		0.443	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		Missense_Mutation
KRT32	3882	broad.mit.edu	37	17	39616412	39616412	+	Missense_Mutation	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:39616412G>T	ENST00000225899.3	-	7	1400	c.1297C>A	c.(1297-1299)Cca>Aca	p.P433T		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	433	Tail.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.P433T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				ACAGTGCGTGGCACACAGACG	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											73.0	54.0	60.0					17																	39616412		2203	4300	6503	36869938	SO:0001583	missense	3882			X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1297C>A	17.37:g.39616412G>T	ENSP00000225899:p.Pro433Thr	Unknown		x	x	x	36869938		Missense_Mutation	SNP	ENST00000225899.3	37	CCDS11393.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	G	9.471	1.095711	0.20471	.	.	ENSG00000108759	ENST00000225899	D	0.86627	-2.15	3.26	2.28	0.28536	.	2.067460	0.02808	N	0.123996	D	0.86347	0.5911	M	0.69185	2.1	0.30647	N	0.755804	B	0.20368	0.044	B	0.13407	0.009	T	0.70974	-0.4726	10	0.48119	T	0.1	.	7.9252	0.29870	0.0:0.0:0.7542:0.2458	.	433	Q14532	K1H2_HUMAN	T	433	ENSP00000225899:P433T	ENSP00000225899:P433T	P	-	1	0	KRT32	36869938	1.000000	0.71417	0.462000	0.27118	0.017000	0.09413	1.714000	0.37961	0.714000	0.32081	-0.296000	0.09543	CCA		0.647	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278		Missense_Mutation
G6PC3	92579	broad.mit.edu	37	17	42152697	42152697	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:42152697G>A	ENST00000269097.4	+	5	786	c.555G>A	c.(553-555)ctG>ctA	p.L185L		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	185			L -> P (in SCN4). {ECO:0000269|PubMed:19118303}.		carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)	p.L185L(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TGGGCTGGCTGATGACTCCCC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	17											106.0	95.0	99.0					17																	42152697		2203	4300	6503	39508223	SO:0001819	synonymous_variant	92579			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.555G>A	17.37:g.42152697G>A		Unknown		x	x	x	39508223	Q8WU15	Silent	SNP	ENST00000269097.4	37	CCDS11476.1	SNP	45	Broad																																																																																				0.592	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387		Silent
ASXL3	80816	broad.mit.edu	37	18	31322969	31322969	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr18:31322969A>T	ENST00000269197.5	+	12	3157	c.3157A>T	c.(3157-3159)Acc>Tcc	p.T1053S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1053	Ala-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T760S(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGGAGCCAGGACCCTCGCAGA	0.597																																																1	Substitution - Missense(1)	ovary(1)	18											30.0	31.0	31.0					18																	31322969		1902	4114	6016	29576967	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3157A>T	18.37:g.31322969A>T	ENSP00000269197:p.Thr1053Ser	Unknown		x	x	x	29576967	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443149	0.83993	.	.	ENSG00000141431	ENST00000269197	T	0.50813	0.73	5.9	5.9	0.94986	.	0.901323	0.09623	N	0.777348	T	0.68293	0.2985	L	0.59436	1.845	0.46317	D	0.998986	D	0.76494	0.999	D	0.78314	0.991	T	0.60495	-0.7252	10	0.52906	T	0.07	.	16.3352	0.83056	1.0:0.0:0.0:0.0	.	1053	Q9C0F0	ASXL3_HUMAN	S	1053	ENSP00000269197:T1053S	ENSP00000269197:T1053S	T	+	1	0	ASXL3	29576967	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.906000	0.75719	2.248000	0.74166	0.528000	0.53228	ACC		0.597	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			Missense_Mutation
WDR7	23335	broad.mit.edu	37	18	54358593	54358593	+	Splice_Site	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr18:54358593G>A	ENST00000254442.3	+	8	1074		c.e8+1		WDR7_ENST00000357574.3_Splice_Site|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7						hematopoietic progenitor cell differentiation (GO:0002244)			p.?(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TACCTGCCAGGTATGCAGCAA	0.343																																																1	Unknown(1)	ovary(1)	18											49.0	54.0	52.0					18																	54358593		2203	4300	6503	52509591	SO:0001630	splice_region_variant	23335			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.863+1G>A	18.37:g.54358593G>A		Unknown		x	x	x	52509591	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Splice_Site_SNP	SNP	ENST00000254442.3	37	CCDS11962.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340305	0.81911	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2552	0.93943	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR7	52509591	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.663000	0.98605	2.729000	0.93468	0.460000	0.39030	.		0.343	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		Intron	Splice_Site_SNP
LRRC8E	80131	broad.mit.edu	37	19	7960518	7960518	+	Silent	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:7960518C>T	ENST00000306708.6	+	2	131	c.30C>T	c.(28-30)ttC>ttT	p.F10F		NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	10					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						TCAAGCAGTTCACGGAACAGC	0.617																																																0			19											144.0	103.0	117.0					19																	7960518		2203	4300	6503	7866518	SO:0001819	synonymous_variant	80131				CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.30C>T	19.37:g.7960518C>T		Unknown		x	x	x	7866518	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	ENST00000306708.6	37	CCDS12189.1	SNP	29	Broad																																																																																				0.617	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061		Silent
ZNF491	126069	broad.mit.edu	37	19	11917484	11917484	+	Missense_Mutation	SNP	G	G	T	rs143071621	byFrequency	TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:11917484G>T	ENST00000323169.5	+	3	1047	c.716G>T	c.(715-717)gGa>gTa	p.G239V	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	239					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G239A(1)|p.G239V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						ACTCACACAGGAGAAAAACCC	0.428																																																2	Substitution - Missense(2)	ovary(1)|central_nervous_system(1)	19											49.0	52.0	51.0					19																	11917484		2203	4300	6503	11778484	SO:0001583	missense	126069			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.716G>T	19.37:g.11917484G>T	ENSP00000313443:p.Gly239Val	Unknown		x	x	x	11778484	Q3MJ35|Q8NAT8	Missense_Mutation	SNP	ENST00000323169.5	37	CCDS12267.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	g	11.66	1.703653	0.30232	.	.	ENSG00000177599	ENST00000323169;ENST00000455048	T	0.01599	4.74	0.981	-0.155	0.13395	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07908	0.0198	M	0.89478	3.035	0.53005	D	0.999968	D	0.76494	0.999	D	0.63703	0.917	T	0.07731	-1.0757	9	0.87932	D	0	.	4.2302	0.10599	0.1727:0.2416:0.5857:0.0	.	239	Q8N8L2	ZN491_HUMAN	V	239;211	ENSP00000313443:G239V	ENSP00000313443:G239V	G	+	2	0	ZNF491	11778484	0.995000	0.38212	0.010000	0.14722	0.047000	0.14425	2.243000	0.43115	-0.016000	0.14127	-0.571000	0.04153	GGA		0.428	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344518.1	NM_152356		Missense_Mutation
UPF1	5976	broad.mit.edu	37	19	18966852	18966852	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:18966852C>T	ENST00000599848.1	+	12	1905	c.1696C>T	c.(1696-1698)Ccg>Tcg	p.P566S	UPF1_ENST00000262803.5_Missense_Mutation_p.P555S			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	566					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CATCGACTCCCCGGTGTCTTT	0.602																																																0			19											68.0	56.0	60.0					19																	18966852		2203	4300	6503	18827852	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1696C>T	19.37:g.18966852C>T	ENSP00000470142:p.Pro566Ser	Unknown		x	x	x	18827852	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362881	0.24684	.	.	ENSG00000005007	ENST00000262803	T	0.81247	-1.47	4.46	3.41	0.39046	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	N	0.04880	-0.145	0.80722	D	1	B;B	0.20459	0.045;0.003	B;B	0.23716	0.048;0.009	T	0.51560	-0.8690	10	0.15066	T	0.55	-33.8745	11.9052	0.52708	0.0:0.9129:0.0:0.0871	.	566;555	Q92900;Q92900-2	RENT1_HUMAN;.	S	555	ENSP00000262803:P555S	ENSP00000262803:P555S	P	+	1	0	UPF1	18827852	1.000000	0.71417	0.476000	0.27291	0.937000	0.57800	7.245000	0.78237	0.999000	0.39023	0.655000	0.94253	CCG		0.602	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911		Missense_Mutation
EGLN2	112398	broad.mit.edu	37	19	41307036	41307036	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:41307036C>T	ENST00000593726.1	+	1	1587	c.559C>T	c.(559-561)Cgg>Tgg	p.R187W	EGLN2_ENST00000406058.2_Missense_Mutation_p.R187W|EGLN2_ENST00000303961.4_Missense_Mutation_p.R187W|EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR|CTC-490E21.12_ENST00000601627.1_5'Flank			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	187					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.R187W(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GCCCTGCATGCGGTACTACGG	0.692																																																1	Substitution - Missense(1)	ovary(1)	19											79.0	85.0	83.0					19																	41307036		2203	4299	6502	45998876	SO:0001583	missense	112398			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.559C>T	19.37:g.41307036C>T	ENSP00000469686:p.Arg187Trp	Unknown		x	x	x	45998876	A8K5S0|Q8WWY4|Q9BV14	Missense_Mutation	SNP	ENST00000593726.1	37	CCDS12567.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688087	0.68271	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	T;T	0.26223	1.75;1.75	4.16	3.1	0.35709	.	0.145189	0.42294	D	0.000737	T	0.34135	0.0887	L	0.34521	1.04	0.41426	D	0.987835	D	0.76494	0.999	D	0.65684	0.937	T	0.06625	-1.0816	10	0.51188	T	0.08	-11.9768	10.1844	0.42988	0.4904:0.5096:0.0:0.0	.	187	Q96KS0	EGLN2_HUMAN	W	187	ENSP00000307080:R187W;ENSP00000385253:R187W	ENSP00000307080:R187W	R	+	1	2	EGLN2	45998876	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.109000	0.31135	1.078000	0.41014	0.591000	0.81541	CGG		0.692	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1			Missense_Mutation
PSG2	5670	broad.mit.edu	37	19	43585264	43585264	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:43585264A>T	ENST00000406487.1	-	2	297	c.199T>A	c.(199-201)Tgg>Agg	p.W67R	PSG2_ENST00000491995.1_5'Flank	NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	67	Ig-like V-type.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.W67R(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				CCTTTGTACCAGATGTAGCCA	0.443																																																2	Substitution - Missense(2)	ovary(2)	19											99.0	103.0	101.0					19																	43585264		2202	4296	6498	48277104	SO:0001583	missense	5670				CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.199T>A	19.37:g.43585264A>T	ENSP00000385706:p.Trp67Arg	Unknown		x	x	x	48277104	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	CCDS12616.1	SNP	7	Broad	.	.	.	.	.	.	.	.	.	.	N	9.936	1.216212	0.22373	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.54675	0.56	0.418	0.418	0.16429	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79575	0.4469	H	0.97940	4.11	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65981	-0.6036	8	0.87932	D	0	.	.	.	.	.	67;67	B5MCM8;P11465	.;PSG2_HUMAN	R	67	ENSP00000385706:W67R	ENSP00000332984:W67R	W	-	1	0	PSG2	48277104	0.757000	0.28394	0.084000	0.20598	0.081000	0.17604	1.918000	0.40006	0.382000	0.24878	0.155000	0.16302	TGG		0.443	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246		Missense_Mutation
PPP6R1	22870	broad.mit.edu	37	19	55748105	55748105	+	Missense_Mutation	SNP	C	C	A	rs372967698		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr19:55748105C>A	ENST00000412770.2	-	17	2460	c.1894G>T	c.(1894-1896)Gcc>Tcc	p.A632S	AC010327.1_ENST00000581390.1_RNA|PPP6R1_ENST00000587283.1_Missense_Mutation_p.A632S	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	632	Glu-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)	p.A632S(1)		breast(1)	1						GAGCCCTGGGCCTCTTCCTCG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19						C	SER/ALA	1,4027		0,1,2013	65.0	66.0	66.0		1894	4.9	1.0	19		66	0,8334		0,0,4167	no	missense	PPP6R1	NM_014931.3	99	0,1,6180	AA,AC,CC		0.0,0.0248,0.0081	benign	632/882	55748105	1,12361	2014	4167	6181	60439917	SO:0001583	missense	22870			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1894G>T	19.37:g.55748105C>A	ENSP00000414202:p.Ala632Ser	Unknown		x	x	x	60439917	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	SNP	26	Broad	.	.	.	.	.	.	.	.	.	.	C	11.46	1.644561	0.29246	2.48E-4	0.0	ENSG00000105063	ENST00000412770	T	0.42513	0.97	4.95	4.95	0.65309	.	0.208116	0.24072	N	0.041806	T	0.23649	0.0572	N	0.08118	0	0.29675	N	0.842136	B	0.13594	0.008	B	0.14578	0.011	T	0.03463	-1.1034	10	0.08179	T	0.78	-33.2623	17.3187	0.87230	0.0:1.0:0.0:0.0	.	632	Q9UPN7	PP6R1_HUMAN	S	632	ENSP00000414202:A632S	ENSP00000414202:A632S	A	-	1	0	PPP6R1	60439917	0.982000	0.34865	1.000000	0.80357	0.937000	0.57800	-0.022000	0.12480	2.439000	0.82584	0.563000	0.77884	GCC		0.632	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931		Missense_Mutation
NRXN1	9378	broad.mit.edu	37	2	50699576	50699576	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:50699576G>A	ENST00000406316.2	-	16	4580	c.3104C>T	c.(3103-3105)aCa>aTa	p.T1035I	NRXN1_ENST00000401669.2_Missense_Mutation_p.T1035I|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Missense_Mutation_p.T1075I|NRXN1_ENST00000401710.1_Missense_Mutation_p.T44I|NRXN1_ENST00000405472.3_Missense_Mutation_p.T1027I|NRXN1_ENST00000402717.3_Missense_Mutation_p.T1027I|NRXN1_ENST00000406859.3_Missense_Mutation_p.T1035I	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1035	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.T1035I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGATTTGTATGTTTCTTTAGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	2											100.0	96.0	97.0					2																	50699576		1863	4097	5960	50553080	SO:0001583	missense	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3104C>T	2.37:g.50699576G>A	ENSP00000384311:p.Thr1035Ile	Unknown		x	x	x	50553080	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656967	0.47467	.	.	ENSG00000179915	ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.42	4.31	0.51392	.	0.044361	0.85682	D	0.000000	T	0.59018	0.2163	N	0.16903	0.455	0.23271	N	0.99801	B;P;B	0.34546	0.004;0.456;0.066	B;B;B	0.32928	0.014;0.115;0.155	T	0.55335	-0.8157	10	0.56958	D	0.05	.	6.8891	0.24220	0.2455:0.0:0.7545:0.0	.	1075;1035;1027	Q9ULB1-3;F8WB18;A7E294	.;.;.	I	44;1075;1035;1027;1035;1076;1027;1035	ENSP00000385580:T44I;ENSP00000385142:T1075I;ENSP00000384311:T1035I;ENSP00000434015:T1027I;ENSP00000385017:T1035I;ENSP00000385434:T1027I;ENSP00000385681:T1035I	ENSP00000385017:T1035I	T	-	2	0	NRXN1	50553080	1.000000	0.71417	0.988000	0.46212	0.973000	0.67179	4.448000	0.60027	2.691000	0.91804	0.655000	0.94253	ACA		0.403	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			Missense_Mutation
RTN4	57142	broad.mit.edu	37	2	55252692	55252692	+	Missense_Mutation	SNP	G	G	C	rs144867063	byFrequency	TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:55252692G>C	ENST00000337526.6	-	3	2786	c.2543C>G	c.(2542-2544)tCt>tGt	p.S848C	RTN4_ENST00000394611.2_Missense_Mutation_p.S642C|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.S642C|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000404909.1_Missense_Mutation_p.S642C|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000354474.6_Missense_Mutation_p.S616C|RTN4_ENST00000357376.3_Missense_Mutation_p.S642C	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	848					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.S642C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TGCTTCCTTAGAAATAAATAA	0.338													G|||	7	0.00139776	0.0053	0.0	5008	,	,		19160	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2						G	CYS/SER,,,CYS/SER	21,4383	25.3+/-52.1	1,19,2182	46.0	48.0	47.0		2543,,,1925	4.6	0.8	2	dbSNP_134	47	0,8596		0,0,4298	yes	missense,intron,intron,missense	RTN4	NM_020532.4,NM_153828.2,NM_207520.1,NM_207521.1	112,,,112	1,19,6480	CC,CG,GG		0.0,0.4768,0.1615	probably-damaging,,,probably-damaging	848/1193,,,642/987	55252692	21,12979	2202	4298	6500	55106196	SO:0001583	missense	57142			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.2543C>G	2.37:g.55252692G>C	ENSP00000337838:p.Ser848Cys	Unknown		x	x	x	55106196	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	SNP	33	Broad	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	16.51	3.143857	0.57044	0.004768	0.0	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.93	5.45	4.56	0.56223	.	1.697110	0.02987	N	0.146379	T	0.42832	0.1220	L	0.43152	1.355	0.29850	N	0.828543	D	0.62365	0.991	P	0.52710	0.707	T	0.49173	-0.8967	10	0.72032	D	0.01	-2.5692	16.1142	0.81289	0.0:0.1341:0.8659:0.0	.	848	Q9NQC3	RTN4_HUMAN	C	642;642;848;642;642;616	ENSP00000384471:S642C;ENSP00000349944:S642C;ENSP00000337838:S848C;ENSP00000378109:S642C;ENSP00000385650:S642C;ENSP00000346465:S616C	ENSP00000337838:S848C	S	-	2	0	RTN4	55106196	1.000000	0.71417	0.842000	0.33263	0.611000	0.37282	3.149000	0.50655	1.235000	0.43724	0.655000	0.94253	TCT		0.338	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1			Missense_Mutation
AMER3	205147	broad.mit.edu	37	2	131521561	131521561	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:131521561C>G	ENST00000423981.1	+	2	2026	c.1916C>G	c.(1915-1917)cCc>cGc	p.P639R	AMER3_ENST00000321420.4_Missense_Mutation_p.P639R	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	639					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.P639R(1)									TCTACCTGGCCCTGCTCCCAG	0.592																																																1	Substitution - Missense(1)	ovary(1)	2											33.0	36.0	35.0					2																	131521561		2203	4300	6503	131238031	SO:0001583	missense	205147			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1916C>G	2.37:g.131521561C>G	ENSP00000392700:p.Pro639Arg	Unknown		x	x	x	131238031	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	14.31	2.498614	0.44455	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.50277	0.75;0.75	4.32	1.43	0.22495	.	0.730679	0.11735	N	0.534552	T	0.37758	0.1015	L	0.27053	0.805	0.09310	N	1	D	0.54964	0.969	P	0.47891	0.56	T	0.18650	-1.0330	10	0.62326	D	0.03	.	6.0863	0.19968	0.0:0.6477:0.0:0.3523	.	639	Q8N944	F123C_HUMAN	R	639	ENSP00000314914:P639R;ENSP00000392700:P639R	ENSP00000314914:P639R	P	+	2	0	FAM123C	131238031	0.002000	0.14202	0.002000	0.10522	0.270000	0.26580	0.511000	0.22739	0.051000	0.15978	0.462000	0.41574	CCC		0.592	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698		Missense_Mutation
ERMN	57471	broad.mit.edu	37	2	158178234	158178234	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:158178234G>A	ENST00000410096.1	-	3	695	c.404C>T	c.(403-405)aCt>aTt	p.T135I	ERMN_ENST00000409216.1_3'UTR|ERMN_ENST00000420719.2_Missense_Mutation_p.T115I|ERMN_ENST00000535935.1_Missense_Mutation_p.T29I|ERMN_ENST00000397283.2_Missense_Mutation_p.T148I	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	135					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)		p.T148I(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						AGGCTGCTCAGTAATCCTCTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	2											103.0	98.0	100.0					2																	158178234		1909	4126	6035	157886480	SO:0001583	missense	57471			AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.404C>T	2.37:g.158178234G>A	ENSP00000387047:p.Thr135Ile	Unknown		x	x	x	157886480	B4DKA6|Q9ULN1	Missense_Mutation	SNP	ENST00000410096.1	37	CCDS46431.1	SNP	36	Broad	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.524586	0.00959	.	.	ENSG00000136541	ENST00000410096;ENST00000397283;ENST00000535935;ENST00000420719;ENST00000420317;ENST00000411762	.	.	.	5.77	-0.835	0.10775	.	1.619920	0.03004	N	0.148536	T	0.20170	0.0485	N	0.08118	0	0.09310	N	1	B;B;B	0.13145	0.002;0.007;0.002	B;B;B	0.06405	0.001;0.002;0.002	T	0.25813	-1.0121	9	0.54805	T	0.06	-0.3165	5.753	0.18158	0.3044:0.2715:0.424:0.0	.	115;148;135	B4DIZ1;Q8TAM6-2;Q8TAM6	.;.;ERMIN_HUMAN	I	135;148;29;115;135;135	.	ENSP00000380453:T148I	T	-	2	0	ERMN	157886480	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.529000	0.06186	0.014000	0.14944	-0.305000	0.09177	ACT		0.458	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1	NM_001009959		Missense_Mutation
GAD1	2571	broad.mit.edu	37	2	171687500	171687500	+	Missense_Mutation	SNP	A	A	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:171687500A>T	ENST00000358196.3	+	5	895	c.345A>T	c.(343-345)caA>caT	p.Q115H	GAD1_ENST00000375272.1_Missense_Mutation_p.Q115H|GAD1_ENST00000344257.5_Missense_Mutation_p.Q115H|GAD1_ENST00000429023.1_3'UTR	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	115					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.Q115H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						AAACCGTGCAATTCCTCCTGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											94.0	82.0	86.0					2																	171687500		2203	4300	6503	171395746	SO:0001583	missense	2571				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.345A>T	2.37:g.171687500A>T	ENSP00000350928:p.Gln115His	Unknown		x	x	x	171395746	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	SNP	4	Broad	.	.	.	.	.	.	.	.	.	.	A	13.55	2.270044	0.40194	.	.	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257;ENST00000455008;ENST00000456864	T;T;T;D;T	0.83591	1.13;1.13;1.13;-1.74;-1.22	5.9	3.07	0.35406	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.75576	0.3868	L	0.49350	1.555	0.80722	D	1	B;B	0.27910	0.003;0.193	B;B	0.15484	0.001;0.013	T	0.68812	-0.5310	10	0.42905	T	0.14	-15.6551	10.6492	0.45638	0.2467:0.0:0.7533:0.0	.	115;115	Q99259;Q99259-3	DCE1_HUMAN;.	H	115	ENSP00000350928:Q115H;ENSP00000364421:Q115H;ENSP00000341167:Q115H;ENSP00000405917:Q115H;ENSP00000394255:Q115H	ENSP00000341167:Q115H	Q	+	3	2	GAD1	171395746	1.000000	0.71417	1.000000	0.80357	0.416000	0.31233	2.714000	0.47202	0.406000	0.25560	-0.187000	0.12897	CAA		0.498	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2			Missense_Mutation
PDK1	5163	broad.mit.edu	37	2	173429284	173429285	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:173429284_173429285CA>AC	ENST00000282077.3	+	4	646_647	c.464_465CA>AC	c.(463-465)aCA>aAC	p.T155N	PDK1_ENST00000392571.2_Missense_Mutation_p.T175N|PDK1_ENST00000544863.1_5'UTR|PDK1_ENST00000410055.1_Missense_Mutation_p.T155N|PDK1_ENST00000543905.1_Missense_Mutation_p.T79N			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	155					cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)	p.T155N(1)		central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			GTCATTCCCACAATGGCCCAGG	0.426									Autosomal Dominant Polycystic Kidney Disease																																							1	Substitution - Missense(1)	ovary(1)	2																																								173137531	SO:0001583	missense	5163	Familial Cancer Database	ADPKD	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	Exception_encountered	2.37:g.173429284_173429285delinsAC	ENSP00000282077:p.Thr155Asn	Unknown		x	x	x	173137530	B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Missense_Mutation	DNP	ENST00000282077.3	37	CCDS2250.1	DNP	17	Broad																																																																																				0.426	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255380.3	NM_002610		Missense_Mutation
DGKD	8527	broad.mit.edu	37	2	234377112	234377112	+	Missense_Mutation	SNP	C	C	A	rs538736007		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:234377112C>A	ENST00000264057.2	+	29	3480	c.3468C>A	c.(3466-3468)caC>caA	p.H1156Q	DGKD_ENST00000409813.3_Missense_Mutation_p.H1112Q	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	1156	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.H1156Q(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GGCTGGAGCACCTCAGTCTCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	2											95.0	87.0	90.0					2																	234377112		2203	4300	6503	234041851	SO:0001583	missense	8527			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.3468C>A	2.37:g.234377112C>A	ENSP00000264057:p.His1156Gln	Unknown		x	x	x	234041851	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412739	0.25465	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	D;D	0.84146	-1.81;-1.81	4.83	4.83	0.62350	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.435914	0.24113	N	0.041425	T	0.53351	0.1791	N	0.00263	-1.745	0.31436	N	0.672556	B;B	0.15930	0.015;0.0	B;B	0.20384	0.029;0.007	T	0.57230	-0.7847	10	0.10636	T	0.68	.	9.5848	0.39510	0.0:0.7795:0.1428:0.0777	.	1112;1156	Q16760-2;Q16760	.;DGKD_HUMAN	Q	1156;1112	ENSP00000264057:H1156Q;ENSP00000386455:H1112Q	ENSP00000264057:H1156Q	H	+	3	2	DGKD	234041851	0.994000	0.37717	1.000000	0.80357	0.999000	0.98932	0.414000	0.21164	2.666000	0.90696	0.655000	0.94253	CAC		0.587	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648		Missense_Mutation
BOK	666	broad.mit.edu	37	2	242501817	242501817	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr2:242501817T>C	ENST00000318407.3	+	3	577	c.275T>C	c.(274-276)cTg>cCg	p.L92P		NM_032515.4	NP_115904.1	Q9UMX3	BOK_HUMAN	BCL2-related ovarian killer	92					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell proliferation (GO:0008283)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|neuron apoptotic process (GO:0051402)|oligodendrocyte differentiation (GO:0048709)|positive regulation of apoptotic process (GO:0043065)|positive regulation of execution phase of apoptosis (GO:1900119)	cytoplasm (GO:0005737)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.L92P(1)		large_intestine(1)|lung(3)|ovary(1)	5		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.04e-33)|all cancers(36;7.87e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.52e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.64e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0835)		GCGCGTCAGCTGCACATCTCC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											115.0	84.0	94.0					2																	242501817		2203	4300	6503	242150490	SO:0001583	missense	666			AF174487	CCDS2550.1	2q37.3	2008-05-22			ENSG00000176720	ENSG00000176720			1087	protein-coding gene	gene with protein product		605404				9356461, 11034351, 15102863	Standard	NM_032515		Approved	BCL2L9, BOKL, MGC4631	uc002wbq.3	Q9UMX3	OTTHUMG00000133411	ENST00000318407.3:c.275T>C	2.37:g.242501817T>C	ENSP00000314132:p.Leu92Pro	Unknown		x	x	x	242150490		Missense_Mutation	SNP	ENST00000318407.3	37	CCDS2550.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	17.78	3.474310	0.63737	.	.	ENSG00000176720	ENST00000318407	T	0.57436	0.4	4.97	4.97	0.65823	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.000000	0.64402	D	0.000003	T	0.71913	0.3396	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76075	-0.3092	10	0.72032	D	0.01	-15.3267	14.643	0.68739	0.0:0.0:0.0:1.0	.	92	Q9UMX3	BOK_HUMAN	P	92	ENSP00000314132:L92P	ENSP00000314132:L92P	L	+	2	0	BOK	242150490	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	7.378000	0.79679	1.851000	0.53745	0.533000	0.62120	CTG		0.637	BOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257268.2	NM_032515		Missense_Mutation
GPCPD1	56261	broad.mit.edu	37	20	5528439	5528439	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr20:5528439G>A	ENST00000379019.4	-	20	2099	c.1887C>T	c.(1885-1887)cgC>cgT	p.R629R	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	629					glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)	p.R629R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						CCTGCTTCAGGCGTTCCAATT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	20											174.0	171.0	172.0					20																	5528439		2203	4300	6503	5476439	SO:0001819	synonymous_variant	56261				CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.1887C>T	20.37:g.5528439G>A		Unknown		x	x	x	5476439	D3DW06|Q9BQL8|Q9NUX0	Silent	SNP	ENST00000379019.4	37	CCDS13090.1	SNP	42	Broad	.	.	.	.	.	.	.	.	.	.	g	7.229	0.598990	0.13939	.	.	ENSG00000125772	ENST00000418646	.	.	.	5.43	-0.637	0.11504	.	.	.	.	.	T	0.50034	0.1592	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38520	-0.9657	4	.	.	.	-10.8392	4.9587	0.14056	0.4454:0.0:0.4143:0.1404	.	.	.	.	S	221	.	.	P	-	1	0	GPCPD1	5476439	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.985000	0.29578	0.017000	0.15025	-0.157000	0.13467	CCT		0.403	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593		Silent
GHRH	2691	broad.mit.edu	37	20	35884854	35884854	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr20:35884854A>C	ENST00000373614.2	-	3	242	c.131T>G	c.(130-132)gTg>gGg	p.V44G	GHRH_ENST00000237527.3_Missense_Mutation_p.V44G|GHRH_ENST00000373611.2_Missense_Mutation_p.V44G			P01286	SLIB_HUMAN	growth hormone releasing hormone	44					adenohypophysis development (GO:0021984)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|growth hormone secretion (GO:0030252)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|response to food (GO:0032094)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	growth hormone-releasing hormone activity (GO:0016608)|growth hormone-releasing hormone receptor binding (GO:0031770)	p.V44G(1)		lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Myeloproliferative disorder(115;0.00878)				CTGGCCCAGCACCTTCCGGTA	0.622																																																1	Substitution - Missense(1)	ovary(1)	20											64.0	56.0	59.0					20																	35884854		2203	4300	6503	35318268	SO:0001583	missense	2691				CCDS13292.1, CCDS54460.1	20q11.2	2014-01-30			ENSG00000118702	ENSG00000118702		"""Endogenous ligands"""	4265	protein-coding gene	gene with protein product	"""sermorelin"", ""somatocrinin"", ""somatoliberin"""	139190		GHRF		3918305	Standard	NM_021081		Approved		uc002xgr.3	P01286	OTTHUMG00000032413	ENST00000373614.2:c.131T>G	20.37:g.35884854A>C	ENSP00000362716:p.Val44Gly	Unknown		x	x	x	35318268	Q4KN10|Q5JYR1	Missense_Mutation	SNP	ENST00000373614.2	37	CCDS13292.1	SNP	6	Broad	.	.	.	.	.	.	.	.	.	.	A	22.9	4.348463	0.82132	.	.	ENSG00000118702	ENST00000373614;ENST00000237527;ENST00000373611	T;T;T	0.34859	1.34;1.34;1.34	5.0	5.0	0.66597	Glucagon/GIP/secretin/VIP (3);	0.662303	0.13349	N	0.394578	T	0.58452	0.2123	M	0.75615	2.305	0.54753	D	0.999989	D;D	0.69078	0.997;0.997	D;D	0.68621	0.931;0.959	T	0.59198	-0.7499	10	0.87932	D	0	-22.6382	11.0293	0.47763	1.0:0.0:0.0:0.0	.	44;44	P01286-2;P01286	.;SLIB_HUMAN	G	44	ENSP00000362716:V44G;ENSP00000237527:V44G;ENSP00000362713:V44G	ENSP00000237527:V44G	V	-	2	0	GHRH	35318268	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	6.649000	0.74364	2.105000	0.64084	0.523000	0.50628	GTG		0.622	GHRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079094.2			Missense_Mutation
MATN4	8785	broad.mit.edu	37	20	43933367	43933367	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr20:43933367G>A	ENST00000372754.1	-	2	152	c.144C>T	c.(142-144)ttC>ttT	p.F48F	RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000342716.4_Silent_p.F48F|MATN4_ENST00000537548.1_Silent_p.F48F|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000372756.1_Silent_p.F48F|MATN4_ENST00000360607.6_Silent_p.F48F|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000353917.5_Silent_p.F48F|RBPJL_ENST00000372741.3_5'Flank			O95460	MATN4_HUMAN	matrilin 4	48	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.F48F(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				TCTCGAACTCGAAAGGGCGCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	20											31.0	28.0	29.0					20																	43933367		2202	4299	6501	43366781	SO:0001819	synonymous_variant	8785			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.144C>T	20.37:g.43933367G>A		Unknown		x	x	x	43366781	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	ENST00000372754.1	37		SNP	37	Broad																																																																																				0.627	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1			Silent
PHACTR3	116154	broad.mit.edu	37	20	58330380	58330380	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr20:58330380G>A	ENST00000371015.1	+	4	969	c.502G>A	c.(502-504)Gac>Aac	p.D168N	PHACTR3_ENST00000541461.1_Missense_Mutation_p.D127N|PHACTR3_ENST00000355648.4_Missense_Mutation_p.D127N|PHACTR3_ENST00000395636.2_Missense_Mutation_p.D127N|PHACTR3_ENST00000361300.4_Missense_Mutation_p.D127N|PHACTR3_ENST00000359926.3_Missense_Mutation_p.D165N|PHACTR3_ENST00000395639.4_Missense_Mutation_p.D127N	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	168						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.D168N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GGTCTCCCTGGACAAGCCACT	0.602																																																1	Substitution - Missense(1)	ovary(1)	20											36.0	30.0	32.0					20																	58330380		2203	4300	6503	57763775	SO:0001583	missense	116154			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.502G>A	20.37:g.58330380G>A	ENSP00000360054:p.Asp168Asn	Unknown		x	x	x	57763775	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	37	CCDS13480.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585057	0.28268	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.30182	1.91;1.92;1.54;1.94;1.94;1.94;1.54	3.7	2.74	0.32292	.	0.568281	0.14827	U	0.296090	T	0.21347	0.0514	L	0.29908	0.895	0.09310	N	1	B;B;B	0.28128	0.13;0.09;0.201	B;B;B	0.30179	0.112;0.022;0.058	T	0.17107	-1.0380	10	0.35671	T	0.21	-1.2639	7.7707	0.29006	0.1242:0.0:0.8758:0.0	.	127;168;165	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	N	165;168;127;127;127;127;127	ENSP00000353002:D165N;ENSP00000360054:D168N;ENSP00000379001:D127N;ENSP00000442483:D127N;ENSP00000347866:D127N;ENSP00000378998:D127N;ENSP00000354555:D127N	ENSP00000347866:D127N	D	+	1	0	PHACTR3	57763775	0.158000	0.22850	0.005000	0.12908	0.190000	0.23558	1.808000	0.38912	0.863000	0.35553	0.591000	0.81541	GAC		0.602	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672		Missense_Mutation
TMEM50B	757	broad.mit.edu	37	21	34828045	34828045	+	Silent	SNP	A	A	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr21:34828045A>C	ENST00000542230.2	-	6	634	c.420T>G	c.(418-420)ctT>ctG	p.L140L		NM_006134.6	NP_006125.2	P56557	TM50B_HUMAN	transmembrane protein 50B	140						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L140L(1)		breast(1)|kidney(1)|ovary(1)|skin(1)	4						TAAAAAATATAAGTGCATTTT	0.318																																																1	Substitution - coding silent(1)	ovary(1)	21											98.0	97.0	97.0					21																	34828045		2202	4298	6500	33749915	SO:0001819	synonymous_variant	757			AF045606	CCDS13625.1	21q22.1	2008-07-29	2005-06-02	2005-06-02	ENSG00000142188	ENSG00000142188			1280	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 4"""	C21orf4			Standard	NR_040016		Approved		uc002yrs.2	P56557	OTTHUMG00000065286	ENST00000542230.2:c.420T>G	21.37:g.34828045A>C		Unknown		x	x	x	33749915	B2R4L4|D3DSF1|O60537|Q5PY47	Silent	SNP	ENST00000542230.2	37	CCDS13625.1	SNP	13	Broad																																																																																				0.318	TMEM50B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140080.5			Silent
C21orf33	8209	broad.mit.edu	37	21	45556009	45556009	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr21:45556009C>A	ENST00000291577.6	+	3	355	c.262C>A	c.(262-264)Cac>Aac	p.H88N	C21orf33_ENST00000427803.2_Missense_Mutation_p.H88N|C21orf33_ENST00000493883.1_3'UTR|C21orf33_ENST00000348499.5_Missense_Mutation_p.H88N	NM_004649.6	NP_004640	P30042	ES1_HUMAN	chromosome 21 open reading frame 33	88						mitochondrion (GO:0005739)		p.H88N(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		CCCTCAGATGCACGTGATTGA	0.587																																																1	Substitution - Missense(1)	ovary(1)	21											89.0	76.0	81.0					21																	45556009		2203	4300	6503	44380437	SO:0001583	missense	8209			Y07572	CCDS33580.1, CCDS33581.1	21q22.3	2008-07-29			ENSG00000160221	ENSG00000160221			1273	protein-coding gene	gene with protein product		601659				9150728, 8975701	Standard	NM_004649		Approved	KNP-Ia, GT335, ES1, HES1, D21S2048E, KNPI, KNPH, KNP-I	uc002zec.4	P30042	OTTHUMG00000086916	ENST00000291577.6:c.262C>A	21.37:g.45556009C>A	ENSP00000291577:p.His88Asn	Unknown		x	x	x	44380437	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000291577.6	37	CCDS33580.1	SNP	25	Broad	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	24.7|24.7|24.7	4.564001|4.564001|4.564001	0.86335|0.86335|0.86335	.|.|.	.|.|.	ENSG00000160221|ENSG00000160221|ENSG00000248354;ENSG00000160221;ENSG00000160221;ENSG00000160221;ENSG00000160221	ENST00000449622|ENST00000419699|ENST00000433711;ENST00000291577;ENST00000427803;ENST00000348499;ENST00000389690	.|.|T;T;T;T	.|.|0.31247	.|.|1.5;1.5;1.5;1.5	4.93|4.93|4.93	4.93|4.93|4.93	0.64822|0.64822|0.64822	.|.|ThiJ/PfpI (1);	.|.|0.051197	.|.|0.85682	.|.|D	.|.|0.000000	T|.|T	0.62551|.|0.62551	0.2437|.|0.2437	M|M|M	0.88241|0.88241|0.88241	2.94|2.94|2.94	0.58432|0.58432|0.58432	D|D|D	0.999997|0.999997|0.999997	.|.|D;D	.|.|0.60575	.|.|0.985;0.988	.|.|D;D	.|.|0.67382	.|.|0.919;0.951	T|.|T	0.71203|.|0.71203	-0.4662|.|-0.4662	5|.|10	.|.|0.72032	.|.|D	.|.|0.01	-24.1491|-24.1491|-24.1491	18.5529|18.5529|18.5529	0.91072|0.91072|0.91072	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|88;88	.|.|P30042-2;P30042	.|.|.;ES1_HUMAN	E|X|N	49|3|67;88;88;88;61	.|.|ENSP00000291577:H88N;ENSP00000396655:H88N;ENSP00000344901:H88N;ENSP00000374340:H61N	.|.|ENSP00000415634:H67N	A|C|H	+|+|+	2|3|1	0|2|0	C21orf33|C21orf33|C21orf33;AP001055.7	44380437|44380437|44380437	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	5.594000|5.594000|5.594000	0.67557|0.67557|0.67557	2.449000|2.449000|2.449000	0.82847|0.82847|0.82847	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCA|TGC|CAC		0.587	C21orf33-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195824.1	NM_004649		Missense_Mutation
SLC35E4	339665	broad.mit.edu	37	22	31032922	31032922	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:31032922T>C	ENST00000343605.4	+	1	1284	c.485T>C	c.(484-486)cTt>cCt	p.L162P	SLC35E4_ENST00000406566.1_Missense_Mutation_p.L162P|SLC35E4_ENST00000300385.8_Missense_Mutation_p.L162P	NM_001001479.2	NP_001001479.1	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	162	EamA.|Leu-rich.					integral component of membrane (GO:0016021)		p.L162P(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	10						CACCACCCACTTCAGTTGGCC	0.692																																																1	Substitution - Missense(1)	ovary(1)	22											26.0	19.0	21.0					22																	31032922		2194	4281	6475	29362922	SO:0001583	missense	339665				CCDS13882.1	22q12.2	2013-05-22			ENSG00000100036	ENSG00000100036		"""Solute carriers"""	17058	protein-coding gene	gene with protein product							Standard	NM_001001479		Approved		uc003ais.1	Q6ICL7	OTTHUMG00000151110	ENST00000343605.4:c.485T>C	22.37:g.31032922T>C	ENSP00000339626:p.Leu162Pro	Unknown		x	x	x	29362922	Q567P0	Missense_Mutation	SNP	ENST00000343605.4	37	CCDS13882.1	SNP	56	Broad	.	.	.	.	.	.	.	.	.	.	T	15.84	2.951335	0.53186	.	.	ENSG00000100036	ENST00000343605;ENST00000300385;ENST00000406566;ENST00000451479	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.16	5.16	0.70880	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.63165	0.2488	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.60378	-0.7275	10	0.29301	T	0.29	-13.4556	14.0058	0.64463	0.0:0.0:0.0:1.0	.	162;162	Q6ICL7-2;Q6ICL7	.;S35E4_HUMAN	P	162;162;162;138	ENSP00000339626:L162P;ENSP00000300385:L162P;ENSP00000384377:L162P;ENSP00000413552:L138P	ENSP00000300385:L162P	L	+	2	0	SLC35E4	29362922	1.000000	0.71417	0.830000	0.32933	0.113000	0.19764	7.212000	0.77941	1.950000	0.56595	0.448000	0.29417	CTT		0.692	SLC35E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321382.1	XM_290973		Missense_Mutation
CYTH4	27128	broad.mit.edu	37	22	37705313	37705313	+	Missense_Mutation	SNP	C	C	G	rs535579793		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:37705313C>G	ENST00000248901.6	+	9	944	c.757C>G	c.(757-759)Ctc>Gtc	p.L253V		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	253					positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)	p.L253V(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						CGGCAATGACCTCACTCACAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	22											222.0	162.0	182.0					22																	37705313		2203	4300	6503	36035259	SO:0001583	missense	27128			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.757C>G	22.37:g.37705313C>G	ENSP00000248901:p.Leu253Val	Unknown		x	x	x	36035259	Q5R3F9|Q9UGT6	Missense_Mutation	SNP	ENST00000248901.6	37	CCDS13946.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394601	0.62066	.	.	ENSG00000100055	ENST00000248901	T	0.08102	3.13	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.11324	0.0276	M	0.64404	1.975	0.80722	D	1	P	0.39116	0.66	B	0.37047	0.24	T	0.17319	-1.0373	10	0.22706	T	0.39	.	16.0929	0.81102	0.0:1.0:0.0:0.0	.	253	Q9UIA0	CYH4_HUMAN	V	253	ENSP00000248901:L253V	ENSP00000248901:L253V	L	+	1	0	CYTH4	36035259	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.931000	0.70113	2.150000	0.67090	0.561000	0.74099	CTC		0.567	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1			Missense_Mutation
GTPBP1	9567	broad.mit.edu	37	22	39112025	39112025	+	Missense_Mutation	SNP	G	G	C	rs34475334		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:39112025G>C	ENST00000216044.5	+	3	651	c.418G>C	c.(418-420)Gct>Cct	p.A140P		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	140					GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.A140P(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					ACGGCAAGAAGCTGGGGGCCG	0.597																																																1	Substitution - Missense(1)	ovary(1)	22											71.0	60.0	64.0					22																	39112025		2203	4300	6503	37441971	SO:0001583	missense	9567			U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.418G>C	22.37:g.39112025G>C	ENSP00000216044:p.Ala140Pro	Unknown		x	x	x	37441971	Q6IC67	Missense_Mutation	SNP	ENST00000216044.5	37	CCDS13977.2	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392947	0.42410	.	.	ENSG00000100226	ENST00000216044;ENST00000484657;ENST00000488787	T;T;T	0.46819	1.41;0.86;0.87	4.93	3.89	0.44902	.	0.104423	0.64402	D	0.000005	T	0.39332	0.1074	L	0.34521	1.04	0.52501	D	0.999959	P	0.34562	0.457	B	0.36335	0.222	T	0.21280	-1.0250	10	0.37606	T	0.19	.	14.7419	0.69461	0.0:0.0:0.8546:0.1454	.	140	O00178	GTPB1_HUMAN	P	140;59;59	ENSP00000216044:A140P;ENSP00000442881:A59P;ENSP00000439505:A59P	ENSP00000216044:A140P	A	+	1	0	GTPBP1	37441971	1.000000	0.71417	0.990000	0.47175	0.722000	0.41435	4.222000	0.58580	1.042000	0.40150	0.467000	0.42956	GCT		0.597	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075532.1	NM_004286		Missense_Mutation
L3MBTL2	83746	broad.mit.edu	37	22	41609977	41609977	+	Missense_Mutation	SNP	T	T	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:41609977T>G	ENST00000216237.5	+	3	501	c.343T>G	c.(343-345)Tcc>Gcc	p.S115A	L3MBTL2_ENST00000489136.1_3'UTR|RP4-756G23.5_ENST00000451176.1_RNA|RP4-756G23.5_ENST00000441316.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	115					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S115A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGTCTCCTGCTCCAGGAGCTA	0.527																																																1	Substitution - Missense(1)	ovary(1)	22											130.0	120.0	123.0					22																	41609977		2203	4300	6503	39939923	SO:0001583	missense	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.343T>G	22.37:g.41609977T>G	ENSP00000216237:p.Ser115Ala	Unknown		x	x	x	39939923	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	SNP	54	Broad	.	.	.	.	.	.	.	.	.	.	T	21.6	4.167503	0.78339	.	.	ENSG00000100395	ENST00000216237	T	0.18960	2.18	5.84	5.84	0.93424	Zinc finger, FCS-type (1);	0.118277	0.64402	D	0.000015	T	0.32971	0.0847	L	0.33293	1	0.58432	D	0.999996	D;P	0.61697	0.99;0.876	D;B	0.73380	0.98;0.338	T	0.04565	-1.0942	10	0.11182	T	0.66	.	16.2194	0.82247	0.0:0.0:0.0:1.0	.	115;115	Q969R5-3;Q969R5	.;LMBL2_HUMAN	A	115	ENSP00000216237:S115A	ENSP00000216237:S115A	S	+	1	0	L3MBTL2	39939923	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.040000	0.89188	2.234000	0.73211	0.528000	0.53228	TCC		0.527	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488		Missense_Mutation
XRCC6	2547	broad.mit.edu	37	22	42049689	42049689	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:42049689C>A	ENST00000359308.4	+	8	1941	c.1286C>A	c.(1285-1287)cCt>cAt	p.P429H	XRCC6_ENST00000405506.1_Missense_Mutation_p.P379H|XRCC6_ENST00000360079.3_Missense_Mutation_p.P429H|XRCC6_ENST00000402580.3_Missense_Mutation_p.P388H|XRCC6_ENST00000405878.1_Missense_Mutation_p.P429H|XRCC6_ENST00000428575.2_Missense_Mutation_p.P296H			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	429	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CAGGTGACTCCTCCAGGTATG	0.478								Non-homologous end-joining																																								0			22											80.0	76.0	77.0					22																	42049689		2203	4300	6503	40379635	SO:0001583	missense	2547			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1286C>A	22.37:g.42049689C>A	ENSP00000352257:p.Pro429His	Unknown		x	x	x	40379635	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	ENST00000359308.4	37	CCDS14021.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176275	0.78564	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	3.57	3.57	0.40892	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);DNA helicase, ATP-dependent, Ku type (2);	0.046876	0.85682	D	0.000000	D	0.84000	0.5376	M	0.91717	3.235	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.984;0.998	D	0.86226	0.1634	9	0.42905	T	0.14	-6.7126	14.6393	0.68711	0.0:1.0:0.0:0.0	.	379;429;388;429	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	H	429;388;296;429;429;429;379	.	ENSP00000352257:P429H	P	+	2	0	XRCC6	40379635	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.616000	0.83018	2.289000	0.77006	0.561000	0.74099	CCT		0.478	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321688.1	NM_001469		Missense_Mutation
CHKB	1120	broad.mit.edu	37	22	51020289	51020289	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr22:51020289G>A	ENST00000406938.2	-	3	553	c.336C>T	c.(334-336)ggC>ggT	p.G112G	CHKB-CPT1B_ENST00000453634.1_5'Flank|CHKB-AS1_ENST00000380711.3_RNA|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CHKB_ENST00000463053.1_5'UTR	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	112					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)	p.G112G(1)		NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	GGGAGTCCACGCCCTGAAAAA	0.612																																																1	Substitution - coding silent(1)	ovary(1)	22											51.0	54.0	53.0					22																	51020289		2203	4300	6503	49367155	SO:0001819	synonymous_variant	1120			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.336C>T	22.37:g.51020289G>A		Unknown		x	x	x	49367155	A0PJM6|Q13388	Silent	SNP	ENST00000406938.2	37	CCDS14099.1	SNP	38	Broad																																																																																				0.612	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198		Silent
ITPR1	3708	broad.mit.edu	37	3	4703822	4703822	+	Silent	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr3:4703822T>A	ENST00000443694.2	+	12	1263	c.1263T>A	c.(1261-1263)tcT>tcA	p.S421S	ITPR1_ENST00000357086.4_Silent_p.S436S|ITPR1_ENST00000302640.8_Silent_p.S421S|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Silent_p.S436S|ITPR1_ENST00000456211.2_Silent_p.S421S|ITPR1_ENST00000423119.2_Silent_p.S436S			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	436	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.S421S(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTCCGGTTTCTCCTGCTGAAG	0.502																																																1	Substitution - coding silent(1)	ovary(1)	3											114.0	112.0	112.0					3																	4703822		1969	4151	6120	4678822	SO:0001819	synonymous_variant	3708			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.1263T>A	3.37:g.4703822T>A		Unknown		x	x	x	4678822	E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	CCDS54551.1	SNP	54	Broad																																																																																				0.502	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222		Silent
GRM7	2917	broad.mit.edu	37	3	7620140	7620140	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr3:7620140G>A	ENST00000357716.4	+	8	1821	c.1547G>A	c.(1546-1548)cGa>cAa	p.R516Q	GRM7_ENST00000403881.1_Missense_Mutation_p.R516Q|GRM7_ENST00000402647.2_Missense_Mutation_p.R516Q|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000389336.4_Missense_Mutation_p.R516Q|GRM7_ENST00000486284.1_Missense_Mutation_p.R516Q	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	516					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R516Q(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AAAGGAGTCCGAGAGATACCC	0.458																																																1	Substitution - Missense(1)	ovary(1)	3											71.0	70.0	70.0					3																	7620140		2203	4300	6503	7595140	SO:0001583	missense	2917			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1547G>A	3.37:g.7620140G>A	ENSP00000350348:p.Arg516Gln	Unknown		x	x	x	7595140	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	SNP	37	Broad	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.663295	0.00772	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;T	0.88975	-2.41;-2.45;-2.44;-2.44;-2.45;-0.92	5.71	4.83	0.62350	.	0.133103	0.51477	D	0.000089	T	0.81331	0.4800	L	0.28344	0.845	0.34292	D	0.683344	B;B;B;B;B	0.12630	0.006;0.002;0.003;0.001;0.003	B;B;B;B;B	0.09377	0.004;0.001;0.0;0.0;0.004	T	0.77935	-0.2401	10	0.11182	T	0.66	.	15.5544	0.76180	0.0:0.1384:0.8616:0.0	.	516;516;271;516;516	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	Q	516;516;516;516;516;516;516;173	ENSP00000350348:R516Q;ENSP00000417536:R516Q;ENSP00000373987:R516Q;ENSP00000385664:R516Q;ENSP00000384585:R516Q;ENSP00000395035:R173Q	ENSP00000350348:R516Q	R	+	2	0	GRM7	7595140	0.989000	0.36119	0.957000	0.39632	0.005000	0.04900	2.947000	0.49058	1.418000	0.47098	-0.165000	0.13383	CGA		0.458	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		Missense_Mutation
TTC21A	199223	broad.mit.edu	37	3	39170331	39170331	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr3:39170331G>A	ENST00000431162.2	+	14	1959	c.1825G>A	c.(1825-1827)Ggc>Agc	p.G609S	TTC21A_ENST00000440121.1_Missense_Mutation_p.G561S|TTC21A_ENST00000301819.6_Missense_Mutation_p.G610S			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	609								p.G610S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GAAGGAAGAAGGCAGAAAGTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	3											87.0	88.0	87.0					3																	39170331		1928	4154	6082	39145335	SO:0001583	missense	199223			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1825G>A	3.37:g.39170331G>A	ENSP00000398211:p.Gly609Ser	Unknown		x	x	x	39145335	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	CCDS46800.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	2.484	-0.319004	0.05386	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.61392	0.11;0.11;0.24	5.17	0.138	0.14793	Tetratricopeptide-like helical (1);	0.931884	0.09035	N	0.858149	T	0.38772	0.1053	N	0.21583	0.68	0.09310	N	1	B;B;B	0.12013	0.001;0.005;0.003	B;B;B	0.12156	0.002;0.007;0.003	T	0.23013	-1.0200	10	0.09843	T	0.71	-2.3165	10.1282	0.42663	0.4625:0.0:0.5375:0.0	.	561;610;609	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	S	610;592;609;561	ENSP00000301819:G610S;ENSP00000398211:G609S;ENSP00000410882:G561S	ENSP00000301819:G610S	G	+	1	0	TTC21A	39145335	0.012000	0.17670	0.720000	0.30636	0.223000	0.24884	-0.022000	0.12480	0.026000	0.15269	-0.471000	0.05019	GGC		0.537	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755		Missense_Mutation
ZNF35	7584	broad.mit.edu	37	3	44701295	44701295	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr3:44701295G>A	ENST00000396056.2	+	4	1675	c.1440G>A	c.(1438-1440)ggG>ggA	p.G480G	ZNF35_ENST00000542250.1_Silent_p.G320G|ZNF35_ENST00000296092.3_3'UTR|RP11-944L7.4_ENST00000457331.1_RNA	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	480					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G480G(1)		large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		ATGAGTGTGGGAAGGCCTTCA	0.463																																																1	Substitution - coding silent(1)	ovary(1)	3											74.0	73.0	73.0					3																	44701295		2203	4300	6503	44676299	SO:0001819	synonymous_variant	7584			X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1440G>A	3.37:g.44701295G>A		Unknown		x	x	x	44676299	B2RBU6|Q53Y54|Q96D01	Silent	SNP	ENST00000396056.2	37	CCDS2718.2	SNP	41	Broad																																																																																				0.463	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	NM_003420		Silent
RTP1	132112	broad.mit.edu	37	3	186917744	186917744	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr3:186917744G>A	ENST00000312295.4	+	2	708	c.678G>A	c.(676-678)tcG>tcA	p.S226S	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	226					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.S226S(1)		breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CCACCAAGTCGCAGGACCAGA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	3											59.0	56.0	57.0					3																	186917744		2203	4300	6503	188400438	SO:0001819	synonymous_variant	132112			BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.678G>A	3.37:g.186917744G>A		Unknown		x	x	x	188400438		Silent	SNP	ENST00000312295.4	37	CCDS3287.2	SNP	38	Broad																																																																																				0.627	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708		Silent
PIGG	54872	broad.mit.edu	37	4	524498	524498	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr4:524498G>A	ENST00000453061.2	+	11	2641	c.2535G>A	c.(2533-2535)atG>atA	p.M845I	PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000383028.4_Missense_Mutation_p.M712I|PIGG_ENST00000504346.1_Missense_Mutation_p.M756I|PIGG_ENST00000310340.5_Missense_Mutation_p.M837I	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	845					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)	p.M837I(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						TTACTGTGATGCATTATTGGT	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											214.0	216.0	215.0					4																	524498		2203	4300	6503	514498	SO:0001583	missense	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.2535G>A	4.37:g.524498G>A	ENSP00000415203:p.Met845Ile	Unknown		x	x	x	514498	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	CCDS46992.1	SNP	46	Broad	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654447	0.88056	.	.	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000453065;ENST00000510235	T;T;T;T	0.09723	3.28;3.28;2.96;2.95	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.27419	0.0673	L	0.59436	1.845	0.80722	D	1	D;P;P	0.69078	0.997;0.74;0.831	D;B;P	0.77557	0.99;0.387;0.591	T	0.02424	-1.1161	10	0.08837	T	0.75	-44.5616	17.8347	0.88692	0.0:0.0:1.0:0.0	.	712;845;837	Q5H8A4-3;Q5H8A4;Q5H8A4-2	.;PIGG_HUMAN;.	I	837;845;756;712;1;19	ENSP00000311750:M837I;ENSP00000415203:M845I;ENSP00000424800:M756I;ENSP00000372494:M712I	ENSP00000311750:M837I	M	+	3	0	PIGG	514498	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	7.126000	0.77201	2.814000	0.96858	0.655000	0.94253	ATG		0.348	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733		Missense_Mutation
MAN2B2	23324	broad.mit.edu	37	4	6599954	6599954	+	Silent	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr4:6599954T>A	ENST00000285599.3	+	9	1314	c.1278T>A	c.(1276-1278)acT>acA	p.T426T	MAN2B2_ENST00000504248.1_Silent_p.T375T	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	426					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.T426T(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						TCACTGGGACTGAGTCCCCCA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	4											94.0	81.0	85.0					4																	6599954		2203	4300	6503	6650855	SO:0001819	synonymous_variant	23324			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1278T>A	4.37:g.6599954T>A		Unknown		x	x	x	6650855	Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	37	CCDS33951.1	SNP	55	Broad	.	.	.	.	.	.	.	.	.	.	T	1.277	-0.611353	0.03690	.	.	ENSG00000013288	ENST00000505907	.	.	.	4.86	-9.72	0.00515	.	.	.	.	.	T	0.43919	0.1269	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	T	0.52056	-0.8626	4	.	.	.	-3.8129	6.7928	0.23709	0.1632:0.5853:0.0917:0.1599	.	.	.	.	Q	425	.	.	L	+	2	0	MAN2B2	6650855	0.042000	0.20092	0.019000	0.16419	0.061000	0.15899	-1.365000	0.02587	-1.632000	0.01541	-1.219000	0.01604	CTG		0.597	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274		Silent
TRMT10A	93587	broad.mit.edu	37	4	100470496	100470496	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr4:100470496C>G	ENST00000273962.3	-	8	1081	c.769G>C	c.(769-771)Gaa>Caa	p.E257Q	TRMT10A_ENST00000394877.3_Missense_Mutation_p.E257Q|TRMT10A_ENST00000394876.2_Missense_Mutation_p.E257Q	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	257	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)	p.E257Q(1)									TCCAGGTATTCCAGAATAATT	0.393																																																1	Substitution - Missense(1)	ovary(1)	4											83.0	83.0	83.0					4																	100470496		2203	4300	6503	100689519	SO:0001583	missense	93587			BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.769G>C	4.37:g.100470496C>G	ENSP00000273962:p.Glu257Gln	Unknown		x	x	x	100689519	B2R8X7|Q9Y2T9	Missense_Mutation	SNP	ENST00000273962.3	37	CCDS3650.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	19.18	3.778107	0.70107	.	.	ENSG00000145331	ENST00000394877;ENST00000273962;ENST00000394876	T;T;T	0.21734	1.99;1.99;1.99	5.94	5.94	0.96194	.	0.213391	0.45606	D	0.000352	T	0.19406	0.0466	N	0.24115	0.695	0.42515	D	0.992989	B	0.22683	0.073	B	0.29663	0.105	T	0.08006	-1.0743	10	0.21540	T	0.41	-28.5877	20.3591	0.98849	0.0:1.0:0.0:0.0	.	257	Q8TBZ6	RG9D2_HUMAN	Q	257	ENSP00000378343:E257Q;ENSP00000273962:E257Q;ENSP00000378342:E257Q	ENSP00000273962:E257Q	E	-	1	0	RG9MTD2	100689519	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.459000	0.60102	2.816000	0.96949	0.561000	0.74099	GAA		0.393	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253668.1	NM_152292		Missense_Mutation
PCDHA3	56145	broad.mit.edu	37	5	140183057	140183057	+	Missense_Mutation	SNP	T	T	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:140183057T>C	ENST00000522353.2	+	1	2275	c.2275T>C	c.(2275-2277)Tgc>Cgc	p.C759R	PCDHA2_ENST00000520672.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.C759R|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	759	6 X 4 AA repeats of P-X-X-P.		C -> Y (in dbSNP:rs2240694).		cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.C759R(1)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGAGGGTGTGCTCTGGAGA	0.622																																																1	Substitution - Missense(1)	ovary(1)	5											97.0	102.0	100.0					5																	140183057		2203	4300	6503	140163241	SO:0001583	missense	56145			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.2275T>C	5.37:g.140183057T>C	ENSP00000429808:p.Cys759Arg	Unknown		x	x	x	140163241	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	SNP	59	Broad	.	.	.	.	.	.	.	.	.	.	t	15.13	2.741846	0.49151	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.14766	2.48;2.48	4.16	2.95	0.34219	.	0.338457	0.20695	U	0.087381	T	0.41419	0.1158	H	0.96142	3.775	0.42303	D	0.992183	P;P	0.51653	0.947;0.903	P;P	0.56514	0.8;0.707	T	0.49513	-0.8932	10	0.87932	D	0	.	8.9648	0.35869	0.2942:0.0:0.0:0.7058	.	759;759	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	R	759	ENSP00000429808:C759R;ENSP00000434086:C759R	ENSP00000429808:C759R	C	+	1	0	PCDHA3	140163241	.	.	0.991000	0.47740	0.643000	0.38383	.	.	0.539000	0.28788	0.383000	0.25322	TGC		0.622	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		Missense_Mutation
PCDHA13	56136	broad.mit.edu	37	5	140262692	140262692	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:140262692C>T	ENST00000289272.2	+	1	839	c.839C>T	c.(838-840)tCa>tTa	p.S280L	PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.S280L|PCDHA10_ENST00000307360.5_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	280	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S280L(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAGTTTACTCATTTAGAAGG	0.383																																					Melanoma(147;1739 1852 5500 27947 37288)											1	Substitution - Missense(1)	ovary(1)	5											81.0	80.0	80.0					5																	140262692		2203	4300	6503	140242876	SO:0001583	missense	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.839C>T	5.37:g.140262692C>T	ENSP00000289272:p.Ser280Leu	Unknown		x	x	x	140242876	O75277	Missense_Mutation	SNP	ENST00000289272.2	37	CCDS4240.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977101	0.34848	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.55052	0.54;0.54	5.58	3.76	0.43208	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.60663	0.2286	M	0.84773	2.715	0.09310	N	0.999999	B;B;B	0.31625	0.064;0.226;0.332	B;B;B	0.39258	0.295;0.204;0.232	T	0.59209	-0.7497	9	0.72032	D	0.01	.	8.3678	0.32397	0.2717:0.6565:0.0:0.0719	.	280;280;280	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	L	280	ENSP00000386821:S280L;ENSP00000289272:S280L	ENSP00000289272:S280L	S	+	2	0	PCDHA13	140242876	0.000000	0.05858	0.028000	0.17463	0.971000	0.66376	-0.103000	0.10940	1.328000	0.45358	0.561000	0.74099	TCA		0.383	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904		Missense_Mutation
FBXO38	81545	broad.mit.edu	37	5	147820788	147820788	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:147820788G>A	ENST00000340253.5	+	21	3544	c.3376G>A	c.(3376-3378)Gac>Aac	p.D1126N	FBXO38_ENST00000394370.3_Missense_Mutation_p.D1051N|FBXO38_ENST00000296701.6_Missense_Mutation_p.D881N|FBXO38_ENST00000513826.1_Missense_Mutation_p.D881N			Q6PIJ6	FBX38_HUMAN	F-box protein 38	1126					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D1126N(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACTTTGAAGACGATGAAGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											187.0	158.0	168.0					5																	147820788		2203	4300	6503	147800981	SO:0001583	missense	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.3376G>A	5.37:g.147820788G>A	ENSP00000342023:p.Asp1126Asn	Unknown		x	x	x	147800981	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770837	0.90108	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.34072	1.38;1.44;1.42;1.44	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.43964	0.1271	N	0.19112	0.55	0.39060	D	0.960504	D;P;D	0.89917	0.996;0.698;1.0	D;P;D	0.87578	0.981;0.561;0.998	T	0.18524	-1.0334	10	0.11182	T	0.66	-22.0152	18.3358	0.90287	0.0:0.0:1.0:0.0	.	881;1051;1126	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	N	1126;881;1051;881	ENSP00000342023:D1126N;ENSP00000296701:D881N;ENSP00000377895:D1051N;ENSP00000426410:D881N	ENSP00000296701:D881N	D	+	1	0	FBXO38	147800981	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.328000	0.96403	2.750000	0.94351	0.591000	0.81541	GAC		0.413	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793		Missense_Mutation
G3BP1	10146	broad.mit.edu	37	5	151179553	151179553	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:151179553C>G	ENST00000394123.3	+	9	1092	c.947C>G	c.(946-948)cCc>cGc	p.P316R	G3BP1_ENST00000356245.3_Missense_Mutation_p.P316R|G3BP1_ENST00000543466.1_Missense_Mutation_p.P134R			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	316					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.P316R(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			CAAAGGGGACCCAGACCAAGT	0.448																																																1	Substitution - Missense(1)	ovary(1)	5											29.0	30.0	29.0					5																	151179553		2203	4300	6503	151159746	SO:0001583	missense	10146			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.947C>G	5.37:g.151179553C>G	ENSP00000377681:p.Pro316Arg	Unknown		x	x	x	151159746	Q5HYE9	Missense_Mutation	SNP	ENST00000394123.3	37	CCDS4319.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894147	0.91889	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245;ENST00000274596	T;T;T	0.75477	-0.76;-0.94;-0.76	5.29	5.29	0.74685	.	0.048044	0.85682	D	0.000000	D	0.86940	0.6054	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87410	0.2375	10	0.56958	D	0.05	-11.5939	19.3089	0.94177	0.0:1.0:0.0:0.0	.	316	Q13283	G3BP1_HUMAN	R	316;134;316;158	ENSP00000377681:P316R;ENSP00000445035:P134R;ENSP00000348578:P316R	ENSP00000274596:P158R	P	+	2	0	G3BP1	151159746	1.000000	0.71417	0.977000	0.42913	0.984000	0.73092	6.957000	0.76019	2.631000	0.89168	0.650000	0.86243	CCC		0.448	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1	NM_005754		Missense_Mutation
ITK	3702	broad.mit.edu	37	5	156644898	156644898	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:156644898C>T	ENST00000422843.3	+	5	628	c.476C>T	c.(475-477)cCt>cTt	p.P159L	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	159					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.P159L(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CCTCTTCCTCCTACTCCTGAA	0.507			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	ovary(1)	5											135.0	139.0	138.0					5																	156644898		2203	4300	6503	156577476	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.476C>T	5.37:g.156644898C>T	ENSP00000398655:p.Pro159Leu	Unknown		x	x	x	156577476	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394612	0.62066	.	.	ENSG00000113263	ENST00000521769;ENST00000422843	D;T	0.91011	-2.77;-1.01	5.01	5.01	0.66863	.	0.111999	0.64402	D	0.000009	D	0.93058	0.7790	M	0.84948	2.725	0.53005	D	0.999963	D	0.56521	0.976	P	0.49140	0.601	D	0.93863	0.7155	10	0.56958	D	0.05	.	15.253	0.73561	0.0:1.0:0.0:0.0	.	159	Q08881	ITK_HUMAN	L	34;159	ENSP00000430327:P34L;ENSP00000398655:P159L	ENSP00000398655:P159L	P	+	2	0	ITK	156577476	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.205000	0.51090	2.318000	0.78349	0.561000	0.74099	CCT		0.507	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2			Missense_Mutation
DOCK2	1794	broad.mit.edu	37	5	169435740	169435740	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:169435740G>C	ENST00000256935.8	+	32	3302	c.3222G>C	c.(3220-3222)tgG>tgC	p.W1074C	DOCK2_ENST00000520908.1_Missense_Mutation_p.W566C|DOCK2_ENST00000540750.1_Missense_Mutation_p.W135C|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1074	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.W1074C(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGATATGTGGTACAAGCTTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	5											216.0	185.0	196.0					5																	169435740		2203	4300	6503	169368318	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3222G>C	5.37:g.169435740G>C	ENSP00000256935:p.Trp1074Cys	Unknown		x	x	x	169368318	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458500	0.84317	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.58940	0.3;0.3;0.3	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	D	0.85470	0.1172	10	0.87932	D	0	.	20.1346	0.98019	0.0:0.0:1.0:0.0	.	566;1074	E7ERW7;Q92608	.;DOCK2_HUMAN	C	1074;566;135	ENSP00000256935:W1074C;ENSP00000429283:W566C;ENSP00000438827:W135C	ENSP00000256935:W1074C	W	+	3	0	DOCK2	169368318	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.869000	0.99810	2.765000	0.95021	0.655000	0.94253	TGG		0.498	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946		Missense_Mutation
KCNMB1	3779	broad.mit.edu	37	5	169805927	169805927	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr5:169805927G>A	ENST00000274629.4	-	4	799	c.357C>T	c.(355-357)gaC>gaT	p.D119D	KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	119					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.D119D(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	CCTTCTCCACGTCGGCCCGGG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	5											78.0	78.0	78.0					5																	169805927		2203	4300	6503	169738505	SO:0001819	synonymous_variant	3779			AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.357C>T	5.37:g.169805927G>A		Unknown		x	x	x	169738505	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Silent	SNP	ENST00000274629.4	37	CCDS4373.1	SNP	40	Broad																																																																																				0.572	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3			Silent
HIST1H4E	8367	broad.mit.edu	37	6	26205108	26205108	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:26205108G>A	ENST00000360441.4	+	1	251	c.236G>A	c.(235-237)cGc>cAc	p.R79H		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	79					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R79H(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				CACGCCAAACGCAAGACAGTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											141.0	121.0	128.0					6																	26205108		2203	4300	6503	26313087	SO:0001583	missense	8367			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.236G>A	6.37:g.26205108G>A	ENSP00000353624:p.Arg79His	Unknown		x	x	x	26313087	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000360441.4	37	CCDS4593.1	SNP	38	Broad	.	.	.	.	.	.	.	.	.	.	.	18.84	3.709455	0.68730	.	.	ENSG00000198518	ENST00000360441	T	0.77358	-1.09	2.2	2.2	0.27929	.	0.000000	0.85682	U	0.000000	T	0.78786	0.4338	.	.	.	0.49798	D	0.999824	.	.	.	.	.	.	T	0.82261	-0.0545	7	0.87932	D	0	.	12.403	0.55424	0.0:0.0:1.0:0.0	.	.	.	.	H	79	ENSP00000353624:R79H	ENSP00000353624:R79H	R	+	2	0	HIST1H4E	26313087	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	9.201000	0.95017	1.521000	0.48983	0.655000	0.94253	CGC		0.537	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545		Missense_Mutation
B3GALT4	8705	broad.mit.edu	37	6	33245242	33245242	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:33245242C>G	ENST00000451237.1	+	1	326	c.46C>G	c.(46-48)Ctg>Gtg	p.L16V		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	16					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.L16V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						CGCTTTGCTGCTGGTGATCGT	0.682																																																1	Substitution - Missense(1)	ovary(1)	6											36.0	40.0	39.0					6																	33245242		2202	4298	6500	33353220	SO:0001583	missense	8705			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.46C>G	6.37:g.33245242C>G	ENSP00000390784:p.Leu16Val	Unknown		x	x	x	33353220		Missense_Mutation	SNP	ENST00000451237.1	37	CCDS34425.1	SNP	28	Broad	.	.	.	.	.	.	.	.	.	.	C	10.08	1.251573	0.22880	.	.	ENSG00000235863	ENST00000451237	T	0.39997	1.05	4.54	1.52	0.23074	.	0.552015	0.16562	N	0.209001	T	0.07999	0.0200	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30357	-0.9981	10	0.23891	T	0.37	.	3.7125	0.08425	0.0:0.5588:0.2079:0.2333	.	16	O96024	B3GT4_HUMAN	V	16	ENSP00000390784:L16V	ENSP00000390784:L16V	L	+	1	2	B3GALT4	33353220	0.492000	0.26027	0.906000	0.35671	0.531000	0.34715	0.609000	0.24238	0.540000	0.28808	-0.326000	0.08463	CTG		0.682	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076162.2			Missense_Mutation
CUL9	23113	broad.mit.edu	37	6	43154085	43154085	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:43154085G>C	ENST00000252050.4	+	4	1227	c.1143G>C	c.(1141-1143)caG>caC	p.Q381H	CUL9_ENST00000354495.3_Missense_Mutation_p.Q381H|CUL9_ENST00000372647.2_Missense_Mutation_p.Q381H	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	381					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.Q381H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ATGTGCAGCAGACACTCCAGC	0.582																																																1	Substitution - Missense(1)	ovary(1)	6											75.0	71.0	72.0					6																	43154085		2203	4300	6503	43262063	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1143G>C	6.37:g.43154085G>C	ENSP00000252050:p.Gln381His	Unknown		x	x	x	43262063	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	SNP	33	Broad	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854754	0.32791	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.73152	-0.71;-0.72;-0.61	5.5	3.67	0.42095	CPH domain (1);Translation protein SH3-like, subgroup (1);	0.557771	0.20291	N	0.095254	T	0.44746	0.1308	N	0.22421	0.69	0.27076	N	0.963204	B;B;P	0.37083	0.0;0.001;0.581	B;B;P	0.44359	0.001;0.003;0.447	T	0.39461	-0.9613	10	0.72032	D	0.01	-11.0765	7.9938	0.30256	0.1557:0.1334:0.7109:0.0	.	381;381;381	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	H	381	ENSP00000252050:Q381H;ENSP00000346490:Q381H;ENSP00000361730:Q381H	ENSP00000252050:Q381H	Q	+	3	2	CUL9	43262063	0.811000	0.29063	0.957000	0.39632	0.569000	0.35902	0.968000	0.29357	0.648000	0.30732	0.467000	0.42956	CAG		0.582	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		Missense_Mutation
LIN28B	389421	broad.mit.edu	37	6	105526342	105526342	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:105526342C>T	ENST00000345080.4	+	4	640	c.437C>T	c.(436-438)cCt>cTt	p.P146L		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	146					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P146L(1)		large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				AGTCTACCTCCTCAGCCAAAG	0.453																																																1	Substitution - Missense(1)	ovary(1)	6											134.0	118.0	123.0					6																	105526342		2203	4300	6503	105633035	SO:0001583	missense	389421			AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.437C>T	6.37:g.105526342C>T	ENSP00000344401:p.Pro146Leu	Unknown		x	x	x	105633035	A1L165|B2RPN6|Q5TCM4	Missense_Mutation	SNP	ENST00000345080.4	37	CCDS34504.1	SNP	24	Broad	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733753	0.89482	.	.	ENSG00000187772	ENST00000345080	.	.	.	6.02	6.02	0.97574	Zinc finger, CCHC retroviral-type (1);	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73723	-0.3893	9	0.62326	D	0.03	-7.8972	20.5407	0.99260	0.0:1.0:0.0:0.0	.	146	Q6ZN17	LN28B_HUMAN	L	146	.	ENSP00000344401:P146L	P	+	2	0	LIN28B	105633035	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.794000	0.85869	2.865000	0.98341	0.655000	0.94253	CCT		0.453	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041646.2	NM_001004317		Missense_Mutation
TRDN	10345	broad.mit.edu	37	6	123892076	123892076	+	Missense_Mutation	SNP	T	T	A	rs368939536		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:123892076T>A	ENST00000398178.3	-	2	245	c.224A>T	c.(223-225)aAc>aTc	p.N75I	TRDN_ENST00000546248.1_Missense_Mutation_p.N75I|TRDN_ENST00000334268.4_Missense_Mutation_p.N75I|TRDN_ENST00000542443.1_Missense_Mutation_p.N75I	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	75					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)	p.N75I(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		ACCTGAAAAGTTTTTGTAATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	6						T	ILE/ASN	0,3798		0,0,1899	63.0	63.0	63.0		224	5.3	1.0	6		63	1,8231		0,1,4115	no	missense	TRDN	NM_006073.2	149	0,1,6014	AA,AT,TT		0.0121,0.0,0.0083	probably-damaging	75/730	123892076	1,12029	1899	4116	6015	123933775	SO:0001583	missense	10345			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.224A>T	6.37:g.123892076T>A	ENSP00000381240:p.Asn75Ile	Unknown		x	x	x	123933775	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	CCDS55053.1	SNP	60	Broad	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607124	0.46527	0.0	1.21E-4	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.64803	0.53;0.53;0.53;-0.12	5.3	5.3	0.74995	Aspartyl beta-hydroxylase/Triadin domain (1);	0.160925	0.64402	D	0.000014	T	0.71151	0.3306	M	0.77820	2.39	0.26339	N	0.977394	D;D;D;D;D	0.89917	1.0;1.0;0.997;0.997;0.999	D;D;D;D;D	0.85130	0.997;0.997;0.959;0.959;0.99	T	0.67764	-0.5586	10	0.87932	D	0	-17.6615	12.0555	0.53533	0.0:0.0:0.2633:0.7367	.	75;75;75;75;75	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	I	75	ENSP00000381240:N75I;ENSP00000333984:N75I;ENSP00000439281:N75I;ENSP00000437684:N75I	ENSP00000333984:N75I	N	-	2	0	TRDN	123933775	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.791000	0.38744	2.225000	0.72522	0.460000	0.39030	AAC		0.403	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				Missense_Mutation
VNN1	8876	broad.mit.edu	37	6	133004295	133004295	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:133004295C>G	ENST00000367928.4	-	7	1539	c.1526G>C	c.(1525-1527)tGc>tCc	p.C509S		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	509					acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.C509S(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		ACTTAATGAGCATACAATAGG	0.338																																																1	Substitution - Missense(1)	ovary(1)	6											113.0	106.0	109.0					6																	133004295		2203	4300	6503	133045988	SO:0001583	missense	8876			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.1526G>C	6.37:g.133004295C>G	ENSP00000356905:p.Cys509Ser	Unknown		x	x	x	133045988	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	ENST00000367928.4	37	CCDS5159.1	SNP	25	Broad	.	.	.	.	.	.	.	.	.	.	C	8.499	0.863894	0.17250	.	.	ENSG00000112299	ENST00000367928	D	0.87103	-2.21	5.86	-9.78	0.00496	.	1.934170	0.02002	N	0.046328	T	0.54581	0.1867	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.54833	-0.8234	10	0.22706	T	0.39	-22.9361	2.5296	0.04700	0.3046:0.3823:0.1042:0.2089	.	509	O95497	VNN1_HUMAN	S	509	ENSP00000356905:C509S	ENSP00000356905:C509S	C	-	2	0	VNN1	133045988	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.179000	0.09768	-1.864000	0.01148	-0.247000	0.11927	TGC		0.338	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1			Missense_Mutation
RNF216	54476	broad.mit.edu	37	7	5662568	5662568	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr7:5662568C>T	ENST00000425013.2	-	17	2748	c.2524G>A	c.(2524-2526)Gac>Aac	p.D842N	RNF216_ENST00000389902.3_Missense_Mutation_p.D899N|RNF216_ENST00000469375.1_5'UTR	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	842	Pro-rich.				apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.D899N(1)	FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		GGACCGAAGTCATAGTTGACC	0.632																																																1	Substitution - Missense(1)	ovary(1)	7											107.0	113.0	111.0					7																	5662568		2203	4300	6503	5629094	SO:0001583	missense	54476			AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.2524G>A	7.37:g.5662568C>T	ENSP00000404602:p.Asp842Asn	Unknown		x	x	x	5629094	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	SNP	29	Broad	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066450	0.36470	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.44083	0.96;0.93	4.89	4.89	0.63831	.	0.485806	0.22969	N	0.053450	T	0.24624	0.0597	N	0.14661	0.345	0.37994	D	0.934012	B;B	0.10296	0.001;0.003	B;B	0.11329	0.004;0.006	T	0.14200	-1.0481	10	0.19590	T	0.45	-8.1628	10.6194	0.45470	0.0:0.9095:0.0:0.0905	.	842;899	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	N	842;899;654	ENSP00000404602:D842N;ENSP00000374552:D899N	ENSP00000374552:D899N	D	-	1	0	RNF216	5629094	0.980000	0.34600	0.980000	0.43619	0.967000	0.64934	3.011000	0.49567	2.411000	0.81874	0.561000	0.74099	GAC		0.632	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111		Missense_Mutation
POLM	27434	broad.mit.edu	37	7	44119288	44119288	+	Missense_Mutation	SNP	C	C	T	rs372552883		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr7:44119288C>T	ENST00000242248.5	-	4	625	c.524G>A	c.(523-525)cGc>cAc	p.R175H	POLM_ENST00000335195.6_Missense_Mutation_p.R175H|POLM_ENST00000492971.1_5'Flank|POLM_ENST00000395831.3_Missense_Mutation_p.R175H	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	175					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.R175H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GGTGAGGAGGCGGCCCTCACT	0.647								DNA polymerases (catalytic subunits)																																								1	Substitution - Missense(1)	ovary(1)	7						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	49.0	53.0	51.0		524	3.9	0.7	7		51	0,8600		0,0,4300	no	missense	POLM	NM_013284.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	175/495	44119288	1,13005	2203	4300	6503	44085813	SO:0001583	missense	27434			AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.524G>A	7.37:g.44119288C>T	ENSP00000242248:p.Arg175His	Unknown		x	x	x	44085813	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	CCDS34625.1	SNP	27	Broad	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995279	0.35226	2.27E-4	0.0	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.75	3.91	0.45181	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.051034	0.85682	N	0.000000	T	0.65312	0.2679	M	0.80183	2.485	0.51767	D	0.999936	D;D;D;P;D;D	0.89917	1.0;1.0;1.0;0.901;1.0;1.0	D;D;D;B;D;D	0.91635	0.999;0.997;0.999;0.232;0.999;0.999	T	0.63184	-0.6694	10	0.38643	T	0.18	-34.1918	7.9212	0.29848	0.0:0.7527:0.1611:0.0861	.	142;175;175;175;175;175	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	H	175;175;175;142	ENSP00000335141:R175H;ENSP00000242248:R175H;ENSP00000379174:R175H;ENSP00000390899:R142H	ENSP00000242248:R175H	R	-	2	0	POLM	44085813	0.997000	0.39634	0.663000	0.29738	0.040000	0.13550	3.901000	0.56303	0.744000	0.32741	-0.140000	0.14226	CGC		0.647	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284		Missense_Mutation
GTF2IRD1	9569	broad.mit.edu	37	7	74005265	74005265	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr7:74005265C>A	ENST00000265755.3	+	24	2948	c.2555C>A	c.(2554-2556)cCc>cAc	p.P852H	GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.P837H|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.P837H|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.P869H	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	852					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P852H(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TTCCGGAACCCCAACACGTAC	0.612																																																1	Substitution - Missense(1)	ovary(1)	7											85.0	76.0	79.0					7																	74005265		2203	4300	6503	73643201	SO:0001583	missense	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2555C>A	7.37:g.74005265C>A	ENSP00000265755:p.Pro852His	Unknown		x	x	x	73643201	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	SNP	22	Broad	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745165	0.89663	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.88573	0.6473	M	0.81112	2.525	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.994;0.993	D;D;D;D	0.97110	1.0;0.992;0.93;0.914	D	0.89777	0.3958	10	0.87932	D	0	-17.3011	16.5756	0.84635	0.0:1.0:0.0:0.0	.	869;837;852;837	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	H	852;869;837;837	ENSP00000265755:P852H;ENSP00000397566:P869H;ENSP00000408477:P837H;ENSP00000418383:P837H	ENSP00000265755:P852H	P	+	2	0	GTF2IRD1	73643201	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	7.145000	0.77365	2.599000	0.87857	0.561000	0.74099	CCC		0.612	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328		Missense_Mutation
CACNA2D1	781	broad.mit.edu	37	7	81591785	81591785	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr7:81591785C>A	ENST00000356253.5	-	35	3098	c.2843G>T	c.(2842-2844)aGt>aTt	p.S948I	CACNA2D1_ENST00000535308.1_Missense_Mutation_p.S148I|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.S936I			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	948					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.S936I(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AAAGGTCAAACTCAAGAGAAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	7											44.0	45.0	45.0					7																	81591785		2203	4300	6503	81429721	SO:0001583	missense	781			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2843G>T	7.37:g.81591785C>A	ENSP00000348589:p.Ser948Ile	Unknown		x	x	x	81429721	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800309	0.70567	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.70282	-0.47;-0.47;-0.47	5.42	5.42	0.78866	.	0.043225	0.85682	D	0.000000	D	0.84115	0.5401	M	0.73962	2.25	0.46478	D	0.999065	D;D	0.76494	0.999;0.991	D;D	0.68943	0.961;0.945	D	0.85580	0.1239	10	0.72032	D	0.01	-24.6262	19.2549	0.93943	0.0:1.0:0.0:0.0	.	148;936	B7Z658;P54289-2	.;.	I	936;955;948;148	ENSP00000349320:S936I;ENSP00000348589:S948I;ENSP00000443124:S148I	ENSP00000284088:S955I	S	-	2	0	CACNA2D1	81429721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.249000	0.78278	2.556000	0.86216	0.585000	0.79938	AGT		0.333	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding				Missense_Mutation
PTPRZ1	5803	broad.mit.edu	37	7	121674386	121674386	+	Missense_Mutation	SNP	C	C	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr7:121674386C>A	ENST00000393386.2	+	17	5649	c.5238C>A	c.(5236-5238)aaC>aaA	p.N1746K	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.N879K	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1746	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H1746Q(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACAGCTCCAACCACCCAGACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	64.0	68.0					7																	121674386		2203	4300	6503	121461622	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5238C>A	7.37:g.121674386C>A	ENSP00000377047:p.Asn1746Lys	Unknown		x	x	x	121461622	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	SNP	18	Broad	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234105	0.58886	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.13196	2.61;2.61	5.14	2.14	0.27477	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.64402	D	0.000001	T	0.22975	0.0555	L	0.37697	1.125	0.51767	D	0.999934	D;B;D	0.89917	1.0;0.159;1.0	D;B;D	0.85130	0.997;0.079;0.997	T	0.00664	-1.1620	10	0.66056	D	0.02	.	8.0143	0.30372	0.0:0.5033:0.0:0.4967	.	885;879;1746	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	K	1746;879	ENSP00000377047:N1746K;ENSP00000410000:N879K	ENSP00000377047:N1746K	N	+	3	2	PTPRZ1	121461622	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.035000	0.30216	0.174000	0.19809	-0.229000	0.12294	AAC		0.363	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851		Missense_Mutation
RP1L1	94137	broad.mit.edu	37	8	10480664	10480664	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr8:10480664G>T	ENST00000382483.3	-	2	271	c.48C>A	c.(46-48)tgC>tgA	p.C16*	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	16					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.C16*(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		AGGGCAGGAAGCACTCACGGT	0.647																																																1	Substitution - Nonsense(1)	ovary(1)	8											35.0	39.0	38.0					8																	10480664		1988	4152	6140	10518074	SO:0001587	stop_gained	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.48C>A	8.37:g.10480664G>T	ENSP00000371923:p.Cys16*	Unknown		x	x	x	10518074	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	SNP	34	Broad	.	.	.	.	.	.	.	.	.	.	g	24.3	4.517815	0.85495	.	.	ENSG00000183638	ENST00000382483	.	.	.	4.52	2.54	0.30619	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.6811	1.2222	0.01926	0.2046:0.2956:0.3385:0.1614	.	.	.	.	X	16	.	ENSP00000371923:C16X	C	-	3	2	RP1L1	10518074	0.923000	0.31300	0.975000	0.42487	0.827000	0.46813	1.137000	0.31479	1.121000	0.41925	0.306000	0.20318	TGC		0.647	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			Nonsense_Mutation
RAB11FIP1	80223	broad.mit.edu	37	8	37729629	37729629	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr8:37729629G>A	ENST00000330843.4	-	4	2703	c.2691C>T	c.(2689-2691)gtC>gtT	p.V897V	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000522727.1_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	897					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)		p.V897V(1)		NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CACTCATGGGGACTTCGGAGA	0.597																																																1	Substitution - coding silent(1)	ovary(1)	8											58.0	57.0	57.0					8																	37729629		2203	4300	6503	37848787	SO:0001819	synonymous_variant	80223			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.2691C>T	8.37:g.37729629G>A		Unknown		x	x	x	37848787	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Silent	SNP	ENST00000330843.4	37	CCDS34882.1	SNP	41	Broad																																																																																				0.597	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151		Silent
OSR2	116039	broad.mit.edu	37	8	99961564	99961564	+	Silent	SNP	G	G	A	rs202146539		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr8:99961564G>A	ENST00000297565.4	+	2	880	c.384G>A	c.(382-384)gaG>gaA	p.E128E	OSR2_ENST00000522510.1_Silent_p.E128E|OSR2_ENST00000523368.1_Silent_p.E128E|OSR2_ENST00000435298.2_Silent_p.E128E|OSR2_ENST00000457907.2_Silent_p.E249E	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	128					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.E128E(1)|p.E128D(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			CCACGCAAGAGGATCCGCCTA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17434	0.0		0.0	False		,,,				2504	0.0															2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	8											83.0	93.0	90.0					8																	99961564		1943	4149	6092	100030740	SO:0001819	synonymous_variant	116039			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.384G>A	8.37:g.99961564G>A		Unknown		x	x	x	100030740	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Silent	SNP	ENST00000297565.4	37	CCDS47901.1	SNP	35	Broad																																																																																				0.617	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000379505.1	NM_053001		Silent
KLHL9	55958	broad.mit.edu	37	9	21333996	21333996	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:21333996G>C	ENST00000359039.4	-	1	1383	c.863C>G	c.(862-864)tCa>tGa	p.S288*	KLHL9_ENST00000537938.1_Nonsense_Mutation_p.S220*			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	288					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)		p.S288*(1)		endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		AGTTCTATCTGACTGCATCAC	0.423																																																1	Substitution - Nonsense(1)	ovary(1)	9											159.0	143.0	148.0					9																	21333996		2203	4300	6503	21323996	SO:0001587	stop_gained	55958			AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.863C>G	9.37:g.21333996G>C	ENSP00000351933:p.Ser288*	Unknown		x	x	x	21323996	Q8TCQ2	Nonsense_Mutation	SNP	ENST00000359039.4	37	CCDS6503.1	SNP	45	Broad	.	.	.	.	.	.	.	.	.	.	G	36	5.805918	0.96967	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	.	.	.	5.37	5.37	0.77165	.	0.152839	0.45867	D	0.000327	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9779	0.86319	0.0:0.0:1.0:0.0	.	.	.	.	X	288;220	.	ENSP00000351933:S288X	S	-	2	0	KLHL9	21323996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.764000	0.98949	2.688000	0.91661	0.650000	0.86243	TCA		0.423	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847		Nonsense_Mutation
GABBR2	9568	broad.mit.edu	37	9	101056091	101056091	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:101056091A>G	ENST00000259455.2	-	18	3095	c.2636T>C	c.(2635-2637)aTa>aCa	p.I879T		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	879					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.I879T(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TATATCTTCTATAGGATCTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	9											225.0	219.0	221.0					9																	101056091		2203	4300	6503	100095912	SO:0001583	missense	9568			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.2636T>C	9.37:g.101056091A>G	ENSP00000259455:p.Ile879Thr	Unknown		x	x	x	100095912	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	37	CCDS6736.1	SNP	16	Broad	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845184	0.32606	.	.	ENSG00000136928	ENST00000259455	T	0.79454	-1.27	5.1	2.72	0.32119	.	0.154096	0.56097	D	0.000022	T	0.49966	0.1588	N	0.03608	-0.345	0.35174	D	0.771837	B	0.02656	0.0	B	0.01281	0.0	T	0.46898	-0.9158	10	0.22109	T	0.4	-15.2027	6.6231	0.22814	0.7456:0.1651:0.0893:0.0	.	879	O75899	GABR2_HUMAN	T	879	ENSP00000259455:I879T	ENSP00000259455:I879T	I	-	2	0	GABBR2	100095912	1.000000	0.71417	0.970000	0.41538	0.748000	0.42578	5.499000	0.66937	0.953000	0.37825	-0.280000	0.10049	ATA		0.408	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1			Missense_Mutation
TLR4	7099	broad.mit.edu	37	9	120476895	120476895	+	Missense_Mutation	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:120476895G>A	ENST00000355622.6	+	3	2590	c.2489G>A	c.(2488-2490)gGa>gAa	p.G830E	TLR4_ENST00000394487.4_Missense_Mutation_p.G790E|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	830					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.G830E(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GTGGGTACAGGATGCAATTGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											80.0	83.0	82.0					9																	120476895		2203	4300	6503	119516716	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2489G>A	9.37:g.120476895G>A	ENSP00000363089:p.Gly830Glu	Unknown		x	x	x	119516716	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	SNP	41	Broad	.	.	.	.	.	.	.	.	.	.	G	0.181	-1.062020	0.01950	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37235	1.51;1.21	5.79	2.12	0.27331	.	0.533640	0.18571	N	0.137327	T	0.07999	0.0200	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36986	-0.9725	10	0.02654	T	1	.	4.8098	0.13339	0.667:0.1589:0.1741:0.0	.	830	O00206	TLR4_HUMAN	E	790;830	ENSP00000377997:G790E;ENSP00000363089:G830E	ENSP00000363089:G830E	G	+	2	0	TLR4	119516716	0.031000	0.19500	0.063000	0.19743	0.002000	0.02628	0.536000	0.23129	0.463000	0.27118	-0.302000	0.09304	GGA		0.483	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554		Missense_Mutation
HSPA5	3309	broad.mit.edu	37	9	127999102	127999102	+	Silent	SNP	A	A	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:127999102A>G	ENST00000324460.6	-	8	1937	c.1734T>C	c.(1732-1734)gaT>gaC	p.D578D		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	578					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.D578D(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	GCTTTTCTTTATCTCCAATCT	0.408										Prostate(1;0.17)																																						1	Substitution - coding silent(1)	ovary(1)	9											77.0	81.0	80.0					9																	127999102		2202	4296	6498	127038923	SO:0001819	synonymous_variant	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1734T>C	9.37:g.127999102A>G		Unknown		x	x	x	127038923	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	ENST00000324460.6	37	CCDS6863.1	SNP	16	Broad																																																																																				0.408	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			Silent
HSPA5	3309	broad.mit.edu	37	9	128000546	128000546	+	Missense_Mutation	SNP	T	T	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:128000546T>A	ENST00000324460.6	-	7	1479	c.1276A>T	c.(1276-1278)Att>Ttt	p.I426F		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	426					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.I426F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	ACAGTTTCAATACCAAGTGTA	0.403										Prostate(1;0.17)																																						1	Substitution - Missense(1)	ovary(1)	9											126.0	111.0	116.0					9																	128000546		2203	4300	6503	127040367	SO:0001583	missense	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1276A>T	9.37:g.128000546T>A	ENSP00000324173:p.Ile426Phe	Unknown		x	x	x	127040367	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	CCDS6863.1	SNP	49	Broad	.	.	.	.	.	.	.	.	.	.	T	28.2	4.899104	0.91962	.	.	ENSG00000044574	ENST00000324460	T	0.01422	4.91	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.18087	0.0434	H	0.99425	4.56	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.38950	-0.9637	10	0.87932	D	0	-16.7653	13.1949	0.59732	0.0:0.0:0.0:1.0	.	426	P11021	GRP78_HUMAN	F	426	ENSP00000324173:I426F	ENSP00000324173:I426F	I	-	1	0	HSPA5	127040367	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.701000	0.51217	0.455000	0.32223	ATT		0.403	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1			Missense_Mutation
SURF1	6834	broad.mit.edu	37	9	136218927	136218927	+	Nonsense_Mutation	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:136218927G>T	ENST00000371974.3	-	8	853	c.822C>A	c.(820-822)taC>taA	p.Y274*	SNORD24_ENST00000383884.1_RNA|SNORD36B_ENST00000363961.1_RNA|SNORD36C_ENST00000516733.1_RNA|SNORD36A_ENST00000362874.1_RNA|SURF1_ENST00000495952.1_5'UTR	NM_001280787.1|NM_003172.2	NP_001267716.1|NP_003163.1	Q15526	SURF1_HUMAN	surfeit 1	274			Y -> D (in LS). {ECO:0000269|PubMed:10647889}.		aerobic respiration (GO:0009060)|ATP biosynthetic process (GO:0006754)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory chain complex IV assembly (GO:0008535)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)	p.Y274*(1)		breast(2)|endometrium(1)|ovary(2)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;5.06e-07)|Epithelial(140;4.25e-06)|all cancers(34;3.93e-05)		AGGTCACGATGTACTGCAGAT	0.577											OREG0019585	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Nonsense(1)	ovary(1)	9											71.0	66.0	68.0					9																	136218927		2203	4300	6503	135208748	SO:0001587	stop_gained	6834				CCDS6966.1, CCDS75928.1	9q33-q34	2012-10-12			ENSG00000148290	ENSG00000148290		"""Mitochondrial respiratory chain complex assembly factors"""	11474	protein-coding gene	gene with protein product	"""surfeit locus protein 1"""	185620				8499913, 9843204	Standard	NM_003172		Approved		uc004cdh.1	Q15526	OTTHUMG00000020866	ENST00000371974.3:c.822C>A	9.37:g.136218927G>T	ENSP00000361042:p.Tyr274*	Unknown	1624	x	x	x	135208748	Q5T8T3|Q5T8T4	Nonsense_Mutation	SNP	ENST00000371974.3	37	CCDS6966.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650043	0.67472	.	.	ENSG00000148290	ENST00000371974;ENST00000437995	.	.	.	5.39	3.54	0.40534	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1607	9.6298	0.39772	0.1623:0.0:0.8377:0.0	.	.	.	.	X	274;244	.	ENSP00000361042:Y274X	Y	-	3	2	SURF1	135208748	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	2.484000	0.45242	0.648000	0.30732	0.462000	0.41574	TAC		0.577	SURF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054879.1	NM_003172		Nonsense_Mutation
NOTCH1	4851	broad.mit.edu	37	9	139407882	139407882	+	Missense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr9:139407882G>C	ENST00000277541.6	-	14	2390	c.2315C>G	c.(2314-2316)aCc>aGc	p.T772S		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	772	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTAGCCACTGGTCATGTCTTT	0.602			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0			9											85.0	97.0	93.0					9																	139407882		2180	4278	6458	138527703	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2315C>G	9.37:g.139407882G>C	ENSP00000277541:p.Thr772Ser	Unknown		x	x	x	138527703	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	SNP	44	Broad	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742414	0.49151	.	.	ENSG00000148400	ENST00000277541	D	0.93133	-3.17	4.76	3.84	0.44239	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.89083	0.6614	N	0.01668	-0.77	0.52099	D	0.999947	D	0.76494	0.999	D	0.91635	0.999	D	0.87262	0.2280	10	0.21540	T	0.41	.	13.1918	0.59715	0.0:0.0:0.8391:0.1609	.	772	P46531	NOTC1_HUMAN	S	772	ENSP00000277541:T772S	ENSP00000277541:T772S	T	-	2	0	NOTCH1	138527703	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	5.244000	0.65400	0.965000	0.38133	0.455000	0.32223	ACC		0.602	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617		Missense_Mutation
WWC3	55841	broad.mit.edu	37	X	10084547	10084547	+	Splice_Site	SNP	G	G	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:10084547G>T	ENST00000380861.4	+	10	1455	c.1064G>T	c.(1063-1065)aGc>aTc	p.S355I	WWC3_ENST00000454666.1_Splice_Site_p.S355I	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	355	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.S355I(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CAGTTAAAAAGGTAGGTTACT	0.408																																																1	Substitution - Missense(1)	ovary(1)	X											113.0	108.0	110.0					X																	10084547		2203	4300	6503	10044547	SO:0001630	splice_region_variant	55841			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1064+1G>T	X.37:g.10084547G>T		Unknown		x	x	x	10044547	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	SNP	35	Broad	.	.	.	.	.	.	.	.	.	.	G	14.57	2.573748	0.45902	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543293;ENST00000398613	T;T	0.45668	0.89;0.89	4.95	4.09	0.47781	.	0.230668	0.53938	D	0.000041	T	0.64204	0.2577	M	0.85859	2.78	0.80722	D	1	D	0.63046	0.992	P	0.62014	0.897	T	0.69917	-0.5015	10	0.87932	D	0	-24.883	12.6751	0.56889	0.0824:0.0:0.9176:0.0	.	355	Q9ULE0	WWC3_HUMAN	I	355;355;19;355	ENSP00000370242:S355I;ENSP00000399584:S355I	ENSP00000370242:S355I	S	+	2	0	WWC3	10044547	1.000000	0.71417	0.166000	0.22797	0.124000	0.20399	8.976000	0.93442	0.898000	0.36418	0.585000	0.79938	AGC		0.408	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	Missense_Mutation	Missense_Mutation
RS1	6247	broad.mit.edu	37	X	18662574	18662574	+	Nonsense_Mutation	SNP	G	G	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:18662574G>C	ENST00000379984.3	-	5	538	c.498C>G	c.(496-498)taC>taG	p.Y166*	CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR|CDKL5_ENST00000379989.3_Intron	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	166	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.Y166*(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					TCTGGTCCTTGTAGTAAATCC	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	X											149.0	118.0	129.0					X																	18662574		2203	4300	6503	18572495	SO:0001587	stop_gained	6247			AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.498C>G	X.37:g.18662574G>C	ENSP00000369320:p.Tyr166*	Unknown		x	x	x	18572495	Q0QD39	Nonsense_Mutation	SNP	ENST00000379984.3	37	CCDS14187.1	SNP	48	Broad	.	.	.	.	.	.	.	.	.	.	g	24.3	4.515322	0.85389	.	.	ENSG00000102104	ENST00000379984	.	.	.	4.91	-1.72	0.08107	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2638	0.82563	0.1834:0.0:0.8166:0.0	.	.	.	.	X	166	.	ENSP00000369320:Y166X	Y	-	3	2	RS1	18572495	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	2.440000	0.44855	-0.659000	0.05359	-0.356000	0.07607	TAC		0.557	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055949.1			Nonsense_Mutation
PDHA1	5160	broad.mit.edu	37	X	19367444	19367444	+	Silent	SNP	G	G	A			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:19367444G>A	ENST00000422285.2	+	2	177	c.72G>A	c.(70-72)ctG>ctA	p.L24L	PDHA1_ENST00000379805.3_Silent_p.L24L|PDHA1_ENST00000540249.1_Silent_p.L24L|PDHA1_ENST00000545074.1_Silent_p.L24L|PDHA1_ENST00000379806.5_Silent_p.L62L			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	24					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)	p.L24L(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GCAGAGTGCTGGTAGCATCCC	0.299																																																1	Substitution - coding silent(1)	ovary(1)	X											81.0	73.0	76.0					X																	19367444		2203	4300	6503	19277365	SO:0001819	synonymous_variant	5160				CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.72G>A	X.37:g.19367444G>A		Unknown		x	x	x	19277365	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Silent	SNP	ENST00000422285.2	37	CCDS14192.1	SNP	47	Broad																																																																																				0.299	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1			Silent
EFHC2	80258	broad.mit.edu	37	X	44037780	44037780	+	Missense_Mutation	SNP	G	G	T	rs369113642		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:44037780G>T	ENST00000420999.1	-	12	1865	c.1782C>A	c.(1780-1782)aaC>aaA	p.N594K	EFHC2_ENST00000343571.3_5'UTR	NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	594							calcium ion binding (GO:0005509)	p.N594K(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						GCTCTGCAAGGTTTCCAACAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	X						G	LYS/ASN	0,3130		0,0,0,1280,570	48.0	40.0	43.0		1782	-11.0	0.0	X		43	1,6391		0,0,1,2309,1773	no	missense	EFHC2	NM_025184.3	94	0,0,1,3589,2343	TT,TG,T,GG,G		0.0156,0.0,0.0105	benign	594/750	44037780	1,9521	1850	4083	5933	43922724	SO:0001583	missense	80258			AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.1782C>A	X.37:g.44037780G>T	ENSP00000404232:p.Asn594Lys	Unknown		x	x	x	43922724	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	37	CCDS55405.1	SNP	44	Broad	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.572|0.572	-0.840758|-0.840758	0.02692|0.02692	0.0|0.0	1.56E-4|1.56E-4	ENSG00000183690|ENSG00000183690	ENST00000343571;ENST00000333807;ENST00000420999|ENST00000441230	T;T|.	0.65364|.	-0.14;-0.15|.	5.53|5.53	-11.0|-11.0	0.00169|0.00169	EF-hand-like domain (1);|.	1.359230|.	0.04323|.	N|.	0.351068|.	T|T	0.07279|0.07279	0.0184|0.0184	N|N	0.02960|0.02960	-0.455|-0.455	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.15037|0.15037	-1.0451|-1.0451	10|5	0.02654|.	T|.	1|.	-0.0624|-0.0624	1.0658|1.0658	0.01611|0.01611	0.2933:0.2979:0.25:0.1588|0.2933:0.2979:0.25:0.1588	.|.	594|.	Q5JST6|.	EFHC2_HUMAN|.	K|T	7;594;622|575	ENSP00000333823:N594K;ENSP00000404232:N622K|.	ENSP00000333823:N594K|.	N|P	-|-	3|1	2|0	EFHC2|EFHC2	43922724|43922724	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-1.053000|-1.053000	0.03500|0.03500	-2.125000|-2.125000	0.00821|0.00821	-0.325000|-0.325000	0.08501|0.08501	AAC|CCT		0.368	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184		Missense_Mutation
PQBP1	10084	broad.mit.edu	37	X	48759603	48759603	+	Missense_Mutation	SNP	A	A	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:48759603A>G	ENST00000376563.1	+	5	586	c.386A>G	c.(385-387)gAc>gGc	p.D129G	PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000376566.4_Intron|PQBP1_ENST00000396763.1_Missense_Mutation_p.D129G|PQBP1_ENST00000447146.2_Missense_Mutation_p.D129G|PQBP1_ENST00000247140.4_Intron|PQBP1_ENST00000218224.4_Missense_Mutation_p.D129G	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	129	5 X 7 AA approximate tandem repeats of D- R-[SG]-H-D-K-S.|Intrinsically disordered.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)	p.D129G(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						AGGGGCCACGACAAGTCAGAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	51.0	57.0					X																	48759603		2203	4300	6503	48644547	SO:0001583	missense	10084			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.386A>G	X.37:g.48759603A>G	ENSP00000365747:p.Asp129Gly	Unknown		x	x	x	48644547	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	ENST00000376563.1	37	CCDS14309.1	SNP	10	Broad	.	.	.	.	.	.	.	.	.	.	A	15.21	2.766584	0.49574	.	.	ENSG00000102103	ENST00000376563;ENST00000447146;ENST00000218224;ENST00000396763;ENST00000443648	T;T;T;T;T	0.77750	-1.09;-1.09;-1.09;-1.09;-1.12	5.79	4.64	0.57946	.	0.343009	0.27927	N	0.017282	T	0.62196	0.2408	L	0.29908	0.895	0.19945	N	0.999948	B;B;B;P;B	0.38504	0.042;0.081;0.002;0.634;0.0	B;B;B;B;B	0.35971	0.024;0.094;0.002;0.215;0.0	T	0.55341	-0.8156	10	0.33940	T	0.23	-13.8045	6.7361	0.23411	0.8973:0.0:0.1027:0.0	.	129;129;129;129;129	O60828-6;O60828-2;C9JQA1;O60828-3;O60828	.;.;.;.;PQBP1_HUMAN	G	129	ENSP00000365747:D129G;ENSP00000391759:D129G;ENSP00000218224:D129G;ENSP00000379985:D129G;ENSP00000414861:D129G	ENSP00000218224:D129G	D	+	2	0	PQBP1	48644547	0.987000	0.35691	0.281000	0.24762	0.541000	0.35023	3.504000	0.53347	1.941000	0.56285	0.441000	0.28932	GAC		0.582	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060777.1	NM_001032381.1		Missense_Mutation
TRO	7216	broad.mit.edu	37	X	54949933	54949933	+	Missense_Mutation	SNP	C	C	G			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:54949933C>G	ENST00000173898.7	+	3	1080	c.968C>G	c.(967-969)aCt>aGt	p.T323S	TRO_ENST00000420798.2_Intron|TRO_ENST00000375041.2_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000484031.1_Intron|TRO_ENST00000375022.4_Missense_Mutation_p.T323S|TRO_ENST00000319167.8_Missense_Mutation_p.T323S	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	323					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T323S(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCACTTGCCACTCAGATAGTC	0.582																																																1	Substitution - Missense(1)	ovary(1)	X											15.0	15.0	15.0					X																	54949933		1871	4089	5960	54966658	SO:0001583	missense	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.968C>G	X.37:g.54949933C>G	ENSP00000173898:p.Thr323Ser	Unknown		x	x	x	54966658	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	SNP	20	Broad	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.522071	0.00967	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022	T;T;T	0.39229	1.09;1.09;1.09	3.02	-3.75	0.04372	.	.	.	.	.	T	0.19208	0.0461	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.15141	0.005;0.012	B;B	0.11329	0.006;0.004	T	0.19910	-1.0291	8	.	.	.	.	0.9005	0.01273	0.1654:0.2409:0.1624:0.4312	.	323;323	Q96SX2;Q12816	.;TROP_HUMAN	S	323	ENSP00000173898:T323S;ENSP00000318278:T323S;ENSP00000364162:T323S	.	T	+	2	0	TRO	54966658	0.006000	0.16342	0.000000	0.03702	0.117000	0.20001	-0.679000	0.05203	-1.211000	0.02624	0.502000	0.49764	ACT		0.582	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157		Missense_Mutation
RGAG4	340526	broad.mit.edu	37	X	71350597	71350597	+	Missense_Mutation	SNP	A	A	C			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:71350597A>C	ENST00000545866.1	-	1	1161	c.794T>G	c.(793-795)tTg>tGg	p.L265W	NHSL2_ENST00000540800.1_Intron|RGAG4_ENST00000609883.1_Missense_Mutation_p.L265W|NHSL2_ENST00000373677.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	265								p.L338W(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					ATCCCAAGACAAGAATTGGGC	0.527																																																1	Substitution - Missense(1)	ovary(1)	X											69.0	69.0	69.0					X																	71350597		1941	4136	6077	71267322	SO:0001583	missense	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.794T>G	X.37:g.71350597A>C	ENSP00000441366:p.Leu265Trp	Unknown		x	x	x	71267322	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	CCDS55446.1	SNP	5	Broad	.	.	.	.	.	.	.	.	.	.	A	15.98	2.991280	0.54041	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.15603	2.41;2.41	3.82	3.82	0.43975	Retrotransposon gag protein (1);	.	.	.	.	T	0.28995	0.0720	L	0.39898	1.24	0.29175	N	0.876878	D	0.89917	1.0	D	0.91635	0.999	T	0.03887	-1.0995	8	.	.	.	-3.8187	8.0965	0.30831	1.0:0.0:0.0:0.0	.	265	Q5HYW3	RGAG4_HUMAN	W	265	ENSP00000441366:L265W;ENSP00000418667:L265W	.	L	-	2	0	RGAG4	71267322	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.059000	0.41384	1.728000	0.51552	0.430000	0.28490	TTG		0.527	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455		Missense_Mutation
MTM1	4534	broad.mit.edu	37	X	149809889	149809889	+	Missense_Mutation	SNP	C	C	T			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chrX:149809889C>T	ENST00000370396.2	+	8	730	c.676C>T	c.(676-678)Cca>Tca	p.P226S	MTM1_ENST00000542741.1_Missense_Mutation_p.P131S|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.P111S|MTM1_ENST00000413012.2_Missense_Mutation_p.P189S	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	226	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.		P -> T (in CNMX). {ECO:0000269|PubMed:12522554}.		endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.P226S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					AAATCGAATTCCAGTGAGTAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	X	GRCh37	CM030247	MTM1	M							120.0	106.0	111.0					X																	149809889		2203	4300	6503	149560547	SO:0001583	missense	4534			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.676C>T	X.37:g.149809889C>T	ENSP00000359423:p.Pro226Ser	Unknown		x	x	x	149560547	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	CCDS14694.1	SNP	30	Broad	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647966	0.87958	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.99060	-5.38;-5.38;-5.38;-5.38	5.43	5.43	0.79202	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.048988	0.85682	D	0.000000	D	0.99677	0.9879	H	0.99600	4.65	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.74023	0.982;0.944	D	0.97133	0.9819	10	0.87932	D	0	.	18.6083	0.91275	0.0:1.0:0.0:0.0	.	189;226	B7Z491;Q13496	.;MTM1_HUMAN	S	226;131;111;189	ENSP00000359423:P226S;ENSP00000444015:P131S;ENSP00000439784:P111S;ENSP00000389157:P189S	ENSP00000359423:P226S	P	+	1	0	MTM1	149560547	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	7.409000	0.80053	2.425000	0.82216	0.523000	0.50628	CCA		0.433	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252		Missense_Mutation
TP53	7157	broad.mit.edu	37	17	7577514	7577516	+	In_Frame_Del	DEL	GTG	GTG	-	rs587781433		TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:7577514_7577516delGTG	ENST00000269305.4	-	7	954_956	c.765_767delCAC	c.(763-768)atcaca>ata	p.T256del	TP53_ENST00000413465.2_In_Frame_Del_p.T256del|TP53_ENST00000455263.2_In_Frame_Del_p.T256del|TP53_ENST00000420246.2_In_Frame_Del_p.T256del|TP53_ENST00000445888.2_In_Frame_Del_p.T256del|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_In_Frame_Del_p.T256del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	256	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		T -> I (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I255del(7)|p.T256fs*89(4)|p.T256A(3)|p.T256fs*8(2)|p.T256I(2)|p.T256K(2)|p.T256S(2)|p.I255I(2)|p.?(1)|p.T256P(1)|p.I254fs*7(1)|p.I255M(1)|p.T256fs*90(1)|p.T256del(1)|p.R249_T256delRPILTIIT(1)|p.T256fs*87(1)|p.T256fs*17(1)|p.I254_T256del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTTCCAGTGTGATGATGGTGA	0.591		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Substitution - Missense(11)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Substitution - coding silent(2)|Unknown(1)	breast(8)|central_nervous_system(6)|ovary(6)|bone(5)|large_intestine(4)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)|skin(1)|lung(1)|pancreas(1)	17	GRCh37	CM951232	TP53	M																																				7518241	SO:0001651	inframe_deletion	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.765_767delCAC	17.37:g.7577514_7577516delGTG	ENSP00000269305:p.Thr256del	Unknown		Capture	Illumina GAIIx	Phase_I	7518239	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1	DEL	48	Broad																																																																																				0.591	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546		In_Frame_Del
CNTNAP1	8506	broad.mit.edu	37	17	40842822	40842852	+	Frame_Shift_Del	DEL	ATGGAGCGGCCATTCCTGGGGGCTATCCAGT	ATGGAGCGGCCATTCCTGGGGGCTATCCAGT	-	rs142269872|rs202120747|rs200460212|rs368809538	byFrequency	TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr17:40842822_40842852delATGGAGCGGCCATTCCTGGGGGCTATCCAGT	ENST00000264638.4	+	13	2138_2168	c.1921_1951delATGGAGCGGCCATTCCTGGGGGCTATCCAGT	c.(1921-1953)atggagcggccattcctgggggctatccagtacfs	p.MERPFLGAIQY641fs	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	641	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.M641fs*96(1)|p.M641I(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		AGGTTCCAGCATGGAGCGGCCATTCCTGGGGGCTATCCAGTACTGGAATGC	0.567																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	upper_aerodigestive_tract(1)|ovary(1)	17																																								38096378	SO:0001589	frameshift_variant	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1921_1951delATGGAGCGGCCATTCCTGGGGGCTATCCAGT	17.37:g.40842822_40842852delATGGAGCGGCCATTCCTGGGGGCTATCCAGT	ENSP00000264638:p.Met641fs	Unknown		Capture	Illumina GAIIx	Phase_I	38096348		Frame_Shift_Del	DEL	ENST00000264638.4	37	CCDS11436.1	DEL	8	Broad																																																																																				0.567	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632		Frame_Shift_Del
TBP	6908	broad.mit.edu	37	6	170871038	170871040	+	In_Frame_Del	DEL	CAA	CAA	-	rs71815788|rs55736770	byFrequency	TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr6:170871038_170871040delCAA	ENST00000392092.2	+	3	493_495	c.214_216delCAA	c.(214-216)caadel	p.Q95del	TBP_ENST00000230354.6_In_Frame_Del_p.Q95del|TBP_ENST00000540980.1_In_Frame_Del_p.Q75del	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	95	Poly-Gln.		Missing. {ECO:0000269|PubMed:2374612}.	Missing (in Ref. 4; BAG65425). {ECO:0000305}.	cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q72del(3)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		gcagcagcagcaacagcaacagc	0.567																																																3	Deletion - In frame(3)	ovary(1)|prostate(1)|breast(1)	6																																								170712965	SO:0001651	inframe_deletion	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.214_216delCAA	6.37:g.170871038_170871040delCAA	ENSP00000375942:p.Gln95del	Unknown		Capture	Illumina GAIIx	Phase_I	170712963	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	In_Frame_Del	DEL	ENST00000392092.2	37	CCDS5315.1	DEL	25	Broad																																																																																				0.567	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194		In_Frame_Del
PRKDC	5591	broad.mit.edu	37	8	48801126	48801131	+	In_Frame_Del	DEL	TACAGG	TACAGG	-			TCGA-23-2078-01	TCGA-23-2078-10							Unknown	Unknown	Somatic	Phase_I	WXS	---			Illumina GAIIx	TCGA-23-2078-01	TCGA-23-2078-10	g.chr8:48801126_48801131delTACAGG	ENST00000314191.2	-	35	4414_4419	c.4358_4363delCCTGTA	c.(4357-4365)gcctgtaaa>gaa	p.1453_1455ACK>E	PRKDC_ENST00000338368.3_In_Frame_Del_p.1453_1455ACK>E|PRKDC_ENST00000523565.1_5'UTR|AC103686.1_ENST00000390136.2_RNA	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1454					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.A1453_K1455>E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGAAGCTGTTTACAGGCAGACACAAC	0.437								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Complex - deletion inframe(1)	ovary(1)	8																																								48963684	SO:0001651	inframe_deletion	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.4358_4363delCCTGTA	8.37:g.48801126_48801131delTACAGG	ENSP00000313420:p.Ala1453_Lys1455delinsGlu	Unknown		Capture	Illumina GAIIx	Phase_I	48963679	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	In_Frame_Del	DEL	ENST00000314191.2	37		DEL	61	Broad																																																																																				0.437	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640		In_Frame_Del
